The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028490	Pseudomonas syringae pv. atrofaciens strain LMG5095 chromosome, complete genome	6080544	665885	673628	6080544	tRNA	uncultured_Caudovirales_phage(71.43%)	9	NA	NA
AVX22475.1|665885_667166_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.8	4.1e-97
AVX22476.1|667166_668561_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
AVX22477.1|668611_669610_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
AVX22478.1|669706_670708_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	84.5	2.6e-163
AVX22479.1|670704_671040_-	sulfurtransferase TusE	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	78.4	1.2e-43
AVX22480.1|671036_671336_-	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	62.6	3.2e-29
AVX22481.1|671335_671698_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	6.6e-37
AVX26827.1|671699_672092_-	sulfurtransferase TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	82.3	6.3e-57
AVX22482.1|672326_673628_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.5	8.2e-61
>prophage 2
CP028490	Pseudomonas syringae pv. atrofaciens strain LMG5095 chromosome, complete genome	6080544	1113801	1144525	6080544	protease,tail,integrase,head,terminase,capsid,portal	Pseudomonas_phage(59.38%)	46	1116869:1116887	1136234:1136252
AVX22786.1|1113801_1114833_-|integrase	integrase	integrase	C8CLF4	Xylella_phage	52.0	3.4e-86
AVX22787.1|1114833_1115043_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AVX22788.1|1115152_1115365_+	hypothetical protein	NA	NA	NA	NA	NA
AVX22789.1|1115351_1116002_-	hypothetical protein	NA	A0A059VF56	Pseudomonas_phage	61.8	5.9e-68
AVX22790.1|1116180_1116393_+	hypothetical protein	NA	NA	NA	NA	NA
AVX22791.1|1116419_1117199_-	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	30.6	1.5e-14
1116869:1116887	attL	CAAACTTCGCACGTTCGAC	NA	NA	NA	NA
AVX22792.1|1117455_1117824_+	hypothetical protein	NA	NA	NA	NA	NA
AVX22793.1|1117816_1118182_+	hypothetical protein	NA	NA	NA	NA	NA
AVX22794.1|1119533_1120130_-	hypothetical protein	NA	NA	NA	NA	NA
AVX22795.1|1120199_1120454_-	hypothetical protein	NA	NA	NA	NA	NA
AVX22796.1|1120450_1121041_-	hypothetical protein	NA	NA	NA	NA	NA
AVX22797.1|1121040_1121379_-	hypothetical protein	NA	NA	NA	NA	NA
AVX22798.1|1121674_1121881_-	hypothetical protein	NA	A0A0U4IJ22	Pseudomonas_phage	55.9	1.1e-15
AVX22799.1|1121943_1122345_-	LuxR family transcriptional regulator	NA	A0A2H4JA92	uncultured_Caudovirales_phage	61.7	1.2e-18
AVX22800.1|1122676_1123024_-	hypothetical protein	NA	NA	NA	NA	NA
AVX22801.1|1123041_1123779_-	helix-turn-helix domain-containing protein	NA	A0A2H4J6J6	uncultured_Caudovirales_phage	40.5	1.5e-35
AVX22802.1|1123791_1124037_+	hypothetical protein	NA	NA	NA	NA	NA
AVX22803.1|1124202_1124976_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AVX22804.1|1124972_1125644_+	replication P family protein	NA	A0A1B0YZY6	Pseudomonas_phage	45.2	8.8e-43
AVX22805.1|1125640_1125937_+	DUF1364 domain-containing protein	NA	A0A2D1GNQ4	Pseudomonas_phage	82.3	2.3e-40
AVX22806.1|1125933_1126365_+	VRR-NUC domain-containing protein	NA	A0A2D1GNH3	Pseudomonas_phage	74.1	7.1e-54
AVX22807.1|1126361_1127642_+|integrase	integrase	integrase	A0A2D1GND4	Pseudomonas_phage	86.6	1.7e-220
AVX26847.1|1127660_1127981_+	hypothetical protein	NA	A0A2D1GNG3	Pseudomonas_phage	63.2	7.4e-32
AVX22808.1|1127983_1128325_+	antitermination protein Q	NA	A0A2D1GNB4	Pseudomonas_phage	82.6	6.7e-47
AVX22809.1|1128361_1129150_+	hypothetical protein	NA	NA	NA	NA	NA
