The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP025149	Pseudomonas stutzeri strain SGAir0442 chromosome, complete genome	4524655	56616	68756	4524655	transposase	Bacillus_phage(85.71%)	7	NA	NA
AVX11292.1|56616_59493_-	response regulator	NA	W8CYF6	Bacillus_phage	33.5	2.6e-27
AVX11293.1|59620_61261_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.8	9.1e-17
AVX11294.1|61253_61643_-	response regulator	NA	W8CYM9	Bacillus_phage	31.6	2.0e-07
AVX11295.1|61639_64051_-	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	35.1	2.9e-27
AVX11296.2|64286_65275_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	53.2	7.0e-97
AVX11297.1|65341_65728_-	response regulator	NA	W8CYM9	Bacillus_phage	35.0	1.2e-12
AVX11298.1|65777_68756_-	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	34.3	2.1e-27
>prophage 2
CP025149	Pseudomonas stutzeri strain SGAir0442 chromosome, complete genome	4524655	257349	342987	4524655	plate,holin,integrase,head,tail,terminase,protease,capsid,portal	uncultured_Caudovirales_phage(54.76%)	85	260984:261031	300447:300494
AVX11464.2|257349_260814_-	type I restriction-modification system endonuclease	NA	G9FI19	Nocardia_phage	21.6	1.0e-09
260984:261031	attL	TCGTGGTGCCGGCACCAGGAGTCGAACCCGGGACCTACTGATTACAAG	NA	NA	NA	NA
AVX11465.1|261149_262292_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	39.6	1.3e-70
AVX11466.1|262288_262498_-	hypothetical protein	NA	NA	NA	NA	NA
AVX11467.1|262576_262774_-	hypothetical protein	NA	A0A2H4J958	uncultured_Caudovirales_phage	69.0	2.3e-15
AVX11468.1|262793_263348_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	33.6	1.5e-16
AVX11469.1|263344_263569_-	hypothetical protein	NA	NA	NA	NA	NA
AVX11470.1|263568_263769_-	hypothetical protein	NA	NA	NA	NA	NA
AVX11471.1|264079_264370_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	53.1	5.7e-23
AVX11472.1|264370_264664_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	47.1	3.2e-13
AVX11473.1|264778_265171_-	hypothetical protein	NA	NA	NA	NA	NA
AVX15196.1|265167_265338_-	antitoxin	NA	NA	NA	NA	NA
AVX11474.1|265529_266105_-	hypothetical protein	NA	A0A2I7QN58	Vibrio_phage	28.0	7.9e-16
AVX11475.1|266343_269070_-	bifunctional DNA primase/helicase	NA	A0A2H4J936	uncultured_Caudovirales_phage	54.2	3.2e-285
AVX15197.1|269083_269317_-	hypothetical protein	NA	NA	NA	NA	NA
AVX11476.1|269399_269753_-	hypothetical protein	NA	A0A2H4J947	uncultured_Caudovirales_phage	57.4	4.3e-25
AVX11477.1|269749_270049_-	transcriptional regulator	NA	A0A2H4JAW0	uncultured_Caudovirales_phage	71.8	8.5e-30
AVX11478.1|270150_270732_-	phage antirepressor protein	NA	A0A1U9AJ93	Stx1_converting_phage	53.9	1.4e-33
AVX11479.1|270746_271208_-	hypothetical protein	NA	Q9ZXJ2	Pseudomonas_virus	67.3	2.9e-53
AVX11480.1|271243_271480_-	hypothetical protein	NA	NA	NA	NA	NA
AVX11481.1|271570_271987_+	hypothetical protein	NA	NA	NA	NA	NA
AVX11482.1|272024_272333_+	hypothetical protein	NA	NA	NA	NA	NA
AVX11483.1|272469_272781_+	type II toxin-antitoxin system MqsR family toxin	NA	NA	NA	NA	NA
AVX11484.1|272777_273257_+	type II toxin-antitoxin system MqsA family antitoxin	NA	NA	NA	NA	NA
