The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028574	Acinetobacter pittii strain WCHAP005046 chromosome, complete genome	4052410	626329	647987	4052410	terminase,portal	Acinetobacter_phage(66.67%)	36	NA	NA
AVZ03906.1|626329_626620_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	43.5	9.7e-15
AVZ03907.1|626678_628313_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	60.8	8.1e-175
AVZ03908.1|628451_628676_-	hypothetical protein	NA	A0A0P0J067	Acinetobacter_phage	44.1	1.3e-06
AVZ03909.1|628675_629011_-	hypothetical protein	NA	A0A0P0HSE1	Acinetobacter_phage	57.3	5.0e-31
AVZ03910.1|629007_629232_-	hypothetical protein	NA	I2GUB4	Acinetobacter_phage	94.5	3.1e-37
AVZ03911.1|629218_629596_-	hypothetical protein	NA	A0A1B1P9F6	Acinetobacter_phage	93.4	1.4e-34
AVZ03912.1|629607_629871_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ03913.1|629867_630125_-	hypothetical protein	NA	K4HYN5	Acinetobacter_phage	77.5	8.0e-29
AVZ03914.1|630134_631034_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ03915.1|631036_631888_-	nuclease	NA	G8CLD3	Synechococcus_phage	30.9	6.2e-33
AVZ03916.1|631897_632227_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ03917.1|632226_632613_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ03918.1|632609_633422_-	hypothetical protein	NA	A0A068CDC2	Acinetobacter_phage	43.1	2.6e-41
AVZ03919.1|633414_633912_-	hypothetical protein	NA	A0A2H4J4Q4	uncultured_Caudovirales_phage	74.5	3.6e-65
AVZ03920.1|633911_634112_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ03921.1|634495_634774_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ03922.1|634825_635041_-	hypothetical protein	NA	A0A0P0I8I5	Acinetobacter_phage	98.6	1.6e-30
AVZ03923.1|635055_635820_-	XRE family transcriptional regulator	NA	J7I4M9	Acinetobacter_phage	91.5	2.3e-132
AVZ03924.1|635897_636083_+	hypothetical protein	NA	J7HXD2	Acinetobacter_phage	91.8	3.0e-25
AVZ03925.1|636093_636450_+	hypothetical protein	NA	A0A0P0IKQ0	Acinetobacter_phage	72.0	1.4e-47
AVZ03926.1|636663_637500_+	replication protein	NA	NA	NA	NA	NA
AVZ03927.1|637499_638816_+	DNA helicase	NA	A0A2H4J6D5	uncultured_Caudovirales_phage	74.7	1.6e-165
AVZ06915.1|639022_639280_+	hypothetical protein	NA	A0A0D4DBT5	Acinetobacter_phage	50.0	1.1e-12
AVZ03928.1|639281_639782_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ03929.1|639778_640141_+	hypothetical protein	NA	A0A220NQK3	Acinetobacter_phage	89.1	1.1e-47
AVZ03930.1|640144_640570_+	VRR-NUC domain-containing protein	NA	A0A0D4DBJ8	Acinetobacter_phage	95.0	8.8e-73
AVZ03931.1|640541_640823_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ03932.1|640853_641405_+	hypothetical protein	NA	A0A1B1P9I8	Acinetobacter_phage	63.4	1.7e-60
AVZ03933.1|641880_642126_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ03934.1|642294_642570_+	DUF968 domain-containing protein	NA	A0A0D4DC07	Acinetobacter_phage	61.5	1.1e-23
AVZ03935.1|642572_642842_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ03936.1|642906_643392_+	hypothetical protein	NA	A0A0D4DC11	Acinetobacter_phage	56.9	6.4e-43
AVZ03937.1|643401_643665_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ03938.1|643668_644190_+|terminase	terminase small subunit	terminase	A0A1W6JNT5	Morganella_phage	59.9	1.1e-51
AVZ03939.1|644194_645736_+|terminase	terminase	terminase	A0A1Y0SUC5	Pseudomonas_phage	59.0	1.6e-172
AVZ03940.1|645737_647987_+|portal	portal protein p19	portal	I3PUX6	Vibrio_phage	31.9	2.5e-73
>prophage 2
CP028574	Acinetobacter pittii strain WCHAP005046 chromosome, complete genome	4052410	757108	768049	4052410		Burkholderia_phage(16.67%)	11	NA	NA
AVZ04033.1|757108_760942_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.7	2.1e-109
AVZ06924.1|761058_762225_+	MFS transporter	NA	S4TR35	Salmonella_phage	28.8	6.9e-27
AVZ04034.1|762621_762942_+	NGG1p interacting factor NIF3	NA	A0A1E1EXH0	Acanthamoeba_castellanii_mimivirus	28.6	6.5e-12
AVZ04035.1|762934_763735_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AVZ06925.1|763844_764420_+	nicotinamide-nucleotide adenylyltransferase	NA	A0A292GDD2	Xanthomonas_phage	35.5	6.9e-20
AVZ04036.1|764431_764794_-	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
AVZ04037.1|764805_765375_-	CAP domain-containing protein	NA	NA	NA	NA	NA
AVZ04038.1|765492_765954_-	peroxiredoxin	NA	NA	NA	NA	NA
AVZ04039.1|766196_766613_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ04040.1|766629_767310_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	38.4	6.6e-30
AVZ04041.1|767338_768049_-	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	39.7	7.4e-40
>prophage 3
CP028574	Acinetobacter pittii strain WCHAP005046 chromosome, complete genome	4052410	977373	992180	4052410		Acinetobacter_phage(100.0%)	10	NA	NA
AVZ04205.1|977373_977928_-	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	99.5	7.9e-98
AVZ04206.1|978183_979683_+	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	93.6	5.6e-271
AVZ04207.1|979684_982060_+	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	96.8	0.0e+00
AVZ04208.1|982066_983050_+	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	89.9	4.7e-170
AVZ04209.1|983060_983756_-	DNA mismatch repair protein MutS	NA	A0A0P0IDT4	Acinetobacter_phage	97.0	1.0e-118
AVZ04210.1|983765_984572_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	97.8	2.1e-144
AVZ06942.1|984581_985631_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	99.1	3.1e-188
AVZ04211.1|985988_988721_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	96.0	0.0e+00
AVZ04212.1|988799_991499_+	M1 family peptidase	NA	A0A0P0IY26	Acinetobacter_phage	97.6	0.0e+00
AVZ04213.1|991595_992180_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	98.5	3.3e-110
>prophage 4
CP028574	Acinetobacter pittii strain WCHAP005046 chromosome, complete genome	4052410	1004032	1076456	4052410	terminase,tail,protease,integrase,head,coat	Acinetobacter_phage(53.66%)	78	998042:998057	1048210:1048225
998042:998057	attL	GCTTTTTTATTGCCTG	NA	NA	NA	NA
AVZ04224.1|1004032_1005208_+|protease	serine protease	protease	W5SAB9	Pithovirus	29.6	2.8e-07
AVZ04225.1|1005250_1006489_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	46.2	1.6e-90
AVZ04226.1|1006580_1008851_-	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
AVZ04227.1|1009087_1011940_-	phosphodiesterase	NA	NA	NA	NA	NA
AVZ04228.1|1012073_1012796_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AVZ04229.1|1012814_1013651_-	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
AVZ04230.1|1013721_1015104_-	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	30.4	9.0e-42
AVZ04231.1|1015325_1015862_+	peptidase C39	NA	NA	NA	NA	NA
AVZ04232.1|1015899_1016283_-	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AVZ04233.1|1016389_1018852_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AVZ04234.1|1019131_1020145_-	lipoyl synthase	NA	NA	NA	NA	NA
AVZ04235.1|1020341_1021754_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
AVZ04236.1|1021997_1023212_-	MFS transporter	NA	NA	NA	NA	NA
AVZ04237.1|1023382_1024729_-	MFS transporter	NA	NA	NA	NA	NA
AVZ04238.1|1026457_1027285_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
