The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	0	4187	3837027	transposase	uncultured_virus(100.0%)	2	NA	NA
AVZ80864.1|1659_2625_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
AVZ80865.1|2978_4187_+|transposase	IS256-like element ISEic2 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	1.1e-46
>prophage 2
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	7244	16631	3837027	protease,transposase	Morganella_phage(25.0%)	7	NA	NA
AVZ80870.1|7244_7454_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	76.6	3.5e-22
AVZ80871.1|7495_7612_-	DUF2627 domain-containing protein	NA	NA	NA	NA	NA
AVZ83960.1|8385_9360_-	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
AVZ80872.1|10411_11620_+|transposase	IS256-like element ISEic2 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	1.1e-46
AVZ80873.1|12266_14867_-	type I DNA topoisomerase	NA	E3T4K4	Cafeteria_roenbergensis_virus	35.6	6.6e-86
AVZ80874.1|15266_15518_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ83961.1|15584_16631_-|protease	protease SohB	protease	A0A2I6UG67	Salinibacter_virus	33.0	1.1e-12
>prophage 3
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	21502	21730	3837027		Pectobacterium_phage(100.0%)	1	NA	NA
AVZ80881.1|21502_21730_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	62.5	1.4e-16
>prophage 4
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	27861	30906	3837027		Acinetobacter_phage(100.0%)	3	NA	NA
AVZ80888.1|27861_28497_+	glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	34.7	4.0e-29
AVZ80889.1|28487_29504_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	42.8	3.9e-50
AVZ80890.1|29529_30906_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	37.8	3.8e-32
>prophage 5
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	36067	37816	3837027		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVZ80896.1|36067_37816_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	28.0	2.4e-15
>prophage 6
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	41481	41982	3837027		Clostridium_phage(100.0%)	1	NA	NA
AVZ80901.1|41481_41982_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	34.0	1.6e-20
>prophage 7
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	46634	48610	3837027		Planktothrix_phage(100.0%)	2	NA	NA
AVZ80907.1|46634_47639_-	oligopeptide ABC transporter ATP-binding protein OppF	NA	G9BWD6	Planktothrix_phage	33.7	3.7e-21
AVZ80908.1|47635_48610_-	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	30.7	3.6e-13
>prophage 8
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	57133	67668	3837027		Serratia_phage(16.67%)	11	NA	NA
AVZ80914.1|57133_57721_-	thymidine kinase	NA	A0A1Z1LYD5	Serratia_phage	57.8	1.4e-57
AVZ80915.1|58238_58646_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
AVZ80916.1|58911_59823_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	46.2	3.7e-60
AVZ80917.1|60041_61100_-	two-component system response regulator RssB	NA	Q6XM27	Feldmannia_irregularis_virus	25.2	4.0e-05
AVZ80918.1|61328_61811_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ80919.1|61899_62748_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	31.3	2.1e-12
AVZ83965.1|63488_64058_+	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	25.6	1.3e-10
AVZ80920.1|64154_64964_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
AVZ80921.1|64960_65389_+	pyrimidine (deoxy)nucleoside triphosphate diphosphatase	NA	NA	NA	NA	NA
AVZ80922.1|65416_65746_-	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
AVZ80923.1|65742_67668_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.1	7.1e-37
>prophage 9
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	73862	74498	3837027		Tupanvirus(100.0%)	1	NA	NA
AVZ80929.1|73862_74498_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	37.2	2.4e-21
>prophage 10
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	81782	85008	3837027		Bacillus_phage(50.0%)	2	NA	NA
AVZ80936.1|81782_83054_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	35.5	2.9e-10
AVZ80937.1|83241_85008_+	ABC transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	29.5	4.1e-07
>prophage 11
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	93019	93451	3837027		Morganella_phage(100.0%)	1	NA	NA
AVZ80946.1|93019_93451_-	universal stress protein UspA	NA	A0A1W6JNV4	Morganella_phage	40.0	1.3e-18
>prophage 12
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	98627	104034	3837027	tRNA	Staphylococcus_phage(50.0%)	4	NA	NA
AVZ80954.1|98627_100307_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	24.6	7.1e-33
AVZ80955.1|100610_101213_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ80956.1|101324_102026_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AVZ80957.1|102099_104034_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	29.7	1.5e-79
>prophage 13
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	109242	110715	3837027		Cyanophage(100.0%)	1	NA	NA
AVZ80964.1|109242_110715_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.9	4.3e-82
>prophage 14
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	115017	180675	3837027	tRNA,transposase	Tupanvirus(21.43%)	58	NA	NA
AVZ80968.1|115017_116337_-	murein DD-endopeptidase MepM	NA	Q8SBN9	Clostridium_phage	36.6	1.2e-14
AVZ80969.1|116356_117361_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
AVZ80970.1|117436_118213_+	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.2	5.8e-14
AVZ80971.1|118205_118991_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
AVZ80972.1|119059_120064_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	27.2	1.9e-09
AVZ83966.1|120083_120692_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AVZ80973.1|120827_121349_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	32.4	1.0e-09
AVZ80974.1|121345_122092_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AVZ80975.1|122191_122626_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
AVZ80976.1|122625_124401_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.3	1.4e-10
AVZ80977.1|124426_124693_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
AVZ80978.1|124863_125685_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	63.8	3.7e-43
AVZ80979.1|125816_126215_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ80980.1|126257_127625_-	amino acid permease	NA	NA	NA	NA	NA
AVZ80981.1|127902_128673_+|tRNA	tRNA (cmo5U34)-methyltransferase	tRNA	NA	NA	NA	NA
AVZ80982.1|128669_129641_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AVZ83967.1|129747_130503_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AVZ80983.1|130720_131863_+	putative C-S lyase	NA	NA	NA	NA	NA
AVZ80984.1|131877_132441_-	VOC family protein	NA	NA	NA	NA	NA
AVZ80985.1|132719_134453_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L2F0	Tupanvirus	33.4	3.8e-82
AVZ83968.1|134580_136119_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
AVZ80986.1|136277_136928_-	DUF480 domain-containing protein	NA	NA	NA	NA	NA
AVZ80987.1|136966_137551_-	30S ribosomal protein S5 alanine N-acetyltransferase	NA	NA	NA	NA	NA
AVZ80988.1|137868_139077_+	multidrug transporter MdtH	NA	NA	NA	NA	NA
AVZ80989.1|139249_139813_+	lipoprotein	NA	NA	NA	NA	NA
AVZ80990.1|139911_140496_-	molecular chaperone	NA	NA	NA	NA	NA
AVZ80991.1|140544_141282_-	phosphatase	NA	NA	NA	NA	NA
AVZ80992.1|141684_143106_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AVZ80993.1|143099_144041_-	glyoxylate/hydroxypyruvate reductase GhrA	NA	NA	NA	NA	NA
AVZ80994.1|144165_145641_-	MFS transporter	NA	NA	NA	NA	NA
AVZ80995.1|145985_147155_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVZ80996.1|148065_148539_+	heme-degrading domain-containing protein	NA	NA	NA	NA	NA
AVZ80997.1|148791_150492_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	26.4	3.8e-34
AVZ80998.1|150778_151633_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	38.9	1.9e-45
AVZ80999.1|151789_152599_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ81000.1|152669_153509_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AVZ81001.1|153508_154591_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
AVZ81002.1|154631_155894_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
AVZ81003.1|156112_156733_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
AVZ81004.1|156729_157608_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
AVZ81005.1|157796_158744_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	2.3e-44
AVZ81006.1|158953_160090_+	DUF1214 domain-containing protein	NA	NA	NA	NA	NA
AVZ81007.1|160139_160418_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ81008.1|160762_161356_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AVZ81009.1|161503_162595_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
AVZ81010.1|163917_165939_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ81011.1|167452_167848_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ81012.1|167902_168364_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ81013.1|168362_168638_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ81014.1|169676_170446_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AVZ81015.1|170751_173268_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AVZ81016.1|173315_174011_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ81017.1|174109_174862_-	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
AVZ81018.1|175326_176352_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AVZ81019.1|176690_177899_-|transposase	IS256-like element ISEic2 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	1.1e-46
AVZ81020.1|178127_178879_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AVZ83969.1|179029_179953_-|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	86.6	3.4e-154
AVZ81021.1|179977_180675_-|transposase	IS1-like element ISEic1 family transposase	transposase	A0A077SLN4	Escherichia_phage	56.7	3.3e-77
>prophage 15
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	191645	191945	3837027		Escherichia_phage(100.0%)	1	NA	NA
AVZ81030.1|191645_191945_-	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	70.0	3.9e-19
>prophage 16
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	201769	202508	3837027	transposase	Mycobacterium_phage(100.0%)	1	NA	NA
AVZ81035.1|201769_202508_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	34.6	2.9e-23
>prophage 17
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	211016	213513	3837027	transposase	Helicobacter_phage(50.0%)	2	NA	NA
AVZ83972.1|211016_211448_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	6.2e-42
AVZ81041.1|212139_213513_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.7	1.1e-52
>prophage 18
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	219753	223253	3837027		Burkholderia_phage(100.0%)	3	NA	NA
AVZ81046.1|219753_220281_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	44.9	1.7e-28
AVZ81047.1|220589_222005_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	1.3e-104
AVZ81048.1|222053_223253_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.6	9.3e-35
>prophage 19
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	237269	243148	3837027		Bacillus_thuringiensis_phage(50.0%)	5	NA	NA
AVZ81064.1|237269_237659_-	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	30.4	5.9e-07
AVZ81065.1|237755_238808_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	34.6	1.4e-05
AVZ81066.1|238804_239680_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
AVZ81067.1|239736_241335_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.3	3.3e-11
AVZ81068.1|241480_243148_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.1	1.3e-10
>prophage 20
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	261131	262340	3837027	transposase	uncultured_virus(100.0%)	1	NA	NA
AVZ81082.1|261131_262340_-|transposase	IS256-like element ISEic2 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	8.1e-47
>prophage 21
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	267397	267613	3837027		Morganella_phage(100.0%)	1	NA	NA
AVZ81088.1|267397_267613_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	66.2	4.8e-19
>prophage 22
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	273465	277586	3837027		Tupanvirus(66.67%)	3	NA	NA
AVZ81094.1|273465_275445_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	27.2	2.8e-20
AVZ81095.1|275447_276425_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	32.1	1.3e-34
AVZ81096.1|276440_277586_-	UDP-4-amino-4-deoxy-L-arabinose-oxoglutarate aminotransferase	NA	A0A2K9L0G1	Tupanvirus	28.2	1.3e-25
>prophage 23
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	284020	284683	3837027		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVZ81099.1|284020_284683_+	transmembrane protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	56.0	1.5e-47
>prophage 24
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	289066	291121	3837027		Bacillus_phage(100.0%)	1	NA	NA
AVZ83975.1|289066_291121_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	24.5	2.9e-12
>prophage 25
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	304456	306370	3837027		Tupanvirus(100.0%)	1	NA	NA
AVZ81117.1|304456_306370_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.9	8.4e-46
>prophage 26
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	319567	322279	3837027		Klosneuvirus(50.0%)	3	NA	NA
AVZ81129.1|319567_320479_-	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	28.2	3.1e-22
AVZ81130.1|320493_321438_-	transketolase	NA	NA	NA	NA	NA
AVZ81131.1|321430_322279_-	transketolase	NA	A0A2K9L6P9	Tupanvirus	30.1	7.2e-34
>prophage 27
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	325517	332715	3837027	tRNA	Acinetobacter_phage(33.33%)	4	NA	NA
AVZ81135.1|325517_328139_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.7	2.2e-20
AVZ81136.1|328491_329697_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AVZ81137.1|329908_331309_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	37.7	2.0e-81
AVZ83978.1|331635_332715_+	porin	NA	Q1MVN1	Enterobacteria_phage	62.4	1.5e-116
>prophage 28
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	336989	337952	3837027		Bacillus_phage(100.0%)	1	NA	NA
AVZ81141.1|336989_337952_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	Q9ZXE4	Bacillus_phage	37.1	2.9e-15
>prophage 29
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	353956	354202	3837027		Enterobacteria_phage(100.0%)	1	NA	NA
AVZ81157.1|353956_354202_+	hypothetical protein	NA	Q6H9S6	Enterobacteria_phage	77.9	1.2e-26
>prophage 30
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	357527	365948	3837027	transposase	Phage_Gifsy-2(25.0%)	5	NA	NA
AVZ81159.1|357527_359666_+	hypothetical protein	NA	Q9MBL9	Phage_Gifsy-2	60.0	6.5e-39
AVZ81160.1|360400_361609_+|transposase	IS256-like element ISEic2 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	1.1e-46
AVZ81161.1|361619_362423_-	hypothetical protein	NA	A0A0N7C035	Escherichia_phage	69.8	4.3e-68
AVZ83981.1|363956_364289_-	DUF496 domain-containing protein	NA	NA	NA	NA	NA
AVZ81162.1|364532_365948_-	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	29.4	1.7e-40
>prophage 31
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	372502	376781	3837027		Tupanvirus(50.0%)	4	NA	NA
AVZ81167.1|372502_373510_-	NAD-dependent epimerase	NA	A0A2K9L4U8	Tupanvirus	28.7	2.9e-29
AVZ81168.1|373656_374823_-	UDP-glucose 6-dehydrogenase	NA	O41091	Paramecium_bursaria_Chlorella_virus	54.2	2.5e-109
AVZ81169.1|374846_375863_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	45.3	4.9e-77
AVZ81170.1|375878_376781_-	UTP--glucose-1-phosphate uridylyltransferase subunit GalU	NA	A0A127AW70	Bacillus_phage	39.6	3.1e-43
>prophage 32
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	379871	380657	3837027		Klosneuvirus(100.0%)	1	NA	NA
AVZ81174.1|379871_380657_-	hypothetical protein	NA	A0A1V0SKJ4	Klosneuvirus	27.5	9.7e-09
>prophage 33
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	388957	395182	3837027	tRNA	Saccharomonospora_phage(33.33%)	4	NA	NA
AVZ81179.1|388957_389539_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	43.2	1.6e-32
AVZ81180.1|390716_391358_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	1.0e-32
AVZ81181.1|391546_392659_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
AVZ81182.1|393133_395182_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	29.6	4.4e-53
