The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027604	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 chromosome, complete genome	4775558	592203	615524	4775558	transposase	Liberibacter_phage(33.33%)	17	NA	NA
AVO81471.1|592203_593760_-|transposase	transposase	transposase	NA	NA	NA	NA
AVO81472.1|593800_595249_-	ATP-binding protein	NA	NA	NA	NA	NA
AVO81473.1|595248_597372_-|transposase	transposase	transposase	NA	NA	NA	NA
AVO81474.1|597358_598201_-|transposase	transposase	transposase	NA	NA	NA	NA
AVO81475.1|598423_599011_-	hypothetical protein	NA	NA	NA	NA	NA
AVO81476.1|599669_600446_-	M48 family peptidase	NA	NA	NA	NA	NA
AVO81477.1|600445_603715_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	28.8	1.7e-59
AVO81478.1|603714_604350_-	TIGR02646 family protein	NA	NA	NA	NA	NA
AVO81479.1|604333_605713_-	ATP-binding protein	NA	C7BGE8	Burkholderia_phage	26.9	1.7e-08
AVO81480.1|605712_606900_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AVO81481.1|606889_608401_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.7	1.1e-88
AVO81482.1|608403_609042_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AVO81483.1|609025_609427_-	hypothetical protein	NA	NA	NA	NA	NA
AVO81484.1|609677_611075_-|transposase	transposase	transposase	NA	NA	NA	NA
AVO81485.1|611109_612561_-	ATP-binding protein	NA	NA	NA	NA	NA
AVO81486.1|612550_614710_-|transposase	transposase	transposase	NA	NA	NA	NA
AVO81487.1|614699_615524_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
>prophage 2
CP027604	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 chromosome, complete genome	4775558	1850000	1857595	4775558	integrase	Enterobacteria_phage(30.0%)	10	1842416:1842430	1868109:1868123
1842416:1842430	attL	ACGGCGTAATCCTGT	NA	NA	NA	NA
AVO82554.1|1850000_1851053_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	2.6e-118
AVO82555.1|1851358_1852462_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.9	1.7e-59
AVO82556.1|1852473_1853727_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.6	2.3e-97
AVO82557.1|1853928_1854924_-|integrase	integrase	integrase	A0A2H5BFK7	Salmonella_phage	95.2	9.6e-187
AVO82558.1|1854968_1855319_-	DNA-binding protein	NA	Q5G8V4	Enterobacteria_phage	95.7	1.5e-57
AVO82559.1|1855321_1855531_-	hypothetical protein	NA	A0A220IH74	Escherichia_phage	59.3	2.1e-11
AVO82560.1|1855567_1856113_-	hypothetical protein	NA	E5AGD3	Erwinia_phage	35.0	2.2e-20
AVO82561.1|1856124_1856325_-	hypothetical protein	NA	G8C7S1	Escherichia_phage	71.2	1.1e-20
AVO82562.1|1856333_1857134_-	hypothetical protein	NA	K7P7Q8	Enterobacteria_phage	85.0	6.6e-138
AVO85263.1|1857133_1857595_-	hypothetical protein	NA	A0A2H4N7D9	Pectobacterium_phage	55.7	4.1e-39
1868109:1868123	attR	ACGGCGTAATCCTGT	NA	NA	NA	NA
>prophage 3
CP027604	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 chromosome, complete genome	4775558	2336724	2367754	4775558	capsid,terminase,tail,holin,portal,head,integrase	Cronobacter_phage(80.65%)	38	2336029:2336043	2345190:2345204
2336029:2336043	attL	GAAGAGGGCAACCGC	NA	NA	NA	NA
AVO82991.1|2336724_2337243_+	outer membrane protein X	NA	K7PJP9	Enterobacteria_phage	31.4	3.2e-16
AVO82992.1|2337358_2338942_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
AVO82993.1|2339211_2339340_-	Mn(2+)-response protein MntS	NA	NA	NA	NA	NA
AVO82994.1|2339506_2340547_-|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	61.4	4.4e-118
AVO82995.1|2340547_2341126_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	40.7	1.3e-29
AVO82996.1|2341245_2341467_+	regulator	NA	NA	NA	NA	NA
AVO82997.1|2341497_2342001_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	70.1	9.5e-58
AVO82998.1|2342010_2342205_+	hypothetical protein	NA	NA	NA	NA	NA
AVO82999.1|2342194_2342623_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.2	5.8e-24
AVO83000.1|2342622_2343024_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	54.1	6.0e-39
AVO83001.1|2343090_2343324_+	DUF2732 domain-containing protein	NA	NA	NA	NA	NA
AVO83002.1|2343314_2344181_+	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	93.6	5.0e-147
AVO83003.1|2344177_2344390_+	hypothetical protein	NA	NA	NA	NA	NA
AVO83004.1|2346547_2346754_+	hypothetical protein	NA	NA	NA	NA	NA
2345190:2345204	attR	GAAGAGGGCAACCGC	NA	NA	NA	NA
AVO83005.1|2346727_2347051_-	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	88.5	1.3e-47
AVO83006.1|2347047_2348100_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	78.3	1.5e-158
AVO83007.1|2350044_2350842_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	53.1	8.2e-64
AVO83008.1|2350901_2351924_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	79.1	1.6e-152
AVO83009.1|2351926_2352628_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	3.3e-85
AVO83010.1|2352726_2353179_+|head	head completion protein	head	F1BUL8	Cronobacter_phage	78.0	1.0e-58
AVO83011.1|2353175_2353682_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.7	1.1e-64
AVO83012.1|2353678_2354386_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	78.2	2.3e-102
AVO83013.1|2354382_2355510_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	82.7	4.3e-175
AVO83014.1|2355506_2355962_+	DUF2597 domain-containing protein	NA	F1BUL4	Cronobacter_phage	72.2	3.5e-59
AVO83015.1|2355971_2356265_+|holin	holin	holin	C7BGD7	Burkholderia_phage	48.4	6.8e-16
AVO83016.1|2356261_2356603_+	hypothetical protein	NA	F1BUL3	Cronobacter_phage	89.1	5.4e-49
AVO83017.1|2356602_2356971_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	52.4	3.6e-22
AVO83018.1|2356867_2357107_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	57.9	5.0e-17
AVO83019.1|2357090_2357351_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	59.3	2.4e-20
AVO83020.1|2357538_2359851_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	57.5	3.8e-218
AVO83021.1|2359847_2360177_+	DUF2590 domain-containing protein	NA	F1BUK8	Cronobacter_phage	72.5	4.6e-37
AVO83022.1|2360173_2361358_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	79.0	2.4e-176
AVO83023.1|2361350_2361938_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	80.5	9.9e-91
AVO83024.1|2361947_2364404_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	56.5	1.2e-169
AVO83025.1|2364405_2364840_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	60.8	5.2e-20
AVO83026.1|2364829_2365555_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	51.0	1.2e-61
AVO83027.1|2365526_2366075_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	74.0	4.1e-62
AVO83028.1|2366077_2367754_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	63.5	1.6e-205
>prophage 4
CP027604	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 chromosome, complete genome	4775558	2705945	2766199	4775558	capsid,terminase,holin,tail,portal,tRNA,protease,head,integrase	Enterobacterial_phage(28.3%)	82	2699623:2699640	2773969:2773986
2699623:2699640	attL	TTTTGTAGGCCGGGTAAG	NA	NA	NA	NA
AVO83334.1|2705945_2707058_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AVO83335.1|2707098_2707572_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AVO83336.1|2707571_2708234_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AVO83337.1|2708351_2709602_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	7.9e-21
AVO83338.1|2709677_2709923_+	DUF2543 domain-containing protein	NA	NA	NA	NA	NA
