The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028538	Enterobacter hormaechei strain SCEH020042 chromosome, complete genome	4776086	985312	1027253	4776086	integrase,tail,holin	uncultured_Caudovirales_phage(30.0%)	42	995053:995067	1031950:1031964
AVZ13155.1|985312_986416_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.9	1.0e-59
AVZ13156.1|986427_987681_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.6	5.2e-97
AVZ13157.1|988021_989194_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	50.3	1.6e-111
AVZ13158.1|989190_989379_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AVZ13159.1|989375_990761_-	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	74.0	3.2e-212
AVZ13160.1|990911_991214_-	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	68.2	8.8e-27
AVZ13161.1|991214_991454_-	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	88.3	1.1e-32
AVZ13162.1|991446_991665_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
AVZ13163.1|991730_992489_-	DNA-binding protein	NA	NA	NA	NA	NA
AVZ13164.1|992545_994612_-	DNA polymerase	NA	Q775A3	Bordetella_phage	68.1	5.1e-275
AVZ13165.1|994689_995238_-	DUF2815 family protein	NA	Q775A5	Bordetella_phage	67.6	7.6e-69
995053:995067	attL	TTCCCACTTCTCGCC	NA	NA	NA	NA
AVZ13166.1|995252_996554_-	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	57.1	1.3e-135
AVZ13167.1|996556_997450_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ13168.1|998133_998763_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	41.7	1.4e-34
AVZ13169.1|998872_999097_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVZ13170.1|999100_1001269_+	replication protein	NA	B6SCY1	Bacteriophage	70.9	6.8e-169
AVZ13171.1|1001579_1001855_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ13172.1|1002132_1002552_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ13173.1|1002566_1002797_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ13174.1|1002800_1004426_+|tail	phage tail protein	tail	A0A2H4J3N6	uncultured_Caudovirales_phage	58.8	1.2e-173
AVZ13175.1|1004422_1004656_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ13176.1|1004642_1005479_+	hypothetical protein	NA	A0A2H4JEQ5	uncultured_Caudovirales_phage	43.1	4.3e-47
AVZ13177.1|1005546_1005963_+	hypothetical protein	NA	R9TRJ4	Aeromonas_phage	80.9	6.9e-46
AVZ13178.1|1006180_1007092_+	hypothetical protein	NA	A0A2H4JC66	uncultured_Caudovirales_phage	37.6	9.2e-43
AVZ13179.1|1007149_1007713_+	hypothetical protein	NA	A0A2H4JID6	uncultured_Caudovirales_phage	51.3	9.6e-51
AVZ13180.1|1007714_1009706_+	hypothetical protein	NA	A0A2H4J6H2	uncultured_Caudovirales_phage	49.4	1.6e-188
AVZ13181.1|1009707_1010157_+	GNAT family N-acetyltransferase	NA	A0A2H4J9Z5	uncultured_Caudovirales_phage	43.0	2.0e-22
AVZ13182.1|1010159_1010627_+	hypothetical protein	NA	A0A2H4J679	uncultured_Caudovirales_phage	44.7	2.1e-06
AVZ13183.1|1010629_1013338_+	lytic transglycosylase	NA	G9L6D3	Escherichia_phage	64.0	0.0e+00
AVZ13184.1|1013337_1016229_+	hypothetical protein	NA	G9L6D4	Escherichia_phage	75.8	0.0e+00
AVZ13185.1|1016293_1016635_+	hypothetical protein	NA	A0A2H4J7H0	uncultured_Caudovirales_phage	52.7	7.4e-22
AVZ13186.1|1016631_1018242_+	transcriptional regulator	NA	A0A2H4JCA3	uncultured_Caudovirales_phage	70.3	1.4e-224
AVZ13187.1|1018262_1020257_+	hypothetical protein	NA	G3M191	Escherichia_virus	43.6	1.5e-106
AVZ13188.1|1020291_1021761_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ13189.1|1021757_1022675_-	glycosyltransferase	NA	U5P087	Shigella_phage	89.5	6.6e-158
AVZ13190.1|1022671_1023034_-	GtrA family protein	NA	U5P0S6	Shigella_phage	56.7	5.1e-29
AVZ13191.1|1023219_1023450_+|holin	holin	holin	A5LH82	Enterobacteria_phage	71.4	3.5e-23
AVZ13192.1|1023430_1023970_+	lysozyme	NA	H6WRZ4	Salmonella_phage	90.4	3.3e-93
AVZ13193.1|1023966_1024329_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	45.3	3.9e-13
AVZ13194.1|1025434_1025713_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ13195.1|1026185_1026557_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ13196.1|1026635_1027253_-|integrase	integrase	integrase	A0A1V0E036	Clostridioides_phage	23.5	3.9e-05
1031950:1031964	attR	TTCCCACTTCTCGCC	NA	NA	NA	NA
>prophage 2
CP028538	Enterobacter hormaechei strain SCEH020042 chromosome, complete genome	4776086	2126014	2137378	4776086		Morganella_phage(33.33%)	12	NA	NA
AVZ14206.1|2126014_2127478_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.3	1.9e-45
AVZ14207.1|2127522_2127726_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	56.7	4.4e-14
AVZ14208.1|2128013_2128445_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	35.2	1.5e-16
AVZ14209.1|2128479_2129166_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AVZ14210.1|2129256_2130003_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
AVZ14211.1|2130146_2132180_+	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	22.4	3.8e-20
AVZ14212.1|2132793_2133021_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ14213.1|2133583_2133802_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	62.7	8.3e-19
AVZ14214.1|2134169_2134859_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.5	1.7e-81
AVZ14215.1|2135122_2135362_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	91.1	1.5e-32
AVZ14216.1|2135688_2136108_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	56.7	7.2e-35
AVZ14217.1|2136109_2137378_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	90.8	1.6e-226
>prophage 3
CP028538	Enterobacter hormaechei strain SCEH020042 chromosome, complete genome	4776086	2432859	2492711	4776086	head,coat,lysis,terminase,integrase	Cronobacter_phage(32.14%)	75	2479084:2479098	2503701:2503715
AVZ14461.1|2432859_2433531_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.9	1.2e-79
AVZ14462.1|2433523_2434792_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.5	5.8e-229
AVZ14463.1|2434791_2435109_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	44.0	7.1e-11
AVZ14464.1|2435473_2436598_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	26.5	4.9e-22