AVX11485.1|273324_273840_+	hypothetical protein	NA	NA	NA	NA	NA
AVX15198.1|273880_275047_-	phage late control D family protein	NA	A0A2H4JAV0	uncultured_Caudovirales_phage	78.1	9.3e-173
AVX11486.1|275136_275577_-|tail	phage tail protein	tail	A0A2H4JG54	uncultured_Caudovirales_phage	83.6	5.9e-64
AVX11487.1|275583_278268_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	36.1	4.4e-101
AVX11488.1|278450_278567_-|tail	GpE family phage tail protein	tail	Q9ZXK1	Pseudomonas_virus	72.7	8.6e-07
AVX11489.1|278575_278875_-|tail	phage tail assembly protein	tail	E5E3Q1	Burkholderia_phage	64.6	9.7e-26
AVX11490.1|278973_279804_-	hypothetical protein	NA	A0A0N7KZV8	Escherichia_phage	42.1	9.3e-34
AVX11491.1|279815_280133_-	hypothetical protein	NA	NA	NA	NA	NA
AVX11492.1|280429_280654_-	hypothetical protein	NA	NA	NA	NA	NA
AVX11493.1|280737_281253_-|tail	phage major tail tube protein	tail	A0A2H4J916	uncultured_Caudovirales_phage	77.8	1.3e-75
AVX11494.1|281301_282492_-|tail	phage tail sheath protein	tail	A0A2H4JCP8	uncultured_Caudovirales_phage	90.2	3.0e-203
AVX11495.1|282644_283220_-|tail	phage tail protein	tail	A0A2H4J924	uncultured_Caudovirales_phage	83.2	3.5e-48
AVX11496.1|283221_285585_-	hypothetical protein	NA	A0A2R2YB20	Pseudomonas_phage	39.2	1.4e-26
AVX15199.1|285584_286133_-|tail	phage tail protein I	tail	R4JET8	Burkholderia_phage	49.4	2.4e-46
AVX11497.1|286125_287022_-|plate	baseplate assembly protein	plate	A0A088FQL4	Escherichia_phage	56.2	1.4e-83
AVX11498.1|287018_287372_-|plate	baseplate assembly protein	plate	A0A2H4JE52	uncultured_Caudovirales_phage	85.7	1.1e-47
AVX15200.1|287368_287902_-|plate	phage baseplate assembly protein V	plate	A0A2H4JFJ8	uncultured_Caudovirales_phage	62.1	6.3e-52
AVX11499.1|287976_288429_-	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	71.2	7.7e-51
AVX11500.1|288421_288946_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	73.9	5.8e-58
AVX11501.1|289048_289492_-	DUF2570 domain-containing protein	NA	Q9ZXL5	Pseudomonas_virus	48.6	4.6e-24
AVX11502.1|289488_290304_-	DUF3380 domain-containing protein	NA	A0A2H4JGJ9	uncultured_Caudovirales_phage	94.1	4.5e-142
AVX11503.1|290300_290618_-|holin	phage holin, lambda family	holin	A0A2H4JFM8	uncultured_Caudovirales_phage	99.0	2.3e-49
AVX15201.1|290610_291060_-	hypothetical protein	NA	A0A2H4J973	uncultured_Caudovirales_phage	97.3	3.1e-84
AVX11504.1|291059_291269_-|tail	phage tail protein	tail	A0A2H4J946	uncultured_Caudovirales_phage	98.6	2.0e-33
AVX11505.1|291268_291739_-|head	head completion/stabilization protein	head	A0A2H4JCS4	uncultured_Caudovirales_phage	96.8	7.0e-79
AVX11506.1|291837_292668_-|terminase	terminase	terminase	A0A2H4J948	uncultured_Caudovirales_phage	71.7	9.8e-84
AVX11507.1|292670_293681_-|capsid	phage major capsid protein, P2 family	capsid	A0A2H4JCR7	uncultured_Caudovirales_phage	92.9	1.2e-173
AVX11508.1|293708_294539_-|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	97.1	4.4e-145
AVX11509.1|294689_296456_+|terminase	terminase	terminase	A0A2H4JGK4	uncultured_Caudovirales_phage	99.1	0.0e+00
AVX11510.1|296455_297454_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	94.0	9.0e-185
