The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027118	Escherichia coli strain 26561 chromosome, complete genome	4719625	1024973	1038156	4719625		Escherichia_phage(50.0%)	12	NA	NA
AVT61975.1|1024973_1025735_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
AVT61976.1|1025728_1026355_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
AVT61977.1|1026494_1027634_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
AVT61978.1|1027696_1028689_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
AVT61979.1|1028782_1030147_-	permease	NA	NA	NA	NA	NA
AVT61980.1|1030235_1031012_-	hypothetical protein	NA	NA	NA	NA	NA
AVT61981.1|1031016_1031655_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AVT61982.1|1031651_1032914_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
AVT61983.1|1032910_1033819_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AVT61984.1|1034014_1034782_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
AVT61985.1|1034832_1035489_-	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
AVT61986.1|1035594_1038156_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 2
CP027118	Escherichia coli strain 26561 chromosome, complete genome	4719625	1684100	1693541	4719625		Enterobacteria_phage(85.71%)	10	NA	NA
AVT62558.1|1684100_1685027_+	ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
AVT62559.1|1685031_1685763_+	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AVT62560.1|1685743_1685851_-	hypothetical protein	NA	NA	NA	NA	NA
AVT62561.1|1685910_1686642_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AVT62562.1|1686863_1688549_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AVT62563.1|1688545_1689265_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AVT62564.1|1689311_1689782_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
AVT62565.1|1689821_1690283_-	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AVT62566.1|1690407_1692408_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
AVT62567.1|1692404_1693541_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
>prophage 3
CP027118	Escherichia coli strain 26561 chromosome, complete genome	4719625	2235751	2260899	4719625	lysis,integrase,terminase	Enterobacteria_phage(40.0%)	36	2231041:2231056	2254971:2254986
2231041:2231056	attL	CTTTAAGAGATAAAAA	NA	NA	NA	NA
AVT63063.1|2235751_2238178_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
AVT63064.1|2238376_2238682_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AVT65377.1|2238789_2239500_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
AVT63065.1|2239502_2240063_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AVT63066.1|2240097_2240439_-	hypothetical protein	NA	NA	NA	NA	NA
AVT63067.1|2240573_2240900_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AVT63068.1|2240936_2241125_+	hypothetical protein	NA	NA	NA	NA	NA
AVT63069.1|2241105_2242320_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AVT63070.1|2242331_2243351_+	starvation-sensing protein RspB	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
AVT63071.1|2243408_2243519_+	transporter	NA	NA	NA	NA	NA
AVT63072.1|2243538_2244834_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	3.3e-155
AVT63073.1|2244853_2245105_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
AVT63074.1|2245177_2247649_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
AVT63075.1|2247741_2247933_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AVT63076.1|2247929_2248118_-	division inhibition protein DicB	NA	NA	NA	NA	NA
AVT63077.1|2248685_2248904_-	hypothetical protein	NA	NA	NA	NA	NA
AVT63078.1|2248933_2249104_-	hypothetical protein	NA	NA	NA	NA	NA
AVT63079.1|2249063_2249219_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
AVT63080.1|2249385_2249793_-	transcriptional regulator	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
AVT63081.1|2249876_2250104_+	transcriptional regulator	NA	NA	NA	NA	NA
AVT63082.1|2250787_2251540_+	antitermination protein Q	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
AVT63083.1|2251961_2252174_-	cold-shock protein CspF	NA	NA	NA	NA	NA
AVT63084.1|2252474_2252690_+	cold-shock protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
AVT63085.1|2253443_2253659_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
AVT63086.1|2253663_2253975_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
AVT63087.1|2253971_2254505_+	lysozyme from lambdoid prophage Qin	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
AVT63088.1|2254501_2254999_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