AVZ14465.1|2436627_2438877_-	SGNH/GDSL hydrolase family protein	NA	W6PEG9	Cronobacter_phage	36.5	4.8e-109
AVZ14466.1|2438933_2441414_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	91.0	0.0e+00
AVZ14467.1|2441400_2441766_-	peptidoglycan endopeptidase	NA	F1C5F2	Cronobacter_phage	90.8	5.4e-63
AVZ14468.1|2441779_2442250_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	92.3	1.0e-77
AVZ14469.1|2442249_2442747_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	89.7	2.8e-86
AVZ14470.1|2442746_2446265_-	hypothetical protein	NA	R9TMK1	Aeromonas_phage	37.2	9.5e-104
AVZ14471.1|2446301_2447045_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	53.1	2.0e-64
AVZ14472.1|2447095_2447851_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	53.0	2.9e-58
AVZ14473.1|2447909_2448293_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	57.5	1.7e-38
AVZ14474.1|2448289_2448658_-	HK97 gp10 family phage protein	NA	F1C5E3	Cronobacter_phage	74.6	3.0e-45
AVZ14475.1|2448660_2449017_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	55.6	3.6e-27
AVZ14476.1|2449016_2449190_-	50S ribosomal protein L13	NA	I6R0P9	Salmonella_phage	51.9	1.7e-11
AVZ14477.1|2449243_2449792_-	HNH endonuclease	NA	K9L517	Pectobacterium_phage	42.2	9.4e-35
AVZ14478.1|2449893_2450277_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	75.6	7.5e-47
AVZ14479.1|2450353_2450719_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ14480.1|2450728_2451826_-|coat	phage coat protein	coat	F1C5E1	Cronobacter_phage	77.7	4.5e-161
AVZ14481.1|2451836_2452271_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	72.2	1.4e-49
AVZ14482.1|2452274_2453660_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	59.3	1.8e-151
AVZ14483.1|2453729_2454245_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ14484.1|2454284_2455274_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	66.1	3.6e-109
AVZ14485.1|2455221_2456673_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	74.2	2.5e-196
AVZ14486.1|2456684_2458160_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	77.2	2.7e-230
AVZ14487.1|2458169_2458619_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	82.9	1.5e-54
AVZ14488.1|2458651_2459290_-	hypothetical protein	NA	I6S676	Salmonella_phage	91.0	5.9e-113
AVZ14489.1|2459293_2459512_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ14490.1|2459691_2460237_-	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	64.9	2.5e-56
AVZ14491.1|2460588_2461050_-|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	75.2	3.1e-55
AVZ14492.1|2461046_2461349_-	hypothetical protein	NA	A0A289ZTW9	Serratia_phage	49.5	5.0e-14
AVZ14493.1|2461345_2461840_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	98.2	3.2e-90
AVZ14494.1|2461817_2462042_-|lysis	lysis protein	lysis	M9NZI9	Enterobacteria_phage	95.9	2.1e-33
AVZ14495.1|2462347_2463037_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	5.5e-56
AVZ14496.1|2463033_2463150_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ14497.1|2463146_2463506_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	98.3	2.6e-65
AVZ14498.1|2463502_2463793_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	91.6	1.8e-45
AVZ14499.1|2463785_2463956_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	94.3	9.0e-21
AVZ14500.1|2463955_2464411_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	67.5	1.1e-60
AVZ14501.1|2465108_2465882_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ14502.1|2465958_2466258_-	protein ren	NA	M1FPD5	Enterobacteria_phage	53.7	7.4e-18
AVZ16662.1|2466254_2467034_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	64.2	1.4e-95
AVZ14503.1|2467030_2467759_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	66.7	2.5e-35
AVZ14504.1|2467892_2468438_-	hypothetical protein	NA	K7P7P2	Enterobacteria_phage	96.1	2.6e-93
AVZ14505.1|2468468_2468696_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	70.4	3.4e-23
AVZ16663.1|2468807_2469512_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	78.6	1.0e-102
AVZ14506.1|2469598_2470033_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
AVZ14507.2|2470497_2470917_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ14508.1|2470921_2471527_+	hypothetical protein	NA	A0A2C9D0J8	Yersinia_phage	36.1	3.2e-28
AVZ14509.1|2471848_2472058_+	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	94.2	5.7e-33
AVZ14510.1|2472128_2473097_+	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	75.4	1.5e-38
AVZ14511.1|2473104_2473389_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	93.6	1.1e-47
AVZ14512.1|2473398_2474316_+	recombinase RecT	NA	M9NZA6	Enterobacteria_phage	99.3	7.5e-170
AVZ14513.1|2474312_2474993_+	exonuclease	NA	M9NZE1	Enterobacteria_phage	95.1	2.0e-127
AVZ14514.1|2474989_2475418_+	regulator	NA	M9NYX4	Enterobacteria_phage	95.8	1.5e-72
AVZ14515.1|2475578_2476244_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	93.3	2.5e-114
AVZ16664.1|2476249_2476468_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ14516.1|2476559_2476775_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	59.4	2.5e-15
AVZ14517.1|2476776_2477415_+	HNH endonuclease	NA	A0A173GC65	Salmonella_phage	43.2	3.7e-30
AVZ14518.1|2477520_2477769_+	DNA-binding protein	NA	S4TND0	Salmonella_phage	53.1	2.6e-16
AVZ14519.1|2477800_2479087_+	DUF3596 domain-containing protein	NA	Q6HA01	Enterobacteria_phage	55.3	5.5e-134
2479084:2479098	attL	ATAATTGATTTATAT	NA	NA	NA	NA
AVZ14520.1|2479118_2480543_-	aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
AVZ14521.1|2480682_2482107_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
AVZ14522.1|2482189_2482378_-	cold-shock protein	NA	NA	NA	NA	NA
AVZ14523.1|2482771_2484166_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AVZ14524.1|2484171_2485182_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AVZ14525.1|2485181_2485310_+	DUF2474 domain-containing protein	NA	NA	NA	NA	NA
AVZ14526.1|2485434_2485872_+	heat shock protein HslJ	NA	NA	NA	NA	NA
AVZ16665.1|2485873_2486140_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AVZ14527.1|2486411_2489936_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