>prophage 34
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	399818	404362	3837027		Catovirus(50.0%)	3	NA	NA
AVZ81187.1|399818_400667_+	endonuclease	NA	A0A1V0SBL9	Catovirus	31.0	4.1e-21
AVZ81188.1|400821_401961_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
AVZ81189.1|402193_404362_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	25.9	1.5e-38
>prophage 35
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	415857	416520	3837027		Vibrio_phage(100.0%)	1	NA	NA
AVZ81198.1|415857_416520_-	GTP cyclohydrolase I FolE	NA	R9TJA5	Vibrio_phage	56.7	9.0e-56
>prophage 36
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	432042	432387	3837027		Mannheimia_phage(100.0%)	1	NA	NA
AVZ81210.1|432042_432387_+	DNA-binding protein	NA	A0A0M3LPN5	Mannheimia_phage	45.2	2.8e-08
>prophage 37
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	435993	447703	3837027		Serratia_phage(20.0%)	11	NA	NA
AVZ81213.1|435993_438021_-	NAD-dependent DNA ligase LigA	NA	A0A289ZTZ3	Serratia_phage	50.5	2.2e-145
AVZ81214.1|438089_439007_-	cell division protein ZipA	NA	NA	NA	NA	NA
AVZ81215.1|439281_440061_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
AVZ81216.1|440213_441173_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	51.1	8.1e-74
AVZ81217.1|441548_441806_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AVZ81218.1|441859_443587_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	33.2	7.4e-17
AVZ81219.1|443635_444145_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
AVZ81220.1|444252_445152_-	peroxidase	NA	S4VXK8	Pandoravirus	35.2	1.3e-28
AVZ81221.1|445298_445877_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
AVZ83986.1|446067_446493_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AVZ81222.1|446830_447703_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A067ZJB6	Vibrio_phage	29.4	6.1e-12
>prophage 38
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	455981	456746	3837027		Bacillus_phage(100.0%)	1	NA	NA
AVZ81228.1|455981_456746_-	D-threitol dehydrogenase	NA	W8CYX9	Bacillus_phage	42.1	4.0e-07
>prophage 39
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	472853	476003	3837027		Escherichia_phage(100.0%)	1	NA	NA
AVZ81241.1|472853_476003_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	28.1	4.0e-37
>prophage 40
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	479440	482700	3837027	tRNA	Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
AVZ81247.1|479440_481402_-|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	Q56AQ2	Bacillus_thuringiensis_phage	28.9	8.7e-06
AVZ81248.1|481986_482700_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HWF9	Synechococcus_phage	35.7	1.0e-36
>prophage 41
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	490243	494216	3837027		Enterobacteria_phage(33.33%)	4	NA	NA
AVZ81257.1|490243_491521_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.3	2.3e-63
AVZ81258.1|491625_492252_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AVZ81259.1|492523_493567_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FAD3	Synechococcus_phage	39.5	9.4e-68
AVZ81260.1|493577_494216_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	37.8	9.3e-26
>prophage 42
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	498665	508757	3837027		Bacillus_phage(50.0%)	7	NA	NA
AVZ81264.1|498665_499979_-	two-component system sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.5	1.0e-26
AVZ81265.1|499999_500689_-	phosphate regulon transcriptional regulatory protein PhoB	NA	W8CYM9	Bacillus_phage	37.6	4.8e-36
AVZ81266.1|500880_502113_+	exonuclease subunit SbcD	NA	NA	NA	NA	NA
AVZ81267.1|502109_505811_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	6.9e-12
AVZ81268.1|505823_506171_-	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
AVZ81269.1|506277_506745_-	DNA gyrase inhibitor	NA	NA	NA	NA	NA
AVZ81270.1|507845_508757_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	4.8e-100
>prophage 43
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	517660	521939	3837027		Bacillus_phage(66.67%)	4	NA	NA
AVZ81276.1|517660_519034_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.3	1.8e-26
AVZ81277.1|519130_519862_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.8	2.9e-31
AVZ81278.1|520008_520350_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AVZ81279.1|520571_521939_+	U32 family peptidase	NA	Q6DW11	Phage_TP	80.1	1.7e-173
>prophage 44
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	525762	526971	3837027	transposase	uncultured_virus(100.0%)	1	NA	NA
AVZ81281.1|525762_526971_+|transposase	IS256-like element ISEic2 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	1.1e-46
>prophage 45
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	537494	546027	3837027	transposase	Bacillus_phage(33.33%)	8	NA	NA
AVZ81291.1|537494_538166_-	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	27.0	8.0e-12
AVZ81292.1|538410_539010_+	HutD family protein	NA	NA	NA	NA	NA
AVZ81293.1|539050_539968_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
AVZ81294.1|539964_540447_+	NfeD family protein	NA	NA	NA	NA	NA
AVZ81295.1|540400_540814_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AVZ81296.1|540935_543674_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	36.6	1.2e-106
AVZ81297.1|543801_544614_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
AVZ81298.1|545276_546027_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	35.5	1.3e-23
>prophage 46
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	557749	559621	3837027		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVZ81308.1|557749_559621_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.5	2.0e-116
>prophage 47
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	568648	569399	3837027	transposase	Mycobacterium_phage(100.0%)	1	NA	NA
AVZ81313.1|568648_569399_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	35.4	5.6e-22
>prophage 48
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	573027	575775	3837027		Bacteriophage(50.0%)	2	NA	NA
AVZ81318.1|573027_574986_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	4.0e-43
AVZ81319.1|575223_575775_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	41.8	8.0e-26
>prophage 49
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	595224	603786	3837027	protease	uncultured_Caudovirales_phage(20.0%)	7	NA	NA
AVZ81337.1|595224_595914_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	69.8	1.1e-88
AVZ81338.1|595992_596337_-	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
AVZ81339.1|596479_598360_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AVZ81340.1|598643_598916_-	DNA-binding protein HU-beta	NA	A3E2K9	Sodalis_phage	58.4	2.9e-21
AVZ81341.1|599132_601535_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	53.1	1.5e-225
AVZ81342.1|601711_602983_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.2	4.7e-130
AVZ81343.1|603165_603786_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	63.1	8.4e-64
>prophage 50
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	622801	624536	3837027		Staphylococcus_phage(50.0%)	2	NA	NA
AVZ81363.1|622801_623272_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.0	1.2e-30
AVZ81364.1|623414_624536_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	32.7	1.5e-47
>prophage 51
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	632687	633440	3837027		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AVZ81370.1|632687_633440_+	SDR family NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.9	1.6e-16
>prophage 52
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	638453	642930	3837027	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
AVZ81376.1|638453_639422_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	39.3	2.0e-48
AVZ81377.1|639433_641290_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
AVZ81378.1|641317_641650_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	34.1	5.7e-11
AVZ81379.1|641790_642930_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.3	8.7e-91
>prophage 53
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	655808	660766	3837027		Escherichia_phage(50.0%)	3	NA	NA
AVZ83993.1|655808_655988_+	DUF2633 domain-containing protein	NA	G9L6F2	Escherichia_phage	53.8	3.3e-05
AVZ81388.1|656115_657567_+	magnesium transporter	NA	NA	NA	NA	NA
AVZ83994.1|657811_660766_+	histidine kinase	NA	A0A127AWB9	Bacillus_phage	33.6	6.3e-16
>prophage 54
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	669805	684652	3837027		Acidithiobacillus_phage(20.0%)	8	NA	NA
AVZ81399.1|669805_672031_-	GTPase	NA	K4I1H4	Acidithiobacillus_phage	34.6	5.7e-38
AVZ81400.1|672431_675710_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	25.3	6.6e-59
AVZ81401.1|675774_677160_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AVZ81402.1|677149_678769_-	DNA methyltransferase	NA	A0A2H4UVW8	Bodo_saltans_virus	22.4	1.1e-09
AVZ81403.1|679748_681230_+	acetylneuraminate ABC transporter	NA	A0A219Y9P9	Aeromonas_phage	25.0	4.5e-23
AVZ81404.1|681369_682260_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AVZ81405.1|682429_683320_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
AVZ81406.1|684031_684652_-	iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.8	4.2e-15
>prophage 55
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	689044	694758	3837027	transposase	Salmonella_phage(33.33%)	7	NA	NA
AVZ81412.1|689044_690253_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	79.8	3.4e-186
AVZ83996.1|690275_690692_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.6	3.5e-42
AVZ81413.1|690841_691744_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
AVZ81414.1|691790_692279_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ81415.1|692453_693107_-	oxygen-insensitive NAD(P)H-dependent nitroreductase NfsB	NA	NA	NA	NA	NA
AVZ81416.1|693389_693578_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ81417.1|693594_694758_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	56.6	4.2e-117
>prophage 56
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	709201	710410	3837027	transposase	uncultured_virus(100.0%)	1	NA	NA
AVZ81427.1|709201_710410_-|transposase	IS256 family transposase ISEic2	transposase	A0A218MNI5	uncultured_virus	44.1	8.1e-47
>prophage 57
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	721219	726402	3837027		Escherichia_phage(33.33%)	5	NA	NA
AVZ81433.1|721219_721534_-	hypothetical protein	NA	Q9MCT5	Escherichia_phage	67.0	8.3e-28
AVZ83997.1|721636_721801_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ83998.1|722357_723002_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AVZ81434.1|722998_725734_-	hybrid sensor histidine kinase/response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	27.1	1.6e-26
AVZ81435.1|725745_726402_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	48.8	1.6e-25
>prophage 58
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	752169	809436	3837027	tRNA,portal,transposase	uncultured_virus(11.76%)	47	NA	NA
AVZ81470.1|752169_753378_-|transposase	IS256 family transposase ISEic2	transposase	A0A218MNI5	uncultured_virus	44.1	8.1e-47
AVZ81471.1|754077_755189_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.0	1.7e-06
AVZ83999.1|755162_755651_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AVZ81472.1|756014_757223_+|transposase	IS256-like element ISEic2 family transposase	transposase	A0A218MNI5	uncultured_virus	43.6	3.1e-46
AVZ84000.1|757588_757975_-	hypothetical protein	NA	K7P7N0	Enterobacteria_phage	45.0	7.9e-20
AVZ81473.1|758487_759519_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
AVZ81474.1|759587_760841_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.5	1.9e-86
AVZ81475.1|760850_761957_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.6	1.4e-58
AVZ81476.1|762149_762551_-	Crl family RNA polymerase assembly factor	NA	NA	NA	NA	NA
AVZ81477.1|762612_763878_-	esterase FrsA	NA	NA	NA	NA	NA
AVZ81478.1|764062_764521_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
AVZ81479.1|764937_766398_+	beta-Ala-His dipeptidase	NA	NA	NA	NA	NA
AVZ81480.1|766445_767006_-	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	51.9	4.9e-47
AVZ81481.1|767138_768500_-	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AVZ81482.1|768496_769750_-	peptidase T	NA	NA	NA	NA	NA
AVZ81483.1|769849_770908_-	DNA polymerase IV	NA	NA	NA	NA	NA
AVZ81484.1|771668_773063_+	glutamate decarboxylase	NA	NA	NA	NA	NA
AVZ81485.1|773099_774674_+	amino acid permease	NA	NA	NA	NA	NA
AVZ81486.1|774758_775694_+	glutaminase	NA	NA	NA	NA	NA
AVZ84001.1|775821_776250_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ84002.1|777314_778340_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AVZ81487.1|779174_780887_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AVZ81488.1|781050_782502_+	amino acid permease	NA	NA	NA	NA	NA
AVZ81489.1|782552_784007_+	amino acid permease	NA	NA	NA	NA	NA
AVZ81490.1|784072_785119_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
AVZ81491.1|785435_786158_+	transpeptidase	NA	NA	NA	NA	NA
AVZ81492.1|786128_786896_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
AVZ81493.1|786940_787522_-	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	28.2	2.4e-12
AVZ81494.1|787775_788114_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
AVZ81495.1|788127_789750_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	35.9	3.2e-91
AVZ81496.1|789900_791241_-	two-component system response regulator GlrR	NA	NA	NA	NA	NA
AVZ81497.1|791244_791961_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
AVZ81498.1|791975_793391_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.4	1.1e-13
AVZ81499.1|793877_797765_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	60.7	2.4e-132
AVZ81500.1|798048_799473_+	membrane-bound lytic murein transglycosylase MltF	NA	I1VXB7	Halocynthia_phage	35.0	1.5e-12
AVZ81501.1|799495_800008_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
AVZ81502.1|800205_800544_+	thiosulfate sulfurtransferase PspE	NA	NA	NA	NA	NA
AVZ81503.1|800805_801957_+	L-threonine dehydrogenase	NA	NA	NA	NA	NA
AVZ84003.1|801988_802612_-	acid phosphatase AphA	NA	NA	NA	NA	NA
AVZ81504.1|804763_805447_-|portal	phage portal protein	portal	A4PE27	Ralstonia_virus	63.4	1.3e-65
AVZ81505.1|805865_806210_+	addiction module toxin RelE	NA	NA	NA	NA	NA
AVZ81506.1|806211_806529_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVZ81507.1|806561_806939_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A222YZ88	Escherichia_phage	41.7	1.2e-17
AVZ81508.1|806935_807124_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ81509.1|807168_807348_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	75.9	9.2e-16
AVZ81510.1|807575_808326_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	35.0	1.9e-22
AVZ81511.1|809175_809436_+	4Fe-4S dicluster domain-containing protein	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	50.0	1.4e-17
>prophage 59
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	813771	815238	3837027		Acinetobacter_phage(100.0%)	1	NA	NA
AVZ81519.1|813771_815238_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.3	4.6e-44
>prophage 60
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	822618	826757	3837027		Saccharomonospora_phage(50.0%)	2	NA	NA
AVZ81524.1|822618_826107_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	6.3e-201
AVZ81525.1|826163_826757_-	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	41.5	4.3e-25
>prophage 61
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	835687	836449	3837027		Flavobacterium_phage(100.0%)	1	NA	NA
AVZ81534.1|835687_836449_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	40.0	3.6e-24
>prophage 62
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	850951	854155	3837027		Vibrio_phage(50.0%)	3	NA	NA
AVZ81549.1|850951_851797_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	36.7	2.6e-39
AVZ81550.1|851979_853344_+	LOG family protein	NA	NA	NA	NA	NA
AVZ81551.1|853393_854155_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	30.1	2.9e-10
>prophage 63
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	857181	872707	3837027	tRNA	Bacillus_phage(33.33%)	9	NA	NA
AVZ81555.1|857181_858390_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	34.8	3.6e-63