2254971:2254986	attR	CTTTAAGAGATAAAAA	NA	NA	NA	NA
AVT63089.1|2255361_2255574_+	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AVT63090.1|2255584_2255773_+	cold-shock protein	NA	NA	NA	NA	NA
AVT63091.1|2255803_2256076_+	hypothetical protein	NA	NA	NA	NA	NA
AVT63092.1|2256247_2256421_+	protein GnsB	NA	NA	NA	NA	NA
AVT63093.1|2256572_2256983_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
AVT63094.1|2257040_2257274_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
AVT63095.1|2257379_2257523_+	DNA-packaging protein	NA	NA	NA	NA	NA
AVT63096.1|2257662_2258208_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
AVT63097.1|2260308_2260899_-	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
>prophage 4
CP027118	Escherichia coli strain 26561 chromosome, complete genome	4719625	2973721	2982193	4719625	tail,portal	Salmonella_phage(71.43%)	9	NA	NA
AVT63728.1|2973721_2973979_+	glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
AVT63729.1|2974008_2974386_-	hypothetical protein	NA	NA	NA	NA	NA
AVT63730.1|2974655_2976341_+	transporter	NA	NA	NA	NA	NA
AVT63731.1|2976576_2976795_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AVT63732.1|2976885_2977986_-	late control protein D	NA	E5G6Q3	Salmonella_phage	85.8	3.4e-177
AVT63733.1|2977982_2978468_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	1.8e-66
AVT65415.1|2978464_2979217_-|tail	phage tail protein	tail	E5G6Q1	Salmonella_phage	75.0	2.8e-90
AVT63734.1|2979392_2981159_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
AVT63735.1|2981158_2982193_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	89.0	2.4e-172
>prophage 5
CP027118	Escherichia coli strain 26561 chromosome, complete genome	4719625	3566239	3611330	4719625	tail,integrase,transposase,plate	Shigella_phage(44.44%)	47	3566288:3566304	3613064:3613080
AVT64263.1|3566239_3570694_-	hypothetical protein	NA	A0A2H4PQV1	Staphylococcus_phage	32.4	1.1e-43
3566288:3566304	attL	ATAATAAAATGCTCCAC	NA	NA	NA	NA
AVT64264.1|3571231_3571816_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.9	2.9e-106
AVT64265.1|3571815_3574917_-	helix-turn-helix domain-containing protein	NA	X2KTY7	Enterobacteria_phage	58.8	6.2e-06
AVT64266.1|3574888_3575041_-	amino acid permease	NA	NA	NA	NA	NA
AVT64267.1|3575014_3575707_+	XRE family transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	6.4e-121
AVT64268.1|3575762_3576041_+	hypothetical protein	NA	A0A291AWY6	Escherichia_phage	97.4	3.0e-13
AVT64269.1|3576142_3576337_-	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	98.4	2.5e-30
AVT64270.1|3576409_3576772_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
AVT64271.1|3576837_3577662_+	DUF2303 domain-containing protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
AVT64272.1|3577789_3578326_+	HD family hydrolase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
AVT64273.1|3578316_3578679_+	hypothetical protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
AVT64274.1|3578678_3578984_+	hypothetical protein	NA	U5P0J0	Shigella_phage	98.0	5.8e-50
AVT64275.1|3578983_3579334_+	DNA-binding protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
AVT65434.1|3579435_3580374_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.0	1.1e-181
AVT64276.1|3580578_3581832_-	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
AVT64277.1|3581843_3582947_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
AVT64278.1|3583234_3584290_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	1.6e-118
AVT64279.1|3584328_3584730_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
AVT64280.1|3584787_3586032_-	esterase	NA	NA	NA	NA	NA
AVT64281.1|3586123_3586582_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
AVT64282.1|3586842_3588300_+	aminoacyl-histidine dipeptidase	NA	NA	NA	NA	NA
AVT64283.1|3588356_3588893_-	peptide chain release factor H	NA	NA	NA	NA	NA
AVT64284.1|3588825_3589092_-	hypothetical protein	NA	NA	NA	NA	NA
AVT64285.1|3589078_3589276_+	hypothetical protein	NA	NA	NA	NA	NA
AVT64286.1|3589397_3589850_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AVT64287.1|3589859_3590258_-	mRNA interferase YafO	NA	NA	NA	NA	NA
AVT64288.1|3590260_3590554_-	antitoxin YafN	NA	NA	NA	NA	NA
AVT64289.1|3590605_3591661_-	DNA polymerase IV	NA	NA	NA	NA	NA
AVT65435.1|3591731_3592502_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
AVT64290.1|3592461_3594195_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
AVT64291.1|3594423_3594921_-|transposase	transposase	transposase	NA	NA	NA	NA
AVT64292.1|3595096_3595846_-	endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.0e-20
