The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028578	Escherichia coli strain WCHEC005784 chromosome, complete genome	4812358	1027868	1035008	4812358		Escherichia_phage(83.33%)	6	NA	NA
AVZ08277.1|1027868_1028507_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AVZ08278.1|1028503_1029766_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
AVZ08279.1|1029762_1030671_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.1e-117
AVZ08280.1|1030866_1031634_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
AVZ08281.1|1031684_1032341_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	5.0e-51
AVZ08282.1|1032446_1035008_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	9.2e-32
>prophage 2
CP028578	Escherichia coli strain WCHEC005784 chromosome, complete genome	4812358	1249630	1294007	4812358	terminase,tail,integrase,holin	Escherichia_phage(60.78%)	56	1252729:1252745	1292153:1292169
AVZ08462.1|1249630_1251097_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
AVZ08463.1|1251165_1252743_+	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
1252729:1252745	attL	ATTGAGTGGGAATGATT	NA	NA	NA	NA
AVZ08464.1|1252935_1254186_+|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.0	2.3e-238
AVZ08465.1|1254189_1254384_-	DUF1382 family protein	NA	G9L698	Escherichia_phage	98.4	4.3e-27
AVZ08466.1|1254380_1255031_-	adenine methylase	NA	A0A2R9YJG0	Escherichia_phage	97.7	6.8e-125
AVZ11749.1|1255023_1255275_-	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	100.0	3.1e-41
AVZ08467.1|1255432_1255681_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
AVZ08468.1|1255730_1256612_-	recombinase RecT	NA	G9L6A2	Escherichia_phage	100.0	1.6e-161
AVZ08469.1|1256608_1257430_-	exodeoxyribonuclease VIII	NA	G9L6A3	Escherichia_phage	97.1	2.8e-160
AVZ08470.1|1257426_1257726_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	97.0	2.5e-45
AVZ08471.1|1258034_1258619_-	XRE family transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
AVZ08472.1|1258773_1259004_+	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
AVZ08473.1|1259154_1259355_+	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	98.5	6.0e-32
AVZ08474.1|1259370_1260186_+	primosomal protein	NA	Q286X4	Escherichia_phage	96.0	3.5e-118
AVZ11750.1|1260182_1260968_+	replication protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	99.6	3.6e-152
AVZ08475.1|1261085_1261430_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	96.5	1.5e-59
AVZ08476.1|1261491_1262004_+	hypothetical protein	NA	G9L6B1	Escherichia_phage	66.7	1.6e-44
AVZ08477.1|1262000_1262759_+	ead/Ea22-like family protein	NA	A0A077SLK5	Escherichia_phage	62.9	1.7e-63
AVZ08478.1|1262760_1262997_+	hypothetical protein	NA	A0A2D1GLS1	Escherichia_phage	100.0	3.0e-38
AVZ08479.1|1263956_1264307_+	DUF2591 domain-containing protein	NA	G9L6B5	Escherichia_phage	72.4	5.6e-41
AVZ08480.1|1264299_1264638_+	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	96.4	2.0e-56
AVZ08481.1|1264678_1265353_+|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	98.7	2.4e-117
AVZ08482.1|1265349_1266825_+|terminase	terminase	terminase	A0A0F6TK57	Escherichia_coli_O157_typing_phage	99.6	5.8e-297
AVZ08483.1|1266915_1267272_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	78.0	1.7e-45
AVZ08484.1|1267979_1268186_+	hypothetical protein	NA	G9L6C1	Escherichia_phage	98.5	5.1e-10
AVZ08485.1|1268200_1269880_+|tail	phage tail protein	tail	G9L6C2	Escherichia_phage	99.3	8.0e-303
AVZ08486.1|1269876_1270173_+	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
AVZ08487.1|1270175_1270871_+	peptidase	NA	G9L6C4	Escherichia_phage	94.8	8.4e-89
AVZ08488.1|1270885_1271872_+	hypothetical protein	NA	G9L6C5	Escherichia_phage	99.7	5.6e-187
AVZ08489.1|1271923_1272361_+	hypothetical protein	NA	A0A0F6R7N9	Escherichia_coli_O157_typing_phage	97.9	5.3e-73
AVZ08490.1|1272371_1272707_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	100.0	7.7e-56
AVZ08491.1|1272757_1273081_+	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	96.3	1.1e-51
AVZ08492.1|1273080_1273686_+	hypothetical protein	NA	G9L6C9	Escherichia_phage	100.0	2.8e-112
AVZ08493.1|1273685_1276157_+	hypothetical protein	NA	A0A0F6TJD3	Escherichia_coli_O157_typing_phage	99.1	0.0e+00
AVZ08494.1|1276156_1276621_+	hypothetical protein	NA	G9L6D1	Escherichia_phage	100.0	8.4e-85
AVZ08495.1|1276620_1277160_+	hypothetical protein	NA	A0A193GYJ4	Enterobacter_phage	81.8	1.6e-47
AVZ08496.1|1277172_1279686_+	hypothetical protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	93.9	0.0e+00
AVZ08497.1|1279682_1281485_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	97.8	0.0e+00
AVZ08498.1|1281490_1283965_+	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	98.9	0.0e+00
AVZ08499.1|1284160_1284457_+	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	100.0	2.5e-50
AVZ08500.1|1284488_1284650_-	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
AVZ08501.1|1284733_1285246_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ08502.1|1285232_1285559_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ08503.1|1285688_1286399_-	BRO-like protein	NA	G9L6E2	Escherichia_phage	79.8	1.7e-100
AVZ08504.1|1286796_1287525_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ08505.1|1287547_1287805_-	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	98.8	1.7e-42
AVZ08506.1|1288000_1290163_+	SGNH/GDSL hydrolase family protein	NA	F8R4T7	Escherichia_phage	51.0	2.6e-152
AVZ08507.1|1290252_1290654_+	hypothetical protein	NA	G9L6E6	Escherichia_phage	91.7	3.4e-58
AVZ08508.1|1290643_1290952_+|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	93.1	5.1e-46
AVZ08509.1|1290941_1291571_+	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	97.6	6.8e-114
AVZ08510.1|1291567_1292065_+	DUF2514 family protein	NA	A0A193GYU6	Enterobacter_phage	64.0	8.2e-46
AVZ08511.1|1292261_1292801_-	hypothetical protein	NA	G9L6F0	Escherichia_phage	96.6	1.6e-42
1292153:1292169	attR	ATTGAGTGGGAATGATT	NA	NA	NA	NA
AVZ08512.1|1292816_1293335_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
AVZ08513.1|1293437_1293584_-	succinate dehydrogenase	NA	NA	NA	NA	NA
AVZ08514.1|1293645_1293837_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
AVZ08515.1|1293854_1294007_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
>prophage 3