AVZ81556.1|858386_858833_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
AVZ81557.1|858811_859627_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	32.6	3.2e-15
AVZ81558.1|859729_860881_-	murein transglycosylase A	NA	NA	NA	NA	NA
AVZ81559.1|861508_862771_-	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	29.2	1.9e-14
AVZ81560.1|863008_864334_+	N-acetylglutamate synthase	NA	NA	NA	NA	NA
AVZ81561.1|864376_866230_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	27.1	2.2e-19
AVZ84005.1|866222_869780_-	exodeoxyribonuclease V subunit beta	NA	S5MMD7	Bacillus_phage	23.4	5.2e-09
AVZ84006.1|869821_872707_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	23.5	5.8e-59
>prophage 64
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	878176	878971	3837027		Geobacillus_virus(100.0%)	1	NA	NA
AVZ81566.1|878176_878971_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	1.5e-113
>prophage 65
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	883817	890203	3837027		Enterobacteria_phage(50.0%)	3	NA	NA
AVZ81571.1|883817_885026_+	porin	NA	Q1MVN1	Enterobacteria_phage	45.2	7.0e-83
AVZ81572.1|885189_887682_-	bifunctional glycosyl transferase/transpeptidase	NA	NA	NA	NA	NA
AVZ81573.1|887767_890203_-	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	28.5	1.1e-31
>prophage 66
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	893368	896285	3837027		Bacillus_virus(50.0%)	3	NA	NA
AVZ81578.1|893368_894799_+	polynucleotide adenylyltransferase	NA	G3MAR3	Bacillus_virus	38.6	6.5e-27
AVZ81579.1|894795_895299_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AVZ81580.1|895487_896285_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	M4QNT1	Ostreococcus_lucimarinus_virus	36.5	9.5e-44
>prophage 67
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	906702	909942	3837027		Anomala_cuprea_entomopoxvirus(50.0%)	4	NA	NA
AVZ81591.1|906702_907629_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.9	5.9e-21
AVZ81592.1|907837_908521_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AVZ81593.1|908609_909272_+	carbonate dehydratase	NA	NA	NA	NA	NA
AVZ81594.1|909405_909942_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	34.0	3.0e-17
>prophage 68
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	915599	917033	3837027		Erysipelothrix_phage(100.0%)	1	NA	NA
AVZ84010.1|915599_917033_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.3	1.2e-41
>prophage 69
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	925332	925911	3837027		Sphingobium_phage(100.0%)	1	NA	NA
AVZ81604.1|925332_925911_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	49.1	2.5e-09
>prophage 70
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	929176	930223	3837027		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AVZ81607.1|929176_930223_-	guanosine monophosphate reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	54.8	2.0e-102
>prophage 71
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	957120	964413	3837027		Micromonas_sp._RCC1109_virus(66.67%)	4	NA	NA
AVZ81630.1|957120_958839_-	acetolactate synthase 3 large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	28.1	1.5e-49
AVZ81631.1|959161_960973_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.6	1.1e-39
AVZ81632.1|961236_962196_-	transcriptional regulator LeuO	NA	NA	NA	NA	NA
AVZ81633.1|962832_964413_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	27.0	1.4e-06
>prophage 72
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	972764	973538	3837027		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
AVZ81639.1|972764_973538_-	ABC transporter	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.6	1.5e-09
>prophage 73
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	981753	988118	3837027		Bacillus_virus(33.33%)	3	NA	NA
AVZ81643.1|981753_982467_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	32.7	9.1e-22
AVZ81644.1|982608_984948_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.7	3.0e-29
AVZ81645.1|985211_988118_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	38.6	8.3e-21
>prophage 74
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	995903	997477	3837027		Pseudomonas_phage(50.0%)	2	NA	NA
AVZ81653.1|995903_996743_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A0A0YWI7	Pseudomonas_phage	43.5	4.1e-05
AVZ81654.1|996994_997477_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	49.3	1.7e-32
>prophage 75
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1002302	1003460	3837027		Halovirus(100.0%)	1	NA	NA
AVZ81658.1|1002302_1003460_-	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	33.5	8.0e-52
>prophage 76
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1011578	1021827	3837027	tRNA	Bodo_saltans_virus(25.0%)	7	NA	NA
AVZ81666.1|1011578_1014425_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	25.4	2.5e-62
AVZ81667.1|1014417_1015413_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
AVZ81668.1|1015824_1016088_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
AVZ81669.1|1016157_1017060_-	transcriptional activator NhaR	NA	NA	NA	NA	NA
AVZ81670.1|1017268_1018447_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.8	8.1e-84
AVZ81671.1|1018675_1019809_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	31.8	2.0e-26
AVZ81672.1|1019919_1021827_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.4	7.6e-148
>prophage 77
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1027226	1028180	3837027		Cyanophage(100.0%)	1	NA	NA
AVZ81678.1|1027226_1028180_-	transaldolase	NA	A0A127KNC6	Cyanophage	32.1	9.7e-11
>prophage 78
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1040803	1041235	3837027		Streptomyces_phage(100.0%)	1	NA	NA
AVZ81685.1|1040803_1041235_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	32.6	1.4e-09
>prophage 79
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1049527	1050736	3837027	transposase	uncultured_virus(100.0%)	1	NA	NA
AVZ81693.1|1049527_1050736_-|transposase	IS256 family transposase ISEic2	transposase	A0A218MNI5	uncultured_virus	44.1	8.1e-47
>prophage 80
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1057500	1058532	3837027		Planktothrix_phage(100.0%)	1	NA	NA
AVZ81695.1|1057500_1058532_+	D-methionine ABC transporter, ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	4.0e-34
>prophage 81
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1066528	1070505	3837027		Bacillus_phage(50.0%)	2	NA	NA
AVZ81706.1|1066528_1068457_-	murein transglycosylase	NA	A0A0S2SXL7	Bacillus_phage	35.9	2.2e-09
AVZ81707.1|1068837_1070505_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	25.8	4.7e-37
>prophage 82
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1074214	1082922	3837027		Streptococcus_phage(33.33%)	8	NA	NA
AVZ81711.1|1074214_1075084_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.3	4.5e-47
AVZ81712.1|1075144_1077193_+	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
AVZ81713.1|1077150_1077537_+	YraN family protein	NA	NA	NA	NA	NA
AVZ81714.1|1077583_1078174_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.8	2.4e-12
AVZ81715.1|1078184_1078775_+	osmotically-inducible protein OsmY	NA	NA	NA	NA	NA
AVZ81716.1|1078824_1079559_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AVZ81717.1|1079555_1080209_-	isoprenoid biosynthesis protein ElbB	NA	NA	NA	NA	NA
AVZ81718.1|1080585_1082922_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.1	1.1e-36
>prophage 83
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1097618	1098110	3837027	protease	Pseudomonas_phage(100.0%)	1	NA	NA
AVZ84019.1|1097618_1098110_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.0	9.3e-26
>prophage 84
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1103273	1104335	3837027	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVZ81734.1|1103273_1104335_+|protease	serine endoprotease DegS	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.3	7.2e-23
>prophage 85
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1108426	1117424	3837027		Bacillus_virus(20.0%)	11	NA	NA
AVZ81741.1|1108426_1109257_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	32.2	3.8e-19
AVZ81742.1|1109536_1110526_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
AVZ81743.1|1110580_1111567_+	arabinose-5-phosphate isomerase KdsD	NA	E5E465	Acinetobacter_phage	35.4	1.6e-16
AVZ81744.1|1111582_1112149_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	82.2	2.8e-58
AVZ81745.1|1112145_1112718_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AVZ81746.1|1112692_1113250_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
AVZ81747.1|1113256_1113982_+	lipopolysaccharide ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	4.4e-24
AVZ81748.1|1114106_1115582_+	RNA polymerase sigma-54 factor	NA	NA	NA	NA	NA
AVZ81749.1|1115603_1115891_+	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
AVZ81750.1|1116010_1116475_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AVZ81751.1|1116572_1117424_+	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.2	6.4e-06
>prophage 86
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1121472	1122795	3837027		Geobacillus_virus(100.0%)	1	NA	NA
AVZ81756.1|1121472_1122795_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	42.9	3.4e-78
>prophage 87
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1130116	1131706	3837027		Streptococcus_phage(100.0%)	1	NA	NA
AVZ81763.1|1130116_1131706_-	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	26.9	3.7e-31
>prophage 88
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1136461	1143389	3837027	transposase	Staphylococcus_phage(20.0%)	6	NA	NA
AVZ81769.1|1136461_1137121_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.1	5.4e-45
AVZ84021.1|1137571_1137970_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.6	1.2e-39
AVZ81770.1|1137992_1139201_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	78.8	2.4e-184
AVZ81771.1|1139354_1139621_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ81772.1|1140918_1142352_-	bifunctional heptose 7-phosphate kinase/heptose 1-phosphate adenyltransferase	NA	R9S8D5	Prochlorococcus_phage	26.3	6.1e-17
AVZ81773.1|1142459_1143389_+	lipid A biosynthesis lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	41.9	7.1e-59
>prophage 89
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1148477	1159526	3837027	tRNA	Ostreococcus_lucimarinus_virus(20.0%)	10	NA	NA
AVZ81776.1|1148477_1149743_+	inorganic phosphate transporter	NA	M4QMY4	Ostreococcus_lucimarinus_virus	35.8	1.6e-61
AVZ81777.1|1149951_1150569_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
AVZ81778.1|1150685_1151930_+|tRNA	multifunctional tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/2'phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	47.1	1.7e-84
AVZ81779.1|1151963_1152782_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
AVZ81780.1|1152830_1153196_-	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
AVZ81781.1|1153374_1154043_+	acyl-phosphate--glycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
AVZ81782.1|1154064_1155090_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.3	4.5e-107
AVZ81783.1|1155303_1155519_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AVZ81784.1|1155706_1157455_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	40.5	6.0e-75
AVZ81785.1|1157690_1159526_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
>prophage 90
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1167135	1174129	3837027		Liberibacter_phage(33.33%)	7	NA	NA
AVZ81789.1|1167135_1169496_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	24.1	2.3e-29
AVZ81790.1|1169693_1170101_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ81791.1|1170105_1170234_+	formate acetyltransferase 3	NA	NA	NA	NA	NA
AVZ81792.1|1170292_1170694_-	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	42.5	1.1e-19
AVZ81793.1|1170906_1171566_+	two-component system response regulator QseB	NA	NA	NA	NA	NA
AVZ81794.1|1171565_1172930_+	two-component system sensor histidine kinase QseC	NA	NA	NA	NA	NA
AVZ81795.1|1172971_1174129_-	aminotransferase class I	NA	A0A142C026	Faustovirus	28.6	3.3e-13
>prophage 91
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1178391	1179360	3837027		Escherichia_phage(100.0%)	1	NA	NA
AVZ81800.1|1178391_1179360_+	TerC family protein	NA	A0A291LBC5	Escherichia_phage	32.6	7.5e-35
>prophage 92
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1189050	1189440	3837027		Staphylococcus_phage(100.0%)	1	NA	NA
AVZ81807.1|1189050_1189440_+	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	36.6	4.1e-08
>prophage 93
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1192975	1197342	3837027		Vibrio_phage(33.33%)	5	NA	NA
AVZ84023.1|1192975_1195114_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.7	3.1e-267
AVZ81814.1|1195197_1195662_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.3	2.6e-49
AVZ81815.1|1195674_1196325_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ81816.1|1196420_1196876_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ81817.1|1196961_1197342_+	GIY-YIG nuclease family protein	NA	B6S2G7	Adoxophyes_orana_nucleopolyhedrovirus	53.0	1.2e-15
>prophage 94
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1205097	1207002	3837027		Klosneuvirus(100.0%)	1	NA	NA
AVZ81824.1|1205097_1207002_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A1V0SIR5	Klosneuvirus	35.9	1.6e-52
>prophage 95
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1212430	1215136	3837027		Bodo_saltans_virus(100.0%)	1	NA	NA
AVZ81830.1|1212430_1215136_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.5	8.0e-26
>prophage 96
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1219477	1222344	3837027	protease	Pandoravirus(50.0%)	2	NA	NA
AVZ81835.1|1219477_1220311_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	31.0	1.8e-21
AVZ81836.1|1220403_1222344_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E6G3	Micromonas_pusilla_virus	43.6	2.9e-118
>prophage 97
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1225759	1227492	3837027		Bacillus_phage(100.0%)	2	NA	NA
AVZ81841.1|1225759_1226422_+	two-component system response regulator PmrA	NA	W8CYM9	Bacillus_phage	37.3	1.3e-30
AVZ81842.1|1226418_1227492_+	two-component system sensor histidine kinase PmrB	NA	W8CYF6	Bacillus_phage	21.6	6.6e-08
>prophage 98
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1230638	1232089	3837027		Indivirus(50.0%)	2	NA	NA
AVZ81847.1|1230638_1231610_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	22.5	1.5e-06
AVZ81848.1|1231804_1232089_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	63.5	3.9e-16
>prophage 99
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1236326	1237973	3837027		Klosneuvirus(50.0%)	2	NA	NA
AVZ81852.1|1236326_1237331_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	44.3	1.4e-71
AVZ81853.1|1237442_1237973_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	61.4	3.0e-54
>prophage 100
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1255347	1270449	3837027	protease,tRNA	Lactococcus_phage(20.0%)	12	NA	NA
AVZ81872.1|1255347_1257798_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.2	9.3e-66
AVZ81873.1|1257837_1258260_-	HTH-type transcriptional repressor NsrR	NA	NA	NA	NA	NA
AVZ81874.1|1258549_1259848_-	adenylosuccinate synthetase	NA	A0A2R8FF47	Brazilian_cedratvirus	34.8	9.3e-65
AVZ81875.1|1259946_1260147_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
AVZ81876.1|1260338_1261451_+	acyltransferase	NA	NA	NA	NA	NA
AVZ81877.1|1261760_1262765_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
AVZ81878.1|1262764_1264024_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	29.1	6.2e-05
AVZ81879.1|1264082_1265363_-	GTPase HflX	NA	NA	NA	NA	NA
AVZ81880.1|1265461_1265770_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
AVZ81881.1|1265932_1266886_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AVZ81882.1|1266878_1268798_-	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	38.2	1.5e-58
AVZ81883.1|1268814_1270449_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	U5PWK4	Bacillus_virus	26.9	6.3e-18
>prophage 101
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1274388	1274934	3837027		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AVZ81887.1|1274388_1274934_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	36.8	3.9e-25