AVO83339.1|2709927_2711427_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AVO83340.1|2711551_2711644_-	stress response membrane protein YncL	NA	NA	NA	NA	NA
AVO85285.1|2711801_2711987_+	hypothetical protein	NA	NA	NA	NA	NA
AVO83341.1|2712015_2712264_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AVO85286.1|2712317_2712392_-	hypothetical protein	NA	NA	NA	NA	NA
AVO83342.1|2712392_2712491_-	hypothetical protein	NA	NA	NA	NA	NA
AVO83343.1|2712536_2713565_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	32.1	5.0e-13
AVO83344.1|2713876_2714131_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AVO83345.1|2714211_2714517_+	hypothetical protein	NA	NA	NA	NA	NA
AVO83346.1|2714517_2714862_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AVO83347.1|2715012_2715720_+	hypothetical protein	NA	NA	NA	NA	NA
AVO83348.1|2715751_2716939_-	cyanate MFS transporter	NA	NA	NA	NA	NA
AVO83349.1|2717038_2717830_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVO83350.1|2717813_2718260_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
AVO83351.1|2718366_2720403_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
AVO83352.1|2720418_2721750_-	MFS transporter	NA	NA	NA	NA	NA
AVO83353.1|2722159_2722660_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
AVO83354.1|2722879_2724022_-|integrase	integrase	integrase	O21929	Phage_21	49.3	6.4e-94
AVO83355.1|2723996_2724260_-	hypothetical protein	NA	NA	NA	NA	NA
AVO83356.1|2724292_2724562_-	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	74.2	6.9e-31
AVO83357.1|2724641_2725418_-	DUF551 domain-containing protein	NA	M9NZE4	Enterobacteria_phage	43.1	1.1e-28
AVO83358.1|2725414_2725837_-	HNH endonuclease	NA	C6ZR29	Salmonella_phage	85.7	2.5e-67
AVO83359.1|2726173_2726404_-	hypothetical protein	NA	G8C7U9	Escherichia_phage	97.4	9.7e-34
AVO83360.1|2726400_2726919_-	hypothetical protein	NA	K7PHA5	Enterobacterial_phage	52.3	1.3e-22
AVO83361.1|2726905_2727931_-	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	90.4	4.6e-168
AVO85287.1|2727927_2728341_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	86.1	3.6e-55
AVO85288.1|2728875_2729079_-	hypothetical protein	NA	NA	NA	NA	NA
AVO85289.1|2729289_2729949_-	LexA family transcriptional repressor	NA	K7PGR7	Enterobacteria_phage	62.1	4.1e-69
AVO83362.1|2730056_2730281_+	XRE family transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	54.5	5.4e-13
AVO83363.1|2730306_2730777_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	91.7	6.8e-74
AVO83364.1|2731017_2731224_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	69.2	4.5e-14
AVO83365.1|2731186_2732125_+	transcriptional regulator	NA	K7PLZ7	Enterobacterial_phage	87.1	6.5e-68
AVO83366.1|2732121_2732616_+	hypothetical protein	NA	NA	NA	NA	NA
AVO83367.1|2732615_2733275_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	78.6	1.3e-99
AVO83368.1|2733271_2733595_+	LexA family transcriptional regulator	NA	K7PHB4	Enterobacterial_phage	77.9	7.2e-43
AVO83369.1|2733591_2733981_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	93.8	5.1e-67
AVO83370.1|2733977_2734967_+	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	89.4	4.7e-178
AVO83371.1|2734979_2735558_+	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	53.3	7.3e-46
AVO83372.1|2735924_2736125_+	hypothetical protein	NA	NA	NA	NA	NA
AVO83373.1|2736137_2737037_+|protease	serine protease	protease	NA	NA	NA	NA
AVO83374.1|2737129_2737534_+	hypothetical protein	NA	NA	NA	NA	NA
AVO83375.1|2737530_2737812_+|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	35.9	3.0e-05
AVO83376.1|2737808_2738435_+	endolysin	NA	K7PJS7	Enterobacterial_phage	92.3	9.5e-108
AVO83377.1|2738442_2738718_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	53.3	2.4e-15
AVO83378.1|2738668_2738860_+	hypothetical protein	NA	K7PM01	Enterobacterial_phage	93.3	1.2e-18
AVO83379.1|2739176_2739752_-	hypothetical protein	NA	NA	NA	NA	NA
AVO83380.1|2739937_2741395_+	glycosyltransferase family 2 protein	NA	K7PKP3	Enterobacterial_phage	91.8	9.8e-273
AVO83381.1|2741413_2741644_+	hypothetical protein	NA	NA	NA	NA	NA
AVO83382.1|2741659_2741944_-	hypothetical protein	NA	NA	NA	NA	NA
AVO83383.1|2742109_2742700_+	hypothetical protein	NA	K7PGW6	Enterobacterial_phage	86.2	1.9e-97
AVO85290.1|2742696_2743041_+	HNH endonuclease	NA	A0A2I6PIG1	Escherichia_phage	73.0	6.7e-47
AVO83384.1|2743172_2743637_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	61.4	2.2e-48
AVO83385.1|2743590_2745327_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.3	3.7e-141
AVO83386.1|2745326_2746604_+|portal	phage portal protein	portal	F1C584	Cronobacter_phage	86.3	8.8e-217
AVO83387.1|2746621_2747305_+|head,protease	HK97 family phage prohead protease	head,protease	Q9MCV5	Escherichia_phage	78.4	8.8e-99
AVO83388.1|2747308_2748469_+|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	86.0	1.2e-185
AVO85291.1|2748506_2748827_+	hypothetical protein	NA	K7PKV5	Enterobacterial_phage	61.3	1.2e-34
AVO83389.1|2748826_2749168_+	hypothetical protein	NA	A0A1W6JP44	Morganella_phage	30.1	2.3e-07
AVO83390.1|2749157_2749535_+	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	38.7	1.0e-19
AVO83391.1|2749531_2749936_+	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	72.0	1.1e-43
AVO83392.1|2749968_2750421_+|tail	phage tail protein	tail	Q7Y403	Yersinia_phage	76.7	9.1e-60
AVO83393.1|2750484_2750847_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	54.3	3.1e-26
AVO85292.1|2750867_2751086_+	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	66.7	1.5e-23
AVO83394.1|2751085_2754412_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	69.1	0.0e+00
AVO83395.1|2754411_2754750_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	73.2	1.9e-46
AVO83396.1|2754746_2755505_+|tail	phage minor tail protein L	tail	G8C7J7	Escherichia_phage	94.8	1.4e-142
AVO83397.1|2755506_2756214_+	peptidase P60	NA	K7PLS6	Enterobacteria_phage	97.0	2.7e-143
AVO85293.1|2756246_2756660_+	hypothetical protein	NA	G8C7Q7	Escherichia_phage	65.7	4.9e-52
AVO83398.1|2756718_2757309_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	77.6	3.3e-78
AVO83399.1|2757362_2761199_+	DUF1983 domain-containing protein	NA	K7PJL6	Enterobacteria_phage	83.4	0.0e+00
AVO83400.1|2761242_2761557_+	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	63.7	5.6e-32
AVO83401.1|2761557_2762229_+	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	72.6	2.6e-87
AVO83402.1|2762336_2762570_+	cor protein	NA	E4WL42	Enterobacteria_phage	77.6	8.6e-30
AVO83403.1|2762628_2764011_+|tail	phage tail protein	tail	K7P6I4	Enterobacteria_phage	56.8	1.9e-124
AVO83404.1|2764093_2764333_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	71.8	3.5e-26
AVO83405.1|2764332_2764653_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	54.7	2.3e-25
AVO83406.1|2764915_2766199_-	hypothetical protein	NA	A0A140HLI1	Bacillus_phage	28.3	1.4e-09
2773969:2773986	attR	CTTACCCGGCCTACAAAA	NA	NA	NA	NA
>prophage 5
CP027604	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 chromosome, complete genome	4775558	3000724	3007973	4775558		Escherichia_phage(83.33%)	8	NA	NA
AVO83626.1|3000724_3001402_+	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	62.6	1.5e-77
AVO83627.1|3001577_3001889_-	DNA damage-inducible SOS regulon protein	NA	NA	NA	NA	NA