AVX22810.1|1129680_1130052_+	chemotaxis protein	NA	A0A059VK40	Pseudomonas_phage	87.0	2.2e-43
AVX22811.1|1130051_1130390_+	hypothetical protein	NA	A0A059VJW1	Pseudomonas_phage	74.1	3.1e-28
AVX22812.1|1130437_1130722_+	hypothetical protein	NA	NA	NA	NA	NA
AVX22813.1|1130725_1131064_+	HNH endonuclease	NA	C4ML58	Xanthomonas_virus	49.1	7.3e-22
AVX22814.1|1131203_1131677_+|terminase	terminase	terminase	Q3HQS6	Burkholderia_phage	51.5	4.6e-22
AVX22815.1|1131673_1133362_+|terminase	terminase large subunit	terminase	A0A2H4JDK9	uncultured_Caudovirales_phage	82.9	2.2e-252
AVX22816.1|1133364_1134579_+|portal	phage portal protein	portal	A0A2H4JFN7	uncultured_Caudovirales_phage	76.0	1.3e-177
AVX22817.1|1134565_1135207_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JA51	uncultured_Caudovirales_phage	76.1	6.2e-86
AVX22818.1|1135203_1136409_+|capsid	phage major capsid protein	capsid	A0A2H4J8D1	uncultured_Caudovirales_phage	61.7	2.2e-132
1136234:1136252	attR	CAAACTTCGCACGTTCGAC	NA	NA	NA	NA
AVX22819.1|1136468_1136672_+	hypothetical protein	NA	A0A2H4JG33	uncultured_Caudovirales_phage	53.1	6.6e-10
AVX22820.1|1136672_1136972_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J8C5	uncultured_Caudovirales_phage	80.8	1.0e-38
AVX22821.1|1136971_1137292_+|head,tail	head-tail adaptor protein	head,tail	A0A2D1GNG1	Pseudomonas_phage	64.6	9.1e-30
AVX22822.1|1137469_1137970_+	hypothetical protein	NA	A0A2D1GNN2	Pseudomonas_phage	70.3	9.1e-61
AVX22823.1|1137962_1138349_+	DUF3168 domain-containing protein	NA	A0A2D1GNT4	Pseudomonas_phage	84.4	2.0e-55
AVX22824.1|1138403_1138901_+	hypothetical protein	NA	A0A2D1GNF2	Pseudomonas_phage	80.0	6.7e-72
AVX22825.1|1138912_1139248_+	hypothetical protein	NA	A0A2D1GNT5	Pseudomonas_phage	56.6	5.8e-27
AVX22826.1|1139280_1139490_+	hypothetical protein	NA	A0A2D1GNK2	Pseudomonas_phage	63.3	1.3e-08
AVX22827.1|1139511_1142916_+|tail	phage tail tape measure protein	tail	A0A223LIN6	Pseudoalteromonas_phage	49.8	4.2e-48
AVX22828.1|1142937_1143522_+	hypothetical protein	NA	A0A059VJR9	Pseudomonas_phage	59.3	9.0e-60
AVX22829.1|1143521_1144124_+	hypothetical protein	NA	A0A059VA31	Pseudomonas_phage	96.0	4.4e-110
AVX22830.1|1144126_1144525_+	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	96.2	4.1e-72
>prophage 3
CP028490	Pseudomonas syringae pv. atrofaciens strain LMG5095 chromosome, complete genome	6080544	1149769	1156359	6080544		Pseudomonas_phage(71.43%)	9	NA	NA
AVX22832.1|1149769_1150450_+	hypothetical protein	NA	A0A2D1GNS6	Pseudomonas_phage	37.9	2.1e-36
AVX22833.1|1150485_1150716_+	hypothetical protein	NA	NA	NA	NA	NA
AVX22834.1|1150775_1151309_+	chitinase	NA	A0A059VA40	Pseudomonas_phage	92.1	3.2e-88
AVX26848.1|1151341_1151836_+	DUF2514 domain-containing protein	NA	A0A059VF51	Pseudomonas_phage	84.0	4.6e-57
AVX22835.1|1151892_1152072_+	hypothetical protein	NA	A0A059VK06	Pseudomonas_phage	55.4	4.4e-10
AVX22836.1|1152068_1153313_+	SGNH/GDSL hydrolase family protein	NA	A0A059VA35	Pseudomonas_phage	85.7	2.8e-204
AVX22837.1|1153327_1153672_-	hypothetical protein	NA	NA	NA	NA	NA
AVX22838.1|1154110_1155181_-	DNA topoisomerase IB	NA	A0A0G2Y4T8	Acanthamoeba_polyphaga_mimivirus	33.7	7.5e-44
AVX22839.1|1155270_1156359_-	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.8	4.5e-20
>prophage 4
CP028490	Pseudomonas syringae pv. atrofaciens strain LMG5095 chromosome, complete genome	6080544	3539301	3550119	6080544	integrase,transposase	uncultured_Caudovirales_phage(44.44%)	13	3534508:3534522	3549545:3549559
3534508:3534522	attL	ACTGCGTCACGCCAA	NA	NA	NA	NA