CP028578	Escherichia coli strain WCHEC005784 chromosome, complete genome	4812358	1718308	1812776	4812358	transposase,portal,head,plate,tRNA,terminase,capsid,tail,integrase,lysis	Erwinia_phage(20.0%)	92	1745550:1745571	1779790:1779811
AVZ08882.1|1718308_1720342_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	2.3e-54
AVZ08883.1|1720473_1721583_+	protein mrp	NA	NA	NA	NA	NA
AVZ08884.1|1721845_1722127_+	DUF2574 family protein	NA	NA	NA	NA	NA
AVZ08885.1|1722419_1722962_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AVZ08886.1|1723041_1723716_+	fimbrial assembly protein	NA	NA	NA	NA	NA
AVZ08887.1|1723731_1726212_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AVZ08888.1|1726227_1727262_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
AVZ08889.1|1727343_1727682_-	heavy metal resistance protein	NA	NA	NA	NA	NA
AVZ08890.1|1727900_1728725_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
AVZ08891.1|1728845_1729118_+	transcriptional regulator	NA	NA	NA	NA	NA
AVZ08892.1|1729340_1730129_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
AVZ08893.1|1730125_1730926_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AVZ08894.1|1730990_1731809_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	1.7e-24
AVZ08895.1|1731860_1732607_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AVZ08896.1|1732580_1733546_-	sugar kinase	NA	NA	NA	NA	NA
AVZ08897.1|1733542_1734547_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.0	6.4e-13
AVZ08898.1|1734543_1735821_-	MFS transporter	NA	NA	NA	NA	NA
AVZ08899.1|1736077_1737130_+	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
AVZ08900.1|1737437_1738292_+	tagatose-1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AVZ08901.1|1738320_1739583_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
AVZ08902.1|1739592_1740045_+	galactitol-specific phosphotransferase enzyme IIA component	NA	NA	NA	NA	NA
AVZ08903.1|1740075_1740360_+	galactitol-specific phosphotransferase enzyme IIB component	NA	NA	NA	NA	NA
AVZ08904.1|1740363_1741719_+	galactitol permease IIC component	NA	NA	NA	NA	NA
AVZ08905.1|1741766_1742807_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
AVZ08906.1|1742906_1743686_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AVZ08907.1|1743767_1744667_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.7e-12
AVZ08908.1|1745072_1745390_+	hypothetical protein	NA	NA	NA	NA	NA
1745550:1745571	attL	AAAAAATAAGCCCGTGTAAGGG	NA	NA	NA	NA
AVZ08909.1|1745655_1746669_-|integrase	integrase	integrase	Q83VS6	Escherichia_phage	83.6	1.4e-164
AVZ08910.1|1746765_1747062_-	XRE family transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	71.1	8.6e-35
AVZ08911.1|1747197_1747473_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	82.2	4.4e-41
AVZ08912.1|1747650_1748151_+	replication protein B	NA	M1SV55	Escherichia_phage	83.1	1.1e-77
AVZ08913.1|1748217_1748436_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	64.0	1.6e-09
AVZ08914.1|1748458_1748734_+	hypothetical protein	NA	A0A0M4R2Q0	Salmonella_phage	47.7	5.2e-18
AVZ08915.1|1748723_1751015_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	73.7	0.0e+00
AVZ08916.1|1751014_1751473_+	DUF3850 domain-containing protein	NA	Q858T3	Yersinia_virus	53.0	9.6e-41
AVZ11767.1|1751489_1751714_+	hypothetical protein	NA	Q6K1F0	Salmonella_virus	59.4	6.4e-14
AVZ08917.1|1752014_1753643_+	DUF3696 domain-containing protein	NA	NA	NA	NA	NA
AVZ08918.1|1753645_1754758_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ08919.1|1754853_1755861_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	81.1	1.1e-161
AVZ08920.1|1755862_1757632_-	oxidoreductase	NA	A0A218M4M1	Erwinia_phage	84.7	4.7e-301
AVZ08921.1|1757798_1758653_+|capsid	capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	73.9	4.8e-118
AVZ08922.1|1758713_1759781_+|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.6	3.9e-170
AVZ08923.1|1759784_1760540_+|terminase	terminase	terminase	O80305	Escherichia_phage	72.2	4.6e-80
AVZ08924.1|1760639_1761146_+|head	head completion/stabilization protein	head	O80306	Escherichia_phage	72.6	1.2e-63
AVZ08925.1|1761145_1761349_+|tail	phage tail protein	tail	S4TTA0	Salmonella_phage	83.6	1.3e-26
AVZ08926.1|1761339_1761561_+	primosomal protein	NA	A0A218M4L5	Erwinia_phage	79.2	2.2e-27
AVZ08927.1|1761544_1762054_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	86.9	1.4e-80
AVZ08928.1|1762050_1762476_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A218M4K2	Erwinia_phage	69.6	2.1e-42
AVZ08929.1|1762450_1762609_+|lysis	phage lysis protein	lysis	A0A218M4L1	Erwinia_phage	75.0	3.1e-15
AVZ08930.1|1762571_1763039_+|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	71.6	2.5e-60
AVZ08931.1|1763031_1763478_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	67.3	1.8e-47
AVZ08932.1|1763613_1764663_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AVZ08933.1|1764649_1765228_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ08934.1|1765491_1766133_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	81.2	7.3e-95
AVZ08935.1|1766129_1766480_+|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	70.7	1.5e-38
AVZ08936.1|1766485_1767394_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	81.5	5.0e-134
AVZ08937.1|1767386_1767917_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	87.5	8.1e-92
AVZ08938.1|1767928_1769614_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	60.0	6.1e-125
AVZ08939.1|1769613_1770192_+|tail	tail assembly chaperone	tail	E5G6P1	Salmonella_phage	52.1	8.4e-50
AVZ08940.1|1770327_1771521_+|tail	phage tail protein	tail	S4TRX2	Salmonella_phage	82.9	4.4e-186
AVZ08941.1|1771533_1772052_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	79.1	2.5e-77
AVZ08942.1|1772106_1772421_+|tail	phage tail assembly protein	tail	A0A0M4S5P8	Salmonella_phage	63.9	1.9e-27
AVZ08943.1|1772453_1772576_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	84.6	1.9e-12
AVZ08944.1|1772565_1775007_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	73.8	4.2e-308
AVZ08945.1|1775020_1775485_+|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	71.4	3.2e-60
AVZ08946.1|1775481_1776645_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	79.3	1.7e-171
AVZ08947.1|1776725_1776947_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	75.3	4.5e-28