AVZ04239.1|1027495_1028248_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
AVZ04240.1|1028385_1029261_+	elongation factor Ts	NA	NA	NA	NA	NA
AVZ04241.1|1029326_1029812_+	DUF3465 domain-containing protein	NA	NA	NA	NA	NA
AVZ04242.1|1029917_1030742_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVZ04243.1|1030830_1031547_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AVZ04244.1|1031548_1031866_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
AVZ04245.1|1031909_1032359_-	DUF962 domain-containing protein	NA	NA	NA	NA	NA
AVZ04246.1|1032932_1033544_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	46.6	4.6e-22
AVZ04247.1|1033833_1034835_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
AVZ04248.1|1034854_1035997_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
AVZ04249.1|1036123_1036774_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ04250.1|1036797_1037610_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A126HHM5	Vibrio_phage	35.6	3.9e-37
AVZ04251.1|1037606_1038380_-	ABC transporter permease	NA	NA	NA	NA	NA
AVZ04252.1|1038376_1039312_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.0	1.1e-22
AVZ04253.1|1039609_1040596_+|integrase	site-specific integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	99.4	8.1e-186
AVZ04254.1|1040592_1040862_-	hypothetical protein	NA	A0A1B1P9G0	Acinetobacter_phage	95.5	3.4e-46
AVZ04255.1|1040863_1041058_-	hypothetical protein	NA	A0A1B1P9G2	Acinetobacter_phage	100.0	2.2e-31
AVZ04256.1|1041054_1041264_-	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	94.2	3.7e-32
AVZ04257.1|1041260_1041647_-	hypothetical protein	NA	A0A1B1P9F6	Acinetobacter_phage	70.8	1.9e-34
AVZ04258.1|1041658_1041922_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ04259.1|1041918_1042176_-	hypothetical protein	NA	K4HYN5	Acinetobacter_phage	77.5	8.0e-29
AVZ04260.1|1042567_1043077_+|terminase	terminase small subunit	terminase	A0A1W6JNT5	Morganella_phage	61.1	1.8e-48
AVZ04261.1|1043139_1043856_+	hypothetical protein	NA	I6WLP4	Burkholderia_virus	33.8	2.6e-24
AVZ04262.1|1043824_1045321_+|terminase	terminase	terminase	I6PBN3	Cronobacter_phage	68.3	9.3e-194
AVZ04263.1|1045328_1046732_+	hypothetical protein	NA	A0A0P0IDW1	Acinetobacter_phage	51.6	1.4e-127
AVZ04264.1|1046697_1047783_+|head	phage head morphogenesis protein	head	A0A1B1P9B7	Acinetobacter_phage	95.3	2.2e-192
AVZ04265.1|1047779_1048010_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ04266.1|1048285_1049092_+	hypothetical protein	NA	A0A0P0J090	Acinetobacter_phage	56.9	2.9e-64
1048210:1048225	attR	GCTTTTTTATTGCCTG	NA	NA	NA	NA
AVZ04267.1|1049104_1050259_+|coat	P22 coat - protein 5 family protein	coat	W6EBZ8	Rhizobium_phage	55.5	1.0e-99
AVZ04268.1|1050298_1050712_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ04269.1|1050715_1051108_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ04270.1|1051110_1051491_+	glutamate 5-kinase	NA	A0A1B1P9E3	Acinetobacter_phage	85.2	1.3e-56
AVZ04271.1|1051658_1052114_+	hypothetical protein	NA	A0A1B1P9D5	Acinetobacter_phage	68.9	8.6e-50
AVZ04272.1|1052115_1052511_+	hypothetical protein	NA	A0A1B1P9D6	Acinetobacter_phage	93.1	3.9e-67
AVZ04273.1|1052670_1053198_+	Rha family transcriptional regulator	NA	A0A1B1P9D9	Acinetobacter_phage	63.7	3.9e-54
AVZ04274.1|1053197_1053464_+	hypothetical protein	NA	A0A1B1P9E1	Acinetobacter_phage	90.9	3.3e-41
AVZ04275.1|1053529_1054459_+	hypothetical protein	NA	A0A1B1P9E0	Acinetobacter_phage	96.8	2.5e-165
AVZ04276.1|1054474_1054969_+	hypothetical protein	NA	A0A1B1P9G4	Acinetobacter_phage	97.0	2.6e-84
AVZ06943.1|1055013_1055220_+	hypothetical protein	NA	A0A1B1P9F7	Acinetobacter_phage	95.6	1.5e-30
AVZ04277.1|1055530_1056112_+	DUF4065 domain-containing protein	NA	NA	NA	NA	NA
AVZ04278.1|1056126_1056549_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ04279.1|1056629_1056806_+	hypothetical protein	NA	A0A0R6PI25	Moraxella_phage	59.6	4.8e-09
AVZ04280.1|1056814_1057225_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
AVZ04281.1|1057234_1057582_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ04282.1|1057636_1058038_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ04283.1|1058100_1060809_+	hypothetical protein	NA	A0A1B1P9E6	Acinetobacter_phage	88.9	0.0e+00
AVZ06944.1|1060984_1062151_+	recombinase RecF	NA	C7BGE8	Burkholderia_phage	27.3	2.4e-35
AVZ04284.1|1062154_1062874_+	HNH endonuclease	NA	NA	NA	NA	NA
AVZ04285.1|1062963_1063305_+|tail	phage tail protein	tail	A0A0R6PHH7	Moraxella_phage	45.9	8.8e-15
AVZ04286.1|1063357_1064212_+	hypothetical protein	NA	E5KJQ6	Acinetobacter_phage	68.9	2.3e-48
AVZ04287.1|1064198_1065005_+|tail	phage minor tail protein L	tail	A0A0R6PGU8	Moraxella_phage	64.6	2.7e-94
AVZ04288.1|1065011_1065767_+|tail	phage tail protein	tail	A0A0R6PIM4	Moraxella_phage	55.8	1.2e-83
AVZ04289.1|1065750_1066416_+|tail	tail assembly protein	tail	A0A0R6PIW1	Moraxella_phage	49.1	1.0e-43
AVZ04290.1|1066472_1070873_+	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	64.8	0.0e+00
AVZ04291.1|1070869_1071409_+	DUF4376 domain-containing protein	NA	A0A172Q0F8	Acinetobacter_phage	43.2	1.3e-28
AVZ04292.1|1071474_1071831_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ04293.1|1071827_1072046_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ04294.1|1072035_1072590_+	lysozyme	NA	A0A068CDE9	Acinetobacter_phage	80.4	1.5e-80
AVZ04295.1|1072785_1072974_+	hypothetical protein	NA	A0A1B1P9F8	Acinetobacter_phage	96.7	1.1e-27
AVZ04296.1|1073234_1073864_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ04297.1|1074008_1074695_-	DNA polymerase III subunit epsilon	NA	A0A059VJT9	Pseudomonas_phage	43.9	2.0e-34
AVZ04298.1|1074980_1075142_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ04299.1|1075202_1076456_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	52.3	1.1e-97
>prophage 5
CP028574	Acinetobacter pittii strain WCHAP005046 chromosome, complete genome	4052410	1331399	1375305	4052410	holin,protease,transposase	Enterobacteria_phage(20.0%)	46	NA	NA
AVZ04513.1|1331399_1331738_-|transposase	transposase	transposase	NA	NA	NA	NA
AVZ04514.1|1331829_1332234_-|transposase	DDE transposase family protein	transposase	NA	NA	NA	NA
AVZ04515.1|1332369_1334604_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AVZ04516.1|1334686_1335619_+|transposase	IS5/IS1182 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.9	5.0e-60
AVZ04517.1|1335746_1336430_+	Fe2+-dependent dioxygenase	NA	A0A127KM56	Cyanophage	32.9	3.9e-22
AVZ04518.1|1336471_1336867_-	transcriptional repressor	NA	NA	NA	NA	NA
AVZ04519.1|1337264_1337780_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ04520.1|1337893_1338616_-	GMP synthase	NA	A0A2K9L2L9	Tupanvirus	24.0	2.9e-07
AVZ04521.1|1338882_1339113_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ04522.1|1339264_1339639_+	energy transducer TonB	NA	NA	NA	NA	NA
AVZ04523.1|1339905_1340175_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ04524.1|1340482_1340941_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	48.6	1.9e-33