AVX24667.1|3539301_3540264_-|integrase	integrase	integrase	A0A166YH27	Gordonia_phage	27.2	9.5e-06
AVX24668.1|3540558_3540909_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	58.4	3.3e-33
AVX24669.1|3540929_3542219_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.2	3.4e-168
AVX24670.1|3542228_3542699_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	64.7	7.8e-54
AVX24671.1|3542698_3543433_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	78.7	2.2e-103
AVX24672.1|3543515_3544478_-	arsenic resistance protein	NA	NA	NA	NA	NA
AVX24673.1|3544570_3545005_+	MerR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AVX24674.1|3545070_3545505_+	IS66 family insertion sequence hypothetical protein	NA	B6DZU5	Stx2-converting_phage	38.9	1.5e-14
AVX24675.1|3545501_3545846_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	66.4	4.8e-37
AVX24676.1|3545883_3547389_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	54.4	5.2e-144
AVX24677.1|3547392_3547773_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
AVX26949.1|3547785_3548424_-	organomercurial lyase MerB	NA	NA	NA	NA	NA
AVX24678.1|3548436_3550119_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.1e-37
3549545:3549559	attR	TTGGCGTGACGCAGT	NA	NA	NA	NA
>prophage 5
CP028490	Pseudomonas syringae pv. atrofaciens strain LMG5095 chromosome, complete genome	6080544	4872262	4933294	6080544	protease,transposase,tRNA,holin	Bacteriophage(18.75%)	55	NA	NA
AVX25788.1|4872262_4873588_-|protease	Zn-dependent protease	protease	NA	NA	NA	NA
AVX25789.1|4873587_4875030_-	TldD/PmbA family protein	NA	NA	NA	NA	NA
AVX25790.1|4875153_4876194_-	low specificity L-threonine aldolase	NA	NA	NA	NA	NA
AVX25791.1|4876293_4877040_+	conjugal transfer protein TraX	NA	NA	NA	NA	NA
AVX25792.1|4877244_4878441_-	class I SAM-dependent rRNA methyltransferase	NA	NA	NA	NA	NA
AVX25793.1|4878526_4879066_-	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	34.9	7.9e-18
AVX25794.1|4879251_4880118_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
AVX25795.1|4880163_4880976_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.8	9.1e-18
AVX25796.1|4881073_4881412_+	multidrug transporter	NA	NA	NA	NA	NA
AVX25797.1|4881421_4881673_-	4Fe-4S ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	61.4	1.2e-21
AVX25798.1|4881771_4882251_-	phosphopantetheine adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.0	4.4e-28
AVX25799.1|4882618_4883281_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AVX25800.1|4883335_4884193_+	sulfurtransferase	NA	NA	NA	NA	NA
AVX26997.1|4884207_4885242_-	hydrolase	NA	NA	NA	NA	NA
AVX25801.1|4885509_4886100_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
AVX25802.1|4886099_4887590_-	insulinase family protein	NA	NA	NA	NA	NA
AVX25803.1|4887586_4888939_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	25.5	1.0e-21
AVX25804.1|4889195_4890680_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
AVX25805.1|4890676_4891348_+	cell division ATP-binding protein FtsE	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.8	3.0e-14
AVX25806.1|4891344_4892379_+	ABC transporter permease	NA	NA	NA	NA	NA
AVX25807.1|4892497_4893352_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	38.5	3.6e-41
AVX25808.1|4893465_4894413_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AVX26998.1|4895133_4895844_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AVX25809.1|4895924_4896305_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
AVX25810.1|4896419_4896620_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