AVZ14528.1|2490323_2491451_+	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	60.3	5.2e-120
AVZ14529.1|2491484_2491907_-	GFA family protein	NA	NA	NA	NA	NA
AVZ14530.1|2491910_2492108_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ16666.1|2492414_2492711_+|integrase	integrase	integrase	A0A0U2JGI6	Escherichia_phage	56.5	2.3e-19
2503701:2503715	attR	ATAATTGATTTATAT	NA	NA	NA	NA
>prophage 4
CP028538	Enterobacter hormaechei strain SCEH020042 chromosome, complete genome	4776086	2752760	2842809	4776086	protease,tRNA,head,tail,capsid,holin,portal,terminase,transposase	Enterobacteria_phage(24.14%)	104	NA	NA
AVZ14755.1|2752760_2753642_-|protease	protease HtpX	protease	NA	NA	NA	NA
AVZ14756.1|2753835_2755884_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	32.6	7.8e-82
AVZ14757.1|2755903_2756590_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
AVZ14758.1|2756686_2757184_-	GAF domain-containing protein	NA	NA	NA	NA	NA
AVZ16677.1|2757316_2758600_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
AVZ14759.1|2758568_2761202_+	PqiB family protein	NA	NA	NA	NA	NA
AVZ16678.2|2761258_2762722_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
AVZ14760.1|2762826_2763066_+	DUF1480 family protein	NA	NA	NA	NA	NA
AVZ14761.1|2763100_2763745_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	49.8	1.5e-55
AVZ14762.1|2763912_2764893_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
AVZ14763.1|2765261_2765600_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AVZ14764.1|2765616_2766486_-	copper resistance D family protein	NA	NA	NA	NA	NA
AVZ14765.1|2766487_2766859_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AVZ14766.1|2766996_2767227_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	7.0e-16
AVZ14767.1|2767338_2767977_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
AVZ14768.1|2768001_2768664_+	exodeoxyribonuclease X	NA	NA	NA	NA	NA
AVZ14769.1|2768645_2770721_-	oligopeptidase B	NA	NA	NA	NA	NA
AVZ14770.1|2770796_2771447_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
AVZ14771.1|2771619_2772798_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
AVZ14772.1|2772859_2774278_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ14773.1|2775702_2776344_-	keto-hydroxyglutarate-aldolase/keto-deoxy- phosphogluconate aldolase	NA	NA	NA	NA	NA
AVZ14774.1|2776383_2778195_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
AVZ14775.1|2778429_2779905_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.2	4.6e-76
AVZ14776.1|2780259_2781129_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AVZ14777.1|2781243_2782686_+	pyruvate kinase	NA	NA	NA	NA	NA
AVZ14778.1|2782729_2783701_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
AVZ14779.1|2783820_2785140_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
AVZ14780.1|2785155_2786115_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
AVZ14781.1|2786177_2786933_+	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.2	6.7e-15
AVZ14782.1|2786929_2787715_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
AVZ14783.1|2787767_2788778_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.5	3.6e-08
AVZ14784.1|2788786_2789401_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AVZ14785.1|2789481_2790003_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	34.2	5.8e-10
AVZ14786.1|2790037_2790778_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AVZ14787.1|2790805_2791249_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
AVZ14788.1|2791250_2793023_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AVZ14789.1|2793021_2793213_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ14790.1|2793286_2793853_+	hydrolase	NA	NA	NA	NA	NA
AVZ14791.1|2794217_2794484_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	94.3	4.7e-40
AVZ14792.1|2794577_2795861_-|tail	phage tail protein	tail	K7PHF0	Enterobacteria_phage	63.3	1.4e-145
AVZ14793.1|2795919_2796153_-	cor protein	NA	E4WL42	Enterobacteria_phage	77.6	6.6e-30
AVZ14794.1|2796260_2796932_-	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	73.5	1.2e-87
AVZ14795.1|2796932_2797247_-	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	64.7	1.5e-32
AVZ14796.1|2797289_2800847_-	DUF1983 domain-containing protein	NA	Q9MCU0	Escherichia_phage	72.0	0.0e+00
AVZ14797.1|2800900_2801485_-|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	53.1	1.1e-54
AVZ14798.1|2801484_2802195_-	peptidase P60	NA	F1C573	Cronobacter_phage	69.4	4.3e-96
AVZ14799.1|2802197_2802956_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	64.0	1.0e-95
AVZ14800.1|2802952_2803291_-|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	59.8	7.3e-38
AVZ14801.1|2803293_2806758_-|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	93.5	0.0e+00
AVZ14802.1|2807088_2808012_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	3.8e-177
AVZ14803.1|2808037_2808268_-	cor protein	NA	Q5G8V7	Enterobacteria_phage	69.6	8.5e-22
AVZ14804.1|2808388_2808667_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	96.7	2.8e-43
AVZ14805.1|2808675_2809059_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	94.4	6.7e-64
AVZ14806.1|2809067_2809511_-	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	94.5	1.6e-72
AVZ14807.1|2809570_2809918_-	DUF3168 domain-containing protein	NA	Q9MCS8	Enterobacteria_phage	99.1	3.8e-58
AVZ14808.1|2809914_2810364_-	HK97 gp10 family phage protein	NA	K7P6X4	Enterobacteria_phage	98.0	1.9e-73
AVZ14809.1|2810360_2810699_-|head,tail	head-tail adaptor protein	head,tail	K7P7L2	Enterobacteria_phage	96.4	5.4e-57
AVZ14810.1|2810698_2811025_-	hypothetical protein	NA	K7PGU9	Enterobacterial_phage	99.1	3.4e-56
AVZ14811.1|2811058_2812216_-|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	100.0	4.5e-212
AVZ14812.1|2812218_2812896_-|head,protease	HK97 family phage prohead protease	head,protease	F1C583	Cronobacter_phage	100.0	3.2e-125
AVZ14813.1|2812913_2814188_-|portal	phage portal protein	portal	F1C584	Cronobacter_phage	99.3	1.6e-247
AVZ14814.1|2814187_2815702_-|terminase	terminase large subunit	terminase	Q9MCT1	Enterobacteria_phage	99.6	8.0e-294
