The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028793	Klebsiella pneumoniae strain WCHKP020030 chromosome, complete genome	5376106	96346	166088	5376106	tRNA,transposase,plate,tail,head	Vibrio_phage(52.27%)	76	NA	NA
AWA72042.1|96346_96571_+	transcriptional regulator	NA	M1PVU4	Vibrio_phage	57.1	1.5e-15
AWA72043.1|96573_98667_+|transposase	transposase	transposase	A0A2D1GNK9	Pseudomonas_phage	51.3	5.9e-186
AWA72044.1|98703_99651_+	DNA transposition protein	NA	A0A0C4UQR3	Shigella_phage	79.4	2.9e-140
AWA72045.1|99655_99895_+	hypothetical protein	NA	NA	NA	NA	NA
AWA72046.1|99897_100185_+	HTH domain-containing protein	NA	C9DGL7	Escherichia_phage	48.3	3.5e-17
AWA72047.1|100200_100818_+	DUF3164 domain-containing protein	NA	A0A2I7S9B0	Vibrio_phage	59.9	2.6e-65
AWA72048.1|100898_101396_+	hypothetical protein	NA	A0A0A7RUP4	Clostridium_phage	36.0	1.9e-05
AWA72049.1|101388_101694_+	hypothetical protein	NA	NA	NA	NA	NA
AWA72050.1|101811_102366_+	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	47.2	8.3e-39
AWA72051.1|102362_102761_+	transcriptional regulator	NA	A0A0C4UR27	Shigella_phage	63.3	3.9e-38
AWA72052.1|102766_103090_+	hypothetical protein	NA	NA	NA	NA	NA
AWA72053.1|103193_103772_+	peptidoglycan-binding protein	NA	A0A2I7S9B9	Vibrio_phage	47.1	2.7e-40
AWA72054.1|103774_103993_+	hypothetical protein	NA	A0A0C4UQR6	Shigella_phage	70.8	1.7e-24
AWA72055.1|103985_104393_+	hypothetical protein	NA	NA	NA	NA	NA
AWA72056.1|104380_104986_+	hypothetical protein	NA	M4MB79	Vibrio_phage	39.8	1.2e-22
AWA72057.1|104982_105213_+	conjugal transfer protein TraR	NA	NA	NA	NA	NA
AWA72058.1|105193_105496_+	DUF2730 domain-containing protein	NA	M1Q558	Vibrio_phage	42.6	4.3e-13
AWA72059.1|105505_105793_+	hypothetical protein	NA	A0A2I7S9D8	Vibrio_phage	64.5	8.4e-27
AWA72060.1|105792_106080_+	hypothetical protein	NA	NA	NA	NA	NA
AWA72061.1|106069_106645_+	DUF3486 domain-containing protein	NA	M4MCR3	Vibrio_phage	58.9	1.7e-50
AWA72062.1|106641_108231_+	hypothetical protein	NA	M4MHG0	Vibrio_phage	68.3	2.3e-198
AWA72063.1|108230_109802_+	DUF935 domain-containing protein	NA	A0A2I7S9K0	Vibrio_phage	56.0	5.1e-158
AWA72064.1|109794_110637_+	hypothetical protein	NA	M1PVV7	Vibrio_phage	57.1	1.3e-88
AWA72065.1|110825_111842_+	peptidase	NA	M1Q578	Vibrio_phage	50.0	8.3e-77
AWA72066.1|111844_112747_+|head	phage head protein	head	M4MB71	Vibrio_phage	61.2	1.0e-102
AWA72067.1|112822_113380_+	hypothetical protein	NA	NA	NA	NA	NA
AWA72068.1|113379_113820_+	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	47.3	3.2e-33
AWA72069.1|113819_114362_+	phage morphogenesis protein	NA	A0A2I7S9D7	Vibrio_phage	63.7	1.4e-59
AWA72070.1|114358_114970_+	hypothetical protein	NA	M1PJ94	Vibrio_phage	39.8	1.7e-37
AWA72071.1|114972_115182_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
AWA72072.1|115183_116665_+|tail	phage tail protein	tail	M1Q565	Vibrio_phage	60.4	4.8e-166
AWA72073.1|116674_117028_+|tail	phage tail protein	tail	A0A2P1A4D6	Alteromonadaceae_phage	33.3	5.0e-13
AWA72074.1|117031_117415_+	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	46.2	2.3e-11
AWA72075.1|117513_119310_+|tail	phage tail protein	tail	M4MHE6	Vibrio_phage	31.7	3.6e-67
AWA72076.1|119306_120566_+	multidrug DMT transporter	NA	A0A2I7S9E8	Vibrio_phage	42.2	1.1e-86
AWA72077.1|120558_121644_+|tail	phage tail protein	tail	M4M9L5	Vibrio_phage	49.6	4.0e-93
AWA72078.1|121634_122174_+|plate	phage baseplate assembly protein V	plate	A0A2I7S9F6	Vibrio_phage	45.0	9.6e-32
AWA72079.1|122170_122623_+	hypothetical protein	NA	A0A2I7S9F0	Vibrio_phage	42.8	1.5e-25
AWA72080.1|122609_123686_+|plate	phage baseplate protein	plate	A0A2I7S9E5	Vibrio_phage	52.8	2.5e-103
AWA72081.1|123670_124255_+	DUF2313 domain-containing protein	NA	M4M9M8	Vibrio_phage	48.2	2.2e-45
AWA72082.1|124257_125013_+|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	45.4	2.2e-26
AWA72083.1|125012_125888_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	39.6	4.1e-24
AWA72084.1|125897_127694_+	right-handed parallel beta-helix repeat-containing protein	NA	A0A0U3DL17	Klebsiella_phage	43.6	8.3e-104
AWA72085.1|127690_127945_+	hypothetical protein	NA	NA	NA	NA	NA
AWA72086.1|128164_129544_-	glycoside hydrolase	NA	NA	NA	NA	NA
AWA72087.1|129556_131116_-	PTS glucose transporter subunit IIBC	NA	NA	NA	NA	NA
AWA72088.1|131363_133079_-	AsmA family protein	NA	NA	NA	NA	NA
AWA72089.1|133219_134611_-	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	95.2	1.4e-66
AWA72090.1|134895_136098_+	sodium/glutamate symporter	NA	NA	NA	NA	NA
AWA72091.1|136212_137724_-	glycerol kinase	NA	NA	NA	NA	NA
AWA72092.1|137745_138597_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.2	2.2e-14
AWA72093.1|139039_139285_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
AWA72094.1|139436_140426_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWA72095.1|140594_141359_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
AWA72096.1|141423_142728_+	citrate transporter	NA	NA	NA	NA	NA
AWA72097.1|142820_143588_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
AWA72098.1|143697_144300_-	DUF1454 domain-containing protein	NA	NA	NA	NA	NA
AWA72099.1|144412_144841_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
AWA72100.1|144841_145588_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AWA72101.1|145738_146749_-	fructose-bisphosphatase class II	NA	NA	NA	NA	NA
AWA72102.1|146797_148879_-	DNA helicase RecG	NA	NA	NA	NA	NA
AWA72103.1|148884_149574_-|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
AWA72104.1|149578_151699_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis(diphosphate) 3'-diphosphatase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
AWA72105.1|151717_151993_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AWA72106.1|152047_152671_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.0	1.7e-19
AWA72107.1|152929_154606_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	23.8	1.5e-22
AWA72108.1|154611_155229_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
AWA72109.1|155503_156754_+	chloride channel protein	NA	NA	NA	NA	NA
AWA72110.1|156809_157868_-	XRE family transcriptional regulator	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	48.5	6.3e-19
AWA72111.1|157870_158617_-	isocitrate lyase/phosphoenolpyruvate mutase family protein	NA	NA	NA	NA	NA
AWA72112.1|158799_159651_-	YicC family protein	NA	NA	NA	NA	NA
AWA72113.1|159708_160632_-|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
AWA76921.1|161093_161273_-	hypothetical protein	NA	NA	NA	NA	NA
AWA72114.1|161433_162414_+|transposase	IS5 family transposase ISKpn26	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
AWA72115.1|164218_165139_+	secretion protein HlyD	NA	NA	NA	NA	NA
AWA72116.1|165164_166088_-|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
>prophage 2
CP028793	Klebsiella pneumoniae strain WCHKP020030 chromosome, complete genome	5376106	483478	552856	5376106	protease,terminase,tRNA,capsid,tail,head,portal,integrase	uncultured_Caudovirales_phage(61.11%)	75	501086:501103	517081:517098
AWA72417.1|483478_484426_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
AWA72418.1|484440_484950_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
AWA72419.1|485078_486203_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
AWA72420.1|486174_486648_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
AWA72421.1|486673_487216_+	hypothetical protein	NA	NA	NA	NA	NA
AWA72422.1|487220_487793_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
AWA72423.1|487796_488615_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
AWA72424.1|488611_488869_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
AWA76937.1|488844_489399_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AWA72425.1|495194_495416_-	hypothetical protein	NA	NA	NA	NA	NA
AWA72426.1|495709_498820_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
AWA72427.1|498832_499972_-	MexX family efflux pump subunit	NA	NA	NA	NA	NA
AWA72428.1|500350_501001_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
501086:501103	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
AWA72429.1|501276_502503_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
AWA72430.1|502595_503537_+	hypothetical protein	NA	NA	NA	NA	NA
AWA72431.1|503718_504003_+	transcriptional regulator	NA	NA	NA	NA	NA
AWA72432.1|504013_504793_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
AWA72433.1|504916_505111_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
AWA76938.1|505244_505514_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