AVT64293.1|3596055_3596316_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
AVT64294.1|3596318_3596597_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
AVT64295.1|3596752_3597493_+	transpeptidase	NA	NA	NA	NA	NA
AVT64296.1|3597463_3598231_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
AVT64297.1|3598436_3599015_-	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
AVT64298.1|3599254_3601699_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AVT64299.1|3601741_3602215_-	inhibitor of vertebrate lysozyme	NA	NA	NA	NA	NA
AVT64300.1|3602368_3603139_+	hydrolase YafV	NA	NA	NA	NA	NA
AVT64301.1|3603179_3604316_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
AVT64302.1|3604919_3605138_-	hypothetical protein	NA	NA	NA	NA	NA
AVT64303.1|3606959_3607460_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AVT64304.1|3607494_3607719_+	hypothetical protein	NA	NA	NA	NA	NA
AVT64305.1|3607769_3609245_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AVT64306.1|3609251_3609665_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AVT64307.1|3609668_3611330_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
3613064:3613080	attR	ATAATAAAATGCTCCAC	NA	NA	NA	NA
>prophage 6
CP027118	Escherichia coli strain 26561 chromosome, complete genome	4719625	3856039	3909765	4719625	integrase,tRNA,capsid,tail,lysis	Escherichia_phage(30.56%)	60	3894190:3894205	3916308:3916323
AVT64518.1|3856039_3856726_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AVT64519.1|3857125_3857266_-	hypothetical protein	NA	NA	NA	NA	NA
AVT64520.1|3857361_3858078_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AVT64521.1|3858136_3859489_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
AVT64522.1|3859546_3860971_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.0	1.4e-08
AVT64523.1|3860970_3861660_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	1.1e-29
AVT64524.1|3861672_3862146_-	protein CreA	NA	NA	NA	NA	NA
AVT64525.1|3862356_3863226_+	right origin-binding protein	NA	NA	NA	NA	NA
AVT64526.1|3863222_3863870_-	phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
AVT65445.1|3863921_3864443_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
AVT64527.1|3864527_3864854_-	Trp operon repressor	NA	NA	NA	NA	NA
AVT65446.1|3864943_3866881_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
AVT65447.1|3866989_3867118_-	methionine aminopeptidase	NA	NA	NA	NA	NA
AVT64528.1|3867091_3868759_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
AVT64529.1|3869065_3870298_-	trifunctional nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase/transcriptional regulator NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
AVT64530.1|3870318_3871701_-	DNA repair protein RadA	NA	NA	NA	NA	NA
AVT64531.1|3871749_3872718_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
AVT64532.1|3872823_3873468_+	protein Smp	NA	NA	NA	NA	NA
AVT64533.1|3873495_3874512_+	lipoate-protein ligase LplA	NA	NA	NA	NA	NA
AVT64534.1|3874512_3875844_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
AVT64535.1|3876010_3876730_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
AVT64536.1|3876786_3878010_-	phosphopentomutase	NA	NA	NA	NA	NA
AVT64537.1|3878061_3879384_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	8.8e-79
AVT64538.1|3879550_3880330_-	2-deoxyribose-5-phosphate aldolase	NA	NA	NA	NA	NA
AVT64539.1|3880588_3882139_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
AVT64540.1|3882110_3882974_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
AVT64541.1|3883489_3884272_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AVT64542.1|3884268_3885342_-	patatin family protein	NA	NA	NA	NA	NA
AVT64543.1|3885463_3885643_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	2.0e-10
AVT64544.1|3885751_3886357_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
AVT64545.1|3886749_3888336_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
AVT64546.1|3888555_3888804_+	damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	98.8	2.0e-37
AVT65448.1|3889321_3889618_+	hypothetical protein	NA	A0A291AWW6	Escherichia_phage	99.0	6.8e-48
AVT64547.1|3889953_3890457_-	hypothetical protein	NA	A0A291AWW1	Escherichia_phage	99.4	1.5e-90
AVT64548.1|3890887_3891010_-|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AVT64549.1|3890982_3891567_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	93.8	4.3e-102
AVT65449.1|3891566_3893294_-|tail	phage tail protein	tail	A0A291AWX1	Escherichia_phage	95.1	1.6e-91
AVT64550.1|3893394_3893655_-	DUF1441 domain-containing protein	NA	A0A291AWV8	Escherichia_phage	97.5	2.4e-36