AVZ04525.1|1341127_1341328_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ04526.1|1341511_1342021_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
AVZ04527.1|1342037_1342610_+	lysozyme	NA	I2GUG4	Acinetobacter_phage	68.3	6.8e-52
AVZ04528.1|1343169_1343403_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ04529.1|1344864_1345128_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ04530.1|1345184_1346039_-	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AVZ04531.1|1346262_1347132_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVZ04532.1|1347322_1347454_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ04533.1|1347728_1348016_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ04534.1|1348264_1348627_+	DNA-binding protein	NA	NA	NA	NA	NA
AVZ04535.1|1348718_1349225_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVZ04536.1|1349432_1349861_+	DNA breaking-rejoining protein	NA	NA	NA	NA	NA
AVZ06963.1|1349929_1351456_-	ABC transporter ATP-binding protein	NA	A0A1V0SKJ1	Klosneuvirus	27.5	5.7e-21
AVZ04537.1|1351773_1352217_-	universal stress protein	NA	NA	NA	NA	NA
AVZ04538.1|1352507_1352735_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ04539.1|1352899_1353832_-|transposase	IS5/IS1182 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.9	5.0e-60
AVZ04540.1|1353958_1354132_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ04541.1|1354399_1354843_+	RDD family protein	NA	NA	NA	NA	NA
AVZ04542.1|1354903_1356079_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ04543.1|1356244_1356739_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AVZ04544.1|1356792_1357443_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
AVZ04545.1|1357518_1358508_-	transaldolase	NA	NA	NA	NA	NA
AVZ04546.1|1358638_1359532_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVZ06964.1|1359532_1360057_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ04547.1|1360121_1361690_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
AVZ04548.1|1361925_1363317_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AVZ04549.1|1363391_1364246_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ04550.1|1364317_1365577_+	esterase	NA	A0A2K9L1U3	Tupanvirus	23.2	2.3e-12
AVZ04551.1|1365624_1366203_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AVZ04552.1|1366327_1367806_+	methyl viologen resistance protein SmvA	NA	A0A0M3UL24	Mycobacterium_phage	26.4	6.1e-28
AVZ04553.1|1368064_1369846_+	metalloendopeptidase CpaA	NA	NA	NA	NA	NA
AVZ04554.1|1369868_1370501_+|protease	metalloprotease secretion chaperone CpaB	protease	NA	NA	NA	NA
AVZ04555.1|1370623_1372753_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	31.5	6.2e-42
AVZ04556.1|1373076_1375305_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
>prophage 6
CP028574	Acinetobacter pittii strain WCHAP005046 chromosome, complete genome	4052410	1950658	2032781	4052410	terminase,transposase,tRNA,holin,portal,capsid,integrase,head,tail	Acinetobacter_phage(40.82%)	104	1987486:1987504	2029836:2029854
AVZ05058.1|1950658_1951744_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
AVZ05059.1|1951992_1952223_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ05060.1|1952258_1953005_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ05061.1|1953198_1953789_+|holin	phosphatidylcholine--retinol O-acyltransferase	holin	NA	NA	NA	NA
AVZ05062.1|1954292_1955451_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	38.1	1.1e-48
AVZ05063.1|1955878_1956286_+	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AVZ05064.1|1956341_1958330_-	transketolase	NA	NA	NA	NA	NA
AVZ05065.1|1958866_1960033_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	61.1	1.6e-124
AVZ07001.1|1960161_1960302_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ05066.1|1960669_1960861_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ05067.1|1960927_1961494_-	FxsA protein	NA	NA	NA	NA	NA
AVZ05068.1|1961910_1962732_+	OXA-213 family carbapenem-hydrolyzing class D beta-lactamase OXA-417	NA	NA	NA	NA	NA
AVZ05069.1|1962811_1963357_-	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	28.5	9.7e-16
AVZ05070.1|1963353_1963947_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVZ05071.1|1964145_1964691_+	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
AVZ05072.1|1964695_1966156_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
AVZ07002.1|1966212_1967283_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
AVZ05073.1|1967370_1968360_+	biotin synthase BioB	NA	NA	NA	NA	NA
AVZ05074.1|1968408_1968621_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ05075.1|1968684_1969035_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ05076.1|1969444_1970017_+	ferrous iron transporter B	NA	NA	NA	NA	NA
AVZ05077.1|1970090_1970834_+	pilus assembly protein	NA	NA	NA	NA	NA
AVZ07003.1|1970973_1973418_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AVZ05078.1|1973414_1974434_+	fimbrial protein	NA	NA	NA	NA	NA
AVZ05079.1|1975252_1976251_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVZ05080.1|1976354_1976981_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ05081.1|1977047_1977899_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVZ07004.1|1978005_1978923_+	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AVZ05082.1|1979159_1979624_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ05083.1|1979865_1981281_+	cytosine permease	NA	NA	NA	NA	NA
AVZ05084.1|1981340_1981778_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ05085.1|1981867_1982752_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVZ05086.1|1984103_1984979_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ05087.1|1985245_1985818_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AVZ05088.1|1986004_1986550_+	acyltransferase	NA	NA	NA	NA	NA
AVZ05089.1|1986711_1987461_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
1987486:1987504	attL	CGCACCATTTGGTGCGTTT	NA	NA	NA	NA
AVZ05090.1|1987611_1987809_-	hypothetical protein	NA	A0A1B1P9F8	Acinetobacter_phage	57.1	6.2e-13
AVZ05091.1|1987904_1988096_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ05092.1|1988043_1988412_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ05093.1|1988411_1988921_-	lysozyme	NA	A0A0B5L5F7	Acinetobacter_phage	58.6	2.6e-47
AVZ05094.1|1988904_1989180_-|holin	holin	holin	NA	NA	NA	NA
AVZ05095.1|1989245_1989785_-	hypothetical protein	NA	A0A172Q0F8	Acinetobacter_phage	43.9	3.4e-29
AVZ05096.1|1989781_1994182_-|tail	phage tail protein	tail	A0A0R6PIC9	Moraxella_phage	64.8	0.0e+00
AVZ05097.1|1994238_1994904_-|tail	tail assembly protein	tail	A0A0R6PIW1	Moraxella_phage	49.1	1.0e-43
AVZ05098.1|1994887_1995643_-|tail	phage tail protein	tail	A0A0R6PIM4	Moraxella_phage	55.8	1.2e-83
AVZ05099.1|1995649_1996456_-|tail	phage minor tail protein L	tail	A0A0R6PGU8	Moraxella_phage	64.6	2.7e-94
AVZ05100.1|1996442_1997297_-	hypothetical protein	NA	E5KJQ6	Acinetobacter_phage	68.9	2.3e-48
AVZ05101.1|1997350_1997692_-|tail	phage tail protein	tail	A0A0R6PHH7	Moraxella_phage	43.1	1.3e-13
AVZ05102.1|1998002_2001677_-	replication protein	NA	D4FUM0	Pseudomonas_phage	29.8	2.0e-40