AWA72434.1|505506_505695_+	hypothetical protein	NA	NA	NA	NA	NA
AWA72435.1|505687_506002_+	hypothetical protein	NA	NA	NA	NA	NA
AWA72436.1|505998_506367_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
AWA72437.1|506363_506729_+	hypothetical protein	NA	NA	NA	NA	NA
AWA72438.1|506728_508864_+	DNA primase	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
AWA72439.1|509206_509542_+	hypothetical protein	NA	NA	NA	NA	NA
AWA72440.1|509590_510103_-	hypothetical protein	NA	NA	NA	NA	NA
AWA72441.1|510366_511533_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
AWA72442.1|511584_512145_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
AWA72443.1|512146_513388_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
AWA72444.1|513384_513720_+|head,tail	head-tail adaptor	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
AWA72445.1|513716_514016_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
AWA72446.1|514015_514459_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
AWA72447.1|514585_514777_+|terminase	terminase	terminase	NA	NA	NA	NA
AWA72448.1|514734_515091_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
AWA72449.1|515074_516736_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
AWA72450.1|516738_516930_+	hypothetical protein	NA	NA	NA	NA	NA
AWA72451.1|517083_517380_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
517081:517098	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
AWA72452.1|517404_518370_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
AWA72453.1|518527_518722_-	hypothetical protein	NA	NA	NA	NA	NA
AWA72454.1|518727_519609_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AWA72455.1|519620_521072_-	sodium/panthothenate symporter	NA	NA	NA	NA	NA
AWA72456.1|521061_521304_-	hypothetical protein	NA	NA	NA	NA	NA
AWA72457.1|521414_522764_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AWA72458.1|522774_523242_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
AWA72459.1|523264_523717_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AWA72460.1|523940_524549_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
AWA72461.1|524548_525550_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
AWA72462.1|525778_525970_+	hypothetical protein	NA	NA	NA	NA	NA
AWA72463.1|526049_527990_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
AWA72464.1|528111_528318_-	hypothetical protein	NA	NA	NA	NA	NA
AWA72465.1|528295_529339_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
AWA72466.1|529409_530402_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AWA72467.1|530401_530890_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AWA72468.1|530897_531479_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AWA72469.1|531481_532951_+	ribonuclease G	NA	NA	NA	NA	NA
AWA72470.1|532988_536786_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
AWA72471.1|536874_538320_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AWA72472.1|538355_539285_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
AWA72473.1|539416_539620_+	protein AaeX	NA	NA	NA	NA	NA
AWA72474.1|539627_540560_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
AWA72475.1|540565_542533_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
AWA72476.1|542612_542888_+	hypothetical protein	NA	NA	NA	NA	NA
AWA72477.1|542938_543205_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AWA72478.1|543303_543567_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AWA72479.1|543942_544413_-	arginine repressor	NA	NA	NA	NA	NA
AWA72480.1|544827_545766_+	malate dehydrogenase	NA	NA	NA	NA	NA
AWA72481.1|545902_546961_-|protease	serine endoprotease DegS	protease	NA	NA	NA	NA
AWA72482.1|547048_548416_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
AWA72483.1|548589_548988_-	DUF1043 domain-containing protein	NA	NA	NA	NA	NA
AWA72484.1|549178_550306_+	cell division protein ZapE	NA	NA	NA	NA	NA
AWA72485.1|550571_551000_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
AWA72486.1|551015_551408_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
AWA72487.1|551517_551721_-	hypothetical protein	NA	NA	NA	NA	NA
AWA72488.1|551719_552358_+	stringent starvation protein A	NA	NA	NA	NA	NA
AWA72489.1|552361_552856_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
>prophage 3
CP028793	Klebsiella pneumoniae strain WCHKP020030 chromosome, complete genome	5376106	1258840	1309050	5376106	lysis,tRNA,transposase,plate,capsid,tail,head,coat,portal,integrase	Salmonella_phage(78.26%)	64	1253667:1253681	1309606:1309620
1253667:1253681	attL	GGCTGGCGCTGTTGG	NA	NA	NA	NA
AWA73171.1|1258840_1259821_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AWA73172.1|1259866_1260865_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	94.5	2.2e-183
AWA73173.1|1260867_1261497_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
AWA73174.1|1261619_1261862_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
AWA73175.1|1261894_1262404_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
AWA73176.1|1262411_1262612_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
AWA73177.1|1262575_1262914_+	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
AWA73178.1|1262981_1263215_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
AWA73179.1|1263214_1263442_+	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
AWA73180.1|1263438_1264290_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
AWA73181.1|1264286_1266671_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
AWA73182.1|1266900_1267152_+	hypothetical protein	NA	NA	NA	NA	NA
AWA73183.1|1267151_1268636_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AWA73184.1|1268743_1268932_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
AWA73185.1|1269020_1269944_-|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
AWA73186.1|1270024_1270243_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	98.6	7.8e-33
AWA73187.1|1270338_1271022_-	hypothetical protein	NA	NA	NA	NA	NA
AWA73188.1|1271008_1272088_-	hypothetical protein	NA	NA	NA	NA	NA
AWA73189.1|1272087_1273089_-	hypothetical protein	NA	NA	NA	NA	NA
AWA76964.1|1273610_1273880_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
AWA73190.1|1273936_1274980_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
AWA73191.1|1274979_1276743_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
AWA73192.1|1276883_1277717_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
AWA73193.1|1277733_1278786_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
AWA73194.1|1278789_1279443_+	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
AWA73195.1|1279538_1280003_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
AWA73196.1|1280002_1280206_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
AWA76965.1|1280209_1280425_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
AWA73197.1|1280405_1280915_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
AWA73198.1|1280919_1281303_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
AWA73199.1|1281299_1281728_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
AWA73200.1|1281657_1281861_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	77.6	3.0e-23
AWA73201.1|1281823_1282246_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
AWA73202.1|1282238_1282685_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
AWA73203.1|1282707_1283574_-	hypothetical protein	NA	NA	NA	NA	NA
AWA73204.1|1283668_1284241_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
AWA73205.1|1284237_1284600_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
AWA73206.1|1284586_1285495_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
AWA76966.1|1285487_1286159_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
AWA73207.1|1286160_1288110_+|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
AWA73208.1|1288119_1289238_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
AWA73209.1|1289289_1290363_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
AWA73210.1|1290511_1291684_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
AWA73211.1|1291693_1292209_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
AWA73212.1|1292261_1292561_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
AWA73213.1|1292575_1292695_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AWA73214.1|1292687_1295318_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
AWA73215.1|1295314_1295800_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
AWA73216.1|1295796_1296891_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
AWA73217.1|1296957_1297176_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