AVO83628.1|3001998_3002613_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	34.7	3.3e-28
AVO83629.1|3002657_3003512_-	dimethylsulfoxide reductase	NA	A0A077SK59	Escherichia_phage	34.9	1.2e-23
AVO83630.1|3003513_3004131_-	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	59.1	1.4e-74
AVO83631.1|3004141_3006580_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.5	2.9e-216
AVO83632.1|3006710_3007016_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AVO83633.1|3007118_3007973_-	benzoate transporter	NA	M1I711	Paramecium_bursaria_Chlorella_virus	33.2	8.1e-25
>prophage 6
CP027604	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 chromosome, complete genome	4775558	3333450	3425594	4775558	tail,terminase,tRNA,plate,holin	Enterobacteria_phage(28.85%)	87	NA	NA
AVO83909.1|3333450_3333669_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	65.7	2.9e-19
AVO83910.1|3334230_3334458_+	hypothetical protein	NA	NA	NA	NA	NA
AVO83911.1|3334662_3335001_+	hypothetical protein	NA	NA	NA	NA	NA
AVO83912.1|3335415_3335982_-	DNA-invertase	NA	A0A1S6L009	Salmonella_phage	80.0	6.0e-77
AVO83913.1|3336109_3336847_+	hypothetical protein	NA	K7P6T0	Enterobacteria_phage	55.7	5.4e-70
AVO83914.1|3337706_3339017_-	hypothetical protein	NA	K7PGY2	Enterobacteria_phage	46.2	1.3e-77
AVO83915.1|3339075_3339309_-	cor protein	NA	E4WL42	Enterobacteria_phage	76.3	9.5e-29
AVO83916.1|3339377_3340088_-	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	72.6	3.6e-87
AVO83917.1|3340088_3340403_-	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	65.7	6.6e-33
AVO83918.1|3340443_3343995_-	DUF1983 domain-containing protein	NA	K7P840	Enterobacteria_phage	84.6	0.0e+00
AVO83919.1|3344047_3344674_-|tail	tail assembly protein	tail	K7PH91	Enterobacterial_phage	59.9	1.8e-53
AVO83920.1|3344785_3345436_-	hypothetical protein	NA	NA	NA	NA	NA
AVO83921.1|3345428_3346142_-	peptidase P60	NA	K7PLS6	Enterobacteria_phage	97.4	1.0e-142
AVO83922.1|3346143_3346899_-|tail	phage minor tail protein L	tail	G8C7J7	Escherichia_phage	77.2	2.0e-115
AVO83923.1|3346895_3347243_-|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	62.6	1.7e-37
AVO83924.1|3347299_3347653_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	98.3	6.0e-59
AVO83925.1|3347727_3350640_-|tail	phage tail tape measure protein	tail	A0A0K0VLY2	Klebsiella_phage	34.7	1.6e-128
AVO83926.1|3350636_3350951_-	hypothetical protein	NA	I6PD79	Cronobacter_phage	65.0	1.1e-16
AVO83927.1|3350947_3351259_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	68.0	1.8e-35
AVO83928.1|3351324_3351996_-|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	47.3	7.4e-50
AVO83929.1|3352065_3352476_-	hypothetical protein	NA	I6PDJ8	Cronobacter_phage	52.2	1.9e-32
AVO83930.1|3352472_3353057_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	55.3	1.4e-49
AVO83931.1|3353058_3353409_-	hypothetical protein	NA	I6PD77	Cronobacter_phage	57.8	2.1e-32
AVO83932.1|3353410_3353893_-	hypothetical protein	NA	A0A0E3GMJ4	Enterobacteria_phage	34.7	2.6e-12
AVO83933.1|3354210_3355164_-	hypothetical protein	NA	A0A1B0VMF8	Pseudomonas_phage	75.0	5.3e-134
AVO83934.1|3355176_3355947_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	59.6	6.3e-69
AVO83935.1|3356027_3357125_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	57.9	1.8e-117
AVO83936.1|3357126_3358515_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	49.2	2.1e-123
AVO83937.1|3358516_3359824_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	57.3	1.3e-143
AVO83938.1|3359801_3360800_-|terminase	terminase small subunit	terminase	I6X6R5	Burkholderia_virus	43.4	1.1e-38
AVO83939.1|3360846_3361296_-	hypothetical protein	NA	NA	NA	NA	NA
AVO85314.1|3362804_3363080_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	84.4	3.7e-32
AVO83940.1|3363087_3363717_-	endolysin	NA	G8C7W0	Escherichia_phage	87.1	2.3e-101
AVO83941.1|3363716_3363998_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	46.2	1.3e-19
AVO83942.1|3363984_3364371_-	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	78.1	3.2e-45
AVO83943.1|3364464_3364653_-	hypothetical protein	NA	NA	NA	NA	NA
AVO83944.1|3365156_3365348_-	hypothetical protein	NA	NA	NA	NA	NA
AVO83945.1|3365873_3366707_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	78.7	3.3e-124
AVO85315.1|3366703_3367066_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	83.1	5.2e-50
AVO83946.1|3367068_3367269_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	78.8	9.0e-28
AVO83947.1|3367273_3367876_-	DUF1367 domain-containing protein	NA	A0A0M4QX23	Salmonella_phage	82.5	6.8e-95
AVO85316.1|3367915_3368113_-	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	70.5	1.4e-20
AVO83948.1|3368264_3368489_-	DinI family protein	NA	H6WRY5	Salmonella_phage	62.3	1.8e-21
AVO83949.1|3368859_3369306_-	VOC family protein	NA	NA	NA	NA	NA
AVO83950.1|3369792_3370974_+	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AVO83951.1|3371319_3371538_-	hypothetical protein	NA	NA	NA	NA	NA
AVO83952.1|3371839_3372289_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AVO83953.1|3372396_3372579_-	hypothetical protein	NA	NA	NA	NA	NA
AVO83954.1|3372565_3373252_-	phage replication protein	NA	G8C7U6	Escherichia_phage	63.0	2.0e-82
AVO83955.1|3373248_3374106_-	hypothetical protein	NA	K7PGZ0	Enterobacteria_phage	70.1	3.1e-101
AVO83956.1|3374250_3374802_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	47.3	7.5e-32
AVO83957.1|3374804_3375032_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	62.2	1.6e-20
AVO83958.1|3375131_3375524_+	transcriptional regulator	NA	K7PM35	Enterobacteria_phage	63.1	6.3e-41
AVO83959.1|3376342_3379480_+	exodeoxyribonuclease	NA	K7P6V4	Enterobacteria_phage	64.4	0.0e+00
AVO83960.1|3379489_3380575_+	enterohemolysin	NA	K7PKR8	Enterobacteria_phage	63.3	2.8e-123
AVO83961.1|3380613_3380856_+	DUF4060 domain-containing protein	NA	K7PHF4	Enterobacteria_phage	93.6	1.3e-33
AVO83962.1|3380920_3381133_+	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	63.4	4.3e-20
AVO83963.1|3381134_3382373_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	70.0	4.3e-168
AVO83964.1|3382422_3383358_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	95.7	3.0e-142
AVO83965.1|3383401_3384775_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.6	1.1e-50
AVO83966.1|3385123_3385321_+	hypothetical protein	NA	NA	NA	NA	NA
AVO83967.1|3385259_3386243_-	zinc transporter ZntB	NA	NA	NA	NA	NA
AVO83968.1|3386333_3387464_-	chemoreceptor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.6	2.6e-10
AVO83969.1|3387780_3388269_-	hypothetical protein	NA	NA	NA	NA	NA
AVO83970.1|3388297_3389614_-	hypothetical protein	NA	NA	NA	NA	NA
AVO83971.1|3389637_3390093_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AVO83972.1|3391238_3391763_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AVO83973.1|3392647_3392833_-	hypothetical protein	NA	NA	NA	NA	NA
AVO83974.1|3395247_3395742_-	hypothetical protein	NA	NA	NA	NA	NA
AVO83975.1|3395751_3396759_-	hypothetical protein	NA	NA	NA	NA	NA
AVO83976.1|3396748_3399211_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
AVO83977.1|3399215_3399740_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AVO83978.1|3399775_3400858_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AVO83979.1|3401190_3401682_-	hypothetical protein	NA	NA	NA	NA	NA