AVZ08948.1|1777014_1778383_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
AVZ08949.1|1778699_1779551_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ08950.1|1779960_1781322_-	peptidase	NA	Q6DW11	Phage_TP	99.7	1.9e-217
1779790:1779811	attR	AAAAAATAAGCCCGTGTAAGGG	NA	NA	NA	NA
AVZ08951.1|1781468_1781801_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AVZ08952.1|1781991_1782714_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
AVZ08953.1|1782710_1784114_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
AVZ08954.1|1784110_1785526_-	MFS transporter	NA	NA	NA	NA	NA
AVZ08955.1|1785526_1788604_-	multidrug transporter subunit MdtC	NA	NA	NA	NA	NA
AVZ08956.1|1788604_1791727_-	multidrug resistance protein MdtB	NA	NA	NA	NA	NA
AVZ08957.1|1791726_1792974_-	multidrug resistance protein MdtA	NA	NA	NA	NA	NA
AVZ11768.1|1793252_1793309_+	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
AVZ11769.1|1793580_1793637_+	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
AVZ11770.1|1793909_1793969_+	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
AVZ08958.1|1794190_1794850_+	VWA domain-containing protein	NA	NA	NA	NA	NA
AVZ08959.1|1794846_1795608_+	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
AVZ08960.1|1795604_1797545_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
AVZ08961.1|1797557_1798910_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.3	4.1e-07
AVZ08962.1|1799043_1799901_+	DNA-3-methyladenine glycosylase 2	NA	NA	NA	NA	NA
AVZ08963.1|1799938_1803256_-	diguanylate cyclase	NA	NA	NA	NA	NA
AVZ08964.1|1803573_1804215_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
AVZ08965.1|1804306_1804888_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
AVZ08966.1|1804909_1806763_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
AVZ08967.1|1807214_1808798_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	1.6e-34
AVZ11771.1|1809555_1810446_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	40.3	9.6e-45
AVZ08968.1|1811624_1812776_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	5.8e-42
>prophage 4
CP028578	Escherichia coli strain WCHEC005784 chromosome, complete genome	4812358	1829415	1838779	4812358	transposase	Escherichia_phage(37.5%)	9	NA	NA
AVZ08980.1|1829415_1830822_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.5	6.2e-38
AVZ08981.1|1831045_1832110_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.8	3.2e-103
AVZ08982.1|1832136_1833006_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	66.7	2.9e-110
AVZ08983.1|1833037_1833928_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.6	4.3e-29
AVZ08984.1|1833942_1834497_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	56.4	5.6e-51
AVZ08985.1|1834677_1835844_+	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	53.7	7.0e-112
AVZ08986.1|1836139_1837120_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	2.3e-185
AVZ11774.1|1837158_1837275_-	ABC transporter	NA	NA	NA	NA	NA
AVZ08987.1|1837483_1838779_+	O9 family O-antigen ABC transporter ATP-binding protein Wzt	NA	A0A2H4PQG7	Staphylococcus_phage	27.0	1.5e-14
>prophage 5
CP028578	Escherichia coli strain WCHEC005784 chromosome, complete genome	4812358	2710321	2767677	4812358	transposase,head,portal,holin,protease,tRNA,terminase,capsid,tail,integrase	Escherichia_phage(41.67%)	69	2718513:2718527	2767779:2767793
AVZ09786.1|2710321_2711428_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AVZ11829.1|2711463_2712105_+	lysogenization protein HflD	NA	NA	NA	NA	NA
AVZ09787.1|2712108_2713479_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
AVZ09788.1|2713647_2714319_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AVZ09789.1|2714318_2715779_+	sensor protein PhoQ	NA	NA	NA	NA	NA
AVZ09790.1|2715854_2716976_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AVZ09791.1|2717024_2718251_-	peptidase T	NA	NA	NA	NA	NA
AVZ11830.1|2718306_2718522_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ09792.1|2718500_2719637_+	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
2718513:2718527	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
AVZ09793.1|2719620_2720484_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
AVZ11831.1|2721080_2721707_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVZ09794.1|2722384_2723908_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AVZ09795.1|2724201_2724573_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ09796.1|2725527_2726058_-|tail	tail fiber domain-containing protein	tail	A0A2D1UII2	Escherichia_phage	85.2	2.5e-69
AVZ09797.1|2726059_2727272_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
AVZ09798.1|2730663_2731263_-	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	95.0	1.6e-107
AVZ09799.1|2731330_2734810_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
AVZ09800.1|2734870_2735518_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.4	2.6e-108
AVZ09801.1|2735415_2736159_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	4.5e-149
AVZ09802.1|2736164_2736863_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	3.4e-130
AVZ09803.1|2736862_2737219_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
AVZ09804.1|2737196_2740424_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.0	0.0e+00
AVZ11832.1|2740470_2740731_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	95.3	2.3e-39
AVZ09805.1|2740772_2741159_-|tail	phage tail protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
AVZ09806.1|2741158_2741863_-|tail	phage tail protein	tail	A0A1B5FP82	Escherichia_phage	92.7	1.4e-112
AVZ09807.1|2741923_2742268_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	5.1e-55
AVZ09808.1|2742264_2742714_-	hypothetical protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
AVZ09809.1|2742710_2743049_-|head,tail	head-tail adaptor protein	head,tail	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
AVZ09810.1|2743057_2743375_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.5	5.3e-22
AVZ09811.1|2743451_2744669_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
AVZ09812.1|2744683_2745283_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
AVZ09813.1|2745275_2746502_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.3	3.7e-204
AVZ09814.1|2746649_2748407_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