AVX11511.1|297931_299353_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
AVX11513.1|300595_301828_-	methyltransferase	NA	NA	NA	NA	NA
300447:300494	attR	TCGTGGTGCCGGCACCAGGAGTCGAACCCGGGACCTACTGATTACAAG	NA	NA	NA	NA
AVX11514.1|301918_303295_-	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
AVX11515.1|303287_303833_-	TRAP transporter small permease subunit	NA	NA	NA	NA	NA
AVX11516.1|304126_305233_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
AVX11517.1|305309_305735_-	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AVX11518.1|305776_306085_-	DUF2388 domain-containing protein	NA	NA	NA	NA	NA
AVX11519.1|306154_310849_-	PAS domain S-box protein	NA	NA	NA	NA	NA
AVX11520.1|311030_312611_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
AVX11521.1|312832_313546_+	hypothetical protein	NA	NA	NA	NA	NA
AVX11522.1|313643_315428_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
AVX11523.1|315524_316889_-	inorganic triphosphatase	NA	NA	NA	NA	NA
AVX11524.1|317002_317680_+	TIGR00153 family protein	NA	NA	NA	NA	NA
AVX11525.1|317721_318987_+	inorganic phosphate transporter	NA	M4QMY4	Ostreococcus_lucimarinus_virus	35.3	1.1e-57
AVX11526.1|319105_320257_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
AVX11527.1|320302_321601_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
AVX11528.1|321634_323212_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AVX11529.1|323338_323728_-	PaaI family thioesterase	NA	NA	NA	NA	NA
AVX11530.1|323730_326043_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
AVX11531.1|326140_329599_-	cellulose biosynthesis protein BcsC	NA	NA	NA	NA	NA
AVX11532.1|329605_331828_-	cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB	NA	NA	NA	NA	NA
AVX11533.1|331824_334422_-	UDP-forming cellulose synthase catalytic subunit	NA	NA	NA	NA	NA
AVX11534.1|334423_335158_-	cellulose synthase operon protein YhjQ	NA	NA	NA	NA	NA
AVX11535.1|335154_335388_-	hypothetical protein	NA	NA	NA	NA	NA
AVX11536.1|335395_337021_-	cellulose biosynthesis protein BcsG	NA	NA	NA	NA	NA
AVX11537.1|337017_337200_-	cellulose biosynthesis protein BcsF	NA	NA	NA	NA	NA
AVX11538.1|337196_338735_-	cellulose biosynthesis protein BcsE	NA	NA	NA	NA	NA
AVX11539.1|338951_339338_+	diacylglycerol kinase	NA	NA	NA	NA	NA
AVX11540.1|339452_340187_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	35.7	5.5e-30
AVX11541.1|340263_341595_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
AVX11542.1|341617_342523_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A127KMC2	Cyanophage	34.6	7.2e-40
AVX11543.1|342519_342987_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
>prophage 3
CP025149	Pseudomonas stutzeri strain SGAir0442 chromosome, complete genome	4524655	1628056	1659277	4524655	integrase,transposase,tRNA	Stx2-converting_phage(28.57%)	31	1646886:1646903	1659329:1659346
AVX12738.2|1628056_1629045_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	53.2	7.0e-97
AVX12739.1|1629128_1629830_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
AVX12740.1|1629876_1630176_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
AVX12741.1|1630369_1631554_+	response regulator	NA	NA	NA	NA	NA