AVZ05103.1|2001739_2002072_-	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	41.4	5.0e-15
AVZ05104.1|2002151_2002367_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ05105.1|2002402_2002918_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ05106.1|2002917_2003391_-	structural protein 3 family protein	NA	A0A2H4JBZ0	uncultured_Caudovirales_phage	62.8	2.1e-54
AVZ05107.1|2003461_2003986_-	Rha family transcriptional regulator	NA	A0A0P0HSR5	Acinetobacter_phage	63.7	3.4e-58
AVZ05108.1|2004157_2004520_-	DUF3168 domain-containing protein	NA	A0A2H4J359	uncultured_Caudovirales_phage	61.0	3.6e-35
AVZ05109.1|2004516_2004978_-	hypothetical protein	NA	A0A2H4J6A2	uncultured_Caudovirales_phage	65.1	5.6e-49
AVZ05110.1|2004986_2005334_-|head,tail	head-tail adaptor protein	head,tail	A0A1J0GUY4	Halomonas_phage	45.8	3.1e-15
AVZ05111.1|2005480_2005774_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JAM4	uncultured_Caudovirales_phage	55.1	7.5e-23
AVZ05112.1|2005770_2007231_-|portal	phage portal protein	portal	A0A2H4JB65	uncultured_Caudovirales_phage	61.4	3.0e-168
AVZ05113.1|2007500_2008847_-|capsid	phage major capsid protein	capsid	A0A2H4JBZ9	uncultured_Caudovirales_phage	79.6	1.3e-175
AVZ05114.1|2008843_2009437_-	peptidase U35	NA	A0A2H4J367	uncultured_Caudovirales_phage	77.2	4.8e-85
AVZ05115.1|2009491_2010994_-|terminase	terminase	terminase	Q9MCV7	Escherichia_phage	67.7	8.5e-187
AVZ05116.1|2011028_2011493_-	TerS protein	NA	A0A0F7L441	uncultured_marine_virus	45.5	2.1e-27
AVZ05117.1|2011601_2011937_-	HNH endonuclease	NA	B5WZZ4	Pseudomonas_phage	53.3	1.2e-29
AVZ05118.1|2011969_2012269_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ05119.1|2012271_2012487_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ05120.1|2012559_2012754_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ05121.1|2012914_2013397_-	hypothetical protein	NA	A0A0D4DC11	Acinetobacter_phage	70.6	1.8e-61
AVZ05122.1|2013461_2013731_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ05123.1|2013733_2014009_-	hypothetical protein	NA	A0A0D4DC07	Acinetobacter_phage	82.4	4.1e-39
AVZ05124.1|2014001_2014220_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ05125.1|2014636_2015098_-	hypothetical protein	NA	A0A2H4J353	uncultured_Caudovirales_phage	75.2	7.6e-62
AVZ05126.1|2015128_2015362_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ05127.1|2015381_2015807_-	VRR-NUC domain-containing protein	NA	A0A0D4DBJ8	Acinetobacter_phage	97.2	8.0e-74
AVZ05128.1|2015810_2016173_-	hypothetical protein	NA	A0A220NQK3	Acinetobacter_phage	89.1	1.1e-47
AVZ05129.1|2016169_2016664_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ05130.1|2016663_2017023_-	hypothetical protein	NA	I2GUD2	Acinetobacter_phage	87.2	8.9e-18
AVZ05131.1|2017015_2017234_-	hypothetical protein	NA	A0A068CDE4	Acinetobacter_phage	40.3	5.1e-08
AVZ05132.1|2017226_2017631_-	hypothetical protein	NA	A0A068CDI0	Acinetobacter_phage	35.0	1.2e-10
AVZ05133.1|2017627_2017864_-	hypothetical protein	NA	A0A0R6PHM6	Moraxella_phage	87.1	6.7e-30
AVZ05134.1|2017860_2018286_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ05135.1|2018282_2018525_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ05136.1|2018521_2019319_-	DNA cytosine methyltransferase	NA	A0A2I7QZY6	Vibrio_phage	54.1	1.8e-66
AVZ05137.1|2019315_2020635_-	DNA helicase	NA	A0A2H4J6D5	uncultured_Caudovirales_phage	74.5	5.6e-166
AVZ05138.1|2020634_2021462_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ05139.1|2021660_2021936_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ05140.1|2021944_2022133_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ05141.1|2022238_2022985_+	helix-turn-helix domain-containing protein	NA	A0A1B1P9J5	Acinetobacter_phage	79.3	7.4e-107
AVZ07005.1|2023000_2023216_+	hypothetical protein	NA	A0A0P0I8I5	Acinetobacter_phage	98.6	5.5e-31
AVZ05142.1|2023267_2023495_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ05143.1|2023802_2023994_+	hypothetical protein	NA	A0A1B1P9G9	Acinetobacter_phage	63.2	5.4e-14
AVZ05144.1|2023993_2024287_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ05145.1|2024356_2024569_+	hypothetical protein	NA	A0A1B1P9G5	Acinetobacter_phage	94.3	9.6e-28
AVZ05146.1|2024576_2024891_+	hypothetical protein	NA	A0A1B1P9H1	Acinetobacter_phage	94.2	3.6e-55
AVZ05147.1|2024893_2025910_+	hypothetical protein	NA	A0A076G8D7	Sinorhizobium_phage	37.1	1.3e-24
AVZ05148.1|2025920_2026778_+	phage recombination protein Bet	NA	A0A088CBI3	Shigella_phage	56.7	1.9e-58
AVZ05149.1|2026758_2027367_+	exonuclease	NA	A0A2H4J882	uncultured_Caudovirales_phage	75.8	7.1e-84
AVZ05150.1|2027363_2027750_+	hypothetical protein	NA	A0A2H4JB33	uncultured_Caudovirales_phage	28.9	2.2e-06
AVZ05151.1|2027749_2028520_+	phage repressor protein/antirepressor Ant	NA	A0A0P0IDX3	Acinetobacter_phage	60.1	5.4e-44
AVZ05152.1|2028516_2028768_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ05153.1|2028733_2029693_-|integrase	site-specific integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	37.8	2.9e-47
AVZ05154.1|2029856_2030327_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
2029836:2029854	attR	CGCACCATTTGGTGCGTTT	NA	NA	NA	NA
AVZ05155.1|2030693_2031986_+	DcaP-like protein	NA	NA	NA	NA	NA
AVZ05156.1|2032037_2032781_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	2.3e-28
>prophage 7
CP028574	Acinetobacter pittii strain WCHAP005046 chromosome, complete genome	4052410	2321413	2370508	4052410	tRNA,transposase	Bacillus_phage(16.67%)	50	NA	NA
AVZ05413.1|2321413_2322439_-|transposase	IS30-like element ISAba125 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.4	2.0e-25
AVZ05414.1|2322909_2323833_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ05415.1|2324276_2324714_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
AVZ05416.1|2324799_2326104_-	MFS transporter	NA	NA	NA	NA	NA
AVZ05417.1|2326452_2327049_-	cytochrome b	NA	NA	NA	NA	NA
AVZ07020.1|2327061_2328078_-	catalase	NA	NA	NA	NA	NA
AVZ05418.1|2328442_2329006_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AVZ05419.1|2329765_2330458_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AVZ05420.1|2330658_2331549_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVZ07021.1|2331799_2331988_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ05421.1|2332159_2332369_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	66.7	3.4e-17
AVZ05422.1|2332599_2332920_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ05423.1|2333303_2333456_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ05424.1|2333631_2333748_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ05425.1|2334080_2334485_+|transposase	DDE transposase family protein	transposase	NA	NA	NA	NA
AVZ05426.1|2334576_2334915_+|transposase	transposase	transposase	NA	NA	NA	NA
AVZ07022.1|2335153_2335273_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ07023.1|2335431_2336025_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ05427.1|2336242_2337118_-	EamA family transporter	NA	NA	NA	NA	NA
AVZ05428.1|2337236_2337704_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AVZ05429.1|2337792_2339208_-	ethanolamine permease	NA	NA	NA	NA	NA