AVZ14815.1|2815708_2816194_-|terminase	terminase	terminase	Q77WA1	Escherichia_phage	98.8	1.3e-80
AVZ14816.1|2816377_2816581_-	hypothetical protein	NA	A0A220NRN5	Escherichia_phage	76.1	9.8e-22
AVZ14817.1|2816580_2816922_-	HNH endonuclease	NA	K7PM05	Enterobacterial_phage	99.1	4.6e-64
AVZ14818.1|2816978_2817569_-	hypothetical protein	NA	K7P7D2	Enterobacteria_phage	94.4	5.6e-110
AVZ14819.1|2817550_2819011_-	glycosyltransferase family 2 protein	NA	A0A220NRM5	Escherichia_phage	77.2	5.5e-231
AVZ14820.1|2819010_2819571_-	HNH endonuclease	NA	A0A220NRM6	Escherichia_phage	88.7	1.4e-97
AVZ14821.1|2819690_2820026_-	hypothetical protein	NA	S4TTH3	Salmonella_phage	73.9	3.7e-42
AVZ14822.1|2820102_2820648_+	hypothetical protein	NA	S4TR57	Salmonella_phage	96.7	3.1e-94
AVZ14823.1|2821108_2821444_-	hypothetical protein	NA	Q5QF73	Pseudomonas_virus	55.4	6.6e-15
AVZ14824.1|2821561_2821762_-	hypothetical protein	NA	K7PM01	Enterobacterial_phage	80.4	7.9e-16
AVZ14825.1|2821712_2821985_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ14826.1|2821992_2822622_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	86.6	6.2e-99
AVZ14827.1|2822621_2822900_-|holin	phage holin family protein	holin	G8C7V9	Escherichia_phage	85.9	1.3e-37
AVZ14828.1|2822889_2823279_-	hypothetical protein	NA	G8C7V8	Escherichia_phage	99.2	8.9e-64
AVZ14829.1|2823784_2824012_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ14830.1|2824058_2824544_-	HNH endonuclease	NA	C4ML56	Xanthomonas_virus	42.7	1.5e-23
AVZ14831.1|2824839_2825622_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.0	1.1e-108
AVZ14832.1|2825625_2827497_-	toprim domain-containing protein	NA	Q5G8S8	Enterobacteria_phage	59.6	1.1e-223
AVZ14833.1|2827604_2828537_-	hypothetical protein	NA	C5IHL2	Burkholderia_virus	37.8	1.7e-36
AVZ14834.1|2828533_2828731_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AVZ14835.1|2828732_2828951_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ14836.1|2829065_2829773_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	73.4	2.6e-93
AVZ14837.1|2830186_2830387_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ14838.1|2831001_2831205_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ14839.1|2831185_2831596_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	83.5	9.5e-48
AVZ14840.1|2831782_2832289_+	hypothetical protein	NA	F1C5A2	Cronobacter_phage	54.8	4.1e-53
AVZ14841.1|2832301_2833162_+	ORF6N domain-containing protein	NA	F1C5A3	Cronobacter_phage	75.9	1.6e-126
AVZ14842.1|2833161_2833413_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ14843.1|2833414_2833837_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ14844.1|2833833_2833959_+	sodium:solute symporter	NA	NA	NA	NA	NA
AVZ14845.1|2833955_2834312_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ14846.1|2834304_2834637_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ14847.1|2834699_2834936_+	excisionase	NA	Q8W657	Enterobacteria_phage	88.5	1.1e-37
AVZ14848.1|2834991_2836305_+	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	85.8	1.0e-220
AVZ14849.1|2836283_2837057_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	79.5	2.5e-57
AVZ14850.1|2837108_2837504_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ14851.1|2837544_2838288_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	A0A1S6L2V9	Erwinia_phage	30.2	6.1e-29
AVZ14852.1|2838284_2839256_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AVZ14853.1|2839152_2839428_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ14854.1|2839454_2840198_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AVZ14855.1|2840276_2840837_-	VOC family protein	NA	NA	NA	NA	NA
AVZ14856.1|2841075_2842809_+|tRNA	arginine--tRNA ligase	tRNA	A0A1V0SIS8	Klosneuvirus	37.2	1.4e-87
>prophage 5
CP028538	Enterobacter hormaechei strain SCEH020042 chromosome, complete genome	4776086	3519372	3602570	4776086	tRNA,protease,capsid,holin,portal,terminase,transposase	Escherichia_phage(21.95%)	88	NA	NA
AVZ15434.1|3519372_3520140_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AVZ15435.1|3520171_3520711_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AVZ15436.1|3520726_3520975_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AVZ15437.1|3521091_3522453_-	signal recognition particle protein	NA	NA	NA	NA	NA
AVZ16701.1|3522619_3523411_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
AVZ15438.1|3523430_3524717_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AVZ15439.1|3524769_3525387_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AVZ15440.1|3525485_3526364_+	NAD(+) kinase	NA	NA	NA	NA	NA
AVZ15441.1|3526449_3528111_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AVZ15442.1|3528085_3528268_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ15443.1|3528249_3528588_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AVZ15444.1|3528649_3528937_-	RnfH family protein	NA	NA	NA	NA	NA
AVZ15445.1|3528926_3529403_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AVZ15446.1|3529520_3530003_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	6.8e-29
AVZ15447.1|3530659_3531901_+	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	48.3	6.7e-105
AVZ15448.1|3531959_3532838_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ15449.1|3532963_3533176_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
AVZ16702.1|3533340_3534696_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
AVZ15450.1|3534937_3535558_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AVZ15451.1|3536921_3537149_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ16703.1|3537370_3537652_+	DNA-binding protein	NA	NA	NA	NA	NA
AVZ15452.1|3537686_3538256_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AVZ15453.1|3538361_3541211_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.2	1.5e-128
AVZ15454.1|3541210_3541402_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ15455.1|3541462_3543040_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	C7U047	Ostreococcus_tauri_virus	43.8	4.5e-98
