The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028487	Yersinia massiliensis strain GTA chromosome, complete genome	4986001	539689	584115	4986001	head,portal,integrase,plate,transposase,capsid,tail,tRNA,holin	Erwinia_phage(46.15%)	51	535085:535100	563326:563341
535085:535100	attL	GGGTATTTGTTGAGCC	NA	NA	NA	NA
AVX36626.1|539689_540700_-|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	91.5	6.1e-181
AVX36627.1|540699_541278_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	63.0	5.6e-62
AVX36628.1|541407_541683_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	82.4	2.8e-35
AVX36629.1|541703_542213_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	51.2	2.1e-44
AVX36630.1|542222_542408_+	hypothetical protein	NA	NA	NA	NA	NA
AVX36631.1|542419_542731_+	hypothetical protein	NA	NA	NA	NA	NA
AVX36632.1|542796_543045_+	hypothetical protein	NA	NA	NA	NA	NA
AVX36633.1|543031_545314_+	replication protein	NA	Q858T4	Yersinia_virus	57.2	1.7e-242
AVX40300.1|545333_545693_+	hypothetical protein	NA	H9C172	Pectobacterium_phage	43.4	3.1e-18
AVX36634.1|545893_546112_+	hypothetical protein	NA	NA	NA	NA	NA
AVX36635.1|546402_546609_+	hypothetical protein	NA	NA	NA	NA	NA
AVX36636.1|546625_547477_+	hypothetical protein	NA	I6PD67	Cronobacter_phage	54.2	5.9e-76
AVX36637.1|547612_547801_+	hypothetical protein	NA	NA	NA	NA	NA
AVX36638.1|547862_548900_-|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	79.1	4.5e-163
AVX36639.1|548896_550669_-	oxidoreductase	NA	F1BUR2	Erwinia_phage	81.3	2.0e-288
AVX36640.1|550814_551669_+|capsid	phage capsid protein	capsid	Q01088	Escherichia_phage	62.5	6.9e-93
AVX36641.1|551745_552981_+|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	74.4	1.9e-152
AVX36642.1|552984_553644_+	hypothetical protein	NA	F1BUQ7	Erwinia_phage	71.7	8.6e-83
AVX36643.1|553743_554217_+|head	head completion/stabilization protein	head	M1SNN6	Escherichia_phage	56.1	4.9e-40
AVX36644.1|554216_554420_+|tail	phage tail protein	tail	A0A218M4L8	Erwinia_phage	65.7	5.4e-20
AVX36645.1|554422_554632_+	hypothetical protein	NA	NA	NA	NA	NA
AVX36646.1|554615_555122_+	glycoside hydrolase	NA	A0A218M4K3	Erwinia_phage	63.1	8.9e-56
AVX36647.1|555123_555528_+	LysB family transcriptional regulator	NA	F1BUQ1	Erwinia_phage	50.4	1.5e-26
AVX36648.1|555499_555697_+|holin	holin	holin	F1BUQ0	Erwinia_phage	54.8	5.2e-12
AVX36649.1|555635_556091_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	62.7	1.8e-47
AVX36650.1|556087_556552_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	66.0	4.5e-46
AVX36651.1|556638_557262_+	protein cII	NA	NA	NA	NA	NA
AVX40301.1|557247_558279_-	beta family protein	NA	NA	NA	NA	NA
AVX36652.1|558284_558827_-	ImmA/IrrE family metallo-endopeptidase	NA	Q854W5	Mycobacterium_virus	34.2	6.1e-10
AVX36653.1|558827_559571_-	hydrolase	NA	NA	NA	NA	NA
AVX36654.1|559725_560367_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	64.5	2.5e-71
AVX36655.1|560363_560714_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	66.4	2.0e-38
AVX36656.1|560718_561627_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	79.8	1.9e-125
AVX36657.1|561619_562228_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	79.1	6.7e-90
AVX36658.1|562224_563394_+|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	65.5	5.0e-102
563326:563341	attR	GGCTCAACAAATACCC	NA	NA	NA	NA
AVX36659.1|563396_563876_+|tail	phage tail protein	tail	F1BUP0	Erwinia_phage	46.2	1.8e-37
AVX36660.1|564504_567510_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.3	0.0e+00
AVX36661.1|567686_568253_+	resolvase/recombinase	NA	Q1MVP4	Enterobacteria_phage	72.8	4.3e-67
AVX36662.1|568252_570019_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AVX40302.1|570024_571917_+	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	25.9	4.8e-46
AVX36663.1|572771_573287_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	73.7	1.0e-67
AVX36664.1|573340_573652_+	hypothetical protein	NA	F1BUU0	Erwinia_phage	62.5	1.6e-23
AVX36665.1|573684_573807_+|tail	GpE family phage tail protein	tail	Q858U8	Yersinia_virus	71.1	2.0e-09
AVX36666.1|573799_576232_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	45.2	2.8e-147
AVX36667.1|576234_576720_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	59.9	6.3e-51
AVX36668.1|576716_577880_+	hypothetical protein	NA	A0A0M5M5V5	Salmonella_phage	67.2	7.9e-148
AVX36669.1|577986_578205_+	transcriptional regulator	NA	Q37973	Salmonella_virus	70.8	1.6e-25
AVX36670.1|578633_580472_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.9e-34
AVX36671.1|580629_582378_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.0e-74
AVX36672.1|582513_582729_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AVX36673.1|583101_584115_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.7	1.1e-105
>prophage 2
CP028487	Yersinia massiliensis strain GTA chromosome, complete genome	4986001	1887475	1899244	4986001		Herpes_simplex_virus(16.67%)	7	NA	NA
AVX37723.1|1887475_1890622_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	63.2	0.0e+00
AVX37724.1|1890770_1891796_-	lac repressor	NA	C6ZCU4	Enterobacteria_phage	52.1	7.5e-86