AVZ05430.1|2339389_2340391_+	serine kinase	NA	NA	NA	NA	NA
AVZ05431.1|2340465_2341791_+	phosphoserine phosphatase	NA	NA	NA	NA	NA
AVZ07024.1|2342099_2343134_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVZ05432.1|2343284_2344625_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AVZ05433.1|2345028_2347668_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	25.4	2.3e-33
AVZ05434.1|2347729_2348260_+	N-acetyltransferase	NA	NA	NA	NA	NA
AVZ05435.1|2348605_2348929_+	ferredoxin family protein	NA	NA	NA	NA	NA
AVZ05436.1|2349111_2349783_+	peptidase M15	NA	NA	NA	NA	NA
AVZ05437.1|2349921_2350590_+	O-methyltransferase	NA	W8CYT3	Bacillus_phage	44.8	5.2e-27
AVZ05438.1|2350706_2351549_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	33.9	3.4e-36
AVZ05439.1|2351704_2352316_-	chloramphenicol acetyltransferase CAT	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	55.6	7.3e-12
AVZ05440.1|2352308_2352908_-	DUF1949 domain-containing protein	NA	A0A1X9I5T8	Streptococcus_phage	36.6	1.0e-21
AVZ05441.1|2352999_2354196_-	secretion protein HlyD	NA	NA	NA	NA	NA
AVZ05442.1|2354192_2356334_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	24.9	1.8e-28
AVZ07025.1|2356330_2357554_-	RND transporter	NA	NA	NA	NA	NA
AVZ05443.1|2358070_2358814_-	LPS export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.2	1.8e-20
AVZ05444.1|2358813_2359362_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
AVZ05445.1|2359345_2359894_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AVZ05446.1|2359931_2360471_-	3-deoxy-D-manno-octulosonate 8-phosphate phosphatase	NA	NA	NA	NA	NA
AVZ05447.1|2360474_2361452_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.7	7.3e-38
AVZ05448.1|2361665_2363087_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	30.8	6.6e-56
AVZ05449.1|2363401_2363755_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
AVZ05450.1|2364349_2365783_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ05451.1|2365796_2366165_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ05452.1|2366689_2366917_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ05453.1|2367036_2367375_-|transposase	transposase	transposase	NA	NA	NA	NA
AVZ05454.1|2367466_2367871_-|transposase	DDE transposase family protein	transposase	NA	NA	NA	NA
AVZ05455.1|2368264_2368714_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ05456.1|2369575_2370508_-|transposase	IS5/IS1182 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.9	5.0e-60
>prophage 8
CP028574	Acinetobacter pittii strain WCHAP005046 chromosome, complete genome	4052410	2384758	2422486	4052410	transposase	Acinetobacter_phage(30.77%)	39	NA	NA
AVZ05473.1|2384758_2385691_-|transposase	IS5/IS1182 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.9	5.0e-60
AVZ07027.1|2386558_2387044_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AVZ05474.1|2387222_2387339_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ05475.1|2387354_2388164_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
AVZ05476.1|2388245_2389271_+|transposase	IS30-like element ISAba125 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.4	2.0e-25
AVZ05477.1|2389717_2390650_+|transposase	IS5/IS1182 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.6	2.1e-58
AVZ05478.1|2390687_2390912_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	61.7	6.1e-17
AVZ05479.1|2391255_2392188_-	lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	34.7	2.7e-42
AVZ05480.1|2392427_2393045_+	LysE family translocator	NA	NA	NA	NA	NA
AVZ05481.1|2393141_2393687_-	hypothetical protein	NA	A0A0N7IRE7	Acinetobacter_phage	70.7	5.6e-72
AVZ05482.1|2393717_2394107_-	hypothetical protein	NA	A0A0P0IYC0	Acinetobacter_phage	76.7	3.0e-51
AVZ05483.1|2394316_2394571_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ05484.1|2395243_2395915_+	helix-turn-helix domain-containing protein	NA	A0A1B1P9J5	Acinetobacter_phage	55.8	9.1e-64
AVZ05485.1|2396067_2396301_-|transposase	transposase	transposase	NA	NA	NA	NA
AVZ05486.1|2396808_2398074_+	exodeoxyribonuclease VII large subunit	NA	M1NLU2	Moumouvirus	29.5	8.1e-13
AVZ05487.1|2398063_2398258_+	exodeoxyribonuclease VII	NA	NA	NA	NA	NA
AVZ05488.1|2398511_2398730_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ05489.1|2398778_2399360_-	multidrug transporter MatE	NA	NA	NA	NA	NA
AVZ05490.1|2399811_2400141_+	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	57.1	8.7e-28
AVZ05491.1|2400600_2400957_+	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
AVZ05492.1|2401564_2401972_-	GFA family protein	NA	NA	NA	NA	NA
AVZ05493.1|2402000_2402402_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AVZ05494.1|2402477_2404949_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.0	3.0e-96
AVZ05495.1|2405115_2405316_+	copper chaperone	NA	NA	NA	NA	NA
AVZ05496.1|2405372_2407043_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AVZ05497.1|2407413_2407701_+	phenol hydroxylase	NA	NA	NA	NA	NA
AVZ05498.1|2407722_2408724_+	phenol hydroxylase	NA	NA	NA	NA	NA
AVZ05499.1|2408735_2409002_+	monooxygenase	NA	NA	NA	NA	NA
AVZ05500.1|2409047_2410574_+	YHS domain-containing protein	NA	NA	NA	NA	NA
AVZ05501.1|2410633_2410996_+	phenol hydroxylase	NA	NA	NA	NA	NA
AVZ05502.1|2411010_2412072_+	phenol hydroxylase	NA	NA	NA	NA	NA
AVZ05503.1|2412256_2413138_+	phenol degradation protein meta	NA	NA	NA	NA	NA
AVZ05504.1|2413186_2414146_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVZ05505.1|2414426_2415809_+	benzoate 1,2-dioxygenase large subunit	NA	NA	NA	NA	NA
AVZ05506.1|2415805_2416306_+	benzoate 1,2-dioxygenase small subunit	NA	NA	NA	NA	NA
AVZ05507.1|2416377_2417394_+	NADH oxidase	NA	NA	NA	NA	NA
AVZ05508.1|2418116_2419325_-|transposase	IS256 family transposase ISAba26	transposase	A0A218MNI5	uncultured_virus	46.5	3.1e-46
AVZ05509.1|2419581_2420775_+	benzoate transporter	NA	NA	NA	NA	NA
AVZ05510.1|2421460_2422486_+|transposase	IS30-like element ISAba125 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.4	2.0e-25
>prophage 9
CP028574	Acinetobacter pittii strain WCHAP005046 chromosome, complete genome	4052410	2438211	2494485	4052410	terminase,transposase,tRNA,head,coat	Acinetobacter_phage(57.89%)	58	NA	NA
AVZ05522.1|2438211_2438928_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AVZ05523.1|2439100_2439727_+	glutathione S-transferase	NA	NA	NA	NA	NA
AVZ05524.1|2439740_2440520_-	DUF2520 domain-containing protein	NA	NA	NA	NA	NA
AVZ05525.1|2441036_2442126_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
AVZ05526.1|2443437_2444682_-	aspartate carbamoyltransferase	NA	NA	NA	NA	NA
AVZ05527.1|2444685_2445702_-	aspartate carbamoyltransferase catalytic subunit	NA	NA	NA	NA	NA
AVZ05528.1|2445826_2446171_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ05529.1|2446389_2448621_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
AVZ05530.1|2448727_2449753_-|transposase	IS30-like element ISAba125 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.4	2.0e-25
AVZ05531.1|2449765_2450146_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ05532.1|2450414_2450909_+	damage-inducible protein CinA	NA	A0A218MNG4	uncultured_virus	42.7	4.5e-28