AVO83980.1|3404136_3405906_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AVO83981.1|3405938_3407546_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AVO83982.1|3407565_3410937_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
AVO83983.1|3410929_3412138_-	hypothetical protein	NA	NA	NA	NA	NA
AVO83984.1|3412140_3412404_-	PAAR domain-containing protein	NA	R9U4D0	Rhizobium_phage	48.0	1.5e-06
AVO83985.1|3412600_3413221_-	hypothetical protein	NA	NA	NA	NA	NA
AVO83986.1|3413301_3413883_-	hypothetical protein	NA	NA	NA	NA	NA
AVO83987.1|3416236_3418594_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
AVO83988.1|3418590_3421239_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.8	1.6e-95
AVO83989.1|3421412_3421904_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AVO83990.1|3421909_3423580_-	OmpA family protein	NA	NA	NA	NA	NA
AVO83991.1|3423579_3424254_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AVO83992.1|3424250_3425594_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 7
CP027604	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 chromosome, complete genome	4775558	3686494	3693027	4775558		Shigella_phage(33.33%)	8	NA	NA
AVO84213.1|3686494_3687139_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	49.8	3.3e-55
AVO84214.1|3687306_3688287_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
AVO84215.1|3688764_3689436_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.5	1.1e-80
AVO84216.1|3689502_3689910_-	tolA family protein	NA	NA	NA	NA	NA
AVO84217.1|3690052_3691321_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.5	3.4e-229
AVO84218.1|3691320_3691626_-	hypothetical protein	NA	I6PCW5	Cronobacter_phage	40.6	7.8e-15
AVO84219.1|3691738_3692101_+	GtrA family protein	NA	U5P0S6	Shigella_phage	85.0	4.4e-49
AVO84220.1|3692097_3693027_+	glycosyltransferase	NA	U5P087	Shigella_phage	90.1	5.7e-157
>prophage 8
CP027604	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 chromosome, complete genome	4775558	3697488	3738836	4775558	tail,terminase,holin,integrase	Cronobacter_phage(23.53%)	66	3688408:3688436	3736623:3736651
3688408:3688436	attL	GATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
AVO84222.1|3697488_3699966_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	92.8	0.0e+00
AVO84223.1|3699952_3700318_-	peptidoglycan endopeptidase	NA	F1C5F2	Cronobacter_phage	93.3	1.1e-63
AVO84224.1|3700331_3700802_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	94.2	1.1e-79
AVO84225.1|3700801_3701299_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	87.9	5.3e-85
AVO84226.1|3701298_3704202_-|tail	tail protein (tape measure)	tail	F1C5E9	Cronobacter_phage	37.3	1.7e-106
AVO84227.1|3704214_3704886_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	49.8	7.0e-56
AVO84228.1|3704943_3705687_-	DNA breaking-rejoining protein	NA	F1C5E5	Cronobacter_phage	85.4	1.3e-71
AVO84229.1|3705751_3706135_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	64.6	2.3e-40
AVO84230.1|3706131_3706596_-	hypothetical protein	NA	A0A2P1MXA4	Escherichia_phage	44.8	2.0e-30
AVO84231.1|3706598_3706949_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	67.0	2.0e-38
AVO84232.1|3706948_3707122_-	50S ribosomal protein L13	NA	Q5G8X7	Enterobacteria_phage	49.1	7.8e-12
AVO84233.1|3707121_3707523_-	hypothetical protein	NA	A0A1V0E5R0	Salmonella_phage	81.5	7.1e-56
AVO84234.1|3707585_3707879_-	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	85.6	5.7e-39
AVO84235.1|3707888_3708965_-	hypothetical protein	NA	A0A1V0E5P6	Salmonella_phage	87.7	2.3e-178
AVO84236.1|3708982_3709432_-	hypothetical protein	NA	H6WRT3	Salmonella_phage	85.9	5.5e-65
AVO84237.1|3709444_3710710_-	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	88.6	2.1e-215
AVO84238.1|3711598_3712948_-	DUF1073 domain-containing protein	NA	A0A1V0E5Q5	Salmonella_phage	88.4	4.1e-233
AVO84239.1|3713017_3713284_-	hypothetical protein	NA	Q5G8Y6	Enterobacteria_phage	94.3	3.8e-42
AVO84240.1|3713345_3714830_-	DNA-packaging protein	NA	G0ZND4	Cronobacter_phage	88.1	2.2e-259
AVO84241.1|3714816_3715389_-|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	72.1	6.5e-71
AVO84242.1|3715416_3715752_+	hypothetical protein	NA	NA	NA	NA	NA
AVO84243.1|3715811_3716027_-	hypothetical protein	NA	NA	NA	NA	NA
AVO84244.1|3716131_3716383_-	hypothetical protein	NA	NA	NA	NA	NA
AVO84245.1|3716560_3716758_-	hypothetical protein	NA	K7PM01	Enterobacterial_phage	90.7	1.6e-16
AVO84246.1|3716714_3716987_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	59.1	3.1e-15
AVO84247.1|3716983_3717526_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	70.4	2.7e-74
AVO84248.1|3717528_3717804_-|holin	phage holin family protein	holin	S4TNV9	Salmonella_phage	41.0	5.8e-09
AVO84249.1|3717800_3718202_-	hypothetical protein	NA	NA	NA	NA	NA
AVO84250.1|3718481_3718724_-	hypothetical protein	NA	NA	NA	NA	NA
AVO84251.1|3718913_3719603_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.5	5.1e-62
AVO84252.1|3719602_3719719_-	hypothetical protein	NA	NA	NA	NA	NA
AVO84253.1|3719715_3720357_-	NinG family protein	NA	M9NYX8	Enterobacteria_phage	71.6	2.6e-76
AVO84254.1|3720349_3720520_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	90.9	8.2e-22
AVO84255.1|3720516_3720954_-	protein ninB	NA	G8C7V3	Escherichia_phage	69.0	2.7e-53
AVO84256.1|3721134_3721368_-	hypothetical protein	NA	NA	NA	NA	NA
AVO84257.1|3721376_3721628_-	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	83.6	4.3e-27
AVO84258.1|3721629_3721830_-	hypothetical protein	NA	NA	NA	NA	NA
AVO84259.1|3721937_3722540_-	DUF551 domain-containing protein	NA	G8C7V0	Escherichia_phage	67.5	1.8e-31
AVO84260.1|3722536_3723061_-	hypothetical protein	NA	A0A0K2FJF6	Enterobacteria_phage	48.3	4.8e-36
AVO84261.1|3723057_3723402_-	transcriptional regulator	NA	G8C7U7	Escherichia_phage	96.5	2.1e-56
AVO84262.1|3723398_3724271_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	66.2	5.8e-103
AVO84263.1|3724255_3725125_-	replication protein	NA	K7PGT1	Enterobacteria_phage	48.8	8.4e-62
AVO84264.1|3725210_3725756_-	hypothetical protein	NA	K7P7P2	Enterobacteria_phage	82.3	7.3e-80
AVO84265.1|3725785_3726019_-	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	67.6	1.1e-21
AVO84266.1|3726057_3726828_+	phage repressor protein C	NA	A0A2H4FNG6	Salmonella_phage	65.1	1.9e-94
AVO84267.1|3726838_3727135_+	hypothetical protein	NA	NA	NA	NA	NA
AVO85332.1|3727678_3728116_+	hypothetical protein	NA	K7P7N6	Enterobacteria_phage	97.2	3.9e-76
AVO84268.1|3728279_3728489_+	hypothetical protein	NA	NA	NA	NA	NA
AVO84269.1|3728645_3728852_+	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	100.0	3.6e-32
AVO84270.1|3728930_3729215_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	91.5	1.9e-47
AVO84271.1|3729233_3730079_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	61.2	1.1e-69
AVO84272.1|3730075_3730756_+	exonuclease	NA	M9NZE1	Enterobacteria_phage	94.7	4.5e-127
AVO84273.1|3730752_3731181_+	regulator	NA	G8C7S8	Escherichia_phage	97.2	2.6e-72
AVO84274.1|3731341_3732094_+	hypothetical protein	NA	M1FN76	Enterobacteria_phage	86.4	9.6e-131
AVO84275.1|3732098_3733223_+	site-specific DNA-methyltransferase	NA	A0A060D598	Salmonella_phage	48.4	6.8e-88
AVO84276.1|3733219_3733438_+	hypothetical protein	NA	NA	NA	NA	NA