AVZ09815.1|2748406_2748889_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
AVZ09816.1|2749036_2749387_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	8.0e-64
AVZ09817.1|2749679_2749820_-	Rz1 lytic protein	NA	U5P461	Shigella_phage	84.6	1.0e-09
AVZ09818.1|2749912_2750206_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
AVZ09819.1|2750296_2750479_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
AVZ09820.1|2750531_2750759_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ09821.1|2750695_2751229_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.2	1.5e-98
AVZ09822.1|2751292_2751643_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
AVZ09823.1|2751647_2751863_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
AVZ09824.1|2752012_2752174_-	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	87.0	5.9e-14
AVZ09825.1|2752170_2752359_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
AVZ09826.1|2752619_2752955_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	1.4e-44
AVZ09827.1|2753025_2753238_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ11833.1|2753726_2753813_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
AVZ09828.1|2754207_2755029_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	5.1e-77
AVZ09829.1|2755025_2755406_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.3e-35
AVZ09830.1|2755406_2756465_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	7.5e-89
AVZ09831.1|2756466_2756745_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
AVZ09832.1|2756912_2757125_-	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
AVZ09833.1|2757327_2757507_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ09834.1|2758159_2758342_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
AVZ09835.1|2758435_2758792_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
AVZ09836.1|2758849_2759272_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
AVZ09837.1|2759312_2760383_-	phage replisome organizer	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
AVZ09838.1|2760454_2760880_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AVZ09839.1|2760863_2761106_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
AVZ11834.1|2761311_2761836_+	LexA family transcriptional repressor	NA	H9C160	Pectobacterium_phage	28.0	2.2e-12
AVZ09840.1|2762047_2762206_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ09841.1|2762189_2762489_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ09842.1|2762560_2762779_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ09843.1|2762743_2762998_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ09844.1|2763347_2763536_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AVZ09845.1|2763532_2763724_+	DUF1482 family protein	NA	NA	NA	NA	NA
AVZ09846.1|2763817_2766259_+	exonuclease	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
AVZ09847.1|2766320_2766590_+	excisionase	NA	NA	NA	NA	NA
AVZ09848.1|2766558_2767677_+|integrase	integrase	integrase	Q77Z04	Phage_21	44.4	1.6e-84
2767779:2767793	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 6
CP028578	Escherichia coli strain WCHEC005784 chromosome, complete genome	4812358	2932804	3059519	4812358	holin,head,portal,protease,plate,tRNA,terminase,capsid,tail,integrase,lysis	Escherichia_phage(37.1%)	118	2944743:2944763	3046250:3046270
AVZ10013.1|2932804_2934565_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
AVZ11844.1|2934633_2935152_+	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
AVZ10014.1|2935221_2935389_-	ribosome modulation factor	NA	NA	NA	NA	NA
AVZ10015.1|2935644_2936208_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
AVZ10016.1|2936204_2937845_-	paraquat-inducible protein B	NA	NA	NA	NA	NA
AVZ10017.1|2937849_2939103_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
AVZ10018.1|2939232_2941140_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.9e-54
AVZ10019.1|2941151_2943260_-	ribosomal RNA large subunit methyltransferase K/L	NA	NA	NA	NA	NA
AVZ10020.1|2943503_2944613_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
AVZ10021.1|2944609_2945152_-	cell division protein ZapC	NA	NA	NA	NA	NA
2944743:2944763	attL	AGTGCGGCATTTTCGCCAGAT	NA	NA	NA	NA
AVZ10022.1|2945325_2946336_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AVZ10023.1|2946446_2947157_-	pili assembly chaperone	NA	NA	NA	NA	NA
AVZ10024.1|2947149_2947665_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AVZ10025.1|2947672_2948215_-	fimbrial protein	NA	NA	NA	NA	NA
AVZ10026.1|2948226_2949297_-	fimbrial protein	NA	NA	NA	NA	NA
AVZ10027.1|2949287_2951888_-	usher protein ElfC	NA	NA	NA	NA	NA
AVZ10028.1|2951912_2952614_-	fimbrial chaperone protein ElfD	NA	NA	NA	NA	NA
AVZ10029.1|2952696_2953236_-	fimbrial subunit ElfA	NA	NA	NA	NA	NA
AVZ10030.1|2953591_2954167_+	NAD(P)H-dependent FMN reductase	NA	NA	NA	NA	NA
AVZ10031.1|2954159_2955119_+	sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVZ10032.1|2955115_2956261_+	alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
AVZ10033.1|2956271_2957063_+	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
AVZ10034.1|2957059_2957827_+	aliphatic sulfonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
AVZ10035.1|2957869_2960482_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
AVZ10036.1|2960747_2961950_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AVZ10037.1|2962118_2963519_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
AVZ10038.1|2964121_2965210_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
AVZ10039.1|2965225_2965408_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ10040.1|2965394_2966585_+	aspartate aminotransferase	NA	NA	NA	NA	NA
AVZ10041.1|2966806_2967454_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AVZ11845.1|2967480_2968029_-	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
AVZ10042.1|2968209_2970057_-	transpeptidase	NA	NA	NA	NA	NA
AVZ10043.1|2970317_2974778_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
AVZ10044.1|2974777_2975482_-	condensin subunit E	NA	NA	NA	NA	NA
AVZ10045.1|2975462_2976785_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
AVZ10046.1|2976781_2977567_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
AVZ10047.1|2977702_2978482_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