>prophage 102
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1279712	1281512	3837027		Lactobacillus_phage(100.0%)	1	NA	NA
AVZ81893.1|1279712_1281512_+	fumarate reductase (quinol) flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	28.1	1.5e-17
>prophage 103
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1290616	1292640	3837027		Vibrio_phage(50.0%)	2	NA	NA
AVZ81904.1|1290616_1292260_-	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	67.6	4.3e-184
AVZ84027.1|1292319_1292640_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	38.9	9.4e-11
>prophage 104
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1300909	1305039	3837027		Bacillus_phage(50.0%)	3	NA	NA
AVZ81912.1|1300909_1301920_-	recombinase XerD	NA	A0A142F1N9	Bacillus_phage	24.3	1.7e-05
AVZ81913.1|1301980_1303573_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ81914.1|1303566_1305039_-	ATP-dependent helicase	NA	A0A126DN25	Acinetobacter_phage	28.9	1.5e-42
>prophage 105
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1312393	1315201	3837027	integrase	Faecalibacterium_phage(50.0%)	3	1305139:1305151	1313109:1313121
1305139:1305151	attL	TCCCGGGCAGGAG	NA	NA	NA	NA
AVZ81918.1|1312393_1313077_-|integrase	integrase	integrase	A0A2K9V411	Faecalibacterium_phage	40.6	1.3e-30
AVZ81919.1|1313195_1314131_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
1313109:1313121	attR	TCCCGGGCAGGAG	NA	NA	NA	NA
AVZ84028.1|1314238_1315201_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	37.1	1.1e-46
>prophage 106
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1327862	1390681	3837027	protease,transposase	uncultured_virus(27.27%)	57	NA	NA
AVZ81931.1|1327862_1329071_-|transposase	IS256-like element ISEic2 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	8.1e-47
AVZ81932.1|1329129_1330341_-|transposase	IS256-like element ISEic2 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	8.2e-47
AVZ81933.1|1330448_1330841_-	acetyltransferase	NA	NA	NA	NA	NA
AVZ81934.1|1330837_1333702_-	conjugative transfer ATPase	NA	NA	NA	NA	NA
AVZ81935.1|1333701_1334124_-	TIGR03751 family conjugal transfer lipoprotein	NA	NA	NA	NA	NA
AVZ81936.1|1334133_1335627_-	TIGR03752 family integrating conjugative element protein	NA	NA	NA	NA	NA
AVZ81937.1|1335646_1336449_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	35.5	1.6e-27
AVZ81938.1|1336638_1336797_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ81939.1|1336852_1337782_-	TIGR03749 family integrating conjugative element protein	NA	NA	NA	NA	NA
AVZ81940.1|1337781_1338441_-	TIGR03746 family integrating conjugative element protein	NA	NA	NA	NA	NA
AVZ81941.1|1338437_1338794_-	TIGR03750 family conjugal transfer protein	NA	NA	NA	NA	NA
AVZ81942.1|1338803_1339190_-	TIGR03745 family integrating conjugative element membrane protein	NA	NA	NA	NA	NA
AVZ81943.1|1339216_1339459_-	TIGR03758 family integrating conjugative element protein	NA	NA	NA	NA	NA
AVZ81944.1|1339458_1339800_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ81945.1|1339905_1340496_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ84029.1|1340603_1341359_-	TIGR03747 family integrating conjugative element membrane protein	NA	NA	NA	NA	NA
AVZ81946.1|1341351_1343442_-	conjugative coupling factor TraD, PFGI-1 class	NA	NA	NA	NA	NA
AVZ81947.1|1343438_1344236_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ81948.1|1344399_1344912_-	integrating conjugative element protein	NA	NA	NA	NA	NA
AVZ81949.1|1344911_1345577_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
AVZ81950.1|1345555_1346260_-	TIGR03759 family integrating conjugative element protein	NA	NA	NA	NA	NA
AVZ81951.1|1346266_1346989_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ81952.1|1346985_1347582_-	pilus assembly protein PilL	NA	NA	NA	NA	NA
AVZ81953.1|1347723_1347987_-	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
AVZ81954.1|1347967_1348204_-	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
AVZ81955.1|1348775_1348979_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ81956.1|1349056_1349521_-	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
AVZ81957.1|1350170_1352201_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.5	6.2e-39
AVZ81958.1|1352214_1352970_-	TIGR03761 family integrating conjugative element protein	NA	NA	NA	NA	NA
AVZ81959.1|1353075_1354104_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ81960.1|1354155_1355376_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ81961.1|1355659_1356268_-	DUF2857 domain-containing protein	NA	NA	NA	NA	NA
AVZ81962.1|1356264_1356690_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ81963.1|1356686_1357409_-	DUF2786 domain-containing protein	NA	NA	NA	NA	NA
AVZ81964.1|1357401_1359066_-	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
AVZ81965.1|1359062_1360433_-	replicative DNA helicase	NA	O80281	Escherichia_phage	52.1	1.0e-117
AVZ81966.1|1360425_1361223_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ81967.1|1361219_1361576_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ81968.1|1361572_1362445_-	ParA family protein	NA	NA	NA	NA	NA
AVZ81969.1|1363172_1363631_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
AVZ81970.1|1364205_1366476_-	arginine decarboxylase	NA	NA	NA	NA	NA
AVZ81971.1|1367256_1368465_-|transposase	IS256 family transposase ISEic2	transposase	A0A218MNI5	uncultured_virus	44.1	8.1e-47
AVZ81972.1|1368512_1369775_+	putrescine-ornithine antiporter	NA	NA	NA	NA	NA
AVZ81973.1|1372053_1374846_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	29.8	5.9e-32
AVZ81974.1|1374925_1375960_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
AVZ81975.1|1375967_1376657_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	27.9	2.2e-17
AVZ81976.1|1376748_1377551_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AVZ81977.1|1377661_1378837_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
AVZ81978.1|1378833_1381380_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.7	2.5e-66
AVZ81979.1|1381376_1382015_+	molecular chaperone TorD	NA	NA	NA	NA	NA
AVZ81980.1|1382115_1383033_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ81981.1|1383435_1384005_+	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
AVZ81982.1|1384333_1385011_+	DUF1190 domain-containing protein	NA	W6ARK6	Erwinia_phage	45.2	1.2e-36
AVZ81983.1|1385014_1386175_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	45.4	7.0e-88
AVZ81984.1|1386248_1388399_-	lysine decarboxylase	NA	NA	NA	NA	NA
AVZ81985.1|1388471_1389791_-	amino acid permease	NA	NA	NA	NA	NA
AVZ81986.1|1390153_1390681_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
>prophage 107
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1421384	1424837	3837027		Escherichia_phage(50.0%)	4	NA	NA
AVZ82010.1|1421384_1422905_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.6	1.0e-17
AVZ82011.1|1422908_1423562_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
AVZ82012.1|1423572_1424253_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
AVZ82013.1|1424309_1424837_-	superoxide dismutase [Cu-Zn] SodC1	NA	Q9MC02	Salmonella_phage	62.0	9.9e-58
>prophage 108
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1431114	1433759	3837027		Yellowstone_lake_mimivirus(50.0%)	2	NA	NA
AVZ82019.1|1431114_1432206_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.2	6.3e-30
AVZ82020.1|1432346_1433759_-	replicative DNA helicase DnaB	NA	A0A1B0VG30	Salmonella_phage	76.6	1.8e-194
>prophage 109
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1438579	1439188	3837027		Lactococcus_phage(100.0%)	1	NA	NA
AVZ82026.1|1438579_1439188_-	LexA repressor	NA	Q9G0C2	Lactococcus_phage	38.0	5.0e-13
>prophage 110
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1457802	1458912	3837027		Mycoplasma_phage(100.0%)	1	NA	NA
AVZ82041.1|1457802_1458912_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	46.1	2.0e-15
>prophage 111
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1469121	1479735	3837027		Bacillus_virus(66.67%)	5	NA	NA
AVZ82049.1|1469121_1472826_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	77.8	3.9e-23
AVZ82050.1|1473070_1474489_-	cell division protein FtsP	NA	NA	NA	NA	NA
AVZ82051.1|1474537_1475281_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AVZ82052.1|1475371_1477654_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-79
AVZ82053.1|1477839_1479735_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.4	9.6e-95
>prophage 112
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1485123	1487082	3837027		Staphylococcus_phage(100.0%)	1	NA	NA
AVZ82059.1|1485123_1487082_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	38.2	8.2e-81
>prophage 113
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1494990	1500496	3837027		Prochlorococcus_phage(33.33%)	6	NA	NA
AVZ82062.1|1494990_1496580_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.4e-70
AVZ82063.1|1496621_1497899_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
AVZ82064.1|1497933_1498590_-	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
AVZ82065.1|1498651_1498924_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	54.4	3.0e-18
AVZ82066.1|1499113_1499704_-	DUF416 domain-containing protein	NA	NA	NA	NA	NA
AVZ82067.1|1499809_1500496_-	deoxyribonuclease V	NA	A0A2K9V7A2	Bandra_megavirus	29.3	4.7e-15
>prophage 114
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1505473	1513802	3837027		Vibrio_phage(50.0%)	2	NA	NA
AVZ82072.1|1505473_1509694_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.3	2.2e-67
AVZ82073.1|1509773_1513802_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.4	4.2e-23
>prophage 115
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1517909	1521063	3837027		Klosneuvirus(50.0%)	3	NA	NA
AVZ82080.1|1517909_1519094_-	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	26.9	8.9e-14
AVZ82081.1|1519842_1520115_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ82082.1|1520115_1521063_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	35.4	1.1e-30
>prophage 116
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1530892	1531507	3837027		Streptococcus_phage(100.0%)	1	NA	NA
AVZ82088.1|1530892_1531507_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	39.5	1.7e-21
>prophage 117
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1538849	1545079	3837027		uncultured_Mediterranean_phage(33.33%)	7	NA	NA
AVZ82096.1|1538849_1539638_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	31.3	2.3e-26
AVZ82097.1|1539627_1540158_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
AVZ82098.1|1540161_1540431_-	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
AVZ82099.1|1540543_1542175_-	ubiquinone biosynthesis protein UbiB	NA	C7U092	Ostreococcus_tauri_virus	26.8	2.2e-34
AVZ82100.1|1542171_1542777_-	SCP2 domain-containing protein	NA	NA	NA	NA	NA
AVZ82101.1|1542792_1543548_-	ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE	NA	NA	NA	NA	NA
AVZ82102.1|1543669_1545079_-	DNA recombination protein RmuC	NA	R9RFD7	Alteromonas_phage	61.8	1.3e-08
>prophage 118
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1555918	1558225	3837027		Streptococcus_phage(100.0%)	1	NA	NA
AVZ82109.1|1555918_1558225_-	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	36.5	1.6e-107
>prophage 119
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1561901	1563731	3837027		Catovirus(100.0%)	1	NA	NA
AVZ82113.1|1561901_1563731_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	36.6	1.4e-82
>prophage 120
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1568241	1572105	3837027		Bacillus_phage(50.0%)	3	NA	NA
AVZ82117.1|1568241_1570401_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.0	6.0e-117
AVZ82118.1|1570477_1571194_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
AVZ82119.1|1571193_1572105_-	tyrosine recombinase XerC	NA	A0A1B3B212	Gordonia_phage	30.2	8.1e-15
>prophage 121
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1586907	1593101	3837027		Enterobacteria_phage(40.0%)	6	NA	NA
AVZ82133.1|1586907_1588038_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	35.5	2.2e-17
AVZ82134.1|1588063_1588759_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
AVZ82135.1|1588736_1589618_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	62.8	3.8e-102
AVZ84034.1|1589650_1590715_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.4	4.7e-99
AVZ82136.1|1590711_1591974_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HZW8	Acanthocystis_turfacea_Chlorella_virus	25.3	8.3e-18
AVZ82137.1|1591970_1593101_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	28.8	1.5e-26
>prophage 122
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1597314	1602680	3837027		Streptomyces_phage(33.33%)	4	NA	NA
AVZ82141.1|1597314_1597641_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	44.3	7.3e-19
AVZ82142.1|1597786_1599076_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.5	6.7e-39
AVZ82143.1|1599081_1600584_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
AVZ84035.1|1600652_1602680_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	36.2	2.1e-108
>prophage 123
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1610518	1612168	3837027		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AVZ82150.1|1610518_1612168_-	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	31.4	4.1e-65
>prophage 124
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1615632	1619084	3837027		Vibrio_phage(33.33%)	3	NA	NA
AVZ82153.1|1615632_1616658_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.3	1.4e-18
AVZ82154.1|1616667_1617864_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	28.2	2.8e-31
AVZ82155.1|1618154_1619084_+	ADP-L-glycero-D-mannoheptose-6-epimerase	NA	E3SL51	Synechococcus_phage	36.8	3.3e-32
>prophage 125
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1630980	1635547	3837027		uncultured_Mediterranean_phage(20.0%)	7	NA	NA
AVZ82166.1|1630980_1631466_+	phosphopantetheine adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.4	9.9e-28
AVZ82167.1|1631462_1632272_-	formamidopyrimidine-DNA glycosylase	NA	G3MA33	Bacillus_virus	33.3	2.4e-26
AVZ82168.1|1632365_1632533_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
AVZ82169.1|1632544_1632781_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
AVZ82170.1|1633019_1633706_-	JAB domain-containing protein	NA	A0A1B2LRS6	Wolbachia_phage	29.8	6.3e-20
AVZ84037.1|1633893_1635111_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	2.2e-44
AVZ82171.1|1635088_1635547_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	63.5	3.5e-51
>prophage 126
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1640453	1643698	3837027		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
AVZ82178.1|1640453_1642211_-	type I restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	38.8	7.3e-12
AVZ82179.1|1642210_1643698_-	restriction endonuclease subunit M	NA	J7I0U9	Acinetobacter_phage	28.5	2.7e-36
>prophage 127
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1649752	1652819	3837027		Abalone_herpesvirus(50.0%)	3	NA	NA
AVZ82183.1|1649752_1650376_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.1	8.2e-19
AVZ82184.1|1650430_1650706_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AVZ82185.1|1650725_1652819_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis(diphosphate) 3'-diphosphatase	NA	A0A291L9W9	Bordetella_phage	34.5	4.7e-10
>prophage 128
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1657063	1658476	3837027		environmental_Halophage(100.0%)	1	NA	NA
AVZ84038.1|1657063_1658476_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	79.6	1.2e-54
>prophage 129
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1662042	1663169	3837027		Vibrio_phage(50.0%)	2	NA	NA
AVZ82191.1|1662042_1662702_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	56.8	9.5e-58
AVZ82192.1|1662920_1663169_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	88.9	9.5e-11
>prophage 130
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1671956	1682870	3837027		Synechococcus_phage(25.0%)	11	NA	NA
AVZ82202.1|1671956_1672370_-	heat shock protein IbpA	NA	E3SIH8	Synechococcus_phage	35.4	1.8e-17
AVZ82203.1|1672644_1672995_+	YceK/YidQ family lipoprotein	NA	NA	NA	NA	NA
AVZ82204.1|1673001_1674300_-	DUF3748 domain-containing protein	NA	NA	NA	NA	NA