AVZ15456.1|3543127_3543586_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AVZ15457.1|3543608_3544523_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ15458.1|3544625_3545513_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ15459.1|3545602_3546214_+	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
AVZ15460.1|3546293_3547439_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ15461.1|3547428_3547869_+	thioredoxin TrxC	NA	V5L6J2	Insectomime_virus	32.4	2.6e-11
AVZ15462.1|3547872_3549588_+	sodium:proton exchanger	NA	NA	NA	NA	NA
AVZ15463.1|3549584_3550082_+	phosphate-starvation-inducible E family protein	NA	NA	NA	NA	NA
AVZ15464.1|3551053_3552205_+	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	9.9e-26
AVZ15465.1|3552429_3553410_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	57.3	6.1e-93
AVZ15466.1|3554366_3555518_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.0	6.4e-41
AVZ15467.1|3555474_3555831_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	5.7e-33
AVZ15468.1|3556969_3557791_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.7	2.3e-45
AVZ15469.1|3558007_3558709_+	WYL domain-containing protein	NA	NA	NA	NA	NA
AVZ15470.1|3558749_3558986_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ15471.1|3558985_3559429_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ15472.1|3559453_3559921_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ15473.1|3560222_3561191_-	phage exclusion protein	NA	NA	NA	NA	NA
AVZ15474.1|3561719_3564029_+	ATPase	NA	NA	NA	NA	NA
AVZ15475.1|3564032_3565349_+	ATP-binding protein	NA	NA	NA	NA	NA
AVZ15476.1|3565345_3567541_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
AVZ15477.1|3568394_3568874_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	29.8	2.3e-13
AVZ15478.1|3568889_3569366_+	DNA repair protein RadC	NA	NA	NA	NA	NA
AVZ15479.1|3569374_3569596_+	DUF987 domain-containing protein	NA	NA	NA	NA	NA
AVZ15480.1|3569613_3569931_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
AVZ15481.1|3569951_3570281_+	toxin	NA	NA	NA	NA	NA
AVZ15482.1|3570965_3571892_-|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	44.4	2.9e-68
AVZ15483.1|3572041_3573766_-	flagellin	NA	NA	NA	NA	NA
AVZ15484.1|3577560_3578529_-	hypothetical protein	NA	G1CSU0	Cronobacter_virus	40.8	6.5e-55
AVZ15485.1|3578532_3580140_-	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	68.9	3.7e-212
AVZ15486.1|3580186_3581413_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	87.2	2.3e-129
AVZ15487.1|3581426_3582731_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	93.5	1.8e-233
AVZ15488.1|3582730_3584467_-|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	99.7	0.0e+00
AVZ15489.1|3584466_3584940_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	98.7	2.3e-85
AVZ15490.1|3585097_3585448_-	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	82.8	2.4e-52
AVZ15491.1|3585447_3586038_-	hypothetical protein	NA	S4TR53	Salmonella_phage	84.1	1.0e-95
AVZ15492.1|3586203_3586461_+	hypothetical protein	NA	K7P7V5	Enterobacteria_phage	95.1	2.7e-32
AVZ15493.1|3586761_3588219_-	glycosyltransferase family 2 protein	NA	K7PKP3	Enterobacterial_phage	92.8	1.2e-273
AVZ15494.1|3588409_3588700_+	lipoprotein bor	NA	C6ZCX3	Enterobacteria_phage	62.9	6.3e-30
AVZ16704.1|3588810_3589095_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	67.0	1.1e-26
AVZ16705.1|3589161_3589344_-	hypothetical protein	NA	K7PM01	Enterobacterial_phage	83.7	2.1e-15
AVZ15495.1|3590011_3590281_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	90.8	4.8e-32
AVZ15496.1|3590288_3590918_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	97.6	1.4e-114
AVZ15497.1|3590917_3591196_-|holin	phage holin family protein	holin	G8C7V9	Escherichia_phage	87.4	9.6e-36
AVZ15498.1|3591185_3591575_-	hypothetical protein	NA	G8C7V8	Escherichia_phage	94.5	2.3e-59
AVZ15499.1|3591655_3591883_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ15500.1|3591929_3592415_-	HNH endonuclease	NA	C4ML56	Xanthomonas_virus	42.7	1.5e-23
AVZ15501.1|3592709_3593492_-	antitermination protein	NA	F1C595	Cronobacter_phage	79.1	9.4e-113
AVZ15502.1|3593488_3593797_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ15503.1|3593798_3595670_-	bifunctional DNA primase/helicase	NA	K7PK08	Enterobacteria_phage	61.3	4.5e-230
AVZ15504.1|3595773_3596796_-	hypothetical protein	NA	V5URT9	Shigella_phage	55.6	4.0e-47
AVZ15505.1|3596788_3596998_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AVZ16706.1|3596999_3597224_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	59.7	1.3e-19
AVZ15506.1|3597336_3598035_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	62.5	3.0e-78
AVZ15507.1|3598236_3598668_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AVZ15508.1|3598734_3599121_+	S24 family peptidase	NA	F1C5A0	Cronobacter_phage	59.7	1.9e-37
AVZ15509.1|3599227_3599452_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ15510.1|3599444_3599852_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	87.5	2.1e-47
AVZ15511.1|3599805_3600417_+	HNH endonuclease	NA	A0A2I7S010	Vibrio_phage	47.2	6.6e-37
AVZ15512.1|3600406_3600829_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	66.4	1.6e-45
AVZ15513.1|3600932_3601244_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ15514.1|3601233_3601443_+	excisionase	NA	I6PBM8	Cronobacter_phage	97.1	4.4e-33
AVZ15515.1|3601397_3602570_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	91.0	8.3e-206
>prophage 6
CP028538	Enterobacter hormaechei strain SCEH020042 chromosome, complete genome	4776086	4052546	4103673	4776086	tRNA,plate,protease,head,tail,lysis,portal,terminase,capsid,integrase	Erwinia_phage(37.29%)	71	4058635:4058685	4103853:4103903
AVZ15923.1|4052546_4053560_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.6	5.3e-108
AYM45051.1|4053563_4053746_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ15924.1|4053796_4054012_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AVZ15925.1|4054127_4055873_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	1.4e-76
AVZ15927.1|4056026_4057871_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