AVZ05533.1|2450959_2453539_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	32.7	1.3e-123
AVZ05534.1|2453839_2454649_+	M23 family peptidase	NA	A8ATH6	Listeria_phage	36.6	2.3e-13
AVZ07028.1|2454645_2455071_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVZ05535.1|2455167_2455590_-	OsmC family protein	NA	NA	NA	NA	NA
AVZ07029.1|2455668_2455788_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ05536.1|2456028_2456736_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
AVZ05537.1|2456895_2457945_+	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
AVZ05538.1|2457999_2458779_-	M48 family peptidase	NA	NA	NA	NA	NA
AVZ05539.1|2458894_2459212_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ05540.1|2459334_2460654_-	adenylosuccinate synthase	NA	A0A2P1EKE7	Megavirus	36.2	3.7e-69
AVZ05541.1|2460717_2461884_-	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
AVZ05542.1|2462195_2463215_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AVZ05543.1|2463484_2466121_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.4	3.7e-76
AVZ05544.1|2466407_2467613_+	DUF4102 domain-containing protein	NA	A0A0R6PHZ3	Moraxella_phage	50.5	7.2e-104
AVZ05545.1|2467774_2468269_+	DNA polymerase V	NA	A0A2H4J538	uncultured_Caudovirales_phage	61.5	4.8e-46
AVZ05546.1|2468272_2469571_+	DNA polymerase V subunit UmuC	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	60.8	1.5e-155
AVZ05547.1|2469648_2470395_+|transposase	IS5/IS1182 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	33.3	1.8e-12
AVZ05548.1|2470532_2471696_-	glutathione-dependent formaldehyde dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	26.5	5.5e-08
AVZ05549.1|2472137_2472554_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ05550.1|2473650_2473914_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ05551.1|2473915_2474596_-	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	49.3	2.5e-53
AVZ05552.1|2474694_2475099_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	100.0	3.9e-70
AVZ05553.1|2475191_2475374_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	100.0	7.4e-29
AVZ07030.1|2475699_2476215_-	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	96.4	2.8e-73
AVZ05554.1|2476285_2477203_-	hypothetical protein	NA	A0A0P0IL42	Acinetobacter_phage	97.7	3.9e-166
AVZ05555.1|2477255_2478584_-	hypothetical protein	NA	A0A0D4DCQ4	Acinetobacter_phage	49.1	1.2e-86
AVZ05556.1|2478583_2478937_-	hypothetical protein	NA	A0A0P0IY61	Acinetobacter_phage	94.0	1.5e-57
AVZ05557.1|2479005_2479404_-	hypothetical protein	NA	A0A0P0IRA6	Acinetobacter_phage	94.7	1.2e-68
AVZ05558.1|2479405_2479774_-	hypothetical protein	NA	A0A0P0IDX0	Acinetobacter_phage	98.1	1.1e-55
AVZ05559.1|2479745_2480150_-	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	88.1	1.9e-61
AVZ05560.1|2480887_2481256_-	glutamate 5-kinase	NA	A0A0P0I456	Acinetobacter_phage	95.9	7.2e-63
AVZ05561.1|2481255_2481636_-	hypothetical protein	NA	A0A0P0IVQ3	Acinetobacter_phage	84.9	8.2e-54
AVZ05562.1|2481639_2482170_-	HeH/LEM domain protein	NA	A0A0N7IRE4	Acinetobacter_phage	91.7	4.2e-40
AVZ05563.1|2482212_2483184_-|coat	phage coat protein	coat	A0A2H4JIE6	uncultured_Caudovirales_phage	72.7	4.4e-136
AVZ05564.1|2483186_2483918_-	hypothetical protein	NA	A0A0P0J090	Acinetobacter_phage	75.4	1.0e-92
AVZ05565.1|2484026_2484578_-	hypothetical protein	NA	A0A2I7RHW2	Vibrio_phage	68.4	6.2e-18
AVZ05566.1|2484867_2485110_-	hypothetical protein	NA	A0A0P0IY55	Acinetobacter_phage	95.0	5.2e-38
AVZ05567.1|2485208_2485637_-	hypothetical protein	NA	A0A0D4DBV9	Acinetobacter_phage	92.3	7.3e-67
AVZ05568.1|2485646_2486750_-|head	phage head morphogenesis protein	head	A0A0P0IR98	Acinetobacter_phage	85.2	3.3e-180
AVZ05569.1|2486759_2488103_-	DUF4055 domain-containing protein	NA	A0A0P0IDW1	Acinetobacter_phage	89.1	6.6e-231
AVZ05570.1|2488142_2489435_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	86.3	4.9e-215
AVZ05571.1|2489394_2489910_-	DUF2280 domain-containing protein	NA	A0A1B1P9C2	Acinetobacter_phage	61.3	3.2e-45
AVZ05572.1|2489968_2490565_-	hypothetical protein	NA	J7I4N9	Acinetobacter_phage	96.3	2.8e-109
AVZ05573.1|2490540_2491700_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	38.1	1.1e-48
AVZ05574.1|2491818_2492253_-	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	97.9	1.4e-78
AVZ05575.1|2492312_2492768_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	98.7	3.5e-83
AVZ05576.1|2493459_2494485_-|transposase	IS30-like element ISAba125 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.4	2.0e-25
>prophage 10
CP028574	Acinetobacter pittii strain WCHAP005046 chromosome, complete genome	4052410	2497816	2506206	4052410		Acinetobacter_phage(44.44%)	13	NA	NA
AVZ05582.1|2497816_2498293_-	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	40.3	1.2e-25
AVZ05583.1|2498289_2498691_-	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	98.5	8.1e-68
AVZ05584.1|2498836_2499085_+	DUF551 domain-containing protein	NA	A0A0P0HSE1	Acinetobacter_phage	96.1	5.7e-40
AVZ05585.1|2499081_2499366_+	hypothetical protein	NA	A0A0P0HSI5	Acinetobacter_phage	94.7	2.2e-43
AVZ05586.1|2499369_2499627_+	hypothetical protein	NA	A0A0P0J0B1	Acinetobacter_phage	88.1	1.2e-40
AVZ05587.1|2499628_2499844_+	hypothetical protein	NA	A0A0R6PG25	Moraxella_phage	55.9	3.7e-11
AVZ05588.1|2500053_2501334_+	aspartate kinase	NA	NA	NA	NA	NA
AVZ05589.1|2501580_2501835_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	8.8e-12
AVZ05590.1|2501902_2502469_-	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	43.1	2.4e-25
AVZ07032.1|2502539_2502980_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ05591.1|2503169_2503727_+	cytochrome b	NA	NA	NA	NA	NA
AVZ05592.1|2503771_2504770_-	adenosine deaminase	NA	NA	NA	NA	NA
AVZ05593.1|2504886_2506206_-	guanine permease	NA	A0A0R6PHV4	Moraxella_phage	36.0	1.8e-60
>prophage 11
CP028574	Acinetobacter pittii strain WCHAP005046 chromosome, complete genome	4052410	2722602	2785016	4052410	holin,transposase	Faecalibacterium_phage(33.33%)	49	NA	NA
AVZ05764.1|2722602_2724669_-|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.7	1.4e-17
AVZ05765.1|2724790_2726413_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.3e-22
AVZ05766.1|2726665_2727301_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
AVZ05767.1|2727293_2728766_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AVZ05768.1|2728861_2730520_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.5	3.1e-57
AVZ05769.1|2731004_2731937_-|transposase	IS5/IS1182 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.9	5.0e-60
AVZ05770.1|2732078_2733719_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AVZ05771.1|2733809_2734280_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ05772.1|2734496_2735375_+	homocysteine S-methyltransferase family protein	NA	NA	NA	NA	NA
AVZ05773.1|2735380_2736715_+	amino acid permease	NA	NA	NA	NA	NA
AVZ07053.1|2736770_2738648_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AVZ05774.1|2738832_2739540_-	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