AVZ82205.1|1674376_1675195_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
AVZ82206.1|1675284_1677699_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.1	5.5e-119
AVZ82207.1|1677742_1678819_-	DNA replication and repair protein RecF	NA	NA	NA	NA	NA
AVZ82208.1|1678895_1679996_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	34.7	4.1e-53
AVZ82209.1|1680020_1681412_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
AVZ82210.1|1682134_1682275_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
AVZ82211.1|1682292_1682652_+	ribonuclease P protein component	NA	NA	NA	NA	NA
AVZ82212.1|1682615_1682870_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.5	4.1e-17
>prophage 131
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1688876	1690214	3837027		Moraxella_phage(100.0%)	1	NA	NA
AVZ82216.1|1688876_1690214_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	38.5	4.3e-65
>prophage 132
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1693748	1702204	3837027		Planktothrix_phage(25.0%)	7	NA	NA
AVZ82220.1|1693748_1694528_-	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	30.5	1.1e-17
AVZ82221.1|1694575_1695463_-	phosphate ABC transporter permease PtsA	NA	NA	NA	NA	NA
AVZ82222.1|1695464_1696436_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
AVZ82223.1|1696498_1697539_-	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	37.1	1.4e-47
AVZ82224.1|1697901_1698738_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AVZ82225.1|1698795_1700625_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1HVL7	Paramecium_bursaria_Chlorella_virus	42.6	1.2e-129
AVZ82226.1|1700833_1702204_-	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	35.6	1.3e-32
>prophage 133
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1716681	1724349	3837027		Sulfolobus_monocaudavirus(25.0%)	6	NA	NA
AVZ82241.1|1716681_1718196_-	ATPase RavA	NA	A0A0N9NIH9	Sulfolobus_monocaudavirus	31.7	1.3e-17
AVZ82242.1|1718458_1720327_+	low affinity potassium transporter Kup	NA	A7J6G4	Paramecium_bursaria_Chlorella_virus	30.1	4.2e-66
AVZ82243.1|1720518_1720938_+	D-ribose pyranase	NA	NA	NA	NA	NA
AVZ82244.1|1720945_1722451_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.7	2.1e-15
AVZ82245.1|1722457_1723438_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
AVZ82246.1|1723461_1724349_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	25.4	2.5e-05
>prophage 134
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1739100	1741893	3837027		Bacillus_phage(100.0%)	1	NA	NA
AVZ82257.1|1739100_1741893_+	DNA polymerase I	NA	S5M8J1	Bacillus_phage	29.2	1.6e-66
>prophage 135
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1749329	1750397	3837027		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
AVZ82263.1|1749329_1750397_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	24.3	9.5e-07
>prophage 136
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1756478	1757711	3837027		Salmonella_phage(100.0%)	1	NA	NA
AVZ82269.1|1756478_1757711_-	multidrug transporter MdfA	NA	S4TR35	Salmonella_phage	24.2	1.3e-23
>prophage 137
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1770779	1771514	3837027		Synechococcus_phage(100.0%)	1	NA	NA
AVZ82280.1|1770779_1771514_-	glutathione peroxidase	NA	A0A1D8KSL1	Synechococcus_phage	57.6	7.1e-46
>prophage 138
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1775032	1783360	3837027	tRNA,transposase	uncultured_virus(33.33%)	6	NA	NA
AVZ82284.1|1775032_1776241_+|transposase	IS256 family transposase ISEic2	transposase	A0A218MNI5	uncultured_virus	44.1	8.1e-47
AVZ82285.1|1776653_1777754_-|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
AVZ82286.1|1778251_1779385_-	porin	NA	Q1MVN1	Enterobacteria_phage	41.4	7.8e-76
AVZ82287.1|1779620_1780346_+	acid phosphatase AphA	NA	NA	NA	NA	NA
AVZ82288.1|1780372_1781182_+	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
AVZ82289.1|1781512_1783360_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	27.8	1.8e-08
>prophage 139
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1792251	1796247	3837027		Brevibacillus_phage(50.0%)	4	NA	NA
AVZ84045.1|1792251_1793487_-	murein hydrolase activator EnvC	NA	A0A0K2CNY2	Brevibacillus_phage	37.9	2.4e-09
AVZ82294.1|1793613_1795158_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
AVZ82295.1|1795536_1795974_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AVZ82296.1|1795998_1796247_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	52.1	7.0e-14
>prophage 140
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1799465	1801549	3837027		Bacillus_phage(50.0%)	2	NA	NA
AVZ82301.1|1799465_1800854_-	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	26.6	2.2e-19
AVZ82302.1|1800850_1801549_-	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	29.5	5.8e-05
>prophage 141
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1814619	1823483	3837027		Erwinia_phage(33.33%)	8	NA	NA
AVZ82315.1|1814619_1815951_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.8	1.2e-43
AVZ82316.1|1816138_1817056_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
AVZ82317.1|1817169_1817655_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
AVZ82318.1|1817728_1817971_-	cell division protein ZapB	NA	NA	NA	NA	NA
AVZ82319.1|1818629_1819472_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.2e-10
AVZ82320.1|1819546_1821055_+	glycerol kinase	NA	NA	NA	NA	NA
AVZ82321.1|1821215_1822226_+	fructose-bisphosphatase class II	NA	NA	NA	NA	NA
AVZ82322.1|1822298_1823483_-	multidrug transporter EmrD	NA	S4TR35	Salmonella_phage	24.9	6.0e-10
>prophage 142
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1831129	1831558	3837027		Morganella_phage(100.0%)	1	NA	NA
AVZ82329.1|1831129_1831558_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	43.7	1.1e-25
>prophage 143
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1834642	1837230	3837027		Streptococcus_phage(50.0%)	2	NA	NA
AVZ82332.1|1834642_1835452_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.4	8.4e-32
AVZ82333.1|1835673_1837230_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.4	1.2e-10
>prophage 144
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1846410	1848380	3837027		Planktothrix_phage(100.0%)	2	NA	NA
AVZ82340.1|1846410_1847391_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	5.6e-14
AVZ82341.1|1847387_1848380_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.9	7.0e-20
>prophage 145
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1863833	1868475	3837027		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
AVZ82355.1|1863833_1865411_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	51.3	4.1e-06
AVZ82356.1|1865464_1866817_-	glutathione-disulfide reductase	NA	NA	NA	NA	NA
AVZ82357.1|1866993_1867836_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
AVZ82358.1|1868001_1868475_+	HIT family protein	NA	Q5YEY9	Rock_bream_iridovirus	36.1	2.1e-19
>prophage 146
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1872272	1874449	3837027		Bacillus_phage(100.0%)	2	NA	NA
AVZ82361.1|1872272_1872986_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.7	1.6e-34
AVZ82362.1|1872982_1874449_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.2	2.4e-24
>prophage 147
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1882419	1885131	3837027		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AVZ82368.1|1882419_1885131_-	magnesium-translocating P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	24.2	8.2e-39
>prophage 148
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1897244	1897871	3837027		Dickeya_phage(100.0%)	1	NA	NA
AVZ82378.1|1897244_1897871_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	55.8	3.8e-24
>prophage 149
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1901743	1911914	3837027		Planktothrix_phage(50.0%)	10	NA	NA
AVZ82384.1|1901743_1902415_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	36.2	6.8e-27
AVZ82385.1|1902404_1903373_+	cell division protein FtsX	NA	NA	NA	NA	NA
AVZ82386.1|1903679_1904534_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	38.7	3.9e-43
AVZ82387.1|1904629_1905751_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVZ82388.1|1907205_1908342_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.9	1.1e-45
AVZ82389.1|1908338_1908731_-	aspartate 1-decarboxylase autocleavage activator PanM	NA	NA	NA	NA	NA
AVZ82390.1|1909476_1909719_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ82391.1|1909759_1910488_+	amino acid-binding protein	NA	NA	NA	NA	NA
AVZ82392.1|1910501_1911152_+	amino acid ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AVZ82393.1|1911185_1911914_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.9	9.6e-27
>prophage 150
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1915391	1916138	3837027		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AVZ82396.1|1915391_1916138_+	glycerophosphodiester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	24.7	4.0e-12
>prophage 151
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1920640	1923088	3837027		Dickeya_phage(100.0%)	1	NA	NA
AVZ84047.1|1920640_1923088_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	6.7e-32
>prophage 152
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1934321	1936727	3837027		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
AVZ82408.1|1934321_1936727_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	41.4	2.4e-13
>prophage 153
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1941595	1944934	3837027		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
AVZ82412.1|1941595_1941820_+	hypothetical protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	41.8	1.1e-05
AVZ82413.1|1942168_1942801_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
AVZ82414.1|1942861_1944934_+	hypothetical protein	NA	H9YQA8	environmental_Halophage	68.1	1.1e-51
>prophage 154
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1961434	1965250	3837027		Bacillus_phage(66.67%)	3	NA	NA
AVZ82431.1|1961434_1962154_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	1.6e-29
AVZ82432.1|1962150_1963536_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.4	2.2e-11
AVZ82433.1|1963630_1965250_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	51.4	2.3e-137
>prophage 155
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1985290	1986109	3837027		Vibrio_phage(100.0%)	1	NA	NA
AVZ82453.1|1985290_1986109_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.6	8.2e-67
>prophage 156
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	1994519	1999063	3837027		Indivirus(25.0%)	4	NA	NA
AVZ82461.1|1994519_1995086_+	peptidylprolyl isomerase A	NA	A0A1V0SCU1	Indivirus	34.8	2.0e-11
AVZ84049.1|1995141_1995717_-	aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	58.9	9.2e-65
AVZ82462.1|1995912_1997127_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.6	5.2e-25
AVZ82463.1|1997134_1999063_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	32.1	1.2e-71
>prophage 157
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2004802	2010437	3837027		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
AVZ82471.1|2004802_2005192_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	41.3	1.4e-13
AVZ82472.1|2005200_2005560_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	33.3	7.3e-12
AVZ82473.1|2005577_2005868_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
AVZ82474.1|2006038_2006413_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
AVZ82475.1|2006509_2006980_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
AVZ82476.1|2007075_2009184_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	4.3e-59
AVZ82477.1|2009252_2010437_+	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	26.9	8.9e-14
>prophage 158
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2030166	2031649	3837027	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
AVZ82511.1|2030166_2031114_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.0	1.9e-06
AVZ82512.1|2031133_2031649_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.7	2.3e-19
>prophage 159
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2048366	2057559	3837027		Pseudomonas_phage(25.0%)	6	NA	NA
AVZ82521.1|2048366_2050619_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	69.5	2.8e-101
AVZ82522.1|2050669_2051500_-	2,5-didehydrogluconate reductase DkgA	NA	A0A1V0SDE7	Indivirus	32.5	1.2e-28
AVZ82523.1|2051743_2052946_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
AVZ82524.1|2053521_2053866_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
AVZ82525.1|2053951_2056783_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.9	3.0e-310
AVZ82526.1|2057010_2057559_+	single-stranded DNA-binding protein	NA	R9TR60	Vibrio_phage	62.1	8.2e-55
>prophage 160
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2078526	2082899	3837027		environmental_Halophage(50.0%)	3	NA	NA
AVZ82539.1|2078526_2079945_+	purine permease	NA	H9YQ34	environmental_Halophage	45.2	8.4e-19
AVZ82540.1|2079972_2081292_+	guanine deaminase	NA	NA	NA	NA	NA
AVZ82541.1|2081531_2082899_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	72.7	1.5e-161
>prophage 161
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2086195	2087134	3837027		Lactobacillus_phage(100.0%)	1	NA	NA
AVZ82544.1|2086195_2087134_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	26.9	3.5e-21
>prophage 162
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2104235	2105279	3837027		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVZ82563.1|2104235_2105279_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	2.3e-05
>prophage 163
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2119987	2120923	3837027		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AVZ82575.1|2119987_2120923_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	41.1	3.4e-53
>prophage 164
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2125050	2126928	3837027	tRNA	Tupanvirus(100.0%)	1	NA	NA
AVZ82580.1|2125050_2126928_-|tRNA	selenocysteinyl-tRNA-specific translation elongation factor SelB	tRNA	A0A2K9KZ60	Tupanvirus	23.5	2.5e-10
>prophage 165
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2129952	2131032	3837027		Staphylococcus_phage(100.0%)	1	NA	NA
AVZ82584.1|2129952_2131032_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	44.4	6.7e-08
>prophage 166
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2140335	2148649	3837027	tRNA	Bacillus_virus(33.33%)	5	NA	NA
AVZ82592.1|2140335_2141655_-	nitrate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	6.6e-34
AVZ82593.1|2141691_2143428_-	sulfonate ABC transporter permease	NA	NA	NA	NA	NA
AVZ82594.1|2143654_2146510_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.8	3.9e-140
AVZ82595.1|2146534_2146984_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AVZ82596.1|2147137_2148649_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.4	7.1e-48
>prophage 167
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2155413	2165270	3837027	transposase	Mycobacterium_phage(25.0%)	7	NA	NA
AVZ82603.1|2155413_2156164_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	35.4	7.9e-24
AVZ82604.1|2156245_2156485_+	transcription factor	NA	NA	NA	NA	NA
AVZ82605.1|2156523_2158962_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	37.8	1.7e-75
AVZ84054.1|2158967_2160278_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AVZ82606.1|2160290_2160947_+	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
AVZ82607.1|2160943_2162011_+	Appr-1-p processing protein	NA	A0A173GFD0	Erwinia_phage	38.8	2.7e-17
AVZ82608.1|2162174_2165270_+	restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	29.0	1.2e-57
>prophage 168
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2168884	2169655	3837027		Rhizobium_phage(100.0%)	1	NA	NA
AVZ82612.1|2168884_2169655_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A076YN96	Rhizobium_phage	28.2	6.6e-10
>prophage 169
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2175099	2176917	3837027		Vaccinia_virus(100.0%)	1	NA	NA
AVZ82616.1|2175099_2176917_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	63.4	1.2e-232
>prophage 170
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2181459	2184023	3837027		Erwinia_phage(50.0%)	3	NA	NA
AVZ82618.1|2181459_2181879_-	hypothetical protein	NA	A0A191ZC01	Erwinia_phage	46.8	3.7e-31