AVX37725.1|1892287_1892500_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	80.0	2.0e-25
AVX37726.1|1892833_1893025_+	protein DsrB	NA	NA	NA	NA	NA
AVX37727.1|1893173_1894913_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	51.2	4.7e-11
AVX37728.1|1895657_1896368_+	hypothetical protein	NA	G3MA03	Bacillus_virus	42.5	3.7e-15
AVX37729.1|1896547_1899244_+	magnesium-translocating P-type ATPase	NA	M1HM40	Paramecium_bursaria_Chlorella_virus	25.6	1.2e-42
>prophage 3
CP028487	Yersinia massiliensis strain GTA chromosome, complete genome	4986001	1944247	1992738	4986001	head,tail,holin,protease	Salmonella_phage(28.0%)	73	NA	NA
AVX37775.1|1944247_1945537_-	hypothetical protein	NA	Q6HA01	Enterobacteria_phage	55.0	2.2e-138
AVX37776.1|1945570_1945831_-	excisionase	NA	S4TND0	Salmonella_phage	65.8	9.9e-27
AVX37777.1|1945823_1946057_-	hypothetical protein	NA	A0A2H4J398	uncultured_Caudovirales_phage	68.1	7.8e-23
AVX37778.1|1946041_1946287_-	hypothetical protein	NA	NA	NA	NA	NA
AVX37779.1|1946396_1946939_-	phage N-6-adenine-methyltransferase	NA	G9L688	Escherichia_phage	68.3	5.8e-61
AVX37780.1|1946935_1947646_-	Dcm methylase	NA	A0A2I7R4M7	Vibrio_phage	60.4	1.5e-77
AVX37781.1|1947642_1947846_-	hypothetical protein	NA	NA	NA	NA	NA
AVX37782.1|1948687_1948960_-	hypothetical protein	NA	NA	NA	NA	NA
AVX37783.1|1948984_1949242_-	hypothetical protein	NA	A0A220NQU8	Salmonella_phage	41.3	1.4e-09
AVX37784.1|1949241_1949661_-	hypothetical protein	NA	A0A0M4R4E6	Citrobacter_phage	50.0	6.5e-12
AVX37785.1|1949660_1950116_-	hypothetical protein	NA	NA	NA	NA	NA
AVX37786.1|1950633_1951095_-	ssDNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	84.0	3.8e-53
AVX37787.1|1951091_1951955_-	hypothetical protein	NA	Q94MN8	Myxococcus_phage	44.9	2.4e-48
AVX37788.1|1952138_1952318_-	protein kil	NA	NA	NA	NA	NA
AVX37789.1|1952314_1952446_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	NA	NA	NA	NA
AVX37790.1|1952463_1953513_-	hypothetical protein	NA	A0A088CQ16	Enterobacteria_phage	41.3	1.9e-12
AVX37791.1|1953596_1953803_-	hypothetical protein	NA	NA	NA	NA	NA
AVX37792.1|1954147_1954318_+	ATP-NAD kinase	NA	NA	NA	NA	NA
AVX37793.1|1954527_1954875_-	hypothetical protein	NA	A0A0K2FII1	Escherichia_phage	35.8	1.7e-05
AVX37794.1|1955516_1955723_+	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	59.7	8.4e-13
AVX37795.1|1955882_1956689_-	hypothetical protein	NA	NA	NA	NA	NA
AVX37796.1|1956685_1957531_-	hypothetical protein	NA	NA	NA	NA	NA
AVX37797.1|1957615_1958329_-	XRE family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	44.4	6.7e-49
AVX37798.1|1958433_1958673_+	transcriptional regulator	NA	NA	NA	NA	NA
AVX37799.1|1958781_1959072_+	hypothetical protein	NA	I6RSP4	Salmonella_phage	59.4	6.3e-22
AVX37800.1|1959238_1960123_+	DNA replication protein	NA	Q8VNP8	Enterobacteria_phage	53.5	7.7e-79
AVX37801.1|1960112_1961519_+	helicase DnaB	NA	Q9MCT4	Escherichia_phage	59.4	5.9e-158
AVX37802.1|1961518_1961701_+	hypothetical protein	NA	NA	NA	NA	NA
AVX37803.1|1961697_1962003_+	hypothetical protein	NA	NA	NA	NA	NA
AVX37804.1|1961999_1962347_+	hypothetical protein	NA	NA	NA	NA	NA
AVX37805.1|1962304_1963039_+	hypothetical protein	NA	NA	NA	NA	NA
AVX37806.1|1963035_1963275_+	DUF4752 domain-containing protein	NA	T1S9K2	Salmonella_phage	60.0	7.0e-19
AVX37807.1|1963277_1963715_+	recombination protein NinB	NA	E5AGF7	Erwinia_phage	84.1	3.9e-68
AVX37808.1|1963711_1963918_+	hypothetical protein	NA	A0A2H4P784	Pseudomonas_phage	47.6	8.2e-08
AVX40393.1|1963877_1964045_+	NinE family protein	NA	NA	NA	NA	NA
AVX37809.1|1964041_1964557_+	hypothetical protein	NA	A0A0H4IQ56	Shigella_phage	72.8	7.9e-68
AVX37810.1|1964658_1965267_+	protein NinG	NA	K7PHP1	Enterobacterial_phage	54.8	1.3e-53
AVX37811.1|1965263_1966394_+	hypothetical protein	NA	A0A1W6DY33	Salmonella_phage	40.5	5.7e-26
AVX37812.1|1966834_1967062_-	hypothetical protein	NA	NA	NA	NA	NA
AVX37813.1|1967181_1967382_+|holin	holin	holin	A0A1V0E5H9	Salmonella_phage	60.3	7.9e-16
AVX37814.1|1967359_1967842_+	lysozyme	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	64.2	1.5e-55
AVX37815.1|1968037_1968364_+	hypothetical protein	NA	B6SD04	Bacteriophage	55.1	5.1e-20
AVX37816.1|1968633_1969320_+	hypothetical protein	NA	A0A192Y918	Salmonella_phage	85.1	3.2e-109
AVX37817.1|1969511_1969838_+	hypothetical protein	NA	NA	NA	NA	NA
AVX37818.1|1970003_1970639_+	hypothetical protein	NA	H9C189	Pectobacterium_phage	71.1	3.6e-86
AVX37819.1|1970672_1971152_+	DUF2280 domain-containing protein	NA	F1C5D6	Cronobacter_phage	74.2	6.7e-61
AVX37820.1|1971138_1972617_+	DNA-packaging protein	NA	G0ZND4	Cronobacter_phage	88.2	1.1e-260
AVX37821.1|1972772_1974149_+	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	72.0	4.6e-179
AVX37822.1|1974102_1975026_+|head	phage head morphogenesis protein	head	Q5G8Y3	Enterobacteria_phage	63.3	2.3e-102
AVX37823.1|1975029_1976307_+	hypothetical protein	NA	G0ZND7	Cronobacter_phage	78.8	1.8e-190
AVX37824.1|1976306_1976747_+	hypothetical protein	NA	A0A125RNM2	Pseudomonas_phage	63.4	1.6e-40
AVX37825.1|1976757_1977855_+	hypothetical protein	NA	A0A125RNM3	Pseudomonas_phage	65.8	2.2e-136