AWA73218.1|1297203_1297581_-	hypothetical protein	NA	NA	NA	NA	NA
AWA73219.1|1298184_1298667_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
AWA73220.1|1298777_1299254_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AWA73221.1|1299243_1299534_+	RnfH family protein	NA	NA	NA	NA	NA
AWA73222.1|1299600_1299942_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AWA73223.1|1300089_1301751_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AWA73224.1|1301837_1302716_-	NAD(+) kinase	NA	NA	NA	NA	NA
AWA73225.1|1302840_1303431_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AWA73226.1|1303550_1304837_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AWA73227.1|1304856_1305648_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AWA73228.1|1305811_1307176_+	signal recognition particle protein	NA	NA	NA	NA	NA
AWA73229.1|1307435_1307684_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AWA73230.1|1307702_1308251_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AWA73231.1|1308282_1309050_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
1309606:1309620	attR	GGCTGGCGCTGTTGG	NA	NA	NA	NA
>prophage 4
CP028793	Klebsiella pneumoniae strain WCHKP020030 chromosome, complete genome	5376106	1413766	1480749	5376106	protease,terminase,transposase,holin,tail,integrase	Salmonella_phage(38.46%)	73	1414761:1414778	1483497:1483514
AWA73320.1|1413766_1415233_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
1414761:1414778	attL	GTATTCCGGTTATCGCTG	NA	NA	NA	NA
AWA73321.1|1415300_1416878_+	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
AWA73322.1|1417070_1418321_+|integrase	integrase	integrase	A0A1X9TCT6	Enterobacter_phage	84.9	7.5e-205
AWA73323.1|1418337_1418529_-	hypothetical protein	NA	NA	NA	NA	NA
AWA73324.1|1418525_1419119_-	adenine methylase	NA	T1SA14	Salmonella_phage	91.9	8.2e-109
AWA73325.1|1419115_1419307_-	DUF1382 domain-containing protein	NA	A0A0P0ZC60	Stx2-converting_phage	62.7	3.5e-13
AWA73326.1|1419303_1419951_-	hypothetical protein	NA	A0A059VF56	Pseudomonas_phage	45.2	7.4e-47
AWA73327.1|1419947_1420106_-	DUF1317 domain-containing protein	NA	T1SAR0	Salmonella_phage	78.8	1.1e-17
AWA73328.1|1420098_1420392_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
AWA73329.1|1420501_1420750_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
AWA73330.1|1420798_1421680_-	recombinase RecT	NA	T1SBJ5	Salmonella_phage	82.9	9.2e-133
AWA73331.1|1421676_1422498_-	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	81.0	1.2e-131
AWA73332.1|1422494_1422794_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	52.5	8.8e-19
AWA73333.1|1423160_1423742_-	XRE family transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
AWA73334.1|1423896_1424130_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
AWA73335.1|1424276_1424486_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
AWA73336.1|1424485_1425253_+	primosomal protein	NA	A0A193GZ86	Enterobacter_phage	91.0	4.4e-139
AWA73337.1|1425249_1426035_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	1.7e-133
AWA73338.1|1426154_1426502_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	80.9	7.2e-49
AWA73339.1|1426688_1426925_+	hypothetical protein	NA	NA	NA	NA	NA
AWA73340.1|1426924_1427965_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	67.6	1.8e-143
AWA73341.1|1428747_1428987_+	hypothetical protein	NA	NA	NA	NA	NA
AWA73342.1|1428979_1429318_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	88.2	4.9e-50
AWA73343.1|1429489_1429741_+	hypothetical protein	NA	NA	NA	NA	NA
AWA73344.1|1429740_1431225_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AWA73345.1|1431303_1431633_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	55.1	8.7e-28
AWA73346.1|1431690_1432275_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	89.1	5.8e-91
AWA73347.1|1432271_1433744_+|terminase	terminase	terminase	Q858H3	Salmonella_phage	92.3	1.3e-277
AWA73348.1|1434110_1434299_+	hypothetical protein	NA	NA	NA	NA	NA
AWA73349.1|1434318_1434525_+	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
AWA73350.1|1434539_1436222_+|tail	phage tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.8	3.0e-265
AWA73351.1|1436218_1436515_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	1.2e-33
AWA73352.1|1436517_1437198_+	peptidase	NA	G9L6C4	Escherichia_phage	84.0	6.1e-76
AWA73353.1|1437212_1438199_+	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	93.9	4.3e-179
AWA73354.1|1438252_1438690_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.0	1.3e-66
AWA73355.1|1438700_1439042_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	69.9	5.3e-36
AWA73356.1|1439092_1439416_+	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	3.1e-46
AWA73357.1|1439415_1440021_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	77.5	1.1e-87
AWA73358.1|1440020_1442519_+	hypothetical protein	NA	Q858G3	Salmonella_phage	84.7	0.0e+00
AWA73359.1|1442518_1442983_+	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
AWA73360.1|1442982_1443522_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	8.0e-71
AWA73361.1|1443532_1446049_+	hypothetical protein	NA	T1SBJ1	Salmonella_phage	82.0	0.0e+00
AWA73362.1|1446045_1447848_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	73.7	2.0e-235
AWA73363.1|1447852_1450327_+	hypothetical protein	NA	T1S9I6	Salmonella_phage	95.1	0.0e+00
AWA73364.1|1450522_1450819_+	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	92.7	7.5e-47
AWA73365.1|1450850_1451366_-	toxin YafO, type II toxin-antitoxin system family protein	NA	NA	NA	NA	NA
AWA73366.1|1451352_1451694_-	hypothetical protein	NA	NA	NA	NA	NA
AWA73367.1|1451859_1452549_-	anti-repressor protein	NA	G9L6E2	Escherichia_phage	65.2	1.2e-79
AWA73368.1|1452862_1453159_-	hypothetical protein	NA	T1SA06	Salmonella_phage	65.5	1.1e-24
AWA73369.1|1453316_1455527_+	hypothetical protein	NA	T1S9Y2	Salmonella_phage	62.2	8.4e-74
AWA73370.1|1455523_1455775_+	hypothetical protein	NA	NA	NA	NA	NA
AWA73371.1|1456324_1456729_+	hypothetical protein	NA	T1SA79	Salmonella_phage	83.3	2.1e-55
AWA73372.1|1456715_1457021_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	80.4	6.0e-39
AWA73373.1|1457010_1457640_+	endolysin	NA	Q858F0	Salmonella_phage	77.4	8.1e-91
AWA73374.1|1457636_1458119_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	90.6	3.6e-70
AWA73375.1|1458338_1460207_-	phosphatase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
AWA73376.1|1460190_1461369_-	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
AWA73377.1|1461662_1462895_-	MFS transporter	NA	NA	NA	NA	NA
AWA76969.1|1462992_1463880_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWA73378.1|1463976_1464168_-	DUF2633 domain-containing protein	NA	G9L6F2	Escherichia_phage	79.3	3.3e-19
AWA73379.1|1464520_1466749_+	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
AWA73380.1|1466802_1468335_-	exopolyphosphatase	NA	NA	NA	NA	NA
AWA73381.1|1468338_1470399_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
AWA73382.1|1470579_1471221_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	1.2e-28
AWA73383.1|1471217_1472255_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	8.2e-72
AWA73384.1|1472518_1473412_+	beta-glucoside kinase	NA	NA	NA	NA	NA
AWA73385.1|1473421_1474855_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AWA73386.1|1475072_1475699_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AWA73387.1|1475794_1477081_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
AWA73388.1|1477179_1477881_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
AWA73389.1|1477877_1478789_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	58.8	3.5e-74
AWA73390.1|1478916_1479276_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
AWA73391.1|1479285_1480749_-|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
1483497:1483514	attR	GTATTCCGGTTATCGCTG	NA	NA	NA	NA
>prophage 5
CP028793	Klebsiella pneumoniae strain WCHKP020030 chromosome, complete genome	5376106	1790404	1797310	5376106		Planktothrix_phage(33.33%)	6	NA	NA
AWA76984.1|1790404_1791268_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
AWA73660.1|1791278_1792052_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
AWA76985.1|1792293_1793187_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
AWA73661.1|1793432_1794794_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
AWA73662.1|1795112_1795835_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AWA73663.1|1795831_1797310_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 6