AVZ05775.1|2739861_2740137_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ05776.1|2740139_2740580_-	DUF454 domain-containing protein	NA	NA	NA	NA	NA
AVZ05777.1|2740608_2741208_-	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
AVZ05778.1|2741240_2742161_-	energy transducer TonB	NA	NA	NA	NA	NA
AVZ07054.1|2742171_2743638_-	peptide signal protein	NA	NA	NA	NA	NA
AVZ05779.1|2743740_2744532_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ07055.1|2744722_2747827_-	outer membrane receptor protein	NA	NA	NA	NA	NA
AVZ05780.1|2748035_2749052_-	DUF4974 domain-containing protein	NA	NA	NA	NA	NA
AVZ07056.1|2749052_2749574_-	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AVZ05781.1|2749710_2750601_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVZ05782.1|2750788_2751733_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
AVZ05783.1|2751905_2753291_+	MFS transporter	NA	NA	NA	NA	NA
AVZ05784.1|2753369_2754716_+	outer membrane porin, OprD family	NA	NA	NA	NA	NA
AVZ05785.1|2755467_2756493_+|transposase	IS30-like element ISAba125 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.4	2.0e-25
AVZ05786.1|2759860_2760886_+|transposase	IS30-like element ISAba125 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.4	2.0e-25
AVZ05787.1|2761972_2763958_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
AVZ05788.1|2764261_2765785_-	MFS transporter	NA	NA	NA	NA	NA
AVZ05789.1|2765791_2766943_-	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AVZ05790.1|2767210_2767744_-	thioesterase family protein	NA	NA	NA	NA	NA
AVZ07057.1|2767850_2768864_+	porphobilinogen synthase	NA	NA	NA	NA	NA
AVZ05791.1|2768889_2770005_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AVZ05792.1|2769996_2770902_-	TIGR01777 family protein	NA	A0A0F7LC08	uncultured_marine_virus	25.1	4.4e-05
AVZ05793.1|2770985_2771438_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ05794.1|2771818_2772196_+	VOC family protein	NA	NA	NA	NA	NA
AVZ05795.1|2772272_2772785_-	peroxiredoxin	NA	NA	NA	NA	NA
AVZ05796.1|2772910_2774179_+	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
AVZ05797.1|2774188_2777785_+	ATP-dependent dsDNA exonuclease	NA	Q5ULP4	Lactobacillus_virus	27.4	4.5e-08
AVZ05798.1|2777985_2778678_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AVZ05799.1|2778804_2779842_+	type IV pili twitching motility protein PilT	NA	NA	NA	NA	NA
AVZ05800.1|2779861_2780980_+	type IV pili twitching motility protein PilT	NA	NA	NA	NA	NA
AVZ05801.1|2781049_2781487_-	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
AVZ05802.1|2781598_2781997_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AVZ05803.1|2782061_2782376_-	RnfH family protein	NA	NA	NA	NA	NA
AVZ05804.1|2782375_2783443_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ07058.1|2783369_2783567_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ05805.1|2783596_2783998_-	bacteriohemerythrin	NA	NA	NA	NA	NA
AVZ05806.1|2783990_2785016_-|transposase	IS30-like element ISAba125 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.4	2.0e-25
>prophage 12
CP028574	Acinetobacter pittii strain WCHAP005046 chromosome, complete genome	4052410	3541192	3600350	4052410	tRNA,integrase,transposase	uncultured_virus(33.33%)	39	3556963:3556982	3602758:3602777
AVZ06457.1|3541192_3542983_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	21.5	5.8e-17
AVZ06458.1|3543140_3543755_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
AVZ06459.1|3543795_3544464_-	glutathione S-transferase	NA	NA	NA	NA	NA
AVZ06460.1|3544729_3545938_+|transposase	IS256 family transposase ISAba26	transposase	A0A218MNI5	uncultured_virus	46.5	3.1e-46
AVZ06461.1|3545962_3546310_-	osmotically inducible protein C	NA	NA	NA	NA	NA
AVZ06462.1|3546306_3547254_-	pirin family protein	NA	NA	NA	NA	NA
AVZ06463.1|3547410_3547716_-	DUF3861 domain-containing protein	NA	NA	NA	NA	NA
AVZ06464.1|3547775_3548282_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AVZ06465.1|3548496_3549285_-	ANT(3'')-II family aminoglycoside nucleotidyltransferase	NA	NA	NA	NA	NA
AVZ06466.1|3549350_3550919_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	34.7	1.3e-23
AVZ06467.1|3551292_3552522_+	DUF445 domain-containing protein	NA	NA	NA	NA	NA
AVZ06468.1|3552588_3553068_-	DoxX family protein	NA	NA	NA	NA	NA
AVZ06469.1|3553220_3553862_+	DedA family protein	NA	NA	NA	NA	NA
AVZ06470.1|3553870_3554461_-	threonine transporter RhtB	NA	NA	NA	NA	NA
AVZ06471.1|3554675_3555062_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ06472.1|3555072_3555915_-	ParA family protein	NA	V5UP47	Mycobacterium_phage	24.5	1.5e-10
AVZ06473.1|3555991_3556384_-	invasion protein expression up-regulator SirB	NA	NA	NA	NA	NA
AVZ06474.1|3556395_3556704_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
3556963:3556982	attL	ACCTTGCCAAGGTTGGGGTC	NA	NA	NA	NA
AVZ06475.1|3557457_3557685_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVZ06476.1|3557800_3558010_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ06477.1|3558029_3559211_+|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	30.1	2.3e-38
AVZ06478.1|3559203_3559452_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ06479.1|3559520_3560069_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ06480.1|3560079_3560826_+	DNA replication protein	NA	A0A0D4DBZ2	Acinetobacter_phage	37.8	1.8e-44
AVZ06481.1|3561021_3561723_+|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	54.4	5.4e-35
AVZ06482.1|3562383_3563421_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
AVZ06483.1|3563454_3563820_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ06484.1|3563849_3564725_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ06485.1|3567837_3568455_+	CAP domain-containing protein	NA	NA	NA	NA	NA
AVZ06486.1|3568581_3570021_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
AVZ06487.1|3570017_3572153_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	26.7	3.9e-28
AVZ06488.1|3572319_3573708_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ06489.1|3573815_3591506_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ06490.1|3591643_3592114_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AVZ06491.1|3592061_3592541_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ06492.1|3592629_3593331_-|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	53.6	1.6e-34
AVZ07106.1|3594721_3595219_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ06493.1|3595215_3597396_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ06494.1|3597392_3600350_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
3602758:3602777	attR	ACCTTGCCAAGGTTGGGGTC	NA	NA	NA	NA
>prophage 13
CP028574	Acinetobacter pittii strain WCHAP005046 chromosome, complete genome	4052410	3676361	3687568	4052410		Enterobacteria_phage(28.57%)	10	NA	NA
AVZ06558.1|3676361_3677498_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.2	1.2e-31
AVZ06559.1|3677494_3678757_-	flippase	NA	NA	NA	NA	NA
AVZ06560.1|3678800_3679367_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	52.2	6.5e-47
AVZ06561.1|3679424_3680318_-	glucose-1-phosphate thymidylyltransferase	NA	A0A291LA53	Escherichia_phage	65.9	4.2e-109