AVX37826.1|1977864_1978059_+	glycoprotein	NA	Q5G8X9	Enterobacteria_phage	68.8	3.4e-16
AVX37827.1|1978122_1978521_+	hypothetical protein	NA	G0ZNE1	Cronobacter_phage	80.6	2.4e-56
AVX37828.1|1978522_1978807_+	hypothetical protein	NA	NA	NA	NA	NA
AVX37829.1|1978803_1979154_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	54.3	2.7e-27
AVX37830.1|1979155_1979524_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	69.7	3.7e-43
AVX37831.1|1979520_1979904_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	66.9	2.4e-45
AVX37832.1|1979928_1980678_+	DNA breaking-rejoining protein	NA	G0ZNE6	Cronobacter_phage	46.0	3.5e-48
AVX37833.1|1980752_1981358_-	hypothetical protein	NA	M9NZJ1	Enterobacteria_phage	47.2	4.8e-48
AVX37834.1|1981379_1981577_+	hypothetical protein	NA	NA	NA	NA	NA
AVX40394.1|1981691_1982030_+	hypothetical protein	NA	A0A222YZ97	Escherichia_phage	59.6	2.6e-27
AVX37835.1|1982111_1982804_+	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	49.5	3.7e-52
AVX37836.1|1982793_1985367_+|tail	phage tail tape measure protein	tail	I6S1R4	Salmonella_phage	36.5	3.8e-86
AVX37837.1|1985415_1985634_+	hypothetical protein	NA	NA	NA	NA	NA
AVX37838.1|1985695_1986046_+|tail	phage tail protein	tail	A0A1V0E5N3	Salmonella_phage	75.0	2.8e-48
AVX37839.1|1986072_1986270_+	hypothetical protein	NA	NA	NA	NA	NA
AVX37840.1|1986266_1986491_-	hypothetical protein	NA	NA	NA	NA	NA
AVX37841.1|1986663_1987368_+|tail	phage minor tail protein L	tail	A0A1V0E5N2	Salmonella_phage	79.9	2.0e-109
AVX37842.1|1987367_1988093_+|tail	phage tail protein	tail	Q5G8W2	Enterobacteria_phage	67.9	1.6e-98
AVX37843.1|1988035_1988563_+|tail	tail assembly protein	tail	H6WRW3	Salmonella_phage	58.0	9.7e-45
AVX37844.1|1988572_1991740_+	hypothetical protein	NA	I6R9B3	Salmonella_phage	66.3	0.0e+00
AVX37845.1|1991739_1992738_+	hypothetical protein	NA	I6PBN9	Cronobacter_phage	29.8	5.4e-20
>prophage 4
CP028487	Yersinia massiliensis strain GTA chromosome, complete genome	4986001	2043142	2075832	4986001	head,terminase,portal,protease,integrase,capsid,tail,holin	Enterobacteria_phage(25.81%)	40	2042986:2043045	2082550:2082670
2042986:2043045	attL	TTTAAAATCCCTCGGCTTATGGCTGTGCGGGTTCAAGTCCCGCCCCGGGCACCATGGAAA	NA	NA	NA	NA
AVX37886.1|2043142_2044165_-|integrase	integrase	integrase	K7PLZ2	Enterobacterial_phage	69.9	5.0e-138
AVX37887.1|2044164_2044392_-	DUF4224 domain-containing protein	NA	K7PHA0	Enterobacterial_phage	44.4	3.8e-14
AVX37888.1|2044669_2045200_-	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	57.2	5.5e-48
AVX37889.1|2045657_2046125_+	hypothetical protein	NA	NA	NA	NA	NA
AVX37890.1|2046480_2047113_-	LexA family transcriptional repressor	NA	K7PM82	Enterobacteria_phage	47.8	2.2e-43
AVX37891.1|2047212_2047413_+	cell division protein	NA	NA	NA	NA	NA
AVX37892.1|2047450_2047978_+	DNA-binding protein	NA	Q8SBF4	Shigella_phage	27.7	1.6e-10
AVX37893.1|2048143_2048341_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AVX37894.1|2048337_2049351_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	77.2	7.3e-33
AVX37895.1|2049347_2050910_+	phage N-6-adenine-methyltransferase	NA	A0A2H4J5Y9	uncultured_Caudovirales_phage	54.9	8.2e-100
AVX40400.1|2050933_2051578_+	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	52.0	1.4e-53
AVX37896.1|2051574_2052576_+	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	50.3	4.8e-93
AVX37897.1|2052466_2053264_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	37.1	1.3e-32
AVX40401.1|2054277_2054547_+|holin	holin	holin	NA	NA	NA	NA
AVX37898.1|2054550_2055177_+	endolysin	NA	K7PJS7	Enterobacterial_phage	63.7	5.3e-66
AVX37899.1|2055173_2055506_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
AVX37900.1|2055459_2055711_+	hypothetical protein	NA	NA	NA	NA	NA
AVX37901.1|2055791_2056016_+	hypothetical protein	NA	NA	NA	NA	NA
AVX37902.1|2056109_2056340_+	hypothetical protein	NA	NA	NA	NA	NA
AVX37903.1|2056342_2056693_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	71.3	7.6e-46
AVX37904.1|2056842_2057340_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	81.2	2.2e-70
AVX37905.1|2057339_2059088_+|terminase	terminase	terminase	K7PKT2	Enterobacteria_phage	86.3	1.3e-298
AVX37906.1|2059101_2059290_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	55.8	1.6e-10
AVX37907.1|2059289_2060513_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	77.1	2.2e-180
AVX37908.1|2060502_2061153_+|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	80.6	2.0e-100
AVX37909.1|2061168_2062377_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	81.3	6.4e-185
AVX37910.1|2062776_2063103_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	32.4	3.4e-08
AVX37911.1|2063099_2063438_+|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	61.3	2.3e-31
AVX37912.1|2063434_2063851_+	hypothetical protein	NA	A0A1P8DTH7	Proteus_phage	52.8	5.3e-30
AVX37913.1|2063847_2064195_+	hypothetical protein	NA	K7P7Q9	Enterobacteria_phage	51.3	2.5e-25
AVX37914.1|2064251_2064962_+|tail	phage tail protein	tail	A0A1W6JP06	Morganella_phage	67.8	7.6e-45
AVX37915.1|2064964_2065354_+|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	52.8	2.5e-26
AVX40402.1|2065377_2065650_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	62.7	4.7e-19