AVX25811.1|4896671_4897466_+	thiazole synthase	NA	NA	NA	NA	NA
AVX25812.1|4897476_4898211_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AVX25813.1|4898252_4899311_-|holin	phosphorylcholine phosphatase	holin	NA	NA	NA	NA
AVX25814.1|4899501_4900014_-	dihydrofolate reductase	NA	F8SJN4	Pseudomonas_phage	39.2	1.0e-27
AVX25815.1|4900123_4901503_+	DUF2868 domain-containing protein	NA	NA	NA	NA	NA
AVX25816.1|4901495_4902884_+	DUF3482 domain-containing protein	NA	A0A0R6PHS5	Moraxella_phage	40.5	1.0e-53
AVX25817.1|4903208_4903802_+	transcriptional regulator	NA	NA	NA	NA	NA
AVX25818.1|4903903_4905376_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AVX25819.1|4905387_4905489_+	hypothetical protein	NA	NA	NA	NA	NA
AVX25820.1|4905516_4907223_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	30.0	9.4e-49
AVX25821.1|4907506_4908025_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AVX25822.1|4908021_4909005_+	FecR family protein	NA	NA	NA	NA	NA
AVX25823.1|4909126_4910260_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
AVX25824.1|4910256_4910439_+	hypothetical protein	NA	NA	NA	NA	NA
AVX25825.1|4910508_4911138_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
AVX25826.1|4911242_4911746_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
AVX25827.1|4911939_4912833_+	acyltransferase	NA	NA	NA	NA	NA
AVX25828.1|4912883_4913951_+	RHS repeat-associated core domain-containing protein	NA	A0A1W5K0N1	Bacteriophage	42.9	2.3e-29
AVX25829.1|4913930_4914494_-	hypothetical protein	NA	NA	NA	NA	NA
AVX25830.1|4914674_4920491_+	hypothetical protein	NA	NA	NA	NA	NA
AVX25831.1|4920581_4921559_+	RHS repeat-associated core domain-containing protein	NA	A0A1W5K0N1	Bacteriophage	41.2	4.0e-28
AVX25832.1|4921843_4922857_+	RHS repeat-associated core domain-containing protein	NA	A0A1W5K0N1	Bacteriophage	42.4	2.3e-26
AVX25833.1|4922922_4924122_-	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	27.7	2.2e-12
AVX25834.1|4924171_4925029_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
AVX25835.1|4925321_4925954_-	sarcosine oxidase subunit gamma family protein	NA	NA	NA	NA	NA
AVX25836.1|4926004_4929025_-	sarcosine oxidase subunit alpha	NA	NA	NA	NA	NA
AVX25837.1|4929021_4929318_-	sarcosine oxidase subunit delta family protein	NA	NA	NA	NA	NA
AVX25838.1|4929333_4930584_-	sarcosine oxidase subunit beta family protein	NA	NA	NA	NA	NA
AVX25839.1|4930601_4931855_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.5	3.5e-101
AVX25840.1|4932115_4933294_-|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	36.4	2.2e-25
>prophage 6
CP028490	Pseudomonas syringae pv. atrofaciens strain LMG5095 chromosome, complete genome	6080544	4999101	5083024	6080544	plate,tail,integrase,lysis,transposase,tRNA,bacteriocin	Pseudomonas_phage(41.67%)	88	4994408:4994439	5007643:5007674
4994408:4994439	attL	GGACTCGAACCGTGGACCAAAGGATTATGAGT	NA	NA	NA	NA
AVX25897.1|4999101_5000064_-|integrase	integrase	integrase	A0A142F1N9	Bacillus_phage	24.4	4.9e-10
AVX25898.1|5000400_5000649_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AVX25899.1|5000661_5001012_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AVX25900.1|5001374_5001596_-	hypothetical protein	NA	NA	NA	NA	NA
AVX25901.1|5001663_5003049_-	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
AVX25902.1|5003252_5004008_-	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
AVX25903.1|5004050_5004425_-	conjugal transfer protein TrbJ	NA	NA	NA	NA	NA
AVX25904.1|5004703_5004994_-	conjugal transfer protein TraK	NA	NA	NA	NA	NA