AVZ10048.1|2978458_2979352_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ10049.1|2979505_2980252_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AVZ10050.1|2980248_2980431_-	protein YcaR	NA	NA	NA	NA	NA
AVZ10051.1|2980482_2981715_-	winged helix DNA-binding protein YcaQ	NA	NA	NA	NA	NA
AVZ10052.1|2981751_2982738_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AVZ10053.1|2982734_2984483_-	lipid A export ATP-binding/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
AVZ10054.1|2984519_2986784_-	ComEC family protein	NA	NA	NA	NA	NA
AVZ10055.1|2986991_2987276_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
AVZ10056.1|2987435_2989109_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
AVZ10057.1|2989219_2989903_-	cytidylate kinase	NA	NA	NA	NA	NA
AVZ10058.1|2990075_2990840_-|protease	metalloprotease	protease	NA	NA	NA	NA
AVZ10059.1|2991008_2992292_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AVZ10060.1|2992362_2993451_-	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
AVZ10061.1|2993649_2994342_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AVZ10062.1|2994471_2996232_+	30S ribosomal protein S12 methylthiotransferase accessory factor YcaO	NA	NA	NA	NA	NA
AVZ10063.1|2996637_2997495_+	formate transporter FocA	NA	NA	NA	NA	NA
AVZ10064.1|2997549_2999832_+	formate acetyltransferase 1	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
AVZ10065.1|3000150_3000405_-	DNA-binding transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	100.0	6.1e-45
AVZ10066.1|3000450_3001614_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	4.8e-206
AVZ10067.1|3001613_3002093_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
AVZ10068.1|3002107_3004555_-|tail	phage tail tape measure protein	tail	U5N0T4	Enterobacteria_phage	96.4	0.0e+00
AVZ11846.1|3004547_3004667_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AVZ10069.1|3004699_3004975_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
AVZ10070.1|3005031_3005550_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
AVZ10071.1|3005562_3006753_-|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	6.2e-225
AVZ10072.1|3006812_3007406_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	96.4	3.0e-103
AWY02704.1|3007436_3007931_+|tail	phage tail protein	tail	K7PH60	Enterobacterial_phage	81.0	1.2e-68
AVZ10074.1|3007930_3008524_+|tail	tail fiber assembly protein	tail	K7PMC4	Enterobacterial_phage	50.8	4.9e-53
AVZ10073.1|3008495_3008912_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	46.8	1.2e-21
AWY02703.1|3008914_3010210_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	88.8	7.7e-144
AVZ10076.1|3010206_3010818_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.0	1.1e-116
AVZ10077.1|3010810_3011719_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	2.2e-161
AVZ10078.1|3011723_3012071_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
AVZ10079.1|3012067_3012703_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.6	6.5e-112
AVZ10080.1|3012769_3013222_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	2.4e-76
AVZ10081.1|3013214_3013682_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	1.9e-81
AVZ10082.1|3013644_3013818_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
AVZ10083.1|3013789_3014215_-|lysis	LysB family phage lysis regulatory protein	lysis	Q7Y4E2	Escherichia_virus	97.2	5.5e-67
AVZ10084.1|3014202_3014628_-	protein lysA	NA	A0A0F7LBP4	Escherichia_phage	96.5	8.6e-60
AVZ10085.1|3014642_3015140_-	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
AVZ10086.1|3015139_3015421_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
AVZ10087.1|3015424_3015628_-|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	98.5	2.6e-30
AVZ10088.1|3015627_3016137_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
AVZ10089.1|3016236_3016980_-|terminase	terminase	terminase	Q94MK6	Enterobacteria_phage	97.6	7.3e-123
AVZ10090.1|3016983_3018057_-|capsid	phage major capsid protein, P2 family	capsid	Q94MK7	Enterobacteria_phage	99.7	5.1e-202
AVZ10091.1|3018115_3018970_-|capsid	capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
AVZ10092.1|3019143_3020916_+	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
AVZ10093.1|3020915_3021950_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
AVZ10094.1|3022284_3024099_-	ATP-binding protein	NA	NA	NA	NA	NA
AVZ10095.1|3024085_3025333_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ10096.1|3025535_3027656_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	96.0	0.0e+00
AVZ10097.1|3027645_3027921_-	hypothetical protein	NA	Q858T5	Yersinia_virus	98.9	6.6e-45
AVZ10098.1|3027917_3028142_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	98.6	8.5e-35
AVZ10099.1|3028141_3028444_-	hypothetical protein	NA	A0A0F7LDT6	Escherichia_phage	97.0	2.5e-45
AVZ10100.1|3028443_3028668_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
AVZ10101.1|3028731_3029232_-	replication protein B	NA	S4TTB7	Salmonella_phage	100.0	1.0e-91
AVZ10102.1|3029228_3029426_-	hypothetical protein	NA	A0A0F7LDS9	Escherichia_phage	100.0	2.8e-29
AVZ11848.1|3029409_3029766_-	hypothetical protein	NA	Q1JS28	Enterobacteria_phage	99.2	1.5e-62
AVZ10103.1|3029874_3030174_+	XRE family transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	100.0	3.0e-51
AVZ10104.1|3030267_3031263_+|integrase	site-specific integrase	integrase	A0A0F7LBR0	Escherichia_phage	99.7	7.1e-190
AVZ10105.1|3031294_3032092_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
AVZ10106.1|3032173_3032764_-	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
AVZ10107.1|3032863_3033772_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVZ10108.1|3033772_3035203_-	inner membrane transporter YcaM	NA	NA	NA	NA	NA
AVZ10109.1|3035412_3036561_-	MFS transporter	NA	NA	NA	NA	NA
AVZ10110.1|3036874_3037501_+	hydrolase	NA	NA	NA	NA	NA
AVZ10111.1|3037535_3038399_-	dimethyl sulfoxide reductase subunit C	NA	NA	NA	NA	NA
AVZ10112.1|3038400_3039018_-	dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
AVZ10113.1|3039028_3041473_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
AVZ10114.1|3041711_3043004_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
AVZ10115.1|3043094_3044438_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