AVO84277.1|3733434_3733776_+	DUF551 domain-containing protein	NA	U5P092	Shigella_phage	51.9	3.2e-17
AVO84278.1|3733867_3734086_+	hypothetical protein	NA	M1FQT7	Enterobacteria_phage	64.8	2.1e-17
AVO84279.1|3734176_3734446_+	hypothetical protein	NA	NA	NA	NA	NA
AVO84280.1|3734534_3735065_+	hypothetical protein	NA	A0A059VFZ8	Pseudomonas_phage	42.1	3.0e-30
AVO84281.1|3735221_3735494_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	63.3	2.5e-28
AVO84282.1|3735462_3736548_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	68.4	9.6e-148
AVO84283.1|3736870_3737209_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
3736623:3736651	attR	GATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
AVO84284.1|3737225_3738095_-	hypothetical protein	NA	NA	NA	NA	NA
AVO84285.1|3738096_3738468_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AVO84286.1|3738605_3738836_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	7.0e-16
>prophage 9
CP027604	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 chromosome, complete genome	4775558	3919341	3927087	4775558		Bodo_saltans_virus(16.67%)	7	NA	NA
AVO84453.1|3919341_3919953_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	29.3	2.1e-14
AVO84454.1|3919991_3920972_-	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
AVO84455.1|3921164_3922169_+	NAD-dependent epimerase	NA	A0A2K9L0I7	Tupanvirus	29.3	1.1e-33
AVO84456.1|3922217_3923384_-	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	54.0	4.1e-112
AVO84457.1|3923623_3924505_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.4	1.5e-103
AVO84458.1|3924505_3925591_-	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	52.6	3.7e-99
AVO84459.1|3925680_3927087_-	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	3.1e-37
>prophage 10
CP027604	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 chromosome, complete genome	4775558	4373970	4459592	4775558	tail,terminase,portal,tRNA,plate,holin	Enterobacteria_phage(20.41%)	94	NA	NA
AVO84845.1|4373970_4374708_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
AVO84846.1|4374840_4376169_+	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.5	4.7e-48
AVO84847.1|4376221_4376605_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	71.8	2.1e-33
AVO84848.1|4376920_4377610_+	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	48.8	7.9e-55
AVO84849.1|4377649_4378735_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AVO84850.1|4378939_4379359_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	37.2	1.2e-13
AVO84851.1|4379429_4380128_+	DTW domain-containing protein	NA	NA	NA	NA	NA
AVO84852.1|4380163_4382827_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AVO84853.1|4382936_4384292_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AVO84854.1|4384338_4384662_+	hypothetical protein	NA	NA	NA	NA	NA
AVO84855.1|4384658_4385966_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	29.6	2.7e-43
AVO84856.1|4386117_4386570_-	DUF4385 domain-containing protein	NA	M4QHR1	Cyanophage	50.0	3.9e-34
AVO84857.1|4392224_4394798_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	4.5e-127
AVO84858.1|4394927_4395659_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AVO84859.1|4395655_4396636_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AVO84860.1|4396767_4397505_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AVO84861.1|4397772_4398114_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AVO85347.1|4398219_4398267_+	hypothetical protein	NA	NA	NA	NA	NA
AVO84862.1|4398374_4399535_+	prephenate dehydratase	NA	NA	NA	NA	NA
AVO84863.1|4399531_4400404_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
AVO84864.1|4400464_4401586_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AVO84865.1|4401596_4402667_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	4.5e-89
AVO84866.1|4402879_4403254_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
AVO84867.1|4403407_4403944_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
AVO84868.1|4403936_4405157_+	diguanylate cyclase	NA	A0A2K8I9Y5	Pseudomonas_phage	39.8	1.2e-05
AVO84869.1|4405169_4405655_+	hypothetical protein	NA	NA	NA	NA	NA
AVO84870.1|4405657_4407028_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
AVO84871.1|4407066_4407471_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
AVO84872.1|4407603_4407951_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AVO84873.1|4407994_4408762_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AVO84874.1|4408793_4409333_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AVO84875.1|4409348_4409597_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AVO84876.1|4409713_4411075_-	signal recognition particle protein	NA	NA	NA	NA	NA
AVO85348.1|4411241_4412033_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
AVO84877.1|4412052_4413339_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AVO84878.1|4413391_4414009_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AVO84879.1|4414107_4414986_+	NAD(+) kinase	NA	NA	NA	NA	NA
AVO84880.1|4415071_4416733_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AVO84881.1|4416707_4416890_+	hypothetical protein	NA	NA	NA	NA	NA
AVO84882.1|4416871_4417210_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AVO84883.1|4417271_4417559_-	RnfH family protein	NA	NA	NA	NA	NA
AVO84884.1|4417548_4418025_-	ubiquinone-binding protein	NA	NA	NA	NA	NA
AVO84885.1|4418142_4418625_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	6.8e-29
AVO84886.1|4419367_4420573_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
AVO84887.1|4420828_4421500_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	62.2	5.1e-83
AVO84888.1|4421509_4421827_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.9	1.9e-24
AVO85349.1|4421826_4422066_-	hypothetical protein	NA	K7P7E2	Enterobacteria_phage	69.2	2.7e-26
AVO84889.1|4422361_4422517_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	78.4	1.2e-16
AVO84890.1|4422538_4422943_+	type II toxin-antitoxin system HicB family antitoxin	NA	Q775F5	Haemophilus_virus	49.2	3.1e-35
AVO84891.1|4422983_4424054_-	hypothetical protein	NA	NA	NA	NA	NA
AVO84892.1|4424130_4424709_-|tail	tail assembly chaperone	tail	E5G6P1	Salmonella_phage	54.4	8.9e-52
AVO84893.1|4424708_4426886_-|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	38.7	1.9e-54
AVO84894.1|4426888_4427440_-|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	41.0	4.3e-27
AVO84895.1|4427432_4428347_-|plate	baseplate assembly protein	plate	V5YTH6	Pseudomonas_phage	46.0	6.3e-60
AVO84896.1|4428330_4428684_-|plate	baseplate assembly protein	plate	E5FFH4	Burkholderia_phage	50.0	8.5e-21
AVO84897.1|4428720_4429839_-	late control protein D	NA	R9TNM7	Vibrio_phage	32.6	2.7e-36
AVO84898.1|4429841_4430057_-|tail	phage tail protein	tail	R9TR63	Vibrio_phage	52.9	1.8e-13
AVO84899.1|4430031_4430502_-|tail	phage tail protein	tail	D4HTW5	Vibrio_phage	33.8	3.8e-16
AVO84900.1|4432745_4433033_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AVO84901.1|4433084_4433591_-|tail	phage tail protein	tail	NA	NA	NA	NA
AVO84902.1|4433587_4435057_-|tail	phage tail protein	tail	R9TMQ0	Vibrio_phage	46.8	3.2e-77
AVO84903.1|4435095_4435719_-|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	38.6	1.6e-14