AVZ15928.1|4057973_4058480_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
4058635:4058685	attL	ACTCATAATCGCTTGGTCGCTGGTTCAAGTCCAGCAGGGGCCACCAAATTT	NA	NA	NA	NA
AVZ15929.1|4058837_4059056_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	100.0	4.3e-39
AVZ15930.1|4059122_4060292_-	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	100.0	5.6e-210
AVZ15931.1|4060288_4060774_-|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	98.1	2.6e-84
AVZ15932.1|4060786_4063228_-|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	95.2	0.0e+00
AVZ15933.1|4063220_4063358_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	97.8	1.2e-18
AVZ15934.1|4063372_4063708_-|tail	phage tail assembly protein	tail	A0A218M4J8	Erwinia_phage	99.1	1.8e-52
AVZ15935.1|4063770_4064292_-|tail	phage major tail tube protein	tail	Q37845	Escherichia_phage	100.0	1.7e-94
AVZ15936.1|4064307_4065486_-|tail	phage tail sheath protein	tail	Q37844	Escherichia_phage	95.4	5.4e-213
AVZ15937.1|4065614_4066070_-|tail	tail fiber assembly protein	tail	A0A1B0V844	Salmonella_phage	47.8	6.0e-27
AVZ15938.1|4066036_4068058_-	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	53.9	3.2e-104
AVZ15939.1|4068064_4068598_-|tail	phage tail protein I	tail	Q37841	Escherichia_phage	92.6	2.1e-95
AVZ15940.1|4068590_4069499_-|plate	baseplate assembly protein	plate	Q37840	Escherichia_phage	94.4	2.8e-153
AVZ15941.1|4069505_4069853_-|plate	baseplate assembly protein	plate	A0A218M4K8	Erwinia_phage	98.3	9.4e-57
AVZ15942.1|4069849_4070485_-|plate	phage baseplate assembly protein V	plate	A0A2I8TV69	Erwinia_phage	96.2	4.3e-108
AVZ15943.1|4070553_4071003_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	96.6	8.7e-71
AVZ15944.1|4070995_4071463_-|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	99.4	4.2e-84
AVZ15945.1|4071425_4071599_-|lysis	phage lysis protein	lysis	O80311	Escherichia_phage	98.2	6.2e-25
AVZ15946.1|4071570_4071981_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A218M4K2	Erwinia_phage	75.7	1.7e-49
AVZ15947.1|4071980_4072412_-	lysA protein	NA	A0A218M4L6	Erwinia_phage	83.2	4.4e-64
AVZ15948.1|4072408_4072921_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	97.6	3.0e-91
AVZ15949.1|4072904_4073126_-	primosomal protein	NA	A0A218M4L5	Erwinia_phage	98.6	8.4e-35
AVZ15950.1|4073116_4073320_-|tail	phage tail protein	tail	A0A218M4L8	Erwinia_phage	97.0	2.6e-30
AVZ15951.1|4073319_4073829_-|head	head completion/stabilization protein	head	A0A218M4L7	Erwinia_phage	98.8	1.1e-90
AVZ15952.1|4073922_4074672_-|terminase	terminase	terminase	Q6K1I5	Salmonella_virus	87.6	6.9e-113
AVZ15953.1|4074675_4075743_-|capsid	phage major capsid protein, P2 family	capsid	O80304	Escherichia_phage	99.4	2.9e-197
AVZ15954.1|4075818_4076673_-|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	96.8	4.1e-154
AVZ15955.1|4076838_4078608_+	oxidoreductase	NA	A0A218M4M1	Erwinia_phage	99.7	0.0e+00
AVZ15956.1|4078607_4079654_+|portal	phage portal protein	portal	A0A2I8TV74	Erwinia_phage	95.1	1.2e-190
AVZ15957.1|4079674_4079875_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ15958.1|4079788_4079971_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ15959.1|4079956_4080142_+	hypothetical protein	NA	A0A0M4R4Y4	Salmonella_phage	75.0	7.3e-08
AVZ15960.1|4080138_4080870_-	hypothetical protein	NA	Q37850	Escherichia_phage	95.1	3.6e-130
AVZ15961.1|4080951_4081392_-	DinI family protein	NA	A0A218M4I0	Erwinia_phage	99.3	5.5e-70
AVZ15962.1|4081510_4083727_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	94.6	0.0e+00
AVZ15963.1|4083728_4083950_-	TraR/DksA family transcriptional regulator	NA	A0A218M4I6	Erwinia_phage	79.5	2.2e-27
AVZ15964.1|4083949_4084177_-	DUF2732 domain-containing protein	NA	A0A218M4I9	Erwinia_phage	78.7	3.4e-23
AVZ15965.1|4084246_4084447_-	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	92.4	3.7e-29
AVZ15966.1|4084433_4084661_-	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	93.3	3.9e-35
AVZ15967.1|4084668_4085178_-	phage regulatory CII family protein	NA	Q6K1F8	Salmonella_virus	86.4	9.9e-79
AVZ15968.1|4085208_4085472_-	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	72.4	7.4e-30
AVZ15969.1|4085564_4086194_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	56.6	7.9e-62
AVZ15970.1|4086193_4087237_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	96.8	6.3e-197
AVZ16717.1|4088156_4088495_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ15971.1|4088503_4089118_-|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	68.2	1.0e-66
AVZ15972.1|4089131_4090793_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	97.5	0.0e+00
AVZ15973.1|4090776_4091133_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	98.3	1.2e-59
AVZ15974.1|4091090_4091282_-|terminase	terminase	terminase	NA	NA	NA	NA
AVZ15975.1|4091408_4091852_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	89.1	1.4e-76
AVZ15976.1|4091851_4092145_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	81.4	1.2e-41
AVZ15977.1|4092137_4092476_-|head,tail	head-tail adaptor	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	48.6	5.1e-23
AVZ16718.1|4092472_4093699_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	97.3	9.9e-234
AVZ15978.1|4093709_4094270_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	98.4	1.0e-100
AVZ15979.1|4094321_4095488_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	99.0	2.6e-215
AVZ15980.1|4095731_4096505_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ16719.1|4096547_4096784_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ15981.1|4097151_4098516_-	hypothetical protein	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	96.0	2.7e-256
AVZ15982.1|4098512_4098881_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	98.4	1.8e-61
AVZ15983.1|4098877_4099105_-	aminotransferase	NA	A0A2H4JBA1	uncultured_Caudovirales_phage	87.8	1.0e-27
AVZ15984.1|4099097_4099283_-	hypothetical protein	NA	A0A2H4JFH8	uncultured_Caudovirales_phage	96.7	4.7e-23
AVZ16720.1|4099275_4099488_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	50.9	5.3e-10