AVZ82619.1|2182278_2183274_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ82620.1|2183273_2184023_+	sugar ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.7	2.4e-17
>prophage 171
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2188369	2188942	3837027		Ralstonia_phage(100.0%)	1	NA	NA
AVZ82626.1|2188369_2188942_-	recombinase family protein	NA	A0JC18	Ralstonia_phage	39.6	4.9e-26
>prophage 172
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2208596	2212907	3837027		Tupanvirus(50.0%)	3	NA	NA
AVZ82644.1|2208596_2209742_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	2.1e-81
AVZ82645.1|2210280_2211543_+	nucleoside permease	NA	NA	NA	NA	NA
AVZ82646.1|2212178_2212907_-	nicotinamide riboside transporter PnuC	NA	I6W764	Vibriophage	33.2	3.5e-21
>prophage 173
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2227933	2229088	3837027		Staphylococcus_phage(100.0%)	1	NA	NA
AVZ82660.1|2227933_2229088_-	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	61.6	1.4e-125
>prophage 174
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2245644	2246883	3837027		Catovirus(100.0%)	1	NA	NA
AVZ82675.1|2245644_2246883_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	46.4	1.5e-101
>prophage 175
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2254863	2257746	3837027		Prochlorococcus_phage(100.0%)	1	NA	NA
AVZ82684.1|2254863_2257746_+	glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	50.6	1.4e-257
>prophage 176
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2265567	2271916	3837027	tRNA	Brevibacillus_phage(25.0%)	5	NA	NA
AVZ82692.1|2265567_2266467_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.9	1.4e-32
AVZ82693.1|2266494_2267211_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
AVZ82694.1|2267215_2268949_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.8	2.3e-63
AVZ82695.1|2269290_2270388_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	3.1e-05
AVZ82696.1|2270398_2271916_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.6	5.0e-86
>prophage 177
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2277263	2277845	3837027		Stx2-converting_phage(100.0%)	1	NA	NA
AVZ82700.1|2277263_2277845_+	Ail/Lom family protein	NA	A0A0P0ZBV0	Stx2-converting_phage	29.8	2.6e-14
>prophage 178
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2293755	2294964	3837027	transposase	uncultured_virus(100.0%)	1	NA	NA
AVZ82706.1|2293755_2294964_+|transposase	IS256-like element ISEic2 family transposase	transposase	A0A218MNI5	uncultured_virus	43.6	3.1e-46
>prophage 179
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2304501	2311034	3837027	transposase	Escherichia_phage(50.0%)	7	NA	NA
AVZ82714.1|2304501_2305199_-|transposase	IS1-like element ISEic1 family transposase	transposase	A0A077SLN4	Escherichia_phage	56.7	3.3e-77
AVZ82715.1|2305489_2306203_+	deoxynucleoside kinase	NA	NA	NA	NA	NA
AVZ82716.1|2306199_2306628_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AVZ82717.1|2306704_2307913_-|transposase	IS256-like element ISEic2 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	1.1e-46
AVZ82718.1|2308085_2308688_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ82719.1|2308700_2309216_-	hypothetical protein	NA	G9L6F1	Escherichia_phage	71.9	2.6e-34
AVZ82720.1|2310107_2311034_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.9	3.7e-76
>prophage 180
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2324053	2325313	3837027		Bovine_gammaherpesvirus(100.0%)	1	NA	NA
AVZ82726.1|2324053_2325313_+	diaminopimelate decarboxylase	NA	A0A060D2X4	Bovine_gammaherpesvirus	25.8	1.6e-08
>prophage 181
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2346156	2347167	3837027		Enterobacteria_phage(100.0%)	1	NA	NA
AVZ82745.1|2346156_2347167_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.8	1.2e-24
>prophage 182
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2354770	2373974	3837027	tRNA,transposase	uncultured_Mediterranean_phage(22.22%)	17	NA	NA
AVZ82751.1|2354770_2355487_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	49.5	2.4e-46
AVZ82752.1|2355574_2356264_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
AVZ82753.1|2356951_2357485_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AVZ82754.1|2357497_2359744_+	phosphoenolpyruvate-protein phosphotransferase PtsP	NA	A0A1V0SGR7	Hokovirus	26.2	7.1e-12
AVZ82755.1|2359826_2360171_+	cell division protein FtsB	NA	NA	NA	NA	NA
AVZ84063.1|2360224_2360956_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AVZ82756.1|2360959_2361433_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
AVZ82757.1|2361436_2362483_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
AVZ82758.1|2362463_2363228_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.8	2.6e-67
AVZ82759.1|2363221_2363860_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.4	9.0e-37
AVZ82760.1|2364187_2365120_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	8.3e-07
AVZ82761.1|2365171_2366158_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	31.7	7.9e-32
AVZ82762.1|2366209_2368768_-	DNA mismatch repair protein MutS	NA	A0A2I2L537	Orpheovirus	31.2	4.9e-25
AVZ82763.1|2369637_2369955_-	acid-resistance protein	NA	NA	NA	NA	NA
AVZ82764.1|2370446_2372027_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.9	8.8e-09
AVZ82765.1|2372250_2372484_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ82766.1|2372765_2373974_+|transposase	IS256 family transposase ISEic2	transposase	A0A218MNI5	uncultured_virus	44.1	8.1e-47
>prophage 183
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2379400	2384700	3837027	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
AVZ82768.1|2379400_2379889_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	51.9	1.3e-30
AVZ82769.1|2379959_2381021_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.6	8.3e-112
AVZ82770.1|2381057_2381498_+	recombination regulator RecX	NA	NA	NA	NA	NA
AVZ82771.1|2381632_2384260_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	35.9	3.3e-77
AVZ82772.1|2384514_2384700_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	68.6	9.9e-13
>prophage 184
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2402089	2403160	3837027		Klebsiella_phage(100.0%)	1	NA	NA
AVZ84065.1|2402089_2403160_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A2I6UFP9	Klebsiella_phage	49.8	7.9e-86
>prophage 185
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2409174	2411748	3837027		Cronobacter_phage(100.0%)	1	NA	NA
AVZ82792.1|2409174_2411748_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	36.7	2.1e-121
>prophage 186
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2418605	2508644	3837027	capsid,tail,protease,tRNA,plate,head,transposase,terminase,holin,portal,integrase	Salmonella_phage(17.39%)	90	2455170:2455186	2471170:2471186
AVZ82794.1|2418605_2419814_-|transposase	IS256-like element ISEic2 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	1.1e-46
AVZ82795.1|2419906_2421289_-	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	38.7	6.3e-11
AVZ84067.1|2421358_2422114_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AVZ82796.1|2422145_2422868_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVZ82797.1|2422885_2423350_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.1	1.4e-47
AVZ82798.1|2423417_2424149_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	1.3e-39
AVZ82799.1|2424474_2425662_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
AVZ82800.1|2426002_2427256_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	52.3	5.6e-99
AVZ82801.1|2428405_2429209_-	inositol-1-monophosphatase	NA	NA	NA	NA	NA
AVZ82802.1|2429436_2430174_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
AVZ82803.1|2430394_2430892_+	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
AVZ82804.1|2430961_2432176_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.4	1.0e-33
AVZ82805.1|2432208_2432595_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	80.6	6.4e-54
AVZ82806.1|2432661_2432985_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	3.2e-22
AVZ82807.1|2433075_2433594_+	co-chaperone protein HscB	NA	NA	NA	NA	NA
AVZ82808.1|2433623_2435474_+	molecular chaperone HscA	NA	A0A167RF67	Powai_lake_megavirus	39.8	1.0e-104
AVZ82809.1|2435482_2435818_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AVZ82810.1|2435819_2436020_+	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AVZ82811.1|2436150_2437452_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	38.7	1.5e-33
AVZ82812.1|2437519_2438386_+	endopeptidase IV	NA	NA	NA	NA	NA
AVZ82813.1|2438698_2439130_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	2.3e-20
AVZ82814.1|2439317_2440553_+|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
AVZ82815.1|2440634_2441387_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
AVZ82816.1|2441376_2442402_+	cytoskeleton protein RodZ	NA	NA	NA	NA	NA
AVZ82817.1|2442427_2443555_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
AVZ82818.1|2443661_2444936_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
AVZ82819.1|2444949_2445570_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ82820.1|2445581_2446760_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
AVZ82821.1|2446894_2448379_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
AVZ82822.1|2448637_2449594_+	AEC family transporter	NA	NA	NA	NA	NA
AVZ82823.1|2449603_2449828_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ82824.1|2450279_2451728_+	ammonia-forming cytochrome c nitrite reductase subunit c552	NA	NA	NA	NA	NA
AVZ82825.1|2451770_2452358_+	cytochrome c nitrite reductase pentaheme subunit	NA	NA	NA	NA	NA
AVZ82826.1|2452354_2453026_+	cytochrome c nitrite reductase Fe-S protein	NA	NA	NA	NA	NA
AVZ82827.1|2453022_2453964_+	cytochrome c nitrite reductase subunit NrfD	NA	NA	NA	NA	NA
AVZ82828.1|2454002_2455697_+	heme lyase NrfEFG subunit NrfE	NA	NA	NA	NA	NA
2455170:2455186	attL	AACGGCGTACTGCTGCC	NA	NA	NA	NA
AVZ82829.1|2455693_2456077_+	heme lyase NrfEFG subunit NrfF	NA	NA	NA	NA	NA
AVZ82830.1|2456073_2456652_+	heme lysase NrfEFG subunit NrfG	NA	NA	NA	NA	NA
AVZ82831.1|2456664_2458047_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	34.4	1.2e-38
AVZ82832.1|2458218_2459685_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.8	4.2e-90
AVZ82833.1|2459769_2461347_+	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
AVZ82834.1|2461572_2462775_+|integrase	site-specific integrase	integrase	T1S9J3	Salmonella_phage	61.5	1.4e-136
AVZ82835.1|2462778_2463033_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	48.4	1.1e-06
AVZ82836.1|2463068_2463875_-	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	50.2	4.0e-66
AVZ82837.1|2463867_2464239_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ82838.1|2464251_2466909_-	bifunctional DNA primase/helicase	NA	A0A077K8T2	Ralstonia_phage	58.5	1.3e-307
AVZ84068.1|2466994_2467225_-	transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	38.6	1.7e-06
AVZ82839.1|2467551_2467893_+	XRE family transcriptional regulator	NA	A0A0S4L3B5	Pseudomonas_phage	29.7	3.9e-07
AVZ82840.1|2467895_2468570_+	hypothetical protein	NA	A0A2H4J954	uncultured_Caudovirales_phage	53.4	1.9e-08
AVZ82841.1|2468560_2469865_+	DUF3644 domain-containing protein	NA	NA	NA	NA	NA
AVZ82842.1|2469867_2470917_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	50.7	5.7e-97
AVZ82843.1|2470913_2471342_-	oxidoreductase	NA	E5G6Q2	Salmonella_phage	58.1	6.0e-37
2471170:2471186	attR	GGCAGCAGTACGCCGTT	NA	NA	NA	NA
AVZ82844.1|2471352_2474202_-|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	33.3	1.9e-118
AVZ84069.1|2474198_2474327_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AVZ82845.1|2474323_2474620_-|tail	phage tail assembly protein	tail	F1BUU0	Erwinia_phage	53.8	3.1e-16
AVZ82846.1|2474629_2475145_-|tail	phage major tail tube protein	tail	Q37845	Escherichia_phage	62.8	1.1e-53
AVZ82847.1|2475159_2476338_-|tail	phage tail protein	tail	A4PE49	Ralstonia_virus	69.1	1.2e-156
AVZ82848.1|2476443_2477202_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	67.9	4.1e-105
AVZ82849.1|2477459_2479262_-	hypothetical protein	NA	A0A0M3ULH6	Salmonella_phage	57.7	7.8e-62
AVZ82850.1|2479258_2479876_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	57.2	2.6e-65
AVZ82851.1|2479868_2480780_-|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	64.8	9.3e-104
AVZ82852.1|2480776_2481127_-	hypothetical protein	NA	A4PE42	Ralstonia_virus	51.8	5.8e-22
AVZ82853.1|2481126_2481726_-|plate	phage baseplate assembly protein V	plate	Q7Y4D8	Escherichia_virus	49.3	3.1e-47
AVZ82854.1|2481904_2482222_+	toxin HigB-2	NA	NA	NA	NA	NA
AVZ82855.1|2482297_2482594_+	transcriptional regulator	NA	NA	NA	NA	NA
AVZ82856.1|2483256_2483715_-|tail	phage tail protein	tail	A0A077K8R3	Ralstonia_phage	50.4	6.9e-31
AVZ82857.1|2483816_2484407_-	DUF3380 domain-containing protein	NA	A0A2H4JGJ9	uncultured_Caudovirales_phage	52.6	4.5e-51
AVZ82858.1|2484384_2484696_-|holin	phage holin family protein	holin	NA	NA	NA	NA
AVZ82859.1|2484692_2485070_-	hypothetical protein	NA	A0A1S5NRL1	Burkholderia_phage	45.8	8.5e-19
AVZ82860.1|2485072_2485276_-|tail	phage tail protein	tail	A0A2H4J946	uncultured_Caudovirales_phage	51.6	2.7e-11
AVZ82861.1|2485385_2485853_-|head	phage head protein	head	E5E3S2	Burkholderia_phage	49.7	6.8e-34
AVZ82862.1|2485938_2486592_-|terminase	terminase	terminase	A0A077K804	Ralstonia_phage	47.8	5.2e-48
AVZ82863.1|2486588_2487608_-|capsid	phage major capsid protein, P2 family	capsid	E5E3W8	Burkholderia_phage	57.4	7.5e-110
AVZ82864.1|2487618_2488446_-|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	58.3	1.7e-64
AVZ82865.1|2488600_2490388_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	63.5	6.7e-223
AVZ82866.1|2490384_2491371_+|portal	phage portal protein	portal	A4PE27	Ralstonia_virus	62.7	2.9e-119
AVZ82867.1|2491408_2491597_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ82868.1|2492933_2493725_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVZ82869.1|2493824_2495015_+	cyanate MFS transporter	NA	NA	NA	NA	NA
AVZ82870.1|2495158_2495863_+	N-acetyltransferase	NA	NA	NA	NA	NA
AVZ82871.1|2497537_2498235_-|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	56.3	8.2e-76
AVZ82872.1|2498597_2499881_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
AVZ82873.1|2500115_2501555_+	H(+)/Cl(-) exchange transporter ClcA	NA	NA	NA	NA	NA
AVZ82874.1|2501646_2501991_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	46.4	1.1e-25
AVZ82875.1|2502068_2502680_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ82876.1|2502957_2503821_-	vitamin B12 ABC transporter substrate-binding protein BtuF	NA	NA	NA	NA	NA
AVZ82877.1|2503824_2504523_-	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
AVZ84070.1|2504687_2506211_+	dGTPase	NA	NA	NA	NA	NA
AVZ82878.1|2506433_2507849_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.4	4.6e-25
AVZ82879.1|2507966_2508644_-	ABC transporter	NA	G9BWD6	Planktothrix_phage	34.5	2.8e-20
>prophage 187
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2519342	2520717	3837027		Escherichia_phage(50.0%)	2	NA	NA
AVZ82888.1|2519342_2519720_-	hypothetical protein	NA	Q9MCT5	Escherichia_phage	50.0	1.6e-12
AVZ82889.1|2519856_2520717_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	27.8	1.2e-12
>prophage 188
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2528288	2530109	3837027		Klosneuvirus(100.0%)	1	NA	NA
AVZ82894.1|2528288_2530109_+	hypothetical protein	NA	A0A1V0SJ29	Klosneuvirus	25.7	1.2e-22
>prophage 189
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2533257	2533740	3837027		Staphylococcus_phage(100.0%)	1	NA	NA
AVZ82896.1|2533257_2533740_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	1.5e-28
>prophage 190
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2538616	2560194	3837027	transposase	Moraxella_phage(28.57%)	12	NA	NA
AVZ82903.1|2538616_2539312_-	uracil-DNA glycosylase	NA	A0A1X9WHI9	Cercopithecine_herpesvirus	48.6	3.3e-53
AVZ82904.1|2539713_2540097_+	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	66.0	4.4e-31
AVZ82905.1|2540704_2540995_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ82906.1|2541300_2543040_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	27.1	1.3e-34
AVZ82907.1|2543104_2554240_+	hypothetical protein	NA	A0A0R6PJK4	Moraxella_phage	38.1	6.8e-47