CP028793	Klebsiella pneumoniae strain WCHKP020030 chromosome, complete genome	5376106	1839235	1854981	5376106		Enterobacteria_phage(33.33%)	15	NA	NA
AWA73690.1|1839235_1840642_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	3.6e-38
AWA73691.1|1840865_1841930_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	4.4e-105
AWA73692.1|1841943_1842813_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	67.4	3.4e-111
AWA73693.1|1842844_1843735_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	3.7e-28
AWA73694.1|1843749_1844304_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
AWA73695.1|1844483_1845650_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
AWA73696.1|1846598_1847603_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.2	4.0e-31
AWA73697.1|1847558_1847840_+	hypothetical protein	NA	NA	NA	NA	NA
AWA73698.1|1848442_1849507_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	2.6e-105
AWA73699.1|1849520_1850390_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	67.0	5.7e-111
AWA73700.1|1850421_1851312_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	3.7e-28
AWA73701.1|1851326_1851881_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
AWA73702.1|1851967_1852798_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AWA73703.1|1852826_1853660_+	ABC transporter permease	NA	NA	NA	NA	NA
AWA73704.1|1853649_1854981_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.1	6.9e-15
>prophage 7
CP028793	Klebsiella pneumoniae strain WCHKP020030 chromosome, complete genome	5376106	2830890	2841777	5376106		Escherichia_phage(87.5%)	9	NA	NA
AWA74614.1|2830890_2833998_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
AWA74615.1|2834052_2835318_+	MFS transporter	NA	NA	NA	NA	NA
AWA74616.1|2835348_2836437_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
AWA74617.1|2836523_2836784_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
AWA74618.1|2837081_2837942_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AWA74619.1|2837962_2838724_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AWA74620.1|2838984_2839887_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
AWA74621.1|2839898_2841164_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
AWA74622.1|2841156_2841777_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 8
CP028793	Klebsiella pneumoniae strain WCHKP020030 chromosome, complete genome	5376106	3038086	3111849	5376106	protease,lysis,terminase,transposase,plate,tail,head	uncultured_Caudovirales_phage(32.69%)	85	NA	NA
AWA74806.1|3038086_3039172_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AWA74807.1|3039135_3040890_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AWA74808.1|3042561_3045987_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
AWA74809.1|3045970_3047110_-	hypothetical protein	NA	NA	NA	NA	NA
AWA74810.1|3047106_3047364_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
AWA74811.1|3047408_3049826_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
AWA74812.1|3049813_3050344_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AWA74813.1|3050411_3050942_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AWA74814.1|3051010_3051541_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AWA74815.1|3051608_3052139_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AWA74816.1|3052207_3052738_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AWA74817.1|3052801_3053581_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AWA74818.1|3053581_3055960_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.8	9.2e-18
AWA74819.1|3055952_3058607_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	2.5e-96
AWA74820.1|3058871_3059363_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AWA74821.1|3059367_3061074_-	OmpA family protein	NA	NA	NA	NA	NA
AWA74822.1|3061070_3061760_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AWA77035.1|3061756_3063097_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AWA74823.1|3063109_3064654_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AWA74824.1|3064696_3065188_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AWA74825.1|3065657_3066638_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AWA74826.1|3066676_3066820_-	ABC transporter	NA	NA	NA	NA	NA
AWA74827.1|3067233_3067482_+	damage-inducible protein DinI	NA	S5MQI1	Escherichia_phage	70.4	1.4e-25
AWA74828.1|3067704_3067989_-	hypothetical protein	NA	NA	NA	NA	NA
AWA74829.1|3068093_3068303_-	hypothetical protein	NA	NA	NA	NA	NA
AWA74830.1|3068299_3069031_-	hypothetical protein	NA	NA	NA	NA	NA
AWA77036.1|3069041_3069770_-	hypothetical protein	NA	NA	NA	NA	NA
AWA74831.1|3070377_3071301_+|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
AWA74832.1|3073186_3073384_-	hypothetical protein	NA	NA	NA	NA	NA
AWA74833.1|3073383_3074250_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
AWA74834.1|3074249_3075023_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
AWA74835.1|3075019_3076216_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
AWA74836.1|3076215_3076569_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
AWA74837.1|3076570_3077224_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
AWA74838.1|3077277_3077844_-	hypothetical protein	NA	NA	NA	NA	NA
AWA74839.1|3077880_3078066_+	hypothetical protein	NA	NA	NA	NA	NA
AWA74840.1|3078118_3078460_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
AWA74841.1|3078459_3079482_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
AWA74842.1|3079484_3079787_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
AWA74843.1|3079787_3080387_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
AWA74844.1|3080386_3082390_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
AWA74845.1|3082379_3082532_-	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
AWA74846.1|3082567_3082993_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
AWA74847.1|3082996_3083437_-	DUF3277 domain-containing protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
AWA74848.1|3083447_3084593_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
AWA74849.1|3084596_3085037_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
AWA74850.1|3085131_3085518_-|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
AWA74851.1|3085517_3086024_-	hypothetical protein	NA	NA	NA	NA	NA
AWA74852.1|3086020_3086440_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
AWA74853.1|3086408_3086690_-	hypothetical protein	NA	NA	NA	NA	NA
AWA74854.1|3086729_3087671_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
AWA74855.1|3087682_3088177_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
AWA74856.1|3088180_3089383_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
AWA77037.1|3089434_3089983_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
AWA74857.1|3090038_3091490_-	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
AWA74858.1|3091727_3093128_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
AWA74859.1|3093078_3093831_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
AWA74860.1|3093932_3094253_-	negative regulator GrlR	NA	NA	NA	NA	NA
AWA74861.1|3094487_3094877_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
AWA74862.1|3094873_3095404_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
AWA74863.1|3095406_3095655_-|lysis	lysis protein	lysis	NA	NA	NA	NA
AWA74864.1|3096060_3096843_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
AWA74865.1|3096839_3097316_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
AWA74866.1|3097312_3098275_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
AWA74867.1|3098276_3099935_-	helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
AWA74868.1|3100243_3100537_-	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	97.6	2.8e-38
AWA74869.1|3100511_3100733_-	XRE family transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
AWA74870.1|3100830_3101499_+	LexA family transcriptional repressor	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
AWA74871.1|3101669_3101984_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
AWA74872.1|3101976_3102165_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
AWA74873.1|3102334_3102700_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
AWA74874.1|3102692_3102947_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
AWA74875.1|3103133_3103559_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
AWA74876.1|3103555_3103750_+	hypothetical protein	NA	NA	NA	NA	NA
AWA74877.1|3103746_3104574_+|protease	serine protease	protease	Q8W654	Enterobacteria_phage	84.0	5.5e-111
AWA74878.1|3104678_3105197_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