AVZ16721.1|4099681_4099876_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ15985.1|4100389_4101169_-	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	52.0	4.3e-41
AVZ15986.1|4101177_4101387_-	DNA-binding protein	NA	NA	NA	NA	NA
AVZ16722.1|4101529_4101889_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ16723.1|4102251_4103673_-	DUF4102 domain-containing protein	NA	H7BV31	unidentified_phage	27.2	8.8e-08
4103853:4103903	attR	ACTCATAATCGCTTGGTCGCTGGTTCAAGTCCAGCAGGGGCCACCAAATTT	NA	NA	NA	NA
>prophage 1
CP028537	Enterobacter hormaechei strain SCEH020042 plasmid pQnrB4_020042, complete sequence	328828	61632	104963	328828	transposase	Escherichia_phage(30.77%)	44	NA	NA
AVZ12027.1|61632_62655_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	4.6e-200
AVZ12028.1|62651_63434_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
AVZ12029.1|64271_65771_-	kinase	NA	NA	NA	NA	NA
AVZ12030.1|65796_67434_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
AVZ12031.1|67433_68474_-	VWA domain-containing protein	NA	NA	NA	NA	NA
AVZ12032.1|68559_69198_-	VWA domain-containing protein	NA	NA	NA	NA	NA
AVZ12033.1|69197_69839_-	tellurium resistance protein TerX	NA	NA	NA	NA	NA
AVZ12034.1|69861_70500_-	VWA domain-containing protein	NA	NA	NA	NA	NA
AVZ12035.1|70962_71430_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
AVZ12036.1|71447_72656_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
AVZ12037.1|72666_73623_-	citrate lyase subunit beta	NA	NA	NA	NA	NA
AVZ12038.1|73622_74702_-	hypothetical protein	NA	A0A172Q0S8	Acinetobacter_phage	33.8	8.1e-38
AVZ12039.1|74703_75477_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ12040.1|75469_76612_-	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	1.7e-30
AVZ12041.1|76621_77680_-	carbamoyl-phosphate synthase large chain	NA	NA	NA	NA	NA
AVZ12042.1|78003_78585_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
AVZ12043.1|78584_79742_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
AVZ12044.1|79764_80220_+	Tellurite resistance protein TerB	NA	NA	NA	NA	NA
AVZ12045.1|80242_81283_+	tellurium resistance protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
AVZ12046.1|81331_81910_+	TerD family protein	NA	A0A2P1N0L4	Streptomyces_phage	40.0	3.3e-06
AVZ12047.1|81977_82553_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
AVZ12048.1|82981_84223_+	tellurium resistance protein TerF	NA	NA	NA	NA	NA
AVZ12049.1|84785_85067_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ12050.1|85116_85308_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ12051.1|85399_85771_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ12052.1|86113_86506_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ12053.1|86484_86796_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ12294.1|87109_87403_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVZ12054.1|87407_88733_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
AVZ12055.1|88793_89000_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ12056.1|89101_89512_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ12057.1|89524_90340_+	HNH endonuclease	NA	G0X580	Salmonella_phage	36.5	1.1e-15
AVZ12058.1|90593_91019_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ12059.1|91567_91876_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ12060.1|91891_92749_+	HNH endonuclease	NA	G0X580	Salmonella_phage	34.2	3.9e-11
AVZ12061.1|92810_93014_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ12062.1|93100_93280_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ12063.1|94469_94811_-	RamA family antibiotic efflux transcriptional regulator	NA	D0R0F8	Streptococcus_phage	29.8	2.0e-06
AVZ12064.1|95397_96660_-|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AVZ12065.1|97297_98002_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVZ12066.1|98965_99808_+|transposase	transposase	transposase	NA	NA	NA	NA
AVZ12067.1|99794_101918_+|transposase	transposase	transposase	NA	NA	NA	NA
AVZ12068.1|101917_103366_+	ATP-binding protein	NA	NA	NA	NA	NA
AVZ12069.1|103406_104963_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
CP028537	Enterobacter hormaechei strain SCEH020042 plasmid pQnrB4_020042, complete sequence	328828	139983	189293	328828	integrase,transposase	Escherichia_phage(38.1%)	48	173114:173173	176706:177527
AVZ12104.1|139983_142881_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	9.3e-182
AVZ12105.1|142975_143581_+	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
AVZ12106.1|146325_146775_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	9.0e-60
AVZ12107.1|146833_147538_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVZ12108.1|148527_148704_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
AVZ12109.1|149033_149849_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AVZ12110.1|149935_150238_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AVZ12111.1|150131_150383_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ12112.1|150413_151907_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AVZ12113.1|152018_152324_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVZ12114.1|152351_153566_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
AVZ12115.1|153782_154667_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
AVZ12116.1|154697_156191_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AVZ12117.1|156401_156626_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ12118.1|156622_157360_-	resolvase	NA	NA	NA	NA	NA
AVZ12119.1|157466_157958_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ12120.1|157991_158696_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVZ12121.1|158783_160361_+	PAS domain S-box protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.2e-95
AVZ12122.1|161020_161308_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ12123.1|161773_162550_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AVZ12124.1|162620_163574_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AVZ12125.1|163593_163992_-	ester cyclase	NA	NA	NA	NA	NA