AVX37916.1|2065682_2069078_+|tail	tail length tape measure protein	tail	A0A1P8DTH2	Proteus_phage	30.0	1.4e-99
AVX37917.1|2069074_2069428_+|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	51.3	3.6e-27
AVX37918.1|2069436_2070189_+|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	54.6	4.2e-78
AVX37919.1|2070191_2070905_+	peptidase P60	NA	A0A1W6JP31	Morganella_phage	58.2	1.4e-78
AVX37920.1|2070960_2071503_+	hypothetical protein	NA	NA	NA	NA	NA
AVX37921.1|2071557_2072148_+|tail	phage tail protein	tail	A0A1W6JNY8	Morganella_phage	57.3	1.6e-51
AVX37922.1|2072205_2075832_+	host specificity protein	NA	F1C571	Cronobacter_phage	54.5	0.0e+00
2082550:2082670	attR	TTTAAAATCCCTCGGCTTATGGCTGTGCGGGTTCAAGTCCCGCCCCGGGCACCATGGAAAATATTCTAAGTAAAACAAAGTAGTATGAGTATGTCGTTAACCGCCGAGAGGCGGTTTTTTT	NA	NA	NA	NA
>prophage 5
CP028487	Yersinia massiliensis strain GTA chromosome, complete genome	4986001	2811863	2852490	4986001	head,terminase,portal,integrase,plate,capsid,tail,tRNA,holin	Klebsiella_phage(20.0%)	60	2807582:2807596	2848614:2848628
2807582:2807596	attL	AGTTTTGCAGAAGGG	NA	NA	NA	NA
AVX38511.1|2811863_2812460_-|tail	phage tail protein	tail	A0A2P9JZK7	Alteromonadaceae_phage	36.2	1.8e-31
AVX38512.1|2812456_2813593_-|plate	phage baseplate protein	plate	A0A1B0Z1L7	Shewanella_phage	24.3	3.7e-09
AVX38513.1|2813596_2814034_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	43.1	2.0e-19
AVX38514.1|2814030_2814624_-|plate	baseplate assembly protein	plate	NA	NA	NA	NA
AVX38515.1|2814623_2815694_-|tail	phage tail protein	tail	M1PVV2	Vibrio_phage	30.9	1.8e-42
AVX38516.1|2815690_2817097_-	hypothetical protein	NA	A0A192Y5U9	Salmonella_phage	27.7	1.3e-24
AVX38517.1|2817153_2819001_-	lytic transglycosylase	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	42.3	1.3e-24
AVX38518.1|2819118_2819421_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AVX38519.1|2819422_2819797_-|tail	phage tail protein	tail	NA	NA	NA	NA
AVX38520.1|2819809_2821300_-|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	44.2	1.2e-103
AVX38521.1|2821299_2821491_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
AVX38522.1|2821496_2822042_-	ATP-binding protein	NA	NA	NA	NA	NA
AVX38523.1|2822038_2822383_-	hypothetical protein	NA	NA	NA	NA	NA
AVX38524.1|2822382_2822877_-	hypothetical protein	NA	NA	NA	NA	NA
AVX38525.1|2822878_2823925_-|capsid	capsid protein	capsid	Q6UYI3	Burkholderia_phage	31.3	2.4e-39
AVX38526.1|2824033_2824435_-|head	head decoration protein	head	A0A067ZIL6	Vibrio_phage	37.5	9.0e-11
AVX38527.1|2824434_2825019_-	DNA primase	NA	NA	NA	NA	NA
AVX38528.1|2825018_2825876_-	serine peptidase	NA	A0A2I6TC87	Escherichia_phage	38.8	5.0e-51
AVX38529.1|2825872_2827441_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	38.3	1.3e-97
AVX38530.1|2827509_2827773_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
AVX38531.1|2827781_2829890_-|terminase	terminase	terminase	A0A2K9V3X4	Faecalibacterium_phage	36.5	6.1e-98
AVX38532.1|2829831_2830398_-	hypothetical protein	NA	NA	NA	NA	NA
AVX38533.1|2830646_2831171_-	Fis family transcriptional regulator	NA	A0A1W6DY33	Salmonella_phage	50.9	4.0e-35
AVX38534.1|2831247_2831892_-	hypothetical protein	NA	NA	NA	NA	NA
AVX38535.1|2832038_2832308_+	hypothetical protein	NA	NA	NA	NA	NA
AVX40445.1|2832473_2832974_-	hypothetical protein	NA	Q7Y3V2	Yersinia_phage	85.5	8.8e-72
AVX38536.1|2832991_2833387_-	peptidase M15	NA	E7C9S9	Salmonella_phage	61.8	2.7e-39
AVX38537.1|2833376_2833715_-|holin	phage holin, lambda family	holin	C6ZR64	Salmonella_phage	51.6	2.7e-16
AVX38538.1|2834384_2835149_-	antitermination protein	NA	A0A286N2Q2	Klebsiella_phage	48.1	1.1e-62
AVX38539.1|2835148_2836111_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	79.7	1.0e-153
AVX38540.1|2836107_2837730_-	helicase	NA	A0A286N2P9	Klebsiella_phage	80.2	4.9e-249
AVX38541.1|2838061_2838349_-	hypothetical protein	NA	A0A1B5FPB9	Escherichia_phage	68.2	3.1e-29
AVX38542.1|2838614_2839442_-	transporter	NA	Q8W644	Enterobacteria_phage	49.5	3.4e-68
AVX38543.1|2839491_2839704_-	transcriptional regulator	NA	Q716D6	Shigella_phage	60.0	7.1e-15
AVX38544.1|2839809_2840442_+	DNA-binding protein	NA	A0A1I9KG86	Aeromonas_phage	40.2	6.8e-37
AVX38545.1|2840645_2840864_+	hypothetical protein	NA	NA	NA	NA	NA
AVX38546.1|2840860_2841052_+	hypothetical protein	NA	NA	NA	NA	NA
AVX38547.1|2841048_2841333_+	hypothetical protein	NA	NA	NA	NA	NA
AVX38548.1|2841322_2841523_+	hypothetical protein	NA	NA	NA	NA	NA
AVX38549.1|2841515_2841722_+	hypothetical protein	NA	NA	NA	NA	NA
AVX38550.1|2841711_2841930_+	hypothetical protein	NA	NA	NA	NA	NA
AVX38551.1|2841926_2842310_+	hypothetical protein	NA	NA	NA	NA	NA
AVX38552.1|2842492_2842741_+	hypothetical protein	NA	NA	NA	NA	NA
AVX38553.1|2842827_2843175_+	hypothetical protein	NA	NA	NA	NA	NA
AVX38554.1|2843171_2843390_+	hypothetical protein	NA	A0A291LBA3	Klebsiella_phage	44.3	3.3e-07
AVX38555.1|2843393_2843969_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	59.9	1.9e-62
AVX38556.1|2843979_2844840_+	hypothetical protein	NA	F1C5A3	Cronobacter_phage	68.5	1.5e-116
AVX38557.1|2844839_2845430_+	hypothetical protein	NA	NA	NA	NA	NA