AVX27002.1|5005060_5005786_-	phage replication protein	NA	NA	NA	NA	NA
AVX25905.1|5005907_5006126_-	plasmid-related protein	NA	NA	NA	NA	NA
AVX25906.1|5006427_5007642_-|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	37.5	1.1e-48
AVX25907.1|5007720_5010207_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.0	5.8e-15
5007643:5007674	attR	GGACTCGAACCGTGGACCAAAGGATTATGAGT	NA	NA	NA	NA
AVX25908.1|5010476_5012327_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	34.7	2.0e-36
AVX25909.1|5012394_5014350_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.0	1.8e-72
AVX25910.1|5014829_5015045_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AVX25911.1|5015243_5016269_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	56.1	2.1e-104
AVX25912.1|5016292_5016871_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
AVX25913.1|5016936_5017290_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AVX25914.1|5017280_5017805_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AVX25915.1|5017924_5019154_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	47.1	7.9e-82
AVX25916.1|5019251_5020814_-	SpoVR family protein	NA	NA	NA	NA	NA
AVX25917.1|5020810_5022082_-	hypothetical protein	NA	A0A140HLI1	Bacillus_phage	40.4	4.9e-10
AVX25918.1|5022203_5024126_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
AVX25919.1|5024410_5024731_-	thiosulfate sulfurtransferase	NA	NA	NA	NA	NA
AVX25920.1|5024754_5025630_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A291L9W7	Bordetella_phage	43.8	1.0e-06
AVX27003.1|5025629_5026010_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
AVX25921.1|5026126_5026933_-	ribosomal RNA small subunit methyltransferase A	NA	NA	NA	NA	NA
AVX25922.1|5026929_5027919_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
AVX27004.1|5027915_5029202_-	molecular chaperone SurA	NA	NA	NA	NA	NA
AVX25923.1|5029218_5031999_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
AVX25924.1|5032128_5033151_+	aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
AVX25925.1|5033202_5033925_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
AVX25926.1|5033925_5034696_+	molecular chaperone DjlA	NA	NA	NA	NA	NA
AVX25927.1|5034704_5035709_-	DUF3530 domain-containing protein	NA	NA	NA	NA	NA
AVX25928.1|5035823_5037827_+	PAS domain S-box protein	NA	NA	NA	NA	NA
AVX25929.1|5037823_5038453_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AVX25930.1|5038559_5039935_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	54.7	3.7e-80
AVX25931.1|5040292_5041417_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	31.4	2.3e-27
AVX25932.1|5041499_5042522_+	spermidine/putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVX25933.1|5042611_5043859_+	ABC transporter permease	NA	NA	NA	NA	NA
AVX25934.1|5043870_5044692_+	ABC transporter permease	NA	NA	NA	NA	NA
AVX25935.1|5044951_5045626_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
AVX25936.1|5045622_5046441_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
AVX25937.1|5046511_5047993_+	anthranilate synthase component I	NA	NA	NA	NA	NA
AVX25938.1|5048080_5048200_+	hypothetical protein	NA	NA	NA	NA	NA
AVX25939.1|5048196_5050119_-	autotransporter domain-containing esterase	NA	NA	NA	NA	NA
AVX25940.1|5050224_5050491_-	transcriptional regulator	NA	A0A2H4J8B4	uncultured_Caudovirales_phage	51.2	2.1e-16
AVX25941.1|5050588_5050837_-	DUF1654 domain-containing protein	NA	NA	NA	NA	NA
AVX27005.1|5050990_5051680_-	LexA family transcriptional repressor	NA	Q8HAG7	Salmonella_phage	47.9	1.4e-51