AWA74879.1|3105202_3105913_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
AWA74880.1|3105902_3106127_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
AWA74881.1|3106123_3106336_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
AWA74882.1|3106332_3106812_+	hypothetical protein	NA	NA	NA	NA	NA
AWA74883.1|3106990_3107233_+	AlpA family transcriptional regulator	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
AWA74884.1|3107213_3108395_-	DUF4102 domain-containing protein	NA	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
AWA74885.1|3108591_3109140_+|protease	protease	protease	NA	NA	NA	NA
AWA74886.1|3109338_3110871_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
AWA74887.1|3111087_3111849_-	3-oxoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 9
CP028793	Klebsiella pneumoniae strain WCHKP020030 chromosome, complete genome	5376106	3524401	3609807	5376106	protease,lysis,tRNA,plate,transposase,capsid,tail,head,portal,integrase	Salmonella_phage(47.92%)	84	3579927:3579945	3609882:3609900
AWA75271.1|3524401_3525694_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
AWA75272.1|3525784_3527128_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
AWA75273.1|3527136_3527748_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AWA75274.1|3527870_3532124_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
AWA75275.1|3532259_3532754_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AWA75276.1|3533286_3534255_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
AWA75277.1|3534369_3536136_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
AWA75278.1|3536136_3537858_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
AWA75279.1|3537902_3538604_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AWA75280.1|3538957_3539176_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AWA75281.1|3539296_3541576_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AWA75282.1|3541606_3541924_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AWA75283.1|3542249_3542471_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AWA75284.1|3542425_3542608_-	hypothetical protein	NA	NA	NA	NA	NA
AWA75285.1|3542547_3544488_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AWA75286.1|3544484_3545600_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
AWA75287.1|3545746_3547405_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AWA75288.1|3547824_3548520_+	aquaporin Z	NA	NA	NA	NA	NA
AWA75289.1|3548635_3549535_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
AWA77055.1|3549678_3551331_+	hydroxylamine reductase	NA	NA	NA	NA	NA
AWA75290.1|3551341_3552310_+	NADH oxidoreductase	NA	NA	NA	NA	NA
AWA75291.1|3552260_3552464_+	hypothetical protein	NA	NA	NA	NA	NA
AWA75292.1|3552521_3552956_-	DoxX family protein	NA	NA	NA	NA	NA
AWA77056.1|3553107_3554826_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
AWA75293.1|3554864_3555866_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AWA75294.1|3555876_3557319_+	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
AWA75295.1|3557406_3558420_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AWA75296.1|3558416_3559247_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
AWA75297.1|3559278_3560418_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AWA75298.1|3560470_3560650_+	hypothetical protein	NA	NA	NA	NA	NA
AWA75299.1|3561295_3561811_+	lipoprotein	NA	NA	NA	NA	NA
AWA75300.1|3562037_3562766_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
AWA77057.1|3562786_3563518_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWA75301.1|3563524_3564241_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
AWA75302.1|3564240_3564909_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
AWA75303.1|3565092_3565824_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWA75304.1|3565866_3567339_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
AWA75305.1|3567335_3568052_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
AWA75306.1|3568130_3569258_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
AWA75307.1|3569299_3569788_-	DUF2593 domain-containing protein	NA	NA	NA	NA	NA
AWA75308.1|3569845_3570691_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AWA75309.1|3570687_3571641_-	putrescine ABC transporter permease	NA	NA	NA	NA	NA
AWA77058.1|3571651_3572785_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
AWA75310.1|3572948_3574061_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AWA75311.1|3574409_3574889_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
AWA75312.1|3574977_3575880_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
AWA75313.1|3576701_3576989_-	hypothetical protein	NA	NA	NA	NA	NA
AWA75314.1|3577191_3577455_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
AWA75315.1|3577461_3577845_-	hypothetical protein	NA	NA	NA	NA	NA
AWA77059.1|3578111_3579797_+	transporter	NA	NA	NA	NA	NA
3579927:3579945	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
AWA75316.1|3580016_3580235_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AWA75317.1|3580326_3581427_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
AWA75318.1|3581423_3581909_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
AWA75319.1|3581905_3584533_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
AWA75320.1|3584525_3584645_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AWA75321.1|3584659_3584959_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
AWA75322.1|3585011_3585527_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
AWA75323.1|3585536_3586709_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
AWA75324.1|3586847_3587924_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
AWA75325.1|3587953_3588157_-	hypothetical protein	NA	NA	NA	NA	NA
AWA75326.1|3588153_3588885_-	hypothetical protein	NA	NA	NA	NA	NA
AWA75327.1|3588888_3591840_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
AWA77060.1|3591841_3592441_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
AWA75328.1|3592433_3593342_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
AWA75329.1|3593328_3593691_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.9	4.9e-48
AWA75330.1|3593687_3594260_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
AWA75331.1|3594354_3595047_+	hypothetical protein	NA	NA	NA	NA	NA
AWA75332.1|3595043_3595490_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
AWA75333.1|3595482_3595914_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
AWA75334.1|3596009_3596438_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
AWA75335.1|3596434_3596818_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
AWA75336.1|3596822_3597332_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
AWA75337.1|3597312_3597528_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
AWA75338.1|3597531_3597735_-|tail	phage tail protein	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
AWA75339.1|3597734_3598199_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
AWA75340.1|3598294_3598945_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	96.3	8.7e-112
AWA75341.1|3598948_3600007_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
AWA75342.1|3600023_3600857_-|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
AWA75343.1|3600999_3602766_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
AWA75344.1|3602765_3603791_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
AWA75345.1|3603852_3605595_-	hypothetical protein	NA	NA	NA	NA	NA
AWA75346.1|3605942_3606923_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AWA75347.1|3608335_3608587_-	hypothetical protein	NA	NA	NA	NA	NA
AWA75348.1|3608754_3609807_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
3609882:3609900	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 10
CP028793	Klebsiella pneumoniae strain WCHKP020030 chromosome, complete genome	5376106	4264524	4276177	5376106	integrase	Enterobacteria_phage(70.0%)	13	4264974:4264988	4288030:4288044
AWA75936.1|4264524_4265628_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
4264974:4264988	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
AWA75937.1|4265638_4266892_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
AWA75938.1|4267244_4268435_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
AWA75939.1|4268422_4269373_+	cobyrinic acid a,c-diamide synthase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
AWA75940.1|4269372_4269798_+	hypothetical protein	NA	NA	NA	NA	NA
AWA75941.1|4270365_4270932_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