AVX38558.1|2845419_2845641_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	51.4	9.1e-13
AVX40446.1|2845643_2845982_+	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	49.5	4.9e-26
AVX38559.1|2845978_2846440_+	hypothetical protein	NA	NA	NA	NA	NA
AVX38560.1|2846432_2846669_+	hypothetical protein	NA	NA	NA	NA	NA
AVX38561.1|2846671_2846941_+	hypothetical protein	NA	NA	NA	NA	NA
AVX38562.1|2846918_2847251_+	hypothetical protein	NA	NA	NA	NA	NA
AVX38563.1|2847243_2847486_+	excisionase	NA	NA	NA	NA	NA
AVX38564.1|2847469_2848594_+|integrase	integrase	integrase	Q77Z04	Phage_21	57.8	2.9e-123
AVX38565.1|2848717_2849971_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	87.0	8.8e-20
2848614:2848628	attR	AGTTTTGCAGAAGGG	NA	NA	NA	NA
AVX38566.1|2850101_2850728_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AVX38567.1|2850720_2851167_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AVX38568.1|2851368_2852490_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 6
CP028487	Yersinia massiliensis strain GTA chromosome, complete genome	4986001	2963109	3021910	4986001	head,terminase,portal,protease,integrase,plate,capsid,tail,holin	Enterobacteria_phage(12.5%)	67	2961580:2961596	3009882:3009898
2961580:2961596	attL	CCACCATATCAATCTCA	NA	NA	NA	NA
AVX38661.1|2963109_2963352_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	71.4	5.1e-25
AVX38662.1|2963366_2963612_+	damage-inducible protein	NA	K7PM44	Enterobacteria_phage	53.8	4.4e-16
AVX38663.1|2963978_2967065_+	type V secretion protein A	NA	A0A2L1IV18	Escherichia_phage	42.7	6.6e-101
AVX38664.1|2967118_2967742_-|tail	phage tail protein	tail	A0A0M4RTP2	Salmonella_phage	45.1	1.5e-33
AVX38665.1|2967741_2969004_-	hypothetical protein	NA	Q9MCR6	Enterobacteria_phage	38.5	1.3e-34
AVX38666.1|2969054_2969651_-|tail	phage tail protein	tail	A0A2P9JZK7	Alteromonadaceae_phage	37.2	2.8e-32
AVX38667.1|2969647_2970784_-|plate	phage baseplate protein	plate	B6SBU6	Clostridium_virus	25.7	9.8e-10
AVX38668.1|2970787_2971225_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	48.2	2.6e-19
AVX38669.1|2971221_2971815_-|plate	baseplate assembly protein	plate	NA	NA	NA	NA
AVX38670.1|2971811_2972885_-|tail	phage tail protein	tail	M1PVV2	Vibrio_phage	30.9	1.6e-41
AVX38671.1|2972881_2974288_-	hypothetical protein	NA	A0A192Y5U9	Salmonella_phage	27.3	2.3e-24
AVX38672.1|2974345_2976148_-	lytic transglycosylase	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	51.7	4.5e-25
AVX38673.1|2976265_2976568_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AVX38674.1|2976569_2976944_-|tail	phage tail protein	tail	NA	NA	NA	NA
AVX38675.1|2976956_2978447_-|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	46.0	3.0e-107
AVX38676.1|2978446_2978638_-	hypothetical protein	NA	NA	NA	NA	NA
AVX38677.1|2978643_2979189_-	ATP-binding protein	NA	NA	NA	NA	NA
AVX38678.1|2979185_2979530_-	hypothetical protein	NA	NA	NA	NA	NA
AVX38679.1|2979529_2980024_-	hypothetical protein	NA	NA	NA	NA	NA
AVX38680.1|2980025_2981072_-|capsid	capsid protein	capsid	Q6UYI3	Burkholderia_phage	31.3	2.4e-39
AVX38681.1|2981180_2981582_-|head	head decoration protein	head	A0A067ZIL6	Vibrio_phage	37.5	9.0e-11
AVX38682.1|2981581_2982166_-	DNA primase	NA	NA	NA	NA	NA
AVX38683.1|2982165_2983023_-	serine peptidase	NA	A0A2I6TC87	Escherichia_phage	39.1	1.3e-51
AVX40454.1|2983019_2984588_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	38.3	2.2e-97
AVX38684.1|2984656_2984920_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
AVX40455.1|2984928_2986905_-|terminase	terminase	terminase	G8EXZ6	Synechococcus_phage	45.3	1.7e-134
AVX38685.1|2986876_2987476_-	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
AVX38686.1|2987586_2988111_-	Fis family transcriptional regulator	NA	A0A1W6DY33	Salmonella_phage	50.6	9.0e-35
AVX38687.1|2988187_2988832_-	hypothetical protein	NA	NA	NA	NA	NA
AVX38688.1|2989064_2989340_-	hypothetical protein	NA	NA	NA	NA	NA
AVX38689.1|2989361_2989799_-	hypothetical protein	NA	NA	NA	NA	NA
AVX38690.1|2989782_2990304_-	hypothetical protein	NA	Q7Y3V2	Yersinia_phage	89.6	2.9e-78
AVX38691.1|2990296_2990827_-	lysozyme	NA	H6WRZ4	Salmonella_phage	69.1	2.1e-68
AVX38692.1|2990854_2991070_-|holin	holin	holin	B6SD15	Bacteriophage	48.1	7.7e-09
AVX38693.1|2991257_2991665_-	type II toxin-antitoxin system HicB family antitoxin	NA	F1C593	Cronobacter_phage	63.6	1.9e-40
AVX38694.1|2991715_2991892_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	62.1	2.2e-14
AVX38695.1|2992576_2992777_-	hypothetical protein	NA	NA	NA	NA	NA
AVX38696.1|2993109_2993511_-	antitermination protein	NA	S5M7R9	Escherichia_phage	56.3	2.6e-34
AVX38697.1|2993698_2994715_-	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	50.9	4.9e-69
AVX38698.1|2994814_2997484_-	DNA primase	NA	A0A1W6JPG0	Morganella_phage	48.7	4.8e-233
AVX38699.1|2997480_2997876_-	hypothetical protein	NA	NA	NA	NA	NA
AVX38700.1|2997989_2998193_-	hypothetical protein	NA	NA	NA	NA	NA
AVX38701.1|2998195_2998366_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AVX38702.1|2998343_2998541_-	hypothetical protein	NA	NA	NA	NA	NA