AVZ12126.1|164823_165528_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVZ12127.1|165473_165683_-	hypothetical protein	NA	Q1MVP5	Enterobacteria_phage	89.5	8.9e-10
AVZ12128.1|165721_166108_+	bleomycin binding protein	NA	NA	NA	NA	NA
AVZ12129.1|166427_166820_-	NimC/NimA family protein	NA	NA	NA	NA	NA
AVZ12130.1|167154_167859_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVZ12131.1|168178_169354_+	multidrug efflux RND transporter periplasmic adaptor subunit OqxA	NA	NA	NA	NA	NA
AVZ12132.1|169377_172530_+	multidrug efflux RND transporter permease subunit OqxB	NA	NA	NA	NA	NA
AVZ12133.1|172599_173079_-	transcriptional regulator	NA	NA	NA	NA	NA
173114:173173	attL	TTGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACAT	NA	NA	NA	NA
AVZ12134.1|173167_173872_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVZ12135.1|174100_174415_-|transposase	transposase	transposase	NA	NA	NA	NA
AVZ12136.1|174353_175367_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AVZ12298.1|175524_175998_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
AVZ12137.1|176759_177464_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVZ12138.1|177454_177643_+	hypothetical protein	NA	NA	NA	NA	NA
176706:177527	attR	TTGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCC	NA	NA	NA	NA
AVZ12139.1|177730_179167_+	glutathione synthase	NA	NA	NA	NA	NA
AVZ12140.1|179584_180589_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AVZ12141.1|180770_181043_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ12299.1|181087_181792_-	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	28.7	6.4e-20
AVZ12142.1|181821_182526_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVZ12300.1|182550_183801_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AVZ12143.1|184040_184682_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AVZ12144.1|184922_185273_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ12145.1|185504_186308_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AVZ12146.1|186307_187144_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AVZ12147.1|187479_188295_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.2	4.8e-160
AVZ12148.1|188588_189293_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 3
CP028537	Enterobacter hormaechei strain SCEH020042 plasmid pQnrB4_020042, complete sequence	328828	233337	262135	328828	integrase,transposase	Escherichia_phage(46.15%)	34	243421:243480	260596:261416
AVZ12194.1|233337_234576_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	23.1	2.5e-11
AVZ12195.1|234997_236338_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AVZ12196.1|236768_237374_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ12197.1|237590_237872_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ12198.1|238247_238559_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ12199.1|238781_238982_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ12200.1|239021_239246_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ12201.1|239300_239504_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ12202.1|239683_239977_-	hypothetical protein	NA	I7B2L9	Escherichia_phage	38.6	4.1e-05
AVZ12203.1|240056_240548_-	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
AVZ12204.1|240552_240864_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
AVZ12205.1|241065_241284_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ12206.1|241380_241701_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ12207.1|241879_242110_-	hypothetical protein	NA	NA	NA	NA	NA
243421:243480	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
AVZ12208.1|243483_244188_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVZ12209.1|244677_245787_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	2.8e-33
AVZ12210.1|245881_247066_-	tetracycline efflux MFS transporter Tet(D)	NA	NA	NA	NA	NA
AVZ12211.1|247161_247818_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AVZ12212.1|247829_248534_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVZ12213.1|248567_249059_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ12214.1|249165_249903_+	resolvase	NA	NA	NA	NA	NA
AVZ12215.1|249899_250124_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ12216.1|250245_250422_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
AVZ12217.1|250603_251608_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AVZ12218.1|251686_254653_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.8	0.0e+00
AVZ12219.1|254773_255478_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVZ12220.1|255514_256534_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.1e-71
AVZ12221.1|256710_257265_+	aminoglycoside N-acetyltransferase AAC(6')-Ib3	NA	NA	NA	NA	NA
AVZ12222.1|257492_258233_-	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	41.7	4.4e-43
AVZ12303.1|258219_259728_-|transposase	IS21-like element ISCfr8 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	32.7	9.9e-26
AVZ12223.1|259887_260592_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVZ12224.1|260667_261168_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AVZ12225.1|261186_261366_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ12226.1|261295_262135_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
260596:261416	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCCCGAACGGACGTTAGATTTCGAGTTCTAGGCGTTCTGCGATGAAGGTTGGATCCCAGCCGGGATTGAAAGTGTCGACGTGGGTGAATCCGAGCCGCTCGTATAGGCCACGCAGGTTCGGGTGGCAGTCGAGCCGCAGCTTGGCGCACCCCTGCGTTCGCGCGGCATGGCGGCAAGCCTCGATCAGCGCGGAGCTGACACCCCGGCCCGCATGTGTCCGTCGCACCGCGAGCTTGTGCAGATATGCGGCCTCCCCCTTGAGGGCGTCGGGCCAGAACTCGGGATCCTCGGCCGACAAGGTGCAACAGCCGACGATGCCGTCGCTGCAACTCGCGACTAGGAGCTCGGATCTCAGGACGAAGGTCTCCGCGAATGTCCGGTCGATCCGCGCGACGTCCCAGGCGGGCGTTCCCTTGGCGGACATCCACGCCGCAGCGTCGTGCATCAGCCGCACAACCTCGTCGATATCACCCGAGCAGGCGACCCGAACGTTCGGAGGCTCCTCGCTGTCCATTCGCTCCCCTGGCGCGGTATGAACCGCCGCCTCATAGTGCAGTTTGATCCTGACGAGCCCAGCATGTCTGCGCCCACCTTCGCGGAACCTGACCAGGGTCCGCTAGCGGGCGGCCGGAAGGTGAATGCTAGGCATGATCTAACCCTCGGTCTCTGGCGTCGCGACTGCGAAATTTCGCGAGGGTTTCCGAGAAGGTGATTGCGCTTCGCAGATCTCCAGGCGCGTGGGTGCGGACGTAGTCAGCGCCA	NA	NA	NA	NA