AWA75942.1|4270949_4271195_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
AWA75943.1|4271191_4271929_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	59.4	1.9e-70
AWA75944.1|4272470_4272737_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
AWA75945.1|4272733_4273291_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
AWA75946.1|4273287_4273515_+	hypothetical protein	NA	NA	NA	NA	NA
AWA75947.1|4273511_4273832_+	hypothetical protein	NA	NA	NA	NA	NA
AWA75948.1|4273843_4276177_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.4	0.0e+00
4288030:4288044	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 11
CP028793	Klebsiella pneumoniae strain WCHKP020030 chromosome, complete genome	5376106	4744414	4752819	5376106	transposase	Enterobacteria_phage(83.33%)	8	NA	NA
AWA76354.1|4744414_4746748_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
AWA76355.1|4746762_4747083_-	hypothetical protein	NA	NA	NA	NA	NA
AWA76356.1|4747079_4747307_-	hypothetical protein	NA	NA	NA	NA	NA
AWA76357.1|4747303_4747852_-	Ash-like/host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
AWA76358.1|4748675_4749413_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
AWA76359.1|4749409_4749655_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
AWA76360.1|4749672_4750239_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
AWA76361.1|4751895_4752819_+|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
>prophage 1
CP028790	Klebsiella pneumoniae strain WCHKP020030 plasmid pKPC2_020030, complete sequence	104810	1796	18519	104810	transposase,protease	Escherichia_phage(60.0%)	16	NA	NA
AWA71396.1|1796_2450_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWA71397.1|2669_3134_+	mRNA interferase PemK	NA	NA	NA	NA	NA
AWA71398.1|3130_3235_+	hypothetical protein	NA	NA	NA	NA	NA
AWA71399.1|4444_5149_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWA71400.1|5659_6535_+	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
AWA71401.1|6614_7538_+|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
AWA71402.1|9288_9993_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWA71403.1|11103_11808_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWA71404.1|11873_12392_+	hypothetical protein	NA	NA	NA	NA	NA
AWA71405.1|12396_12813_-	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
AWA71406.1|13198_13903_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWA71407.1|14580_14769_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71513.1|14860_15397_+	recombinase	NA	Q1MVP4	Enterobacteria_phage	100.0	2.8e-84
AWA71408.1|15579_16440_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AWA71409.1|16609_17365_+	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
AWA71410.1|17814_18519_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 2
CP028790	Klebsiella pneumoniae strain WCHKP020030 plasmid pKPC2_020030, complete sequence	104810	48538	100196	104810	transposase	Escherichia_phage(25.0%)	58	NA	NA
AWA71449.1|48538_49243_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWA71450.1|49282_49756_+	recombinase	NA	Q1MVP4	Enterobacteria_phage	99.3	3.3e-76
AWA71451.1|49878_50859_+|transposase	IS481 family transposase ISKpn27	transposase	A8RHK4	Spiroplasma_virus	27.4	2.9e-10
AWA71452.1|51134_52016_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
AWA71453.1|53250_53547_-	transcriptional repressor protein KorC	NA	NA	NA	NA	NA
AWA71454.1|53875_54301_-	antirestriction protein	NA	A0A2D0W8Z5	Bordetella_virus	37.3	5.3e-17
AWA71455.1|54411_54690_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71456.1|55585_56290_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWA71457.1|58319_59693_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
AWA71458.1|59679_60072_-	conjugal transfer protein TrbF	NA	NA	NA	NA	NA
AWA71459.1|60025_60433_-	conjugal transfer protein TrbJ	NA	NA	NA	NA	NA
AWA71460.1|60329_60875_-	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
AWA71461.1|60861_61143_-	type-F conjugative transfer system pilin chaperone TraQ	NA	NA	NA	NA	NA
AWA71462.1|61258_62032_-	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
AWA71463.1|61994_62255_-	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
AWA71464.1|62278_64129_-	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
AWA71465.1|64125_64548_-	HNH endonuclease	NA	C6ZR29	Salmonella_phage	86.8	9.4e-67
AWA71466.1|64573_64945_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71467.1|64941_65580_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
AWA71468.1|65606_66128_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71469.1|66190_66499_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71470.1|66525_67518_-	conjugal transfer protein TraU	NA	NA	NA	NA	NA
AWA71471.1|67514_68147_-	protein TraW	NA	NA	NA	NA	NA
AWA71472.1|68143_68530_-	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
AWA71473.1|70606_71311_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWA71519.1|71779_72337_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71474.1|72988_73969_-|transposase	IS5 family transposase ISKpn26	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
AWA71520.1|74482_74878_+	hypothetical protein	NA	NA	NA	NA	NA
AWA71475.1|74874_75486_+	DUF2913 domain-containing protein	NA	NA	NA	NA	NA
AWA71476.1|75482_76433_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	55.6	6.6e-76
AWA71477.1|76579_76780_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71478.1|76833_77466_-	LacI family DNA-binding transcriptional regulator	NA	A0A1V0E035	Clostridioides_phage	31.9	2.5e-07
AWA71479.1|77828_79034_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.2	1.1e-205
AWA71480.1|79030_80002_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.9	1.4e-113
AWA71481.1|80137_81409_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.0	6.1e-154
AWA71482.1|81408_81831_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	51.5	3.1e-30
AWA71483.1|82010_82682_-	DNA breaking-rejoining protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.7	5.1e-83
AWA71484.1|83040_83718_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
AWA71485.1|83717_83939_+	hypothetical protein	NA	NA	NA	NA	NA
AWA71486.1|83949_84369_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AWA71487.1|84422_85202_+	hypothetical protein	NA	NA	NA	NA	NA
AWA71488.1|85606_86113_+	antirestriction protein	NA	A0A1I9S7Y0	Rhodococcus_phage	31.8	4.8e-09
AWA71489.1|86155_86347_+	hypothetical protein	NA	NA	NA	NA	NA
AWA71490.1|86533_86794_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	46.2	4.1e-12
AWA71491.1|87771_88002_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AWA71492.1|90124_90556_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
AWA71493.1|90552_91281_+	psiA family protein	NA	NA	NA	NA	NA
AWA71494.1|91277_91601_+	theronine dehydrogenase	NA	I3UM57	Rhodobacter_phage	38.1	6.0e-13
AWA71495.1|91662_92022_+	hypothetical protein	NA	NA	NA	NA	NA
AWA71496.1|92326_92557_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71497.1|92547_93252_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWA71498.1|93285_93777_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71499.1|93883_94621_+	resolvase	NA	NA	NA	NA	NA
AWA71500.1|94617_94842_+	hypothetical protein	NA	NA	NA	NA	NA
AWA71501.1|94963_95140_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
AWA71502.1|95321_96326_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AWA71503.1|96404_99371_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.8	0.0e+00
AWA71504.1|99491_100196_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 1
CP028791	Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence	288222	5628	21171	288222	transposase,tail	Escherichia_phage(31.25%)	23	NA	NA
AWA71527.1|5628_6552_-|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
AWA71528.1|6634_6928_+	hypothetical protein	NA	NA	NA	NA	NA
AWA71529.1|6966_7548_+	hypothetical protein	NA	NA	NA	NA	NA
AWA71530.1|7937_8807_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AWA71531.1|8860_9181_+	hypothetical protein	NA	J9Q750	Salmonella_phage	50.9	2.2e-28
AWA71532.1|9260_9575_+	hypothetical protein	NA	NA	NA	NA	NA
AWA71533.1|9695_9947_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	76.7	1.9e-22
AWA71534.1|10112_10331_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	66.7	4.4e-20
AWA71535.1|10423_10921_+	hypothetical protein	NA	A0A076G835	Escherichia_phage	55.9	6.3e-22
AWA71536.1|10917_11106_+	hypothetical protein	NA	NA	NA	NA	NA
AWA71537.1|11583_11811_+	hypothetical protein	NA	A9YWV3	Burkholderia_phage	49.4	1.5e-10