AVX38703.1|2998533_2999328_-	phage antirepressor Ant	NA	F1C5A3	Cronobacter_phage	44.7	1.2e-43
AVX40456.1|2999320_2999617_-	transcriptional regulator	NA	NA	NA	NA	NA
AVX38704.1|2999771_3001079_-	hypothetical protein	NA	NA	NA	NA	NA
AVX38705.1|3001075_3001588_-	hypothetical protein	NA	NA	NA	NA	NA
AVX38706.1|3001696_3001903_-	dipicolinate synthase	NA	A0A1V0E8E5	Vibrio_phage	45.3	4.1e-07
AVX38707.1|3002070_3002988_-	hypothetical protein	NA	NA	NA	NA	NA
AVX38708.1|3003401_3004592_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	59.0	3.2e-136
AVX38709.1|3005111_3005441_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
AVX38710.1|3005517_3005796_-	acylphosphatase	NA	NA	NA	NA	NA
AVX38711.1|3007182_3007620_-	translesion error-prone DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	54.7	3.2e-33
AVX38712.1|3008013_3009198_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	W6LLI2	Streptococcus_phage	26.9	3.5e-26
AVX38713.1|3009259_3009577_+	heat shock protein HspQ	NA	NA	NA	NA	NA
AVX38714.1|3009690_3010104_-	CoA-binding protein	NA	NA	NA	NA	NA
3009882:3009898	attR	CCACCATATCAATCTCA	NA	NA	NA	NA
AVX40457.1|3010435_3011104_+	DUF2057 domain-containing protein	NA	NA	NA	NA	NA
AVX38715.1|3011238_3011697_+	methylglyoxal synthase	NA	NA	NA	NA	NA
AVX38716.1|3011736_3013791_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	25.5	7.4e-16
AVX38717.1|3013985_3014438_+	YccF domain-containing protein	NA	NA	NA	NA	NA
AVX38718.1|3014461_3016597_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
AVX38719.1|3016650_3017274_-	DNA transformation protein tfoX	NA	NA	NA	NA	NA
AVX38720.1|3017503_3018010_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
AVX38721.1|3018368_3019430_+	porin OmpA	NA	NA	NA	NA	NA
AVX38722.1|3019492_3019948_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
AVX38723.1|3020137_3021910_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
>prophage 7
CP028487	Yersinia massiliensis strain GTA chromosome, complete genome	4986001	3446376	3467318	4986001	lysis,terminase,holin	Salmonella_phage(26.92%)	36	NA	NA
AVX40477.1|3446376_3447945_-	hypothetical protein	NA	A0A1B1ITN4	uncultured_Mediterranean_phage	30.4	9.2e-59
AVX39042.1|3447987_3448230_-	hypothetical protein	NA	NA	NA	NA	NA
AVX39043.1|3448229_3449828_-|terminase	terminase	terminase	Q775B9	Bordetella_phage	39.2	5.8e-93
AVX39044.1|3449845_3450232_-	hypothetical protein	NA	NA	NA	NA	NA
AVX39045.1|3450224_3450872_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	76.0	5.8e-76
AVX39046.1|3451448_3451832_-	hypothetical protein	NA	A0A192Y658	Salmonella_phage	42.4	1.9e-18
AVX39047.1|3451828_3452356_-	hypothetical protein	NA	A0A1V0E5P7	Salmonella_phage	54.8	6.7e-46
AVX39048.1|3452671_3453133_-|lysis	lysis protein	lysis	A5LH84	Enterobacteria_phage	45.0	6.3e-24
AVX39049.1|3453126_3453564_-	muraminidase	NA	Q5G8R3	Enterobacteria_phage	69.7	5.2e-52
AVX39050.1|3453550_3453883_-|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	42.6	3.1e-17
AVX39051.1|3454020_3454344_-	nucleoside 2-deoxyribosyltransferase	NA	A0A222YYT7	Escherichia_phage	60.9	1.5e-27
AVX39052.1|3454688_3455072_-	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	70.8	8.3e-46
AVX39053.1|3455072_3455300_-	hypothetical protein	NA	E5AGG2	Erwinia_phage	73.3	4.3e-26
AVX39054.1|3455296_3455656_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	67.8	1.5e-41
AVX39055.1|3455652_3455943_-	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	75.8	1.6e-38
AVX39056.1|3456044_3456560_-	hypothetical protein	NA	G9L6B3	Escherichia_phage	73.6	2.3e-67
AVX39057.1|3456556_3456721_-	NinE family protein	NA	Q5G8S3	Enterobacteria_phage	51.9	8.8e-05
AVX39058.1|3456683_3456890_-	hypothetical protein	NA	A0A2H4P784	Pseudomonas_phage	47.6	1.8e-07
AVX39059.1|3456886_3457333_-	recombination protein NinB	NA	A0A2H4J8D9	uncultured_Caudovirales_phage	62.5	3.9e-47
AVX39060.1|3457325_3457934_-	DUF551 domain-containing protein	NA	A0A2H4FNA9	Salmonella_phage	75.7	2.0e-30
AVX39061.1|3457930_3458134_-	hypothetical protein	NA	NA	NA	NA	NA
AVX40478.1|3458130_3458313_-	hypothetical protein	NA	NA	NA	NA	NA
AVX39062.1|3458375_3458558_-	hypothetical protein	NA	NA	NA	NA	NA
AVX39063.1|3458557_3459964_-	helicase DnaB	NA	Q9MCT4	Escherichia_phage	59.4	3.5e-158
AVX39064.1|3459953_3460838_-	DNA replication protein	NA	Q8VNP8	Enterobacteria_phage	53.5	7.7e-79
AVX39065.1|3461004_3461295_-	hypothetical protein	NA	I6RSP4	Salmonella_phage	59.4	6.3e-22
AVX39066.1|3461406_3461631_-	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	79.1	1.4e-24
AVX40479.1|3461740_3462340_+	XRE family transcriptional regulator	NA	Q76H56	Enterobacteria_phage	61.8	1.0e-18
AVX39067.1|3463369_3463666_+	hypothetical protein	NA	NA	NA	NA	NA
AVX39068.1|3463671_3463914_+	hypothetical protein	NA	S5VV14	Pseudomonas_phage	53.4	2.3e-09
AVX39069.1|3463955_3464186_+	hypothetical protein	NA	NA	NA	NA	NA
AVX39070.1|3464190_3464526_+	hypothetical protein	NA	NA	NA	NA	NA
AVX39071.1|3464948_3465200_+	hypothetical protein	NA	NA	NA	NA	NA
AVX39072.1|3465598_3465910_+	hypothetical protein	NA	NA	NA	NA	NA
AVX39073.1|3465909_3466728_+	exonuclease VIII	NA	A0A0M5M5Y6	Salmonella_phage	69.2	2.5e-108