AVZ10116.1|3044448_3045060_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AVZ10117.1|3045218_3049208_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
3046250:3046270	attR	AGTGCGGCATTTTCGCCAGAT	NA	NA	NA	NA
AVZ10118.1|3049342_3049837_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AVZ10119.1|3050381_3051347_+	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
AVZ10120.1|3051469_3053236_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	24.3	1.8e-23
AVZ10121.1|3053236_3054958_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	9.9e-22
AVZ10122.1|3054999_3055704_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AVZ10123.1|3055988_3056207_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AVZ10124.1|3056891_3059168_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	2.5e-166
AVZ10125.1|3059198_3059519_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 7
CP028578	Escherichia coli strain WCHEC005784 chromosome, complete genome	4812358	3727287	3781439	4812358	transposase,portal,head,holin,terminase,capsid,tail,integrase,lysis	Enterobacteria_phage(35.19%)	65	3729769:3729816	3777536:3777583
AVZ10734.1|3727287_3728211_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
AVZ10735.1|3728398_3729607_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	56.5	7.7e-130
3729769:3729816	attL	AATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
AVZ10736.1|3729881_3730034_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ10737.1|3730563_3731409_+	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	38.0	5.0e-35
AVZ10738.1|3731401_3731800_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ10739.1|3731799_3732465_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ10740.1|3733395_3735285_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AVZ10741.1|3735537_3736044_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ10742.1|3736046_3736457_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	43.3	2.2e-20
AVZ10743.1|3736437_3736671_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ10744.1|3736951_3738165_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
AVZ10745.1|3741044_3741644_-	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.0	6.3e-109
AVZ10746.1|3741714_3745212_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.3	0.0e+00
AVZ10747.1|3745272_3745944_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.6	1.2e-103
AVZ10748.1|3745841_3746585_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.3e-148
AVZ10749.1|3746590_3747289_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
AVZ10750.1|3747288_3747618_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
AVZ10751.1|3747614_3750194_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	86.7	0.0e+00
AVZ10752.1|3750186_3750621_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
AVZ10753.1|3750602_3751025_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	86.4	5.9e-61
AVZ11873.1|3751040_3751781_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	94.3	7.8e-125
AVZ10754.1|3751788_3752184_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	5.0e-70
AVZ10755.1|3752180_3752759_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
AVZ10756.1|3752770_3753124_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.9e-61
AVZ10757.1|3753135_3753531_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	3.1e-56
AVZ10758.1|3753572_3754598_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	96.8	2.9e-186
AVZ10759.1|3754653_3754986_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	96.4	4.6e-53
AVZ10760.1|3754995_3756315_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	1.2e-232
AVZ10761.1|3756295_3757897_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	5.5e-309
AVZ10762.1|3757893_3758100_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AVZ10763.1|3758096_3760022_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
AVZ10764.1|3759996_3760542_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
AVZ11874.1|3760681_3760825_-	DNA-packaging protein	NA	NA	NA	NA	NA
AVZ10765.1|3760930_3761164_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
AVZ10766.1|3761220_3761631_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
AVZ10767.1|3761676_3761841_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ10768.1|3761981_3762134_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
AVZ10769.1|3762121_3762559_-|lysis	lysis protein	lysis	Q716B4	Shigella_phage	95.9	3.0e-68
AVZ10770.1|3762555_3763032_-	lysozyme	NA	K7PKV2	Enterobacteria_phage	94.9	1.9e-84
AVZ10771.1|3763035_3763362_-|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	99.1	1.2e-56
AVZ10772.1|3763762_3764512_+	TIGR04255 family protein	NA	NA	NA	NA	NA
AVZ10773.1|3764875_3765490_+	hypothetical protein	NA	A0A2D1GNI4	Pseudomonas_phage	36.4	9.9e-33
AVZ10774.1|3765515_3765860_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	89.4	7.2e-57
AVZ10775.1|3765878_3766868_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	1.9e-195
AVZ10776.1|3766875_3767673_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	98.9	9.8e-150
AVZ10777.1|3767692_3768082_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
AVZ10778.1|3768078_3768405_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	100.0	9.2e-54
AVZ10779.1|3768401_3769055_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	99.1	2.8e-126
AVZ10780.1|3769054_3769549_-	PerC family transcriptional regulator	NA	S5FUZ7	Shigella_phage	99.4	4.7e-86
AVZ10781.1|3769545_3770487_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.3	2.2e-140
AVZ10782.1|3770476_3770656_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
AVZ11875.1|3770831_3771383_-	hypothetical protein	NA	S5FXP0	Shigella_phage	98.9	7.6e-101
AVZ10783.1|3771420_3771621_-	cell division protein	NA	NA	NA	NA	NA
AVZ10784.1|3771718_3772345_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	5.5e-47
AVZ11876.1|3772572_3773133_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ10785.1|3773558_3773921_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
AVZ10786.1|3773986_3774811_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	1.7e-149
AVZ10787.1|3774938_3775475_+	HD family hydrolase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