AWA71538.1|11807_12452_+	hypothetical protein	NA	A0A0U4JEF1	Pseudomonas_phage	39.8	1.4e-05
AWA71539.1|12452_12776_+	hypothetical protein	NA	E5AGF3	Erwinia_phage	46.9	1.6e-13
AWA71540.1|12868_13255_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	85.1	3.7e-17
AWA71541.1|14505_14988_+	hypothetical protein	NA	A0A077SLK5	Escherichia_phage	58.3	4.4e-12
AWA71802.1|15071_15674_+	DUF551 domain-containing protein	NA	A0A1V0E5M5	Salmonella_phage	31.1	2.1e-19
AWA71542.1|15673_15859_+	hypothetical protein	NA	NA	NA	NA	NA
AWA71543.1|16128_16401_+	hypothetical protein	NA	I7B2L9	Escherichia_phage	50.0	2.5e-12
AWA71544.1|16974_17160_+	hypothetical protein	NA	A0A1V0E5M0	Salmonella_phage	67.4	2.1e-10
AWA71545.1|17169_17619_+|tail	phage tail protein	tail	A0A1I9KFG8	Aeromonas_phage	45.2	2.9e-18
AWA71546.1|17688_18297_+	hypothetical protein	NA	K4JV11	Caulobacter_phage	42.2	1.5e-25
AWA71547.1|18584_19040_+	hypothetical protein	NA	NA	NA	NA	NA
AWA71548.1|19923_21171_+	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	28.9	6.7e-12
>prophage 2
CP028791	Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence	288222	123461	230320	288222	transposase,integrase	Escherichia_phage(20.69%)	108	140349:140408	203551:204608
AWA71648.1|123461_124457_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.7	3.1e-20
AWA71649.1|124662_125676_-	NAD(P)-dependent alcohol dehydrogenase	NA	M1PHA2	Moumouvirus	26.0	5.8e-06
AWA71650.1|125788_126316_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWA71651.1|128947_129871_-|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
AWA71652.1|130240_131392_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
AWA71653.1|131414_131870_+	Tellurium resistance protein TerB	NA	NA	NA	NA	NA
AWA71654.1|131893_132934_+	tellurium resistance protein TerC	NA	K7QKE8	Escherichia_phage	46.5	1.8e-71
AWA71655.1|132972_133551_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.8	1.9e-33
AWA71656.1|133637_134213_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	42.6	9.6e-30
AWA71657.1|134297_135539_+	tellurium resistance protein TerF	NA	A0A2D1GNA9	Pseudoalteromonas_phage	27.2	2.2e-10
AWA71658.1|135875_136511_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
AWA71659.1|138242_139103_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	21.7	9.0e-08
140349:140408	attL	GGGTTTTGTTGAATAAATCGAACTTTTGCTGAGTTGAAGGATCAGATCACGTATCTTCCC	NA	NA	NA	NA
AWA71660.1|140426_141350_+|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
AWA71661.1|142015_143074_+	carbamoyl-phosphate synthase large chain	NA	NA	NA	NA	NA
AWA71662.1|143085_144228_+	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	28.2	6.3e-33
AWA71663.1|144220_144994_+	hypothetical protein	NA	NA	NA	NA	NA
AWA71664.1|144995_146075_+	hypothetical protein	NA	A0A172Q0S8	Acinetobacter_phage	33.8	8.6e-40
AWA71665.1|146074_147031_+	citrate lyase subunit beta	NA	NA	NA	NA	NA
AWA71666.1|147041_148265_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
AWA71667.1|148267_148726_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
AWA71668.1|149205_149844_+	VWA domain-containing protein	NA	NA	NA	NA	NA
AWA71669.1|149868_150510_+	TerD family protein	NA	A0A2P1N0C0	Streptomyces_phage	25.1	2.4e-05
AWA71670.1|150510_151149_+	VWA domain-containing protein	NA	NA	NA	NA	NA
AWA71811.1|151241_152282_+	VWA domain-containing protein	NA	NA	NA	NA	NA
AWA71671.1|152281_154015_+	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
AWA71672.1|154042_155542_+	kinase	NA	NA	NA	NA	NA
AWA71673.1|155673_156321_-	EcsC family protein	NA	NA	NA	NA	NA
AWA71674.1|157980_158373_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71675.1|158477_159017_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71676.1|159457_159838_+	hypothetical protein	NA	NA	NA	NA	NA
AWA71677.1|159838_160051_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71678.1|160051_160534_-	N-acetyltransferase	NA	NA	NA	NA	NA
AWA71679.1|160524_160803_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AWA71680.1|160921_161134_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71681.1|161241_161583_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71682.1|161682_161973_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71683.1|162143_162416_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71684.1|162412_162865_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71685.1|163523_163979_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AWA71686.1|164050_164416_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
AWA71687.1|164431_164707_+	mercuric transporter periplasmic component	NA	NA	NA	NA	NA
AWA71688.1|164734_165160_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AWA71689.1|165198_166884_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
AWA71690.1|166901_167267_+	transcriptional regulator	NA	NA	NA	NA	NA
AWA71691.1|167263_167500_+	mercury resistance protein	NA	NA	NA	NA	NA
AWA71812.1|167483_167603_-	mercury resistance protein	NA	NA	NA	NA	NA
AWA71692.1|167565_167778_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AWA71693.1|168082_168787_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWA71694.1|169585_170590_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AWA71695.1|170771_171044_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71696.1|171062_171242_+	hypothetical protein	NA	NA	NA	NA	NA
AWA71697.1|171171_172011_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AWA71698.1|172004_172352_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AWA71699.1|172574_173027_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
AWA71700.1|173111_173744_-	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
AWA71813.1|173881_174712_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
AWA71814.1|174842_175397_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
AWA71701.1|175688_176702_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AWA71702.1|176646_176970_+|transposase	transposase	transposase	NA	NA	NA	NA
AWA71703.1|177007_177565_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
AWA71704.1|177567_180540_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
AWA71705.1|180618_181623_+|transposase	IS110 family transposase IS4321	transposase	NA	NA	NA	NA
AWA71706.1|182808_183147_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71815.1|183152_183809_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71707.1|184644_185544_-	RepB family plasmid replication initiator protein	NA	A0A1B0VDL5	Salmonella_phage	49.0	6.9e-67
AWA71708.1|185864_186926_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71709.1|187012_187267_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71710.1|187298_187484_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71711.1|187532_187784_+	hypothetical protein	NA	NA	NA	NA	NA
AWA71712.1|187783_189268_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AWA71713.1|189353_190490_+	recombinase	NA	NA	NA	NA	NA
AWA71714.1|190555_190873_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71715.1|191022_191346_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71716.1|191342_192101_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71717.1|192097_193057_-	DNA replication protein	NA	NA	NA	NA	NA
AWA71718.1|193099_193507_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71719.1|193516_193981_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71720.1|194028_194271_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71721.1|194858_195077_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71722.1|195221_195761_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71723.1|195829_197074_-	topoisomerase	NA	A0A0H5AWB1	Pseudomonas_phage	25.5	1.8e-09
AWA71724.1|197184_197415_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71725.1|197486_199469_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71726.1|199532_200609_-	DUF3150 domain-containing protein	NA	NA	NA	NA	NA
AWA71727.1|200702_201755_-	ATP-binding protein	NA	NA	NA	NA	NA
AWA71728.1|201782_202604_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71729.1|202665_203019_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71730.1|203163_203640_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71731.1|203628_204552_+|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
AWA71732.1|205549_207349_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	23.1	1.8e-26