AVX12742.1|1631550_1632033_+	STAS domain-containing protein	NA	NA	NA	NA	NA
AVX12743.1|1632040_1632967_-	transaldolase	NA	E3SQJ7	Cyanophage	36.2	2.1e-10
AVX15232.1|1633098_1634106_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AVX12744.1|1634210_1635323_+|integrase	site-specific integrase	integrase	L7TP61	Pseudomonas_virus	75.2	9.8e-164
AVX12745.1|1635319_1635601_-	Pyocin activator protein PrtN	NA	A0A2K8HN48	Pseudomonas_phage	76.6	1.3e-32
AVX12746.1|1636179_1636758_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
AVX12747.1|1636761_1638270_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.6	9.2e-149
AVX12748.1|1638305_1638650_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	68.2	9.7e-38
AVX12749.1|1638646_1639093_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AVX12750.1|1639703_1640657_+|transposase	IS1595-like element ISAchd1 family transposase	transposase	NA	NA	NA	NA
AZL50109.1|1642828_1642933_-	hypothetical protein	NA	NA	NA	NA	NA
AZL50094.1|1642981_1643293_+	hypothetical protein	NA	NA	NA	NA	NA
AVX12751.1|1643330_1644701_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
AVX12752.1|1644853_1645843_-	arsenic resistance protein	NA	NA	NA	NA	NA
AVX12753.1|1646070_1646631_+	hypothetical protein	NA	NA	NA	NA	NA
1646886:1646903	attL	GCTTTTGGCCGGTTAGCG	NA	NA	NA	NA
AVX12754.1|1646955_1647729_+	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
AVX12755.1|1647960_1648773_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AVX12756.2|1648769_1649591_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
AVX12757.1|1649698_1650148_-	cyanase	NA	NA	NA	NA	NA
AVX12758.1|1650173_1651079_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.7	5.0e-33
AVX12759.1|1651068_1651920_-	nitrate ABC transporter, permease protein	NA	NA	NA	NA	NA
AVX12760.1|1651916_1653323_-	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
AVX12761.1|1653350_1654688_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AVX12762.1|1654684_1655824_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AVX12763.1|1655846_1656407_-	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AVX12764.1|1656608_1658201_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AVX12765.1|1658656_1659277_-|integrase	integrase	integrase	NA	NA	NA	NA
1659329:1659346	attR	CGCTAACCGGCCAAAAGC	NA	NA	NA	NA
>prophage 4
CP025149	Pseudomonas stutzeri strain SGAir0442 chromosome, complete genome	4524655	1693219	1751505	4524655	protease,transposase,tRNA	Escherichia_phage(11.11%)	44	NA	NA
AVX15235.1|1693219_1694758_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
AVX12788.1|1694747_1695017_+	hypothetical protein	NA	NA	NA	NA	NA
AVX12789.1|1696850_1698350_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
AVX12790.1|1698342_1699146_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	36.2	4.0e-34
AVX12791.1|1699851_1700760_-	hypothetical protein	NA	NA	NA	NA	NA
AZL50097.1|1700925_1701288_-	hypothetical protein	NA	NA	NA	NA	NA
AVX12792.1|1703238_1704561_-	TRAP transporter large permease	NA	NA	NA	NA	NA
AVX12793.1|1704557_1705085_-	TRAP transporter small permease	NA	NA	NA	NA	NA