AVZ10788.1|3775465_3775828_+	hypothetical protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
AVZ10789.1|3775827_3776133_+	hypothetical protein	NA	U5P0J0	Shigella_phage	99.0	2.6e-50
AVZ10790.1|3776132_3776483_+	DNA-binding protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
AVZ11877.1|3776584_3777523_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.4	1.8e-182
AVZ10791.1|3777727_3778981_-	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
3777536:3777583	attR	AATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
AVZ10792.1|3778992_3780096_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
AVZ10793.1|3780383_3781439_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	1.6e-118
>prophage 8
CP028578	Escherichia coli strain WCHEC005784 chromosome, complete genome	4812358	3791573	3854885	4812358	transposase,plate,tRNA	uncultured_Caudovirales_phage(20.0%)	55	NA	NA
AVZ10806.1|3791573_3792071_-|transposase	transposase	transposase	NA	NA	NA	NA
AVZ10807.1|3792246_3792996_-	endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.0e-20
AVZ10808.1|3793205_3793466_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
AVZ10809.1|3793468_3793747_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
AVZ10810.1|3793902_3794643_+	transpeptidase	NA	NA	NA	NA	NA
AVZ10811.1|3794613_3795381_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
AVZ10812.1|3795586_3796165_-	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
AVZ10813.1|3796404_3798849_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AVZ10814.1|3798891_3799365_-	inhibitor of vertebrate lysozyme	NA	NA	NA	NA	NA
AVZ10815.1|3799518_3800289_+	hydrolase YafV	NA	NA	NA	NA	NA
AVZ10816.1|3800329_3801466_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
AVZ10817.1|3801896_3802289_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ10818.1|3802266_3806499_-	RHS repeat family protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.4e-22
AVZ10819.1|3806574_3808716_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	2.4e-25
AVZ10820.1|3808755_3808893_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ10821.1|3808925_3809444_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
AVZ10822.1|3810138_3810639_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AVZ10823.1|3810673_3810898_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ10824.1|3810948_3812424_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AVZ10825.1|3812430_3812844_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AVZ10826.1|3812847_3814698_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AVZ10827.1|3814661_3815744_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AVZ10828.1|3815768_3817049_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AVZ10829.1|3817045_3817570_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AVZ10830.1|3817572_3818904_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AVZ10831.1|3818908_3819670_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AVZ10832.1|3819678_3822444_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.8e-81
AVZ10833.1|3822440_3823184_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
AVZ10834.1|3823122_3824601_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AVZ10835.1|3824679_3828144_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AVZ10836.1|3828154_3829507_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ10837.1|3829530_3830013_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
AVZ10838.1|3830056_3830971_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ10839.1|3830980_3831460_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ10840.1|3831596_3832382_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ10841.1|3832799_3832979_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ11879.1|3832918_3833650_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
AVZ10842.1|3833714_3834182_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
AVZ10843.1|3834178_3834901_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVZ10844.1|3834934_3835690_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AVZ10845.1|3835761_3837120_+	lytic transglycosylase	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
AVZ10846.1|3837167_3837791_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVZ10847.1|3837794_3838595_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
AVZ10848.1|3838835_3839750_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVZ10849.1|3839746_3840550_-	2,5-diketo-D-gluconic acid reductase B	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
AVZ10850.1|3846309_3846885_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
AVZ10851.1|3847072_3848104_+	methionine import ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	9.4e-36
AVZ10852.1|3848096_3848750_+	methionine ABC transporter	NA	NA	NA	NA	NA
AVZ10853.1|3848789_3849605_+	methionine ABC transporter substrate-binding protein MetQ	NA	NA	NA	NA	NA
AVZ10854.1|3849722_3850127_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
AVZ10855.1|3850123_3850831_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
AVZ10856.1|3850942_3852661_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AVZ10857.1|3852714_3853539_+	endopeptidase	NA	NA	NA	NA	NA
AVZ10858.1|3853738_3854449_-	lipoprotein NlpE	NA	NA	NA	NA	NA
AVZ10859.1|3854462_3854885_-|tRNA	peptidyl-tRNA hydrolase ArfB	tRNA	NA	NA	NA	NA
>prophage 9
CP028578	Escherichia coli strain WCHEC005784 chromosome, complete genome	4812358	4153378	4182866	4812358	transposase,holin	Escherichia_phage(22.22%)	24	NA	NA
AVZ11126.1|4153378_4154764_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.1	1.9e-257
AVZ11127.1|4155002_4156376_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
AVZ11128.1|4156739_4156949_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.0	5.9e-06
AVZ11129.1|4157111_4157369_-	biofilm development YmgB/AriR family protein	NA	NA	NA	NA	NA
AVZ11130.1|4159119_4159641_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
AVZ11131.1|4159637_4160591_+	fec operon regulator FecR	NA	NA	NA	NA	NA
AVZ11132.1|4160677_4163002_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AVZ11133.1|4163046_4163949_+	Fe(3+)-dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
AVZ11134.1|4163945_4164944_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