AVX39074.1|3466727_3467318_+	hypothetical protein	NA	A0A0M4RD07	Salmonella_phage	63.4	7.5e-62
>prophage 8
CP028487	Yersinia massiliensis strain GTA chromosome, complete genome	4986001	4287316	4390425	4986001	head,terminase,integrase,plate,transposase,tail,tRNA,protease	Burkholderia_virus(37.74%)	114	4364855:4364872	4399067:4399084
AVX39703.1|4287316_4288261_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
AVX39704.1|4288260_4288671_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
AVX39705.1|4288737_4291416_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.6	2.3e-25
AVX39706.1|4291440_4292928_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
AVX39707.1|4292949_4293402_-	ribosome maturation factor	NA	NA	NA	NA	NA
AVX39708.1|4293932_4294268_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
AVX39709.1|4294491_4295832_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AVX39710.1|4295841_4296675_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.4	2.9e-19
AVX39711.1|4296835_4298791_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	44.2	2.2e-118
AVX39712.1|4298847_4299477_-	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
AVX39713.1|4299624_4299918_+	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
AVX39714.1|4300046_4300523_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
AVX39715.1|4300784_4302233_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	NA	NA	NA	NA
AVX39716.1|4302238_4302901_+	two-component system response regulator BasR	NA	W8CYM9	Bacillus_phage	35.5	5.5e-29
AVX39717.1|4302897_4303980_+	two-component system sensor histidine kinase BasS	NA	W8CYF6	Bacillus_phage	24.5	5.5e-10
AVX39718.1|4304083_4305256_-	Obg family GTPase CgtA	NA	NA	NA	NA	NA
AVX39719.1|4305526_4306486_-	EamA family transporter	NA	NA	NA	NA	NA
AVX39720.1|4306568_4306826_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
AVX39721.1|4306845_4307157_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
AVX39722.1|4307416_4308388_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	27.0	2.7e-08
AVX39723.1|4308457_4308853_-	DNA-binding protein	NA	A0A0M3LPN5	Mannheimia_phage	43.5	8.3e-09
AVX39724.1|4308982_4309258_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	61.2	1.5e-17
AVX39725.1|4309470_4310409_-	malate dehydrogenase	NA	NA	NA	NA	NA
AVX39726.1|4310871_4311342_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
AVX39727.1|4311769_4312033_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AVX39728.1|4312265_4313651_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
AVX40541.1|4313821_4314835_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	45.5	5.2e-71
AVX39729.1|4314882_4316463_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	1.3e-12
AVX39730.1|4316752_4317280_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.4e-56
AVX39731.1|4317361_4317724_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
AVX39732.1|4317726_4321545_-	translocation and assembly module TamB	NA	NA	NA	NA	NA
AVX39733.1|4321541_4323278_-	outer membrane protein assembly factor	NA	NA	NA	NA	NA
AVX40542.1|4323617_4324253_+	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
AVX39734.1|4324432_4325764_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
AVX39735.1|4325919_4326126_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
AVX39736.1|4326456_4327020_+	YtfJ family protein	NA	NA	NA	NA	NA
AVX39737.1|4327064_4327808_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
AVX39738.1|4328193_4330179_+	bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase	NA	NA	NA	NA	NA
AVX39739.1|4330323_4330989_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
AVX39740.1|4331089_4331710_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AVX39741.1|4332012_4332780_+	lysine transporter LysM	NA	NA	NA	NA	NA
AVX39742.1|4332922_4333372_+	hypothetical protein	NA	NA	NA	NA	NA
AVX39743.1|4333473_4333926_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
AVX39744.1|4333965_4334193_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
AVX39745.1|4334197_4334518_-	primosomal replication protein N	NA	NA	NA	NA	NA
AVX39746.1|4334523_4334916_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
AVX39747.1|4335327_4335603_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AVX39748.1|4335791_4336541_-	esterase	NA	NA	NA	NA	NA
AVX39749.1|4336726_4337035_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
AVX40543.1|4337131_4337329_+	hypothetical protein	NA	NA	NA	NA	NA
AVX39750.1|4337325_4337802_-|tail	phage tail protein	tail	F1BUP0	Erwinia_phage	45.5	9.3e-39
AVX39751.1|4338667_4339246_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	65.8	2.9e-66
AVX39752.1|4339238_4340342_-|plate	baseplate protein	plate	A4JWL6	Burkholderia_virus	52.2	1.2e-102
AVX39753.1|4340332_4340680_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	62.4	3.0e-34
AVX39754.1|4340756_4341632_-|transposase	transposase	transposase	NA	NA	NA	NA
AVX39755.1|4341712_4342309_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.7	1.2e-35
AVX39756.1|4342305_4343478_-	phage protein D	NA	Q6QIA2	Burkholderia_phage	48.9	1.9e-88