AVZ82908.1|2554226_2554457_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ84073.1|2554642_2555284_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ82909.1|2555322_2555703_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ82910.1|2555750_2556959_-|transposase	IS256 family transposase ISEic2	transposase	A0A218MNI5	uncultured_virus	44.1	8.1e-47
AVZ82911.1|2556955_2558209_-|transposase	IS256-like element ISEic2 family transposase	transposase	A0A218MNI5	uncultured_virus	45.0	2.2e-42
AVZ82912.1|2558450_2558951_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ82913.1|2559094_2560194_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.9	1.1e-47
>prophage 191
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2563768	2567205	3837027	transposase	Enterobacteria_phage(33.33%)	4	NA	NA
AVZ82917.1|2563768_2564314_+	hypothetical protein	NA	B6ETG5	Enterobacteria_phage	33.0	4.8e-15
AVZ82918.1|2564652_2565455_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	35.1	2.4e-26
AVZ82919.1|2565644_2565803_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ82920.1|2565858_2567205_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	29.3	4.4e-41
>prophage 192
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2573010	2583845	3837027		Tupanvirus(50.0%)	9	NA	NA
AVZ82927.1|2573010_2574804_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	40.5	2.7e-22
AVZ82928.1|2574877_2575852_+	signal peptidase I	NA	NA	NA	NA	NA
AVZ82929.1|2576029_2576710_+	ribonuclease 3	NA	A0A2K9L5P0	Tupanvirus	31.1	4.8e-20
AVZ82930.1|2576706_2577612_+	GTPase Era	NA	NA	NA	NA	NA
AVZ82931.1|2577620_2578349_+	DNA repair protein RecO	NA	NA	NA	NA	NA
AVZ82932.1|2578514_2579246_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AVZ82933.1|2579245_2579626_+	holo-ACP synthase	NA	NA	NA	NA	NA
AVZ82934.1|2579688_2582445_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.8	9.5e-51
AVZ82935.1|2582528_2583845_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.4	2.4e-36
>prophage 193
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2587277	2590297	3837027		Only_Syngen_Nebraska_virus(50.0%)	2	NA	NA
AVZ82938.1|2587277_2588915_+	CTP synthetase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.3	5.5e-155
AVZ82939.1|2588995_2590297_+	enolase	NA	W6LP63	Streptococcus_phage	58.7	2.3e-132
>prophage 194
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2595751	2596438	3837027		Planktothrix_phage(100.0%)	1	NA	NA
AVZ82947.1|2595751_2596438_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.1	7.9e-31
>prophage 195
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2602816	2605444	3837027	tRNA	Niemeyer_virus(50.0%)	3	NA	NA
AVZ82954.1|2602816_2604202_+|tRNA	cysteine--tRNA ligase	tRNA	A0A0U2SJ70	Niemeyer_virus	33.0	6.5e-40
AVZ82955.1|2604265_2604478_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ82956.1|2604586_2605444_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	36.9	1.3e-30
>prophage 196
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2614314	2618386	3837027		Acanthocystis_turfacea_Chlorella_virus(33.33%)	3	NA	NA
AVZ82964.1|2614314_2616195_-	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	29.5	2.5e-66
AVZ82965.1|2616543_2617755_+	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	32.6	1.9e-59
AVZ82966.1|2617756_2618386_+	hypothetical protein	NA	A0A0F7L444	uncultured_marine_virus	46.8	2.6e-52
>prophage 197
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2623852	2625690	3837027		Streptococcus_phage(50.0%)	2	NA	NA
AVZ82971.1|2623852_2625061_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	35.9	5.8e-61
AVZ84075.1|2625147_2625690_+	hypothetical protein	NA	A0A068F3J9	Mycobacterium_phage	43.8	2.9e-28
>prophage 198
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2637913	2640273	3837027		Acanthamoeba_polyphaga_moumouvirus(50.0%)	2	NA	NA
AVZ82979.1|2637913_2638885_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	29.4	8.3e-18
AVZ82980.1|2638956_2640273_-	MFS transporter	NA	O13311	Aichi_virus	23.7	1.4e-07
>prophage 199
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2644410	2653217	3837027		Vibrio_phage(33.33%)	6	NA	NA
AVZ82984.1|2644410_2645934_+	L-carnitine/gamma-butyrobetaine antiporter	NA	A0A2I7QNT1	Vibrio_phage	23.7	2.2e-09
AVZ82985.1|2645966_2647109_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AVZ82986.1|2647214_2648435_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
AVZ82987.1|2648498_2650061_+	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	24.1	3.6e-23
AVZ82988.1|2650146_2650932_+	crotonobetainyl-CoA hydratase	NA	NA	NA	NA	NA
AVZ82989.1|2651663_2653217_+	crotonobetaine/carnitine-CoA ligase	NA	A0A1V0SBX8	Catovirus	25.5	7.8e-18
>prophage 200
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2659831	2662317	3837027		Stx2-converting_phage(50.0%)	2	NA	NA
AVZ83000.1|2659831_2661043_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.7	9.5e-104
AVZ83001.1|2661198_2662317_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	48.7	6.7e-11
>prophage 201
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2668755	2673637	3837027	tRNA	Staphylococcus_phage(50.0%)	3	NA	NA
AVZ83009.1|2668755_2671338_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.5	2.5e-186
AVZ83010.1|2671681_2672164_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
AVZ83011.1|2672911_2673637_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.7	4.4e-32
>prophage 202
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2679385	2680441	3837027		Pseudomonas_phage(100.0%)	1	NA	NA
AVZ83018.1|2679385_2680441_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	47.0	6.4e-48
>prophage 203
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2686245	2687907	3837027		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AVZ83022.1|2686245_2687907_-	asparagine synthase B	NA	H8ZJK1	Ostreococcus_tauri_virus	39.5	2.5e-86
>prophage 204
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2695647	2697315	3837027	tRNA	Escherichia_phage(100.0%)	1	NA	NA
AVZ83027.1|2695647_2697315_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	84.4	1.0e-286
>prophage 205
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2702583	2703792	3837027	transposase	uncultured_virus(100.0%)	1	NA	NA
AVZ83030.1|2702583_2703792_-|transposase	IS256-like element ISEic2 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	1.1e-46
>prophage 206
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2711569	2716997	3837027		Hokovirus(50.0%)	3	NA	NA
AVZ83036.1|2711569_2714278_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.2	1.3e-12
AVZ83037.1|2714287_2714908_-	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
AVZ83038.1|2714930_2716997_-	K(+)-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	24.6	5.9e-29
>prophage 207
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2720487	2721918	3837027		Catovirus(100.0%)	1	NA	NA
AVZ83043.1|2720487_2721918_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	30.9	1.8e-45
>prophage 208
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2729264	2734526	3837027		Kaumoebavirus(50.0%)	6	NA	NA
AVZ83049.1|2729264_2730140_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	24.9	4.4e-10
AVZ83050.1|2730114_2731398_-	citrate synthase	NA	NA	NA	NA	NA
AVZ83051.1|2731432_2731654_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ84082.1|2732028_2732418_+	succinate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
AVZ83052.1|2732411_2732759_+	succinate dehydrogenase membrane anchor subunit	NA	NA	NA	NA	NA
AVZ83053.1|2732759_2734526_+	succinate dehydrogenase flavoprotein subunit	NA	M1HTN0	Paramecium_bursaria_Chlorella_virus	26.2	5.8e-17
>prophage 209
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2752571	2755363	3837027	transposase	uncultured_virus(50.0%)	2	NA	NA
AVZ83070.1|2752571_2753780_-|transposase	IS256-like element ISEic2 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	1.1e-46
AVZ83071.1|2754298_2755363_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	48.0	5.8e-81
>prophage 210
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2761269	2762286	3837027		Tupanvirus(100.0%)	1	NA	NA
AVZ83076.1|2761269_2762286_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	46.2	1.8e-79
>prophage 211
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2767116	2772264	3837027		Planktothrix_phage(50.0%)	4	NA	NA
AVZ83082.1|2767116_2768175_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	32.7	5.3e-18
AVZ83083.1|2768223_2769045_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
AVZ83084.1|2769117_2770872_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
AVZ83085.1|2770974_2772264_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.8	5.1e-15
>prophage 212
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2785183	2785936	3837027		Escherichia_phage(100.0%)	1	NA	NA
AVZ83095.1|2785183_2785936_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.7	1.4e-20
>prophage 213
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2801531	2806481	3837027		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
AVZ83111.1|2801531_2803196_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	57.1	3.8e-10
AVZ83112.1|2803406_2804309_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVZ83113.1|2804885_2806481_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.4	4.2e-59
>prophage 214
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2819963	2866822	3837027	plate,transposase	uncultured_virus(33.33%)	41	NA	NA
AVZ83126.1|2819963_2821172_-|transposase	IS256 family transposase ISEic2	transposase	A0A218MNI5	uncultured_virus	44.1	8.1e-47
AVZ83127.1|2821230_2821674_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ83128.1|2821936_2822335_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ83129.1|2823168_2824833_-	FUSC family protein	NA	NA	NA	NA	NA
AVZ83130.1|2824841_2825831_-	HlyD family secretion protein	NA	NA	NA	NA	NA
AVZ83131.1|2825842_2826052_-	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
AVZ83132.1|2827648_2828272_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	22.6	2.3e-05
AVZ83133.1|2828268_2828928_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
AVZ83134.1|2829103_2829856_+	heme ABC transporter permease	NA	NA	NA	NA	NA
AVZ83135.1|2829852_2830086_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
AVZ84086.1|2830085_2830610_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
AVZ83136.1|2830606_2832574_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
AVZ83137.1|2832570_2833125_+	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AVZ83138.1|2833121_2833625_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
AVZ83139.1|2833621_2834836_+	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
AVZ83140.1|2834906_2835674_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AVZ83141.1|2835966_2837283_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
AVZ83142.1|2837679_2837976_+	DUF406 family protein	NA	NA	NA	NA	NA
AVZ83143.1|2838358_2838835_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
AVZ83144.1|2838885_2839431_-	endonuclease SmrB	NA	NA	NA	NA	NA
AVZ83145.1|2839641_2840574_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AVZ83146.1|2840660_2841746_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.8	2.9e-88
AVZ83147.1|2841759_2842584_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AVZ83148.1|2843204_2846987_-	type VI secretion system protein ImpL	NA	NA	NA	NA	NA
AVZ83149.1|2846983_2847634_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AVZ83150.1|2847630_2849019_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AVZ83151.1|2849115_2849745_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AVZ83152.1|2849731_2850802_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AVZ83153.1|2850815_2851118_-	type VI secretion protein	NA	NA	NA	NA	NA
AVZ83154.1|2851212_2853198_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.8	1.9e-48
AVZ84087.1|2853188_2855810_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	32.4	6.6e-86
AVZ83155.1|2855929_2856955_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AVZ83156.1|2856951_2858793_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AVZ83157.1|2858796_2859273_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AVZ83158.1|2859281_2860493_-	type VI secretion protein	NA	NA	NA	NA	NA
AVZ83159.1|2860622_2861114_-	Hcp1 family type VI secretion system effector	NA	NA	NA	NA	NA
AVZ83160.1|2861183_2862671_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AVZ83161.1|2862670_2863183_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AVZ83162.1|2863432_2863735_-	type VI secretion protein	NA	NA	NA	NA	NA
AVZ83163.1|2863905_2864707_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AVZ83164.1|2865613_2866822_+|transposase	IS256-like element ISEic2 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	1.1e-46
>prophage 215
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2879487	2880615	3837027		Brazilian_cedratvirus(100.0%)	1	NA	NA
AVZ83175.1|2879487_2880615_+	erythronate-4-phosphate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	30.0	1.6e-20
>prophage 216
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2887304	2888822	3837027		Mollivirus(100.0%)	1	NA	NA
AVZ83182.1|2887304_2888822_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.6	5.7e-90
>prophage 217
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2936983	2937520	3837027		Escherichia_phage(100.0%)	1	NA	NA
AVZ83221.1|2936983_2937520_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	61.1	7.3e-32
>prophage 218
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2959766	2960675	3837027		Streptococcus_phage(100.0%)	1	NA	NA
AVZ83240.1|2959766_2960675_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	27.9	7.8e-26
>prophage 219
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2965567	2987183	3837027		Pseudomonas_phage(25.0%)	14	NA	NA
AVZ84092.1|2965567_2965891_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	53.1	5.2e-17
AVZ83247.1|2965890_2967021_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	77.5	8.4e-171
AVZ83248.1|2967114_2969397_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	64.1	1.4e-286
AVZ83249.1|2969775_2970483_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
AVZ83250.1|2970725_2973362_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	A0A172JHV7	Bacillus_phage	31.1	7.6e-106
AVZ84093.1|2973564_2976435_+	two-component system sensor histidine kinase RcsC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	27.6	2.7e-32
AVZ83251.1|2976466_2977120_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
AVZ83252.1|2977112_2979815_-	phosphotransferase RcsD	NA	B5LWA6	Feldmannia_species_virus	25.6	8.3e-07
AVZ83253.1|2979902_2981015_-	ABC transporter permease	NA	NA	NA	NA	NA
AVZ83254.1|2981028_2982168_-	ABC transporter permease	NA	NA	NA	NA	NA
AVZ83255.1|2982160_2983897_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.9	6.9e-23
AVZ83256.1|2983908_2984898_-	secretion protein HlyD	NA	NA	NA	NA	NA
AVZ83257.1|2984894_2985614_-	transcriptional regulator	NA	NA	NA	NA	NA
AVZ83258.1|2985860_2987183_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	32.0	6.6e-50
>prophage 220
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	2991352	2998113	3837027		Vibrio_phage(66.67%)	6	NA	NA
AVZ83263.1|2991352_2992261_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	31.3	8.1e-15
AVZ83264.1|2992639_2994388_-	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
AVZ83265.1|2994428_2994656_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ83266.1|2994826_2995831_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.2	3.0e-87
AVZ83267.1|2995929_2996214_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
AVZ83268.1|2996352_2998113_-	ATP-dependent helicase	NA	M4Q3N1	Vibrio_phage	41.6	3.4e-94
>prophage 221
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3003728	3004451	3837027		Planktothrix_phage(100.0%)	1	NA	NA
AVZ83274.1|3003728_3004451_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	43.4	4.6e-37
>prophage 222
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3012514	3013111	3837027		Clostridioides_phage(100.0%)	1	NA	NA
AVZ83282.1|3012514_3013111_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	39.8	1.0e-13