AVT64551.1|3893813_3894014_-	hypothetical protein	NA	K7PJR7	Enterobacteria_phage	98.5	1.4e-33
3894190:3894205	attL	AAGGGATATCAGTTAA	NA	NA	NA	NA
AVT64552.1|3894330_3894483_-	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	100.0	1.2e-21
AVT64553.1|3894470_3894938_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	100.0	7.7e-78
AVT64554.1|3894934_3895432_-	lysozyme	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
AVT64555.1|3895431_3895647_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AVT64556.1|3895714_3896767_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
AVT64557.1|3896917_3897121_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
AVT64558.1|3897344_3897770_-	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	98.6	1.0e-73
AVT64559.1|3898050_3898803_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.4	2.0e-136
AVT64560.1|3898816_3899806_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	4.3e-195
AVT64561.1|3900187_3901024_-	ash family protein	NA	Q8SBF3	Shigella_phage	98.6	6.7e-149
AVT64562.1|3901020_3901572_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	99.5	9.9e-101
AVT64563.1|3901615_3901816_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
AVT64564.1|3901906_3902581_+	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
AVT64565.1|3903267_3903630_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
AVT64566.1|3903695_3904520_+	DUF2303 domain-containing protein	NA	U5P439	Shigella_phage	99.6	6.0e-150
AVT64567.1|3904648_3905185_+	HD family hydrolase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
AVT64568.1|3905175_3905538_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
AVT64569.1|3905537_3906158_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	91.3	3.3e-113
AVT64570.1|3906157_3906352_+	DNA-binding protein	NA	A5LH59	Enterobacteria_phage	96.9	1.3e-31
AVT64571.1|3906590_3908291_-	AIPR family protein	NA	D0UIM0	Aggregatibacter_phage	26.0	3.1e-07
AVT64572.1|3908541_3909765_-|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	99.0	1.2e-234
3916308:3916323	attR	TTAACTGATATCCCTT	NA	NA	NA	NA
>prophage 7
CP027118	Escherichia coli strain 26561 chromosome, complete genome	4719625	3988680	4018995	4719625	transposase,holin	Escherichia_phage(33.33%)	30	NA	NA
AVT64643.1|3988680_3989832_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	2.2e-41
AVT64644.1|3990882_3992886_+|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	5.7e-21
AVT64645.1|3992830_3992989_+|holin	choline transporter	holin	NA	NA	NA	NA
AVT64646.1|3992948_3994226_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
AVT64647.1|3994473_3995130_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AVT64648.1|3995187_3995292_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
AVT64649.1|3995310_3995418_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
AVT64650.1|3995529_3995811_-	hypothetical protein	NA	NA	NA	NA	NA
AVT64651.1|3995824_3996022_-	hypothetical protein	NA	NA	NA	NA	NA
AVT65456.1|3996209_3996410_+	hypothetical protein	NA	NA	NA	NA	NA
AVT64652.1|3996537_3996636_+	acetolactate synthase	NA	NA	NA	NA	NA
AVT64653.1|3996637_3997420_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
AVT64654.1|3997725_3998646_+	ribokinase	NA	NA	NA	NA	NA
AVT64655.1|3998673_3999990_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
AVT64656.1|4000001_4001015_+	DUF4432 domain-containing protein	NA	NA	NA	NA	NA
AVT64657.1|4001159_4002432_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	2.6e-176
AVT64658.1|4003268_4004525_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
AVT64659.1|4004537_4004825_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
AVT64660.1|4004840_4005284_-	PTS mannitol transporter subunit IIA	NA	NA	NA	NA	NA
AVT64661.1|4005554_4006586_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	8.0e-19
AVT64662.1|4007936_4008371_-	reverse transcriptase/maturase	NA	NA	NA	NA	NA
AVT64663.1|4009134_4009398_-	hypothetical protein	NA	NA	NA	NA	NA
AVT64664.1|4009815_4010160_-	hypothetical protein	NA	NA	NA	NA	NA
AVT64665.1|4010514_4011864_-	MFS transporter	NA	NA	NA	NA	NA
AVT64666.1|4011884_4012802_-	hydroxymethylglutaryl-CoA lyase	NA	NA	NA	NA	NA
AVT64667.1|4012813_4014010_-	CoA transferase	NA	NA	NA	NA	NA
AVT64668.1|4014246_4016160_+	PAS domain S-box protein	NA	NA	NA	NA	NA
AVT64669.1|4017048_4017180_+	chemotaxis protein	NA	NA	NA	NA	NA
AVT64670.1|4017193_4018216_+|transposase	IS21 family transposase IS100	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
AVT64671.1|4018212_4018995_+|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	100.0	2.0e-139