AVO84904.1|4435711_4436266_-	hypothetical protein	NA	NA	NA	NA	NA
AVO84905.1|4436274_4436937_-	hypothetical protein	NA	R9TR34	Vibrio_phage	36.7	2.5e-21
AVO84906.1|4436938_4437295_-	hypothetical protein	NA	NA	NA	NA	NA
AVO84907.1|4437294_4437630_-	DUF2190 domain-containing protein	NA	Q9EYD5	Enterobacteria_phage	43.6	6.8e-12
AVO85350.1|4437697_4439776_-	peptidase S14	NA	S5M7Q8	Escherichia_phage	53.3	2.7e-199
AVO84908.1|4439765_4441286_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	55.4	1.6e-153
AVO84909.1|4441294_4441510_-	hypothetical protein	NA	NA	NA	NA	NA
AVO84910.1|4441506_4443627_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	74.7	7.0e-304
AVO84911.1|4443630_4444134_-	DUF1441 domain-containing protein	NA	K7PJY2	Enterobacterial_phage	62.3	5.2e-48
AVO84912.1|4444343_4444859_-	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	91.2	3.4e-79
AVO84913.1|4444855_4445392_-	lysozyme	NA	K7PM52	Enterobacteria_phage	81.1	4.1e-83
AVO84914.1|4445391_4445607_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	80.3	6.3e-27
AVO84915.1|4445691_4445880_-	hypothetical protein	NA	NA	NA	NA	NA
AVO84916.1|4446405_4447470_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	79.9	5.0e-173
AVO84917.1|4447620_4447812_-	TrmB family transcriptional regulator	NA	Q8SBE3	Shigella_phage	79.0	5.1e-20
AVO84918.1|4448010_4448703_-	antitermination protein	NA	NA	NA	NA	NA
AVO84919.1|4448724_4449786_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	55.7	7.0e-111
AVO84920.1|4449782_4450475_-	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	55.1	3.1e-59
AVO84921.1|4450577_4451912_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	51.3	9.7e-118
AVO84922.1|4451908_4452763_-	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	82.2	1.1e-58
AVO84923.1|4452752_4452932_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	69.2	8.6e-14
AVO84924.1|4453104_4453653_-	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	68.7	1.3e-68
AVO84925.1|4453675_4453891_-	cell division protein	NA	NA	NA	NA	NA
AVO84926.1|4453989_4454616_+	LexA family transcriptional repressor	NA	K7PM82	Enterobacteria_phage	48.3	2.7e-46
AVO84927.1|4455249_4455621_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	90.2	2.2e-56
AVO84928.1|4455674_4456505_+	DUF2303 domain-containing protein	NA	Q8HAA2	Salmonella_phage	77.5	3.9e-117
AVO84929.1|4456640_4457180_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	74.3	2.9e-73
AVO84930.1|4457167_4457365_+	hypothetical protein	NA	NA	NA	NA	NA
AVO84931.1|4457361_4457655_+	hypothetical protein	NA	NA	NA	NA	NA
AVO84932.1|4457651_4458224_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	83.4	1.3e-92
AVO84933.1|4458258_4458465_+	excisionase	NA	I6PBM8	Cronobacter_phage	77.0	1.4e-23
AVO84934.1|4458425_4459592_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.3	3.9e-147
>prophage 1
CP027605	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 plasmid unnamed1, complete sequence	118226	1678	111198	118226	integrase,protease,tail,capsid,transposase,terminase	Salmonella_phage(90.68%)	137	8468:8486	79858:79876
AVO85489.1|1678_1981_+|tail	phage tail protein	tail	J9Q6E3	Salmonella_phage	95.5	6.3e-41
AVO85358.1|2045_2834_+	receptor-recognizing protein	NA	E5DHZ0	Enterobacter_phage	63.5	3.9e-58
AVO85359.1|2908_3232_+	hypothetical protein	NA	J9Q6E7	Salmonella_phage	92.5	1.4e-46
AVO85360.1|3245_3938_+	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	96.1	3.9e-126
AVO85361.1|4006_4348_+	hypothetical protein	NA	J9Q7G2	Salmonella_phage	80.6	6.9e-28
AVO85362.1|4375_4900_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVO85363.1|4903_5173_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AVO85364.1|5589_6255_+	plasmid stability protein	NA	J9Q7R7	Salmonella_phage	95.0	4.7e-113
AVO85365.1|6254_6614_+	hypothetical protein	NA	J9Q7G3	Salmonella_phage	100.0	2.3e-45
AVO85366.1|6655_7453_-	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	26.1	2.1e-11
AVO85367.1|7716_8442_+	hypothetical protein	NA	J9Q7R8	Salmonella_phage	99.2	3.8e-140
8468:8486	attL	AGAAAACAAATTGTTTAAG	NA	NA	NA	NA
AVO85368.1|8994_9855_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AVO85369.1|10037_10595_-	recombinase	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
AVO85370.1|10758_13764_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
AVO85371.1|14906_16118_+	DNA primase	NA	J9Q720	Salmonella_phage	96.8	1.1e-213
AVO85372.1|16198_16993_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	96.6	2.9e-141
AVO85491.1|17041_17374_-	hypothetical protein	NA	NA	NA	NA	NA
AVO85490.1|17293_17551_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	96.5	4.4e-35
AVO85373.1|17585_18908_+	DNA ligase	NA	J9Q7G5	Salmonella_phage	98.9	1.8e-257
AVO85374.1|18907_19084_+	hypothetical protein	NA	J9Q729	Salmonella_phage	96.6	2.6e-23
AVO85492.1|19073_19280_+	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.5	4.0e-31
AVO85375.1|19380_19938_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
AVO85376.1|19931_20303_-	hypothetical protein	NA	NA	NA	NA	NA
AVO85377.1|20299_20800_-|transposase	transposase	transposase	NA	NA	NA	NA
AVO85378.1|20796_21123_-	hypothetical protein	NA	NA	NA	NA	NA
AVO85379.1|21377_21734_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AVO85380.1|21723_22125_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
AVO85381.1|22121_22412_-	nucleotidyltransferase	NA	NA	NA	NA	NA
AVO85382.1|22570_25375_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.7	0.0e+00
AVO85383.1|25574_25880_+	C-type natriuretic protein	NA	J9Q7S1	Salmonella_phage	98.0	9.2e-48
AVO85384.1|27061_27895_+	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	63.6	2.3e-88
AVO85385.1|27905_28109_+	hypothetical protein	NA	A0A2P1CDD4	Klebsiella_phage	50.7	5.6e-09
AVO85386.1|28124_28490_+	hypothetical protein	NA	K7PH35	Enterobacteria_phage	66.4	5.1e-37
AVO85387.1|28489_28735_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	44.9	1.0e-12
AVO85388.1|28831_29356_+	hypothetical protein	NA	NA	NA	NA	NA
AVO85389.1|29346_29763_+	hypothetical protein	NA	NA	NA	NA	NA
AVO85493.1|29936_31043_+|integrase	integrase	integrase	A0A1P8DTG6	Proteus_phage	32.6	5.6e-26
AVO85390.1|31034_31421_-	transcriptional regulator	NA	NA	NA	NA	NA
AVO85391.1|31684_31897_+	hypothetical protein	NA	NA	NA	NA	NA
AVO85392.1|32006_34373_+	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	94.5	0.0e+00
AVO85393.1|34469_35705_+	porphyrin biosynthesis protein	NA	J9Q733	Salmonella_phage	99.3	2.3e-238
AVO85394.1|35707_35911_+	hypothetical protein	NA	J9Q6I7	Salmonella_phage	100.0	5.5e-33
AVO85395.1|35885_38249_+	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	93.8	0.0e+00
AVO85396.1|38245_38947_+	hypothetical protein	NA	Q854L3	Mycobacterium_phage	45.1	1.9e-19
AVO85397.1|38966_40136_+	uracil-DNA glycosylase	NA	J9Q7Z2	Salmonella_phage	95.4	7.8e-212
AVO85398.1|40132_40576_+	hypothetical protein	NA	J9Q7S4	Salmonella_phage	99.3	1.7e-71
AVO85399.1|40607_41633_-	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
AVO85400.1|41657_42089_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	99.3	8.9e-73
AVO85401.1|42208_43237_+	regulator	NA	J9Q7Z3	Salmonella_phage	99.7	4.1e-164
AVO85402.1|43297_44242_+	exonuclease	NA	J9Q7S6	Salmonella_phage	99.0	2.2e-180