203551:204608	attR	GGGTTTTGTTGAATAAATCGAACTTTTGCTGAGTTGAAGGATCAGATCACGTATCTTCCCGACAACGCAGACCGTTCCGTGGCAAAGCAAAAGTTCAAAATCACCAACTGGCCCACCTACAATAAAGCCCTCATCAACCGTGGCTCCATAACTTTCTGGCTGGATGATGAAGCTATTCAGGCCTGGTATGAGTCAGCAACACCTTCTTCACGAGGCAGACCTCAGCGCTATTCTGACCTTGCCATCACGACTGTGCTGGTCATTAAACGCGTATTCAGGCTGACCCTGCGCGCTGCGCAGGGCTTTATTGATTCCATTTTTTCTCTGATGAACGTTCCGCTACGCTGCCCGGATTACAGCTGTGTCAGCAGGCGGGCAAAGTCGGTTAATATCAGTTTCAAAACGCCCACCCGGGGTGAAATCGCACACCTGGTAATTGATTCCACCGGGCTGAAGGTCTTCGGTGAAGGCGAGTGGAAAGTCAAAAAGCATGGCCAGGAACGCCGTCGTATATGGCGTAAGCTGCATCTGGCAGTTGACAGTAAAACACATGAAATCATCTGCGCTGACCTGTCGCTGAACAACGTTACGGACTCAGAGGCCTTCCCCGGGTTAATCCGGCAAACCCACCGGAAAATCAGGTCAGCCGCCGCCGATGGAGCTTACGATACCCGGCTCTGTCACGATGAACTGCGGCGTAAGAAAATCAGCGCGCTTATCCCGCCCCGAAAAGGTGCGGGTTACTGGCCCGGTGAATATGCAGACCGTAACCGTGCAGTGGCTAATCAGCGAATGACCGGGAGTAATGCGCGGTGGAAATGGACAACAGATTACAACCGTCGCTCGATAGCGGAAACGGCGATGTACCGGGTAAAACAGCTGTTCGGGGGTTCACTGACGCTGCGTGACTACGATGGTCAGGTTGCGGAGGCTATGGCCCTGGTACGAGCGCTGAACAAAATGACGAAAGCAGGTATGCCTGAAAGCGTGCGTATTGCCTGAAAACACAACCCGCTACGGGGGAGACTTACCCGAAATCTGATTTATTCAACAAAGCC	NA	NA	NA	NA
AWA71733.1|207639_207888_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AWA71734.1|207877_208162_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	59.1	4.7e-22
AWA71735.1|208315_209542_+|transposase	transposase	transposase	O80301	Enterobacteria_phage	76.9	1.7e-153
AWA71736.1|210115_210544_-|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	54.6	1.6e-34
AWA71737.1|210579_211767_+|transposase	transposase	transposase	O80301	Enterobacteria_phage	78.0	3.5e-143
AWA71738.1|213466_214315_+	hypothetical protein	NA	NA	NA	NA	NA
AWA71739.1|214363_217549_-	conjugal transfer protein TraN	NA	NA	NA	NA	NA
AWA71740.1|217558_218596_-	plasmid transfer protein	NA	NA	NA	NA	NA
AWA71741.1|218592_219954_-	conjugal transfer protein	NA	NA	NA	NA	NA
AWA71742.1|219940_220465_-	signal peptidase I	NA	NA	NA	NA	NA
AWA71743.1|220602_224844_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71744.1|224971_225508_-	plasmid transfer protein	NA	NA	NA	NA	NA
AWA71745.1|225495_225900_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71746.1|225874_226333_-	HtdA	NA	NA	NA	NA	NA
AWA71747.1|227016_227820_+	TrhO	NA	NA	NA	NA	NA
AWA71748.1|227809_228526_+	hypothetical protein	NA	NA	NA	NA	NA
AWA71749.1|228512_229013_+	hypothetical protein	NA	NA	NA	NA	NA
AWA71750.1|229339_230320_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 1
CP028792	Klebsiella pneumoniae strain WCHKP020030 plasmid pQnrS1_020030, complete sequence	125009	3622	58227	125009	transposase,plate,holin,tail	Escherichia_phage(45.0%)	52	NA	NA
AWA71824.1|3622_4546_+|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
AWA71825.1|4542_5502_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.3	1.1e-171
AWA71826.1|6174_6432_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71827.1|7050_8487_+	diguanylate cyclase	NA	NA	NA	NA	NA
AWA71938.1|9164_9251_+	ABC transporter	NA	NA	NA	NA	NA
AWA71828.1|9289_10270_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AWA71829.1|10268_10463_+	hypothetical protein	NA	NA	NA	NA	NA
AWA71830.1|10669_11947_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
AWA71831.1|12009_14013_-|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
AWA71939.1|15046_16254_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	4.4e-101
AWA71832.1|17682_18114_-	silver-binding protein SilE	NA	NA	NA	NA	NA
AWA71833.1|18364_19840_-	Cu(+)/Ag(+) sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
AWA71834.1|19832_20513_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
AWA71835.1|20702_22088_+	hypothetical protein	NA	NA	NA	NA	NA
AWA71836.1|22116_22470_+	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWA71837.1|22583_23876_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AWA71838.1|23886_27033_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
AWA71839.1|27119_27560_+	hypothetical protein	NA	NA	NA	NA	NA
AWA71840.1|28463_30911_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
AWA71841.1|30951_31149_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AWA71842.1|31182_31920_-	peptidase M23	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
AWA71843.1|32208_32658_-	copper resistance protein	NA	NA	NA	NA	NA
AWA71844.1|32891_34709_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
AWA71845.1|34708_35605_+	copper resistance protein B	NA	NA	NA	NA	NA
AWA71846.1|35644_36025_+	copper resistance system chaperone PcoC	NA	NA	NA	NA	NA
AWA71847.1|36029_36959_+	copper resistance protein D	NA	NA	NA	NA	NA
AWA71848.1|37013_37694_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
AWA71849.1|37690_39091_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.6	2.4e-18
AWA71850.1|39306_39741_+	copper-binding protein	NA	NA	NA	NA	NA
AWA71851.1|40119_40239_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AWA71852.1|40204_40384_-	antitoxin	NA	NA	NA	NA	NA
AWA71853.1|40696_40960_+	hypothetical protein	NA	NA	NA	NA	NA
AWA71854.1|40956_41523_+	hypothetical protein	NA	NA	NA	NA	NA
AWA71855.1|41553_42048_+	DNA-binding protein	NA	NA	NA	NA	NA
AWA71856.1|42108_42312_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
AWA71857.1|42405_43573_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	95.7	1.3e-177
AWA71858.1|44003_45557_-	L-lactate permease	NA	NA	NA	NA	NA
AWA71859.1|45992_47690_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
AWA71860.1|47764_48484_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
AWA71861.1|48494_49922_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
AWA71862.1|49914_50610_+	lactate utilization protein C	NA	NA	NA	NA	NA
AWA71863.1|50659_51097_-	gluconate transporter	NA	NA	NA	NA	NA
AWA71864.1|51250_51562_+	cytoplasmic protein	NA	NA	NA	NA	NA
AWA71865.1|51558_51978_+	transcriptional regulator	NA	A0A222YXG1	Escherichia_phage	31.4	1.8e-06
AWA71866.1|52014_53217_-|tail	phage tail protein	tail	A0A222YXT1	Escherichia_phage	63.6	3.9e-126
AWA71867.1|53209_53539_-|plate	baseplate protein	plate	A0A222YYR0	Escherichia_phage	65.1	6.7e-36
AWA71940.1|53535_54057_-	maturation control protein	NA	A0A222YZ79	Escherichia_phage	53.8	6.4e-49
AWA71868.1|54388_54619_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71869.1|54618_54975_-	recombination enhancement function domain protein	NA	Q71TG3	Escherichia_phage	65.2	4.2e-36
AWA71870.1|55527_55881_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	4.1e-23
AWA71871.1|56103_56808_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWA71872.1|57222_58227_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP028792	Klebsiella pneumoniae strain WCHKP020030 plasmid pQnrS1_020030, complete sequence	125009	82831	107692	125009	transposase	Escherichia_phage(66.67%)	26	NA	NA
AWA71902.1|82831_83596_+|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AWA71903.1|83786_84143_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71904.1|84088_84673_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AWA71905.1|84672_85911_-	MFS transporter	NA	NA	NA	NA	NA
AWA71906.1|85907_86813_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AWA71907.1|86934_87639_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWA71908.1|87789_88605_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
AWA71909.1|88794_89499_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWA71945.1|89523_91080_+	chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	98.7	3.1e-83
AWA71910.1|91407_92169_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AWA71911.1|92189_93050_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AWA71912.1|93013_93196_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71913.1|93186_93891_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWA71946.1|93920_94142_+	hypothetical protein	NA	NA	NA	NA	NA
AWA71914.1|94278_94851_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
AWA71915.1|94887_96279_+|transposase	ISKra4 family transposase ISKpn19	transposase	NA	NA	NA	NA
AWA71916.1|97058_97715_-	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
AWA71917.1|99311_100169_-	class A beta-lactamase LAP-2	NA	Q1MVP3	Enterobacteria_phage	61.1	2.0e-92
AWA71918.1|100233_101535_-	cell division protein FtsI	NA	NA	NA	NA	NA
AWA71919.1|101657_102362_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWA71920.1|102398_103526_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
AWA71921.1|103576_103822_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71922.1|103827_104019_+	hypothetical protein	NA	NA	NA	NA	NA
AWA71923.1|104500_105043_-	tunicamycin resistance protein	NA	NA	NA	NA	NA
AWA71924.1|105055_105916_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
AWA71925.1|106987_107692_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