AVX12794.1|1705131_1706187_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
AVX12795.1|1706535_1708215_-	tannase/feruloyl esterase family alpha/beta hydrolase	NA	NA	NA	NA	NA
AVX12796.1|1708536_1709490_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVX15236.1|1709704_1711066_+	benzoate 1,2-dioxygenase large subunit	NA	NA	NA	NA	NA
AVX12797.1|1711068_1711557_+	benzoate 1,2-dioxygenase small subunit	NA	NA	NA	NA	NA
AVX12798.1|1711567_1712578_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
AVX12799.1|1712650_1713427_+	1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase	NA	NA	NA	NA	NA
AVX12800.1|1713534_1714881_+	MFS transporter	NA	NA	NA	NA	NA
AVX12801.1|1714909_1716031_+	muconate cycloisomerase	NA	NA	NA	NA	NA
AVX12802.1|1716045_1716336_+	muconolactone Delta-isomerase	NA	NA	NA	NA	NA
AVX12803.1|1716407_1717346_+	catechol 1,2-dioxygenase	NA	NA	NA	NA	NA
AVX12804.1|1717473_1718697_+	benzoate transporter BenE	NA	NA	NA	NA	NA
AVX12805.1|1718837_1719107_-	hypothetical protein	NA	NA	NA	NA	NA
AVX15237.1|1719096_1720635_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
AVX12806.1|1720756_1721101_-	IS66 family insertion sequence hypothetical protein	NA	S5VXZ8	Leptospira_phage	33.7	1.1e-12
AVX12807.1|1721097_1721388_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AVX12808.1|1721477_1722740_+	OprD family porin	NA	NA	NA	NA	NA
AVX12809.1|1728792_1729149_+	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	35.2	8.0e-11
AVX12810.1|1729333_1730650_+	sodium:proton antiporter	NA	NA	NA	NA	NA
AVX12811.1|1730767_1731829_+	AI-2E family transporter	NA	NA	NA	NA	NA
AVX12812.1|1731875_1733870_-	PhoX family phosphatase	NA	NA	NA	NA	NA
AVX12813.1|1734055_1735651_-	isocitrate lyase	NA	NA	NA	NA	NA
AVX12814.1|1736136_1736946_-	secretin	NA	NA	NA	NA	NA
AVX12815.1|1736942_1737572_-	histone acetyltransferase HPA2	NA	NA	NA	NA	NA
AVX12816.1|1737578_1738004_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AVX12817.1|1737996_1739163_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AVX12818.1|1739240_1740611_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	47.8	1.7e-112
AVX12819.1|1740696_1741335_-	lysogenization regulator HflD	NA	NA	NA	NA	NA
AVX15238.2|1741331_1742459_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AVX12820.1|1742526_1742967_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AVX12821.1|1743071_1745300_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
AVX12822.1|1745655_1746912_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	79.6	2.4e-17
AVX12823.1|1746971_1747235_-	cold shock domain-containing protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	58.2	4.7e-16
AVX15239.1|1747453_1747816_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	39.6	2.3e-13
AVX12824.1|1747845_1750116_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.4	9.6e-166
AVX12825.1|1750302_1751505_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	54.4	2.0e-109
>prophage 5
CP025149	Pseudomonas stutzeri strain SGAir0442 chromosome, complete genome	4524655	2102995	2116769	4524655		uncultured_Caudovirales_phage(75.0%)	12	NA	NA