AVO85403.1|44241_44508_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
AVO85404.1|44510_45587_+	recombinase	NA	J9Q736	Salmonella_phage	99.2	1.8e-202
AVO85405.1|45678_45879_+	hypothetical protein	NA	J9Q6J0	Salmonella_phage	92.3	6.7e-23
AVO85406.1|45882_46713_+|protease	serine protease	protease	J9Q7Z4	Salmonella_phage	99.3	1.1e-127
AVO85407.1|46875_47247_+	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	99.2	1.0e-69
AVO85408.1|47230_47641_+	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.8	1.1e-75
AVO85409.1|47709_47985_+	hypothetical protein	NA	J9Q738	Salmonella_phage	95.6	2.3e-45
AVO85410.1|48025_48205_+	hypothetical protein	NA	J9Q6J1	Salmonella_phage	98.3	7.3e-21
AVO85411.1|48201_48537_+	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	99.1	1.6e-56
AVO85412.1|48536_48749_+	hypothetical protein	NA	J9Q7S8	Salmonella_phage	98.6	3.1e-34
AVO85413.1|48754_48970_-	hypothetical protein	NA	NA	NA	NA	NA
AVO85414.1|49317_50382_-	replication protein RepA	NA	J9Q7H0	Salmonella_phage	98.0	7.9e-187
AVO85415.1|51125_51770_+	hypothetical protein	NA	J9Q739	Salmonella_phage	99.1	2.2e-123
AVO85416.1|51845_52340_+	N-acetyltransferase	NA	J9Q6J3	Salmonella_phage	97.0	7.3e-87
AVO85417.1|52371_52875_-	hypothetical protein	NA	J9Q7Z6	Salmonella_phage	97.6	2.1e-89
AVO85418.1|53103_54189_+	exonuclease	NA	J9Q7S9	Salmonella_phage	98.3	1.7e-205
AVO85419.1|54185_54422_+	hypothetical protein	NA	J9Q7H1	Salmonella_phage	98.4	1.1e-29
AVO85420.1|54418_56335_+	exonuclease	NA	J9Q741	Salmonella_phage	98.7	0.0e+00
AVO85421.1|56324_57071_+	hypothetical protein	NA	J9Q6J5	Salmonella_phage	98.4	3.4e-136
AVO85422.1|57082_57652_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	100.0	5.8e-104
AVO85423.1|57729_60045_+	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	99.6	0.0e+00
AVO85424.1|60152_61295_+	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	99.7	2.9e-219
AVO85425.1|61377_62247_+	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	99.3	1.8e-160
AVO85426.1|62424_63540_+	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	98.1	1.0e-216
AVO85427.1|63541_63955_+	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	97.8	9.5e-72
AVO85428.1|63951_64428_+	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	100.0	1.4e-90
AVO85429.1|64427_65072_+	hypothetical protein	NA	J9Q7H4	Salmonella_phage	99.5	1.5e-116
AVO85430.1|65135_65555_+	hypothetical protein	NA	J9Q743	Salmonella_phage	97.1	3.2e-67
AVO85431.1|65564_66107_+	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	97.2	4.2e-96
AVO85432.1|66145_67252_-	DUF697 domain-containing protein	NA	NA	NA	NA	NA
AVO85433.1|67378_68305_+	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	92.9	4.9e-108
AVO85434.1|68490_69084_+	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	100.0	2.1e-112
AVO85435.1|69286_69523_+	hypothetical protein	NA	J9Q7H5	Salmonella_phage	98.7	9.0e-35
AVO85436.1|70859_71354_+	hypothetical protein	NA	J9Q6J9	Salmonella_phage	99.4	4.9e-83
AVO85437.1|71522_73592_-	HypX	NA	NA	NA	NA	NA
AVO85438.1|73963_75667_+	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	98.9	0.0e+00
AVO85439.1|75725_76415_+	hypothetical protein	NA	J9Q6K2	Salmonella_phage	97.4	6.8e-123
AVO85440.1|76411_76693_+	hypothetical protein	NA	J9Q801	Salmonella_phage	98.9	1.9e-47
AVO85441.1|76695_77067_+	hypothetical protein	NA	J9Q7T4	Salmonella_phage	99.2	1.2e-62
AVO85442.1|77158_77800_+	HD domain-containing protein	NA	J9Q7H7	Salmonella_phage	98.6	7.0e-114
AVO85443.1|77796_78348_+	hypothetical protein	NA	J9Q748	Salmonella_phage	90.7	2.8e-95
AVO85444.1|78386_79085_+	DUF1311 domain-containing protein	NA	J9Q6K3	Salmonella_phage	89.7	6.0e-111
AVO85445.1|79140_79344_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	95.5	3.7e-29
AVO85446.1|79533_79800_+	hypothetical protein	NA	J9Q7T5	Salmonella_phage	69.3	3.4e-30
AVO85447.1|79885_80122_+	hypothetical protein	NA	J9Q7H8	Salmonella_phage	96.2	7.9e-39
79858:79876	attR	AGAAAACAAATTGTTTAAG	NA	NA	NA	NA
AVO85448.1|80118_80439_+	hypothetical protein	NA	J9Q750	Salmonella_phage	93.4	1.3e-57
AVO85449.1|80451_80850_+	hypothetical protein	NA	NA	NA	NA	NA
AVO85494.1|81357_81549_-	hypothetical protein	NA	J9Q7T6	Salmonella_phage	87.3	1.3e-23
AVO85450.1|82288_82534_-	hypothetical protein	NA	J9Q751	Salmonella_phage	93.8	9.0e-38
AVO85451.1|82676_82898_+	hypothetical protein	NA	J9Q6K7	Salmonella_phage	95.8	1.2e-33
AVO85452.1|82902_83121_+	hypothetical protein	NA	J9Q804	Salmonella_phage	98.6	6.4e-35
AVO85453.1|83261_83573_+	hypothetical protein	NA	J9Q7T7	Salmonella_phage	97.1	1.2e-47
AVO85454.1|83701_84097_+	hypothetical protein	NA	J9Q7I1	Salmonella_phage	66.2	2.0e-42
AVO85455.1|84217_84505_+	ABC transporter	NA	J9Q753	Salmonella_phage	98.9	1.6e-49
AVO85456.1|84464_84698_+	hypothetical protein	NA	NA	NA	NA	NA
AVO85457.1|84710_85193_+	hypothetical protein	NA	J9Q805	Salmonella_phage	97.5	2.5e-87
AVO85458.1|85836_86040_-	hypothetical protein	NA	J9Q7I3	Salmonella_phage	100.0	1.3e-29
AVO85459.1|86090_86741_-	hypothetical protein	NA	J9Q754	Salmonella_phage	99.1	2.1e-113
AVO85460.1|87064_87592_-	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	99.3	2.6e-82
AVO85461.1|87596_88019_-	hypothetical protein	NA	J9Q806	Salmonella_phage	85.7	8.2e-63
AVO85462.1|88078_88357_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	98.9	3.4e-41
AVO85463.1|88359_89919_-	ATP-dependent helicase	NA	J9Q7I4	Salmonella_phage	99.6	4.4e-295
AVO85464.1|89983_90682_+	chromosome partitioning protein ParB	NA	J9Q756	Salmonella_phage	99.1	2.5e-125
AVO85465.1|90681_91350_+	chromosome partitioning protein ParB	NA	J9Q6L1	Salmonella_phage	99.1	4.3e-114
AVO85466.1|91346_91985_+	adenylyl-sulfate kinase	NA	J9Q807	Salmonella_phage	100.0	3.8e-112
AVO85467.1|91977_92232_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	98.8	4.1e-41
AVO85468.1|92228_93128_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.7	8.2e-169
AVO85469.1|93137_93404_+	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
AVO85470.1|93601_94243_+	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	98.1	3.4e-108
AVO85471.1|94245_95502_+|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	100.0	1.8e-251
AVO85472.1|95535_97110_+	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.2	3.2e-301
AVO85473.1|97132_98029_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	98.0	5.1e-147
AVO85474.1|98055_98931_+|capsid	phage major capsid protein	capsid	J9Q710	Salmonella_phage	99.7	1.9e-162
AVO85475.1|99005_99929_+	hypothetical protein	NA	J9Q6D6	Salmonella_phage	98.4	9.9e-154
AVO85476.1|99972_100407_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	99.3	1.4e-73
AVO85477.1|100406_101240_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	99.6	5.8e-153
AVO85478.1|101337_101682_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	99.1	5.5e-57
AVO85479.1|101672_102146_+	hypothetical protein	NA	J9Q711	Salmonella_phage	99.4	2.0e-81
AVO85480.1|102147_102531_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	100.0	1.7e-67
AVO85481.1|102605_103352_+	hypothetical protein	NA	J9Q7Y4	Salmonella_phage	89.1	6.6e-116
AVO85482.1|103412_103730_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
AVO85483.1|103810_104080_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	8.4e-37