AVZ06562.1|3680317_3681223_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	32.2	2.6e-29
AVZ06563.1|3681239_3682316_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.1	4.8e-99
AVZ06564.1|3682338_3683616_-	Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB	NA	M1I178	Paramecium_bursaria_Chlorella_virus	28.5	5.4e-25
AVZ07111.1|3683820_3684921_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ06565.1|3684922_3685351_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
AVZ06566.1|3685372_3687568_+	tyrosine protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	33.7	5.9e-19
>prophage 1
CP028569	Acinetobacter pittii strain WCHAP005046 plasmid p1_005046, complete sequence	121612	10521	77188	121612	integrase,transposase,terminase	Acinetobacter_phage(20.0%)	76	26364:26383	73646:73665
AVZ03195.1|10521_12231_-	ATP-dependent helicase	NA	L7TNS5	Rhizobium_phage	46.2	3.4e-131
AVZ03196.1|12309_12948_+	chromosome partitioning protein ParB	NA	L7TL04	Rhizobium_phage	46.1	1.0e-48
AVZ03197.1|12976_13579_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ03198.1|13575_14226_+	chromosome partitioning protein ParB	NA	L7TMF9	Rhizobium_phage	41.9	3.8e-35
AVZ03199.1|14225_14882_+	ABC transporter	NA	L7TNS9	Rhizobium_phage	54.8	5.9e-60
AVZ03200.1|14878_15301_+	thioredoxin	NA	NA	NA	NA	NA
AVZ03201.1|15339_16293_+	hypothetical protein	NA	A0A2H4P6X5	Pseudomonas_phage	41.8	1.0e-60
AVZ03202.1|16283_16607_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ03203.1|16575_17070_+	hypothetical protein	NA	A0A0D4DBK8	Acinetobacter_phage	33.9	5.4e-05
AVZ03204.1|17181_17583_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ03205.1|17735_18341_+	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	34.3	4.0e-18
AVZ03206.1|18350_19595_+|terminase	terminase	terminase	A0A2H4P6Z9	Pseudomonas_phage	62.0	1.6e-151
AVZ03207.1|19640_20438_+	hypothetical protein	NA	J9Q7R1	Salmonella_phage	51.7	8.8e-58
AVZ03208.1|20530_20923_+	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	55.5	1.1e-32
AVZ03209.1|20922_21561_+	lysozyme	NA	A0A075DXC6	Acinetobacter_phage	63.1	2.2e-67
AVZ03210.1|22199_22439_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ03211.1|22571_23693_+	RepB family plasmid replication initiator protein	NA	NA	NA	NA	NA
AVZ03212.1|24045_25650_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	53.4	3.0e-145
AVZ03213.1|25724_26114_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AVZ03214.1|26056_26440_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
26364:26383	attL	TGCTGTTTAAATTCAGCACT	NA	NA	NA	NA
AVZ03215.1|27148_27580_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ03216.1|27616_29020_+	DNA helicase	NA	L7TS87	Rhizobium_phage	39.0	1.5e-84
AVZ03217.1|29107_30202_+	DNA primase	NA	A0A2H4P738	Pseudomonas_phage	43.6	8.6e-88
AVZ03218.1|30265_30820_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ03219.1|30819_31311_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ03220.1|31304_31913_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
AVZ03221.1|31909_32419_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ03222.1|32431_33847_+	DNA ligase	NA	A0A2H4P729	Pseudomonas_phage	40.0	4.2e-87
AVZ03223.1|33864_34326_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ03224.1|34365_34938_+	guanylate kinase	NA	A0A218KC48	Bacillus_phage	28.5	1.2e-08
AVZ03225.1|35010_35631_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ03226.1|35618_36047_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ03227.1|36043_36721_-	partition protein	NA	E5FFJ3	Burkholderia_phage	26.4	2.8e-12
AVZ03228.1|36923_37340_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ03229.1|37336_37921_-|integrase	site-specific integrase	integrase	A0A0A8WF93	Clostridium_phage	29.3	8.9e-07
AVZ03230.1|38260_38680_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVZ03231.1|39101_39296_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ03232.1|39536_40442_+	cobalamin biosynthesis protein CobT	NA	A0A2H4P735	Pseudomonas_phage	38.4	9.5e-24
AVZ03233.1|40493_41702_+|transposase	IS256 family transposase ISAba26	transposase	A0A218MNI5	uncultured_virus	46.5	3.1e-46
AVZ03234.1|41842_43042_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	29.1	9.6e-40
AVZ03235.1|43341_43773_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ03236.1|44183_44822_-	glutathione S-transferase	NA	NA	NA	NA	NA
AVZ03237.1|44838_45861_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
AVZ03238.1|46000_46609_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AVZ03239.1|46713_46944_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ03240.1|47027_48155_-	alkene reductase	NA	NA	NA	NA	NA
AVZ03241.1|48356_49034_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
AVZ03242.1|49124_50282_-	NADH-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
AVZ03243.1|50868_51183_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AVZ03244.1|51517_52348_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AVZ03245.1|52576_53689_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.5	5.2e-32
AVZ03246.1|53710_53986_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
AVZ03247.1|54820_55780_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
AVZ03248.1|55895_57134_+	creatininase	NA	NA	NA	NA	NA
AVZ03249.1|57190_58483_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	33.6	1.6e-56
AVZ03250.1|58495_59410_+	drug/metabolite DMT transporter permease	NA	NA	NA	NA	NA
AVZ03251.1|60290_60581_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ03252.1|60787_61783_+	quinone oxidoreductase	NA	NA	NA	NA	NA
AVZ03253.1|61772_62789_+	NADPH:quinone reductase	NA	NA	NA	NA	NA
AVZ03254.1|63557_64766_-|transposase	IS256 family transposase ISAba26	transposase	A0A218MNI5	uncultured_virus	46.5	3.1e-46
AVZ03255.1|65248_65623_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ03256.1|65962_66298_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AVZ03302.1|66582_67011_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ03257.1|67536_69645_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AVZ03258.1|70089_70518_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ03259.1|71118_71475_+	addiction module toxin RelE	NA	NA	NA	NA	NA
AVZ03260.1|71467_71770_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVZ03261.1|71762_71972_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ03303.1|72081_72300_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ03304.1|72923_73091_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	65.4	2.2e-11
AVZ03262.1|73630_74789_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	38.1	1.1e-48
73646:73665	attR	AGTGCTGAATTTAAACAGCA	NA	NA	NA	NA
AVZ03263.1|74757_74940_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ03264.1|74890_75106_-	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	47.8	1.2e-06
AVZ03265.1|75517_76450_+|transposase	IS5/IS1182 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	43.1	5.7e-64
AVZ03266.1|76453_76672_-	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	74.1	1.8e-13
AVZ03267.1|76732_77188_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	95.4	2.7e-80