AVX39757.1|4343465_4343681_-	hypothetical protein	NA	Q6QIA3	Burkholderia_phage	60.0	7.0e-18
AVX39758.1|4343677_4344562_-	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.9	5.2e-51
AVX39759.1|4344561_4347024_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	42.9	6.3e-171
AVX39760.1|4347116_4347254_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AVX39761.1|4347219_4347540_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AVX39762.1|4347638_4347920_-	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	44.3	2.1e-14
AVX39763.1|4347909_4348203_-	hypothetical protein	NA	A0A1B1PEE7	Pectobacterium_phage	41.2	2.8e-09
AVX39764.1|4348205_4348727_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	68.2	2.3e-67
AVX39765.1|4348726_4350154_-|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	77.8	1.8e-215
AVX39766.1|4350143_4350398_-	hypothetical protein	NA	NA	NA	NA	NA
AVX39767.1|4350394_4350859_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	52.3	1.7e-40
AVX39768.1|4350858_4351305_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	53.6	5.5e-33
AVX39769.1|4351306_4351663_-	DUF2190 domain-containing protein	NA	NA	NA	NA	NA
AVX39770.1|4351673_4352627_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	42.3	9.2e-62
AVX39771.1|4352640_4353738_-	peptidase	NA	A4JWJ9	Burkholderia_virus	50.5	5.4e-98
AVX40544.1|4353939_4354398_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	42.4	1.6e-27
AVX39772.1|4354400_4355222_-|head	phage head morphogenesis protein	head	Q6QIB9	Burkholderia_phage	61.5	5.8e-97
AVX39773.1|4355202_4356702_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	60.6	2.0e-172
AVX39774.1|4356701_4358225_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.2	6.4e-182
AVX39775.1|4358221_4358767_-|terminase	terminase	terminase	A4JWJ3	Burkholderia_virus	66.5	6.7e-57
AVX39776.1|4358766_4359078_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	60.6	4.0e-30
AVX39777.1|4359070_4359403_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	46.7	5.4e-17
AVX39778.1|4359399_4360053_-	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	34.2	2.5e-10
AVX39779.1|4360042_4360765_-	lytic murein transglycosylase	NA	Q5ZQZ1	Pseudomonas_phage	57.7	1.0e-60
AVX39780.1|4360767_4361118_-	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.9	6.9e-23
AVX40545.1|4361367_4362138_+	restriction endonuclease subunit M	NA	A2I2Y7	Vibrio_virus	64.9	1.1e-97
AVX39781.1|4362194_4362944_-	hypothetical protein	NA	NA	NA	NA	NA
AVX39782.1|4363029_4364013_-	hypothetical protein	NA	NA	NA	NA	NA
AVX40546.1|4364009_4364492_-	XRE family transcriptional regulator	NA	A4JWN8	Burkholderia_virus	43.3	7.8e-17
AVX39783.1|4364517_4364706_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	74.2	7.2e-19
AVX39784.1|4364758_4365064_+	IclR family transcriptional regulator	NA	Q5ZR02	Pseudomonas_phage	59.0	2.4e-24
4364855:4364872	attL	CTGGCATCAGCACTCGGT	NA	NA	NA	NA
AVX39785.1|4365073_4365982_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	55.1	5.9e-74
AVX39786.1|4365985_4367755_+|integrase	integrase	integrase	A4JWN2	Burkholderia_virus	68.4	4.6e-224
AVX39787.1|4367765_4368932_+	hypothetical protein	NA	A4JWN1	Burkholderia_virus	59.2	5.3e-120
AVX39788.1|4368934_4369204_+	hypothetical protein	NA	NA	NA	NA	NA
AVX39789.1|4369221_4369836_+	sulfate transporter	NA	A0A2D1GNM4	Pseudomonas_phage	69.2	2.1e-75
AVX39790.1|4369914_4370103_+	hypothetical protein	NA	NA	NA	NA	NA
AVX39791.1|4370099_4370372_+	hypothetical protein	NA	NA	NA	NA	NA
AVX39792.1|4370387_4370684_+	hypothetical protein	NA	NA	NA	NA	NA
AVX39793.1|4370670_4371357_+	DUF2786 domain-containing protein	NA	A0A1W6DYA0	Aeromonas_phage	34.3	5.3e-27
AVX39794.1|4371353_4371569_+	hypothetical protein	NA	NA	NA	NA	NA
AVX39795.1|4371561_4371987_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	46.7	1.2e-26
AVX39796.1|4371983_4372364_+	DNA-binding protein	NA	A4JWM4	Burkholderia_virus	56.9	1.3e-30
AVX39797.1|4372440_4372659_+	hypothetical protein	NA	NA	NA	NA	NA
AVX39798.1|4374794_4375535_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
AVX39799.1|4375627_4378174_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.9	1.5e-66
AVX39800.1|4378356_4378782_-	HTH-type transcriptional repressor NsrR	NA	NA	NA	NA	NA
AVX39801.1|4379268_4380567_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	36.7	3.4e-67
AVX39802.1|4380666_4380867_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
AVX39803.1|4380961_4381966_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
AVX39804.1|4381969_4383238_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
AVX39805.1|4383331_4384618_-	GTPase HflX	NA	NA	NA	NA	NA
AVX39806.1|4384716_4385022_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
AVX39807.1|4385139_4386081_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AVX39808.1|4386073_4388020_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.9	3.2e-61
AVX39809.1|4388035_4389946_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	M1IQ67	Bacillus_virus	28.4	4.2e-21
AVX39810.1|4389954_4390425_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
4399067:4399084	attR	CTGGCATCAGCACTCGGT	NA	NA	NA	NA