AVX13105.1|2102995_2103664_+	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	76.7	7.6e-87
AVX13106.1|2103763_2105032_-	MFS transporter	NA	NA	NA	NA	NA
AVX15257.1|2105260_2105653_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	72.1	9.0e-48
AVX13107.1|2105652_2106012_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	63.3	1.5e-33
AVX13108.1|2106011_2106314_+	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	58.0	9.2e-24
AVX13109.1|2106310_2106643_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	71.6	6.5e-39
AVX13110.1|2106639_2107623_+	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	75.2	4.9e-143
AVX13111.1|2107707_2108712_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
AVX13112.1|2108742_2111382_-	PAS domain S-box protein	NA	A0A2K9L5I4	Tupanvirus	28.6	2.0e-13
AVX13113.1|2111311_2112475_-	GfdT protein	NA	NA	NA	NA	NA
AVX13114.1|2112789_2113980_-	porin	NA	NA	NA	NA	NA
AVX13115.1|2114237_2116769_-	pyrroloquinoline quinone biosynthesis protein PqqF	NA	A0A1V0SJA4	Klosneuvirus	29.0	3.5e-15
>prophage 6
CP025149	Pseudomonas stutzeri strain SGAir0442 chromosome, complete genome	4524655	2892910	2938565	4524655	integrase,terminase,tail	Pseudomonas_phage(69.81%)	66	2887772:2887788	2941174:2941190
2887772:2887788	attL	CCACCGGCCGCACCGGC	NA	NA	NA	NA
AVX13787.1|2892910_2893927_-	hypothetical protein	NA	A0A059VF40	Pseudomonas_phage	42.1	1.5e-33
AVX13788.1|2893923_2897499_-	DUF1983 domain-containing protein	NA	A0A0S2SYC5	Pseudomonas_phage	45.2	4.0e-283
AVX13789.1|2897495_2898062_-|tail	tail assembly protein	tail	W0LI27	Edwardsiella_phage	50.5	5.7e-43
AVX15287.1|2898018_2898780_-|tail	phage tail protein	tail	A0A2I6PI52	Pseudomonas_phage	52.5	3.9e-71
AVX13791.1|2899062_2899725_-|tail	phage minor tail protein L	tail	A0A2I6PIA7	Pseudomonas_phage	55.4	1.2e-71
AVX13792.1|2899721_2900075_-|tail	phage tail protein	tail	K7P7R1	Enterobacteria_phage	41.4	2.2e-16
AVX13793.1|2900071_2903131_-	hypothetical protein	NA	A0A0H5AWE4	Pseudomonas_phage	81.2	0.0e+00
AVX13794.1|2903186_2903564_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AVX13795.1|2903596_2903860_-	hypothetical protein	NA	A0A0H5ARS5	Pseudomonas_phage	92.7	3.0e-39
AVX13796.1|2903907_2904219_-	hypothetical protein	NA	A0A0H5AUF4	Pseudomonas_phage	87.4	6.7e-46
AVX13797.1|2904272_2904920_-|tail	phage tail protein	tail	A0A0H5BBY3	Pseudomonas_phage	94.9	2.6e-108
AVX13798.1|2904982_2905390_-	hypothetical protein	NA	A0A0H5ARK5	Pseudomonas_phage	94.8	1.9e-69
AVX13799.1|2905392_2905788_-	HK97 gp10 family phage protein	NA	A0A0H5AWD5	Pseudomonas_phage	94.7	7.7e-63
AVX13800.1|2905787_2906174_-	hypothetical protein	NA	NA	NA	NA	NA
AVX13801.1|2906175_2906544_-	hypothetical protein	NA	A0A0H5AUF0	Pseudomonas_phage	61.8	5.2e-29
AVX13802.1|2906544_2906733_-	hypothetical protein	NA	A0A0H5BBX8	Pseudomonas_phage	95.2	1.1e-24
AVX13803.1|2906779_2907763_-	hypothetical protein	NA	A0A0H5ARK0	Pseudomonas_phage	94.8	1.9e-166
AVX13804.1|2907775_2908522_-	hypothetical protein	NA	A0A0H5AWD1	Pseudomonas_phage	96.0	7.3e-123
AVX15288.1|2908644_2909142_-	DNA-binding protein	NA	A0A0H5ARR4	Pseudomonas_phage	65.8	5.5e-66
AVX13805.1|2909400_2909631_-	hypothetical protein	NA	NA	NA	NA	NA