>prophage 8
CP027118	Escherichia coli strain 26561 chromosome, complete genome	4719625	4484575	4496314	4719625	integrase	Escherichia_phage(41.67%)	14	4478424:4478438	4496396:4496410
4478424:4478438	attL	TGTAGGCCTGATAAG	NA	NA	NA	NA
AVT65074.1|4484575_4484785_-	hypothetical protein	NA	M1TAP7	Escherichia_phage	83.0	2.7e-14
AVT65075.1|4484908_4487392_+	helicase	NA	NA	NA	NA	NA
AVT65076.1|4487631_4489911_-	replication endonuclease	NA	Q858T4	Yersinia_virus	96.6	0.0e+00
AVT65077.1|4489900_4490176_-	hypothetical protein	NA	A0A0F7LCM4	Escherichia_phage	100.0	2.3e-45
AVT65078.1|4490172_4490397_-	hypothetical protein	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
AVT65079.1|4490396_4490699_-	hypothetical protein	NA	A0A0F7LDT6	Escherichia_phage	96.0	2.5e-45
AVT65080.1|4490698_4490923_-	DUF2732 domain-containing protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
AVT65081.1|4490986_4491487_-	replication protein B	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
AVT65082.1|4491656_4491929_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
AVT65083.1|4492065_4492359_+	transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
AVT65084.1|4492428_4493409_+|integrase	integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
AVT65476.1|4493595_4494096_-	periplasmic protein CpxP	NA	NA	NA	NA	NA
AVT65085.1|4494245_4494944_+	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
AVT65086.1|4494940_4496314_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
4496396:4496410	attR	CTTATCAGGCCTACA	NA	NA	NA	NA
>prophage 1
CP027119	Escherichia coli strain 26561 plasmid unnamed1, complete sequence	86731	33686	66228	86731	transposase,protease,integrase	Macacine_betaherpesvirus(36.36%)	34	48035:48094	57520:58288
AVT65507.1|33686_34493_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
AVT65508.1|35264_36020_+	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
AVT65509.1|36607_37774_+	protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
AVT65510.1|37773_38745_+	ParB/RepB/Spo0J family partition protein	NA	I3WF22	Macacine_betaherpesvirus	99.4	7.0e-174
AVT65511.1|39301_39574_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65554.1|40932_41250_+	replication protein RepA	NA	NA	NA	NA	NA
AVT65512.1|41205_41529_-	hypothetical protein	NA	NA	NA	NA	NA
AVT65513.1|42187_42841_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AVT65514.1|43060_43525_+	mRNA interferase PemK	NA	NA	NA	NA	NA
AVT65515.1|43521_43626_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65555.1|43976_44162_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65516.1|44351_45005_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AVT65517.1|45224_45689_+	mRNA interferase PemK	NA	NA	NA	NA	NA
AVT65518.1|45685_45790_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65519.1|46738_48061_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
48035:48094	attL	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGC	NA	NA	NA	NA
AVT65520.1|48893_49328_-	mercuric resistance operon regulatory protein	NA	NA	NA	NA	NA
AVT65521.1|49399_49750_+	mercuric transporter	NA	NA	NA	NA	NA
AVT65522.1|49763_50039_+	mercuric transporter periplasmic component	NA	NA	NA	NA	NA
AVT65556.1|50074_50497_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AVT65523.1|50548_52243_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AVT65524.1|52260_52623_+	transcriptional regulator	NA	NA	NA	NA	NA
AVT65525.1|52619_52856_+	mercury resistance protein	NA	NA	NA	NA	NA
AVT65526.1|52852_53560_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AVT65527.1|53598_54903_+|integrase	integrase	integrase	NA	NA	NA	NA
AVT65528.1|54948_55653_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVT65529.1|55842_56658_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
AVT65530.1|57585_58290_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
57520:58288	attR	GCCACTGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCAGCATCACCCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGT	NA	NA	NA	NA
AVT65531.1|58350_59187_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AVT65532.1|59186_59990_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AVT65533.1|60050_60866_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
AVT65534.1|61171_62023_-	replication protein	NA	NA	NA	NA	NA
AVT65535.1|62777_63482_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVT65536.1|63528_63930_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AVT65537.1|65523_66228_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