AVO85484.1|104087_108668_+|tail	phage tail tape measure protein	tail	J9Q712	Salmonella_phage	90.6	0.0e+00
AVO85485.1|108709_109045_+|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	97.3	5.7e-59
AVO85486.1|109101_109833_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	100.0	5.1e-137
AVO85487.1|109825_110623_+|tail	phage tail protein	tail	J9Q7R4	Salmonella_phage	95.5	2.3e-154
AVO85488.1|110610_111198_+|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	92.3	1.9e-102
>prophage 1
CP027606	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 plasmid unnamed2, complete sequence	87025	0	63477	87025	transposase,integrase	Escherichia_phage(26.92%)	64	35124:35183	53366:53566
AVO85495.1|422_1298_+	replication initiation protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
AVO85496.1|1922_2549_+	cobyrinic acid ac-diamide synthase	NA	E5FFJ3	Burkholderia_phage	30.1	3.8e-16
AVO85497.1|2668_2848_+	Par-like protein	NA	NA	NA	NA	NA
AVO85498.1|3303_4095_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	87.8	1.2e-51
AVO85499.1|4091_4835_-	hypothetical protein	NA	NA	NA	NA	NA
AVO85500.1|4885_5236_-	hypothetical protein	NA	NA	NA	NA	NA
AVO85501.1|5552_5738_-	hypothetical protein	NA	NA	NA	NA	NA
AVO85502.1|5860_7669_-	ATP-binding protein	NA	NA	NA	NA	NA
AVO85503.1|7665_8712_-	hypothetical protein	NA	NA	NA	NA	NA
AVO85504.1|10028_11210_+	DUF4268 domain-containing protein	NA	NA	NA	NA	NA
AVO85505.1|11705_12083_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	90.5	3.2e-58
AVO85506.1|12079_12427_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	96.5	1.8e-60
AVO85507.1|12477_14016_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	90.8	2.8e-270
AVO85508.1|14132_15341_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
AVO85509.1|15374_16808_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	51.5	4.1e-106
AVO85510.1|16956_17653_+|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	93.5	1.5e-125
AVO85511.1|18062_18644_+	hypothetical protein	NA	NA	NA	NA	NA
AVO85512.1|18887_19811_+|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	6.6e-174
AVO85513.1|20523_20910_+	hypothetical protein	NA	NA	NA	NA	NA
AVO85514.1|20918_21110_+	plasmid stabilization protein	NA	NA	NA	NA	NA
AVO85515.1|22122_22878_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	96.0	4.5e-136
AVO85516.1|22878_23073_+	hypothetical protein	NA	NA	NA	NA	NA
AVO85517.1|23672_23861_-	hypothetical protein	NA	NA	NA	NA	NA
AVO85518.1|24408_24744_-	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
AVO85519.1|24916_25198_+	cytoplasmic protein	NA	NA	NA	NA	NA
AVO85520.1|25251_25863_+	DUF2913 domain-containing protein	NA	NA	NA	NA	NA
AVO85572.1|26047_27004_-	hypothetical protein	NA	NA	NA	NA	NA
AVO85521.1|27384_28089_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
AVO85522.1|28278_29094_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
AVO85523.1|29244_29949_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
AVO85524.1|30070_30976_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AVO85525.1|30972_32211_+	MFS transporter	NA	NA	NA	NA	NA
AVO85526.1|32210_32795_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AVO85527.1|32740_33097_+	hypothetical protein	NA	NA	NA	NA	NA
AVO85528.1|33287_34052_-|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
35124:35183	attL	TGTCGTTTTCAGAAGACGGCTGCACTGAACGTCAGAAGCCGACTGCACTATAGCAGCGGA	NA	NA	NA	NA
AVO85529.1|35325_36339_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AVO85573.1|36487_36952_+	aminoglycoside N-acetyltransferase AAC(3)-Ib	NA	NA	NA	NA	NA
AVO85530.1|37162_37495_+	quaternary ammonium compound efflux SMR transporter QacF	NA	NA	NA	NA	NA
AVO85531.1|37667_38015_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AVO85532.1|38008_38848_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AVO85533.1|38777_38957_-	hypothetical protein	NA	NA	NA	NA	NA
AVO85534.1|38975_39248_+	hypothetical protein	NA	NA	NA	NA	NA
AVO85535.1|39429_40434_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AVO85536.1|40661_41867_+	chromate transporter	NA	NA	NA	NA	NA
AVO85537.1|41877_42183_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AVO85538.1|42382_42943_+|transposase	transposase	transposase	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
AVO85539.1|42946_45913_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
AVO85540.1|45982_46411_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	38.6	1.3e-20
AVO85541.1|46417_47023_-	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
AVO85542.1|49681_52714_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
AVO85574.1|52710_53304_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	49.7	1.2e-40
AVO85543.1|53338_53629_-|transposase	transposase	transposase	NA	NA	NA	NA
53366:53566	attR	TGTCGTTTTCAGAAGACGGCTGCACTGAACGTCAGAAGCCGACTGCACTATAGCAGCGGAGGGGTTGGATCCATCAGGCAACGACGGGCTGCTGCCGGCCATCAGCGGACGCAGGGAGGACTTTCCGCAACCGGCCGTTCGATGCGGCACCGATGGCCTTCGCGCAGGGGTAGTGAATCCGCCAGGATTGACTTGCGCTGC	NA	NA	NA	NA
AVO85575.1|54655_55210_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
AVO85576.1|55340_56171_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
AVO85544.1|56308_56941_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
AVO85545.1|57025_57478_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
AVO85546.1|57700_58048_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AVO85547.1|58041_58881_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AVO85548.1|58810_58990_-	hypothetical protein	NA	NA	NA	NA	NA
AVO85549.1|59008_59509_+	N-acetyltransferase	NA	NA	NA	NA	NA
AVO85550.1|59814_59928_-	NTP-binding protein	NA	NA	NA	NA	NA
AVO85551.1|60015_60648_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	67.2	1.0e-77
AVO85552.1|61476_62868_-|transposase	ISKra4 family transposase ISKpn19	transposase	NA	NA	NA	NA
AVO85553.1|62904_63477_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
>prophage 2
CP027606	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 plasmid unnamed2, complete sequence	87025	69468	74107	87025	transposase	Escherichia_phage(50.0%)	4	NA	NA
AVO85557.1|69468_70494_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
AVO85558.1|70490_71270_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
AVO85559.1|71656_72538_+	carbapenem-hydrolyzing class A beta-lactamase KPC-6	NA	A0A1B0VBP7	Salmonella_phage	52.5	2.0e-74
AVO85560.1|72787_74107_-|transposase	IS1182 family transposase ISKpn6	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
>prophage 3
CP027606	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 plasmid unnamed2, complete sequence	87025	77514	80413	87025		Enterobacteria_phage(66.67%)	3	NA	NA
AVO85561.1|77514_78072_+	recombinase	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
AVO85562.1|78254_79115_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AVO85563.1|79597_80413_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.9	4.3e-161
>prophage 4
CP027606	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 plasmid unnamed2, complete sequence	87025	85018	86358	87025	transposase	Emiliania_huxleyi_virus(50.0%)	2	NA	NA
AVO85569.1|85018_85354_+	thermonuclease family protein	NA	G8DH70	Emiliania_huxleyi_virus	35.7	2.8e-05
AVO85570.1|85653_86358_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