AVX13806.1|2909658_2909910_-	hypothetical protein	NA	A0A0H5AUE5	Pseudomonas_phage	58.2	3.9e-20
AVX13807.1|2909917_2911003_-	hypothetical protein	NA	A0A0H5BBX3	Pseudomonas_phage	48.7	7.7e-89
AVX13808.1|2911002_2912355_-	DUF4055 domain-containing protein	NA	A0A0H5AWC7	Pseudomonas_phage	93.3	9.8e-243
AVX13809.1|2912357_2913605_-|terminase	terminase	terminase	A0A2R3UAD4	Siphoviridae_environmental_samples	77.8	8.1e-191
AVX13810.1|2913585_2914146_-	hypothetical protein	NA	A0A2H4J1J5	uncultured_Caudovirales_phage	36.2	1.4e-12
AVX15289.1|2914260_2914443_+	hypothetical protein	NA	NA	NA	NA	NA
AVX13811.1|2914470_2914656_-	hypothetical protein	NA	A0A0H5ARJ1	Pseudomonas_phage	84.7	2.6e-21
AVX13812.1|2915107_2915320_-	hypothetical protein	NA	A0A0H5ARQ8	Pseudomonas_phage	77.6	6.4e-24
AVX13813.1|2915316_2915610_-	hypothetical protein	NA	A0A0H5AUD7	Pseudomonas_phage	37.0	7.3e-10
AVX13814.1|2916213_2916804_-	hypothetical protein	NA	A0A0S2SYA9	Pseudomonas_phage	46.1	5.7e-46
AVX13815.1|2916800_2918312_-	hypothetical protein	NA	A0A292GAH2	Xanthomonas_phage	38.4	2.0e-82
AVX13816.1|2918311_2918677_-	endodeoxyribonuclease RusA	NA	A0A088F6Y8	Sulfitobacter_phage	48.2	1.7e-19
AVX13818.1|2918955_2919240_-	DUF3310 domain-containing protein	NA	A0A1I9SET2	Klebsiella_phage	72.2	1.3e-24
AVX13819.1|2919409_2919718_-	DUF1364 family protein	NA	G8C7V5	Escherichia_phage	62.1	4.0e-27
AVX15290.1|2919717_2920155_-	HNH endonuclease	NA	R9QM99	Lactococcus_phage	39.4	7.1e-17
AVX13820.1|2920250_2920709_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	43.9	3.7e-16
AVX15291.1|2920701_2920947_-	TraR/DksA family transcriptional regulator	NA	A0A0H5ARI0	Pseudomonas_phage	56.8	3.3e-16
AVX13821.1|2920955_2921249_-	hypothetical protein	NA	NA	NA	NA	NA
AVX13822.1|2921397_2922048_-	hypothetical protein	NA	A0A0S2SYE7	Pseudomonas_phage	31.6	1.5e-18
AVX13823.1|2922047_2923388_-	replicative DNA helicase	NA	Q9MC54	Pseudomonas_phage	73.5	2.3e-183
AVX13824.1|2923384_2924374_-	phage replication protein	NA	A0A0S2SYI8	Pseudomonas_phage	71.8	2.9e-127
AVX13825.1|2924567_2924780_-	helix-turn-helix domain-containing protein	NA	A0A2D1GND2	Pseudomonas_phage	50.0	1.7e-08
AVX15292.1|2924996_2925617_+	helix-turn-helix transcriptional regulator	NA	W6MVG5	Pseudomonas_phage	65.5	9.9e-57
AVX13826.2|2925891_2926221_+	hypothetical protein	NA	NA	NA	NA	NA
AVX13827.1|2926563_2926932_+	helix-turn-helix transcriptional regulator	NA	A0A0H5AUC3	Pseudomonas_phage	83.6	3.1e-50
AVX13828.1|2926947_2927178_+	hypothetical protein	NA	NA	NA	NA	NA
AVX13829.1|2927180_2927411_+	hypothetical protein	NA	NA	NA	NA	NA
AVX13830.1|2927410_2927617_+	hypothetical protein	NA	A0A2H4J2M2	uncultured_Caudovirales_phage	76.5	1.7e-29
AVX13831.1|2927991_2928510_+	hypothetical protein	NA	A0A0P0YNE7	Yellowstone_lake_phycodnavirus	45.0	1.3e-12
AVX13832.1|2928622_2928898_+	hypothetical protein	NA	NA	NA	NA	NA
AVX13833.1|2928894_2929116_+	hypothetical protein	NA	NA	NA	NA	NA
AVX13834.1|2929112_2929391_+	hypothetical protein	NA	NA	NA	NA	NA
AZL50101.1|2929607_2930135_+	hypothetical protein	NA	A0A291I9C8	Pseudomonas_phage	34.8	1.1e-16