AVX25942.1|5051791_5052235_+	hypothetical protein	NA	A0A2H4J8A5	uncultured_Caudovirales_phage	45.8	3.5e-24
AVX25943.1|5052702_5053533_+|bacteriocin	lipid II-degrading bacteriocin	bacteriocin	NA	NA	NA	NA
AVX25944.1|5054192_5054582_+	chemotaxis protein	NA	A0A059VK40	Pseudomonas_phage	76.4	2.3e-43
AVX25945.1|5054562_5054901_+	hypothetical protein	NA	A0A059VJW1	Pseudomonas_phage	57.9	2.0e-19
AVX25946.1|5054947_5055538_+	hypothetical protein	NA	B5TK65	Pseudomonas_phage	52.0	1.1e-52
AVX25947.1|5055534_5055723_+	DUF2635 domain-containing protein	NA	B5TK66	Pseudomonas_phage	74.5	1.2e-13
AVX25948.1|5055741_5057238_+|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	80.7	2.2e-235
AVX25949.1|5057298_5057646_+|tail	phage tail protein	tail	B5TK68	Pseudomonas_phage	70.4	8.6e-42
AVX25950.1|5057642_5057939_+|tail	phage tail assembly protein	tail	B5TK69	Pseudomonas_phage	76.0	5.6e-34
AVX25951.1|5057863_5058070_+	hypothetical protein	NA	NA	NA	NA	NA
AVX25952.1|5058069_5060229_+|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	40.7	1.2e-72
AVX25953.1|5060225_5061650_+	hydroxyacid dehydrogenase	NA	B5TK71	Pseudomonas_phage	45.6	5.2e-109
AVX25954.1|5061653_5062781_+|plate	baseplate protein	plate	B5TK72	Pseudomonas_phage	60.2	1.6e-113
AVX25955.1|5062777_5063290_+|plate	phage baseplate assembly protein V	plate	B5TK73	Pseudomonas_phage	73.8	1.4e-64
AVX25956.1|5063286_5063685_+	hypothetical protein	NA	B5TK74	Pseudomonas_phage	62.9	3.4e-42
AVX25957.1|5063674_5064715_+|plate	baseplate J protein	plate	B5TK75	Pseudomonas_phage	69.8	1.6e-131
AVX25958.1|5064702_5065302_+	DUF2313 domain-containing protein	NA	B5TK76	Pseudomonas_phage	71.9	1.9e-84
AVX25959.1|5065312_5066623_+|tail	phage tail protein	tail	Q6QI97	Burkholderia_phage	39.4	6.8e-47
AVX25960.1|5066834_5067380_+	lysozyme	NA	A0A2H4JHX4	uncultured_Caudovirales_phage	72.8	2.2e-68
AVX27006.1|5067391_5067889_+|lysis	lysis protein	lysis	B5TK84	Pseudomonas_phage	48.4	7.7e-28
AVX25961.1|5067922_5068141_+	hypothetical protein	NA	NA	NA	NA	NA
AVX25962.1|5068300_5068900_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	64.7	3.0e-74
AVX25963.1|5068920_5069970_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	58.0	5.3e-111
AVX25964.1|5069966_5070803_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	2.3e-69
AVX25965.1|5070837_5071533_+	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
AVX25966.1|5071544_5072189_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
AVX25967.1|5072391_5072814_+	OsmC family protein	NA	NA	NA	NA	NA
AVX25968.1|5073056_5073851_+	S-adenosylmethionine decarboxylase proenzyme	NA	NA	NA	NA	NA
AVX25969.1|5073920_5074568_-	demethoxyubiquinone hydroxylase family protein	NA	NA	NA	NA	NA
AVX25970.1|5074689_5075028_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
AVX25971.1|5075131_5075908_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AVX25972.1|5075964_5076879_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
AVX25973.1|5076977_5077406_-	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
AVX25974.1|5077539_5078574_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
AVX25975.1|5078673_5079024_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	7.4e-25
AVX25976.1|5079085_5080180_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
AVX25977.1|5080183_5081611_-	peptidase M23	NA	A8ATH6	Listeria_phage	44.7	4.2e-18
AVX27007.1|5081607_5081709_-	hypothetical protein	NA	NA	NA	NA	NA
AVX25978.1|5081812_5083024_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