AVZ11135.1|4164940_4165897_+	iron-dicitrate ABC transporter permease FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
AVZ11136.1|4165897_4166665_+	Fe(3+) dicitrate transport ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
AVZ11137.1|4167222_4167636_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ11138.1|4168130_4169654_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AVZ11139.1|4169947_4170385_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ11140.1|4171235_4172057_+	carbohydrate transporter	NA	NA	NA	NA	NA
AVZ11141.1|4172059_4173148_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AVZ11142.1|4173152_4174103_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
AVZ11143.1|4176068_4177208_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.5e-68
AVZ11144.1|4177355_4179359_+|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.5e-21
AVZ11145.1|4179303_4179462_+|holin	choline transporter	holin	NA	NA	NA	NA
AVZ11146.1|4179421_4180699_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
AVZ11147.1|4180978_4182141_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	2.0e-50
AVZ11148.1|4182207_4182426_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AVZ11149.1|4182476_4182866_-|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	99.2	1.9e-61
>prophage 1
CP028576	Escherichia coli strain WCHEC005784 plasmid pCTXM15_005784, complete sequence	112422	3213	28311	112422	transposase,protease,integrase	Escherichia_phage(46.15%)	23	NA	NA
AVZ07133.1|3213_3954_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
AVZ07134.1|5303_6179_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
AVZ07135.1|6225_6558_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AVZ07136.1|6904_7609_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AVZ07137.1|7979_8159_-	PdcA protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
AVZ07138.1|8163_8544_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
AVZ07139.1|8543_8765_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
AVZ07240.1|8947_10504_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	3.2e-104
AVZ07140.1|10500_11772_+	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	28.0	1.5e-11
AVZ07141.1|11893_15010_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	3.7e-27
AVZ07142.1|16057_16990_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ07143.1|16993_17989_-	nucleotidyltransferase	NA	NA	NA	NA	NA
AVZ07144.1|18696_18915_+	antitoxin CcdA	NA	NA	NA	NA	NA
AVZ07145.1|18916_19222_+	toxin CcdB	NA	NA	NA	NA	NA
AVZ07146.1|19222_20029_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
AVZ07147.1|20805_21510_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AVZ07148.1|22209_23070_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
AVZ07149.1|23238_23943_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AVZ07150.1|24241_25102_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AVZ07151.1|25378_26689_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AVZ07152.1|26872_26977_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ07153.1|26973_27438_-	mRNA interferase PemK	NA	NA	NA	NA	NA
AVZ07154.1|27657_28311_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
CP028576	Escherichia coli strain WCHEC005784 plasmid pCTXM15_005784, complete sequence	112422	64285	97085	112422	transposase	Escherichia_phage(38.46%)	38	NA	NA
AVZ07197.1|64285_65558_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.0	1.8e-174
AVZ07198.1|65579_66113_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ07245.1|66580_66718_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AVZ07199.1|66862_67204_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ07200.1|67473_68037_-	class I SAM-dependent methyltransferase	NA	A0A2I7RQ20	Vibrio_phage	40.0	3.0e-20
AVZ07201.1|68084_69446_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
AVZ07202.1|69497_69728_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ07203.1|70756_70948_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ07247.1|70947_71343_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AVZ07204.1|71408_71834_-	antirestriction protein	NA	NA	NA	NA	NA
AVZ07205.1|73077_73512_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AVZ07206.1|73525_73747_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ07207.1|73747_74431_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	5.1e-30
AVZ07246.1|74815_75718_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
AVZ07208.1|75755_76028_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ07209.1|76584_77556_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	99.4	7.0e-174
AVZ07210.1|77555_78722_-	protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
AVZ07211.1|79309_80065_-	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
AVZ07212.1|80185_80890_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AVZ07213.1|82662_83367_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVZ07248.1|83998_84829_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
AVZ07249.1|84959_85514_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
AVZ07214.1|85657_86362_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVZ07250.1|87264_87738_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
AVZ07215.1|87868_88657_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
AVZ07216.1|88862_89210_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AVZ07217.1|89203_90043_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AVZ07218.1|89972_90152_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ07219.1|90170_90374_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ07220.1|90529_91735_+	chromate transporter	NA	NA	NA	NA	NA
AVZ07221.1|91745_92051_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AVZ07222.1|92066_92249_-	resolvase	NA	NA	NA	NA	NA
AVZ07251.1|92277_93042_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AVZ07223.1|93232_93589_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ07224.1|93534_94119_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AVZ07225.1|94118_95357_-	MFS transporter	NA	NA	NA	NA	NA
AVZ07226.1|95353_96259_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AVZ07227.1|96380_97085_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