AVX15293.1|2930310_2931123_+	exodeoxyribonuclease VIII	NA	A0A1P8DTH1	Proteus_phage	57.7	1.7e-88
AVX13836.1|2931119_2931920_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	65.9	4.4e-89
AVX13837.1|2931900_2932137_+	hypothetical protein	NA	A0A2H4JFL8	uncultured_Caudovirales_phage	45.7	9.1e-11
AVX13838.1|2932176_2932470_+	hypothetical protein	NA	A0A0H5ARL2	Pseudomonas_phage	91.8	5.0e-43
AVX13839.1|2932618_2933074_+	hypothetical protein	NA	A0A0H5AU93	Pseudomonas_phage	94.0	8.8e-79
AVX13840.1|2933070_2934717_+	DUF4942 domain-containing protein	NA	A0A059VA49	Pseudomonas_phage	55.5	8.5e-172
AVX13841.1|2934760_2934955_+	hypothetical protein	NA	A0A0H5BBQ5	Pseudomonas_phage	82.8	1.0e-23
AZL50110.1|2935491_2935731_+	DfrB family trimethoprim-resistant dihydrofolate reductase	NA	A0A0H5ARK7	Pseudomonas_phage	93.0	2.1e-23
AVX13843.1|2935727_2936360_+	hypothetical protein	NA	A0A076G6T3	Escherichia_phage	53.6	5.2e-21
AVX13844.1|2936360_2936549_+	hypothetical protein	NA	NA	NA	NA	NA
AVX13845.1|2936610_2936883_+	hypothetical protein	NA	NA	NA	NA	NA
AVX13846.1|2936907_2937177_+	hypothetical protein	NA	A0A0H5BBP9	Pseudomonas_phage	65.9	2.0e-22
AVX13847.1|2937371_2938565_+|integrase	site-specific integrase	integrase	A0A0H5AW64	Pseudomonas_phage	97.5	4.5e-223
2941174:2941190	attR	CCACCGGCCGCACCGGC	NA	NA	NA	NA
>prophage 7
CP025149	Pseudomonas stutzeri strain SGAir0442 chromosome, complete genome	4524655	3700899	3720403	4524655	integrase,transposase	Stx2-converting_phage(28.57%)	18	3694648:3694662	3707409:3707423
3694648:3694662	attL	GTCGAGGCCGAGCCC	NA	NA	NA	NA
AVX14493.1|3700899_3703893_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	47.6	5.7e-259
AVX14494.1|3703896_3704307_-	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
AVX14495.1|3704306_3704546_-	methionine repressor-like protein	NA	NA	NA	NA	NA
AVX14496.1|3704738_3705632_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AVX14497.1|3705880_3706171_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AVX14498.1|3706167_3706512_+	IS66 family insertion sequence hypothetical protein	NA	S5VXZ8	Leptospira_phage	33.7	1.1e-12
AVX15329.1|3706633_3708172_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
3707409:3707423	attR	GTCGAGGCCGAGCCC	NA	NA	NA	NA
AVX14499.1|3708161_3708431_+	hypothetical protein	NA	NA	NA	NA	NA
AVX14500.1|3709233_3709812_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
AVX14501.1|3709815_3711324_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.6	9.2e-149
AVX14502.1|3711359_3711704_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	68.2	9.7e-38
AVX14503.1|3711700_3712147_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AVX14504.1|3712141_3712465_+	hypothetical protein	NA	C7BGE4	Burkholderia_phage	43.0	6.4e-15
AVX14505.1|3712777_3713999_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	71.0	1.1e-110
AVX14506.1|3714388_3717040_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	34.0	5.2e-155
AVX14507.1|3717118_3717625_-	helicase C2	NA	NA	NA	NA	NA
AVX14508.1|3718605_3718875_-	hypothetical protein	NA	NA	NA	NA	NA
AVX15330.1|3718864_3720403_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