>prophage 223
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3018128	3021254	3837027		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AVZ83286.1|3018128_3019715_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.9	4.4e-08
AVZ83287.1|3019781_3021254_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.3	2.7e-44
>prophage 224
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3026827	3031401	3837027		Escherichia_phage(50.0%)	3	NA	NA
AVZ83293.1|3026827_3029320_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	31.0	1.7e-83
AVZ83294.1|3029319_3030489_-	cytochrome C	NA	NA	NA	NA	NA
AVZ83295.1|3030768_3031401_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	30.8	2.1e-14
>prophage 225
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3036959	3037859	3837027		Cellulophaga_phage(100.0%)	1	NA	NA
AVZ83302.1|3036959_3037859_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	84.2	6.5e-09
>prophage 226
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3049703	3050903	3837027		Stx2-converting_phage(100.0%)	1	NA	NA
AVZ83309.1|3049703_3050903_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	46.7	2.0e-98
>prophage 227
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3056517	3057468	3837027		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AVZ83314.1|3056517_3057468_-	bifunctional glyoxylate/hydroxypyruvate reductase B	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	26.0	1.1e-14
>prophage 228
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3065073	3065346	3837027		Vibrio_phage(100.0%)	1	NA	NA
AVZ83319.1|3065073_3065346_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	71.8	2.3e-26
>prophage 229
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3069119	3069608	3837027		Streptococcus_phage(100.0%)	1	NA	NA
AVZ83324.1|3069119_3069608_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	43.7	2.9e-27
>prophage 230
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3072905	3073634	3837027		Planktothrix_phage(100.0%)	1	NA	NA
AVZ84097.1|3072905_3073634_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	38.1	3.2e-30
>prophage 231
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3079905	3080739	3837027		Agrobacterium_phage(100.0%)	1	NA	NA
AVZ83333.1|3079905_3080739_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A223VZK2	Agrobacterium_phage	33.7	1.1e-13
>prophage 232
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3088197	3095985	3837027		Liberibacter_phage(66.67%)	4	NA	NA
AVZ83340.1|3088197_3090606_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	27.4	2.5e-23
AVZ84098.1|3090637_3091930_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AVZ83341.1|3091932_3092937_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	29.3	7.6e-06
AVZ83342.1|3092952_3095985_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	25.0	2.4e-23
>prophage 233
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3103877	3128353	3837027	protease,tRNA	Escherichia_phage(30.77%)	17	NA	NA
AVZ83349.1|3103877_3104099_-	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	58.2	3.0e-16
AVZ83350.1|3104544_3104865_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	46.5	3.1e-14
AVZ83351.1|3104889_3107184_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	7.9e-168
AVZ83352.1|3107337_3107556_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AVZ83353.1|3107746_3108475_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AVZ83354.1|3108504_3110232_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.0	4.6e-19
AVZ83355.1|3110234_3112034_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	24.4	1.2e-22
AVZ83356.1|3112256_3113228_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.5	9.4e-62
AVZ83357.1|3113949_3114444_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
AVZ83358.1|3114597_3118416_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.8	5.0e-90
AVZ83359.1|3118554_3119169_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AVZ83360.1|3119185_3120529_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	39.8	8.4e-77
AVZ83361.1|3120649_3121942_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.8	5.8e-91
AVZ83362.1|3123744_3126192_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	2.8e-219
AVZ83363.1|3126202_3126820_+	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	61.6	7.8e-78
AVZ83364.1|3126821_3127682_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	32.7	1.9e-21
AVZ83365.1|3127738_3128353_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	38.7	3.6e-27
>prophage 234
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3133821	3137106	3837027		Tetraselmis_virus(100.0%)	2	NA	NA
AVZ83374.1|3133821_3134562_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.6	8.6e-23
AVZ83375.1|3134823_3137106_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	7.9e-160
>prophage 235
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3141668	3142760	3837027		Streptococcus_phage(100.0%)	1	NA	NA
AVZ83379.1|3141668_3142760_+	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	42.9	3.4e-76
>prophage 236
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3148097	3154180	3837027		Geobacillus_virus(25.0%)	5	NA	NA
AVZ83383.1|3148097_3148382_+	integration host factor subunit beta	NA	A0A0H3UZA0	Geobacillus_virus	37.5	7.1e-10
AVZ83384.1|3148606_3150871_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332B9	Clostridium_botulinum_C_phage	23.1	3.0e-10
AVZ83385.1|3150907_3152662_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.3	1.1e-57
AVZ83386.1|3152658_3153654_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AVZ83387.1|3153970_3154180_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	69.2	4.7e-19
>prophage 237
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3157246	3158653	3837027		Enterobacteria_phage(100.0%)	1	NA	NA
AVZ83392.1|3157246_3158653_+	purine permease	NA	Q9KX94	Enterobacteria_phage	28.2	3.5e-25
>prophage 238
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3170969	3171518	3837027		Rhodobacter_phage(100.0%)	1	NA	NA
AVZ83401.1|3170969_3171518_+	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	32.6	7.0e-06
>prophage 239
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3195970	3205513	3837027		Planktothrix_phage(50.0%)	9	NA	NA
AVZ83427.1|3195970_3196747_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G9BWD6	Planktothrix_phage	41.6	3.3e-33
AVZ83428.1|3197013_3197211_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ83429.1|3197483_3197693_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ83430.1|3197954_3198116_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ84099.1|3198393_3198513_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ83431.1|3198517_3198616_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ84100.1|3198807_3198870_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ83432.1|3199047_3199188_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ83433.1|3199471_3205513_+	hypothetical protein	NA	A0A2K9KZV5	Tupanvirus	26.3	4.0e-134
>prophage 240
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3210527	3211226	3837027		Planktothrix_phage(100.0%)	1	NA	NA
AVZ83438.1|3210527_3211226_-	iron ABC transporter ATP-binding protein FetA	NA	G9BWD6	Planktothrix_phage	31.3	5.1e-17
>prophage 241
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3222620	3223746	3837027		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
AVZ83451.1|3222620_3223355_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.6	3.2e-14
AVZ83452.1|3223509_3223746_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.6	6.5e-09
>prophage 242
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3227011	3236882	3837027	transposase	Pseudomonas_phage(20.0%)	7	NA	NA
AVZ83456.1|3227011_3227653_+	thymidylate kinase	NA	Q2Z0N0	Pseudomonas_phage	37.1	7.9e-25
AVZ83457.1|3227649_3228636_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	43.8	3.7e-05
AVZ83458.1|3228665_3229454_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AVZ83459.1|3229760_3231194_+	PTS glucose transporter subunit IIBC	NA	NA	NA	NA	NA
AVZ83460.1|3231620_3232317_+|transposase	IS1-like element ISEic1 family transposase	transposase	A0A077SLN4	Escherichia_phage	56.7	3.3e-77
AVZ83461.1|3233437_3234188_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	36.2	5.4e-25
AVZ83462.1|3234512_3236882_+	hypothetical protein	NA	Q9MBL9	Phage_Gifsy-2	52.1	3.8e-32
>prophage 243
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3241024	3246510	3837027		Enterobacterial_phage(50.0%)	2	NA	NA
AVZ84101.1|3241024_3245836_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	35.6	4.6e-93
AVZ83463.1|3245919_3246510_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	3.8e-42
>prophage 244
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3252402	3255304	3837027		Faustovirus(50.0%)	4	NA	NA
AVZ83472.1|3252402_3253860_-	PLP-dependent aminotransferase family protein	NA	A0A1X7BZP2	Faustovirus	27.5	1.5e-07
AVZ83473.1|3253991_3254108_-	DUF2770 domain-containing protein	NA	NA	NA	NA	NA
AVZ83474.1|3254671_3254926_-	transcriptional regulator	NA	NA	NA	NA	NA
AVZ83475.1|3255055_3255304_-	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	50.0	1.0e-17
>prophage 245
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3264467	3268268	3837027		Planktothrix_phage(50.0%)	4	NA	NA
AVZ83481.1|3264467_3265187_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.2	2.3e-33
AVZ83482.1|3265186_3266434_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
AVZ84102.1|3266445_3267402_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AVZ83483.1|3267401_3268268_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	33.7	1.1e-18
>prophage 246
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3272089	3361967	3837027	capsid,tail,tRNA,head,transposase,terminase,holin,portal,integrase	Cronobacter_phage(19.35%)	98	3301107:3301166	3358771:3360086
AVZ83487.1|3272089_3273139_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	25.5	3.5e-06
AVZ83488.1|3273190_3273949_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AVZ83489.1|3274125_3275496_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	8.8e-106
AVZ83490.1|3275524_3276151_-	lysogenization protein HflD	NA	NA	NA	NA	NA
AVZ83491.1|3276313_3277369_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AVZ83492.1|3277528_3278632_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AVZ84103.1|3278716_3279163_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AVZ83493.1|3279200_3279842_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AVZ83494.1|3280073_3281327_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.8e-20
AVZ83495.1|3281494_3282628_-|integrase	integrase	integrase	Q77Z04	Phage_21	72.5	1.9e-151
AVZ84104.1|3282566_3282854_-	excisionase	NA	NA	NA	NA	NA
AVZ83496.1|3283354_3283825_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ83497.1|3283854_3284208_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ83498.1|3286075_3287284_+|transposase	IS256 family transposase ISEic2	transposase	A0A218MNI5	uncultured_virus	44.1	8.1e-47
AVZ83499.1|3287480_3288845_-	ATP-binding protein	NA	NA	NA	NA	NA
AVZ83500.1|3289723_3290542_-	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
AVZ83501.1|3290538_3291174_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ83502.1|3291406_3292078_-	LexA family transcriptional repressor	NA	A0A077KGZ5	Edwardsiella_phage	74.3	2.6e-71
AVZ83503.1|3292179_3292410_+	Cro/Cl family transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	65.3	1.2e-20
AVZ83504.1|3292454_3292997_+	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	68.4	3.9e-65
AVZ83505.1|3293190_3293370_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AVZ83506.1|3293455_3293824_-	transcriptional regulator	NA	NA	NA	NA	NA
AVZ84105.1|3293828_3294113_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ83507.1|3294161_3295010_+	peptidase	NA	K7PLX4	Enterobacteria_phage	55.5	4.2e-74
AVZ83508.1|3295002_3296001_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	55.9	2.5e-73
AVZ83509.1|3295997_3296732_+	DNA replication protein	NA	A0A1P8DTF3	Proteus_phage	38.2	2.0e-32
AVZ83510.1|3296728_3296977_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AVZ83511.1|3296966_3297356_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	60.4	2.5e-34
AVZ83512.1|3297372_3297744_+	antitermination protein Q	NA	K7PGW2	Enterobacterial_phage	86.7	9.4e-55
AVZ83513.1|3298557_3298773_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ83514.1|3298848_3299196_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	53.3	4.6e-27
AVZ83515.1|3299198_3299750_+	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	70.8	8.2e-71
AVZ83516.1|3299823_3300093_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ83517.1|3300589_3301150_+	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	64.9	1.6e-58
3301107:3301166	attL	GACCCTGTACACGATTCTGTGTAAATGCCTTTTCTCAGAAGTGACCGTCCAGACGATCAC	NA	NA	NA	NA
AVZ83518.1|3301140_3302349_-|transposase	IS256-like element ISEic2 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	1.1e-46
AVZ83519.1|3302409_3303603_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ83520.1|3303617_3303821_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ83521.1|3304046_3305501_+	hypothetical protein	NA	A0A1I9KF34	Aeromonas_phage	80.3	1.4e-226
AVZ83522.1|3305500_3306004_+	hypothetical protein	NA	A0A1I9KF63	Aeromonas_phage	79.4	6.8e-72
AVZ83523.1|3306066_3306654_+|tail	phage tail assembly protein	tail	A0A1I9KFV2	Aeromonas_phage	59.4	1.1e-60
AVZ83524.1|3306768_3309567_+|tail	phage tail tape measure protein	tail	A0A1I9KF40	Aeromonas_phage	72.9	2.2e-289
AVZ83525.1|3309566_3310040_+	hypothetical protein	NA	A0A1I9KF41	Aeromonas_phage	76.4	3.0e-69
AVZ83526.1|3310036_3310243_+|tail	phage tail protein	tail	A0A1I9KG34	Aeromonas_phage	88.2	1.5e-30
AVZ84106.1|3310290_3311250_+|tail	phage tail protein	tail	A0A1I9KF94	Aeromonas_phage	84.9	4.8e-159
AVZ83527.1|3312505_3313714_-|transposase	IS256-like element ISEic2 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	1.1e-46
AVZ83528.1|3313739_3313970_+	hypothetical protein	NA	Q8H9L9	Vibrio_phage	70.4	6.5e-14
AVZ83529.1|3314233_3314812_+	AntA/AntB antirepressor	NA	A0A0N6WET9	Escherichia_phage	57.6	1.2e-43
AVZ83530.1|3314984_3315161_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	3.2e-21
AVZ83531.1|3316341_3316566_-	DUF2594 domain-containing protein	NA	NA	NA	NA	NA
AVZ83532.1|3317131_3317788_+	two-component system response regulator UvrY	NA	NA	NA	NA	NA
AVZ83533.1|3317780_3319613_+	UvrABC system protein C	NA	NA	NA	NA	NA
AVZ83534.1|3319668_3320217_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
AVZ83535.1|3320959_3321112_-	Hok/Gef family protein	NA	NA	NA	NA	NA
AVZ83536.1|3321900_3323649_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	48.4	1.5e-102
AVZ83537.1|3323645_3324230_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	49.3	9.1e-28
AVZ83538.1|3324201_3324924_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	30.0	3.3e-27
AVZ83539.1|3324929_3325550_-|tail	phage tail protein	tail	Q9MCR5	Enterobacteria_phage	39.9	5.8e-33
AVZ83540.1|3325549_3327448_-	hypothetical protein	NA	F1BUK3	Cronobacter_phage	46.9	9.7e-71
AVZ83541.1|3328010_3329195_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	61.3	1.3e-137
AVZ83542.1|3329187_3329541_-	DUF2590 domain-containing protein	NA	F1BUK8	Cronobacter_phage	62.9	1.3e-24
AVZ83543.1|3329530_3331726_-|tail	phage tail tape measure protein	tail	Q94MY4	Haemophilus_virus	39.0	1.7e-106
AVZ83544.1|3331914_3332202_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	43.2	8.2e-14
AVZ83545.1|3332232_3332784_-	hypothetical protein	NA	A0A0U2I1S0	Escherichia_phage	67.4	4.2e-67
AVZ83546.1|3332800_3333091_-|holin	holin	holin	C7BGD7	Burkholderia_phage	43.3	1.8e-13
AVZ83547.1|3333094_3333550_-	DUF2597 domain-containing protein	NA	A5X9I1	Aeromonas_virus	55.6	2.7e-43
AVZ83548.1|3333546_3334701_-	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	49.6	7.9e-100
AVZ83549.1|3334705_3335440_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	44.8	1.8e-41
AVZ83550.1|3335426_3335906_-	hypothetical protein	NA	F1BUL7	Cronobacter_phage	32.5	7.5e-20
AVZ83551.1|3335915_3336398_-|head	head protein	head	F1BUL8	Cronobacter_phage	42.8	1.2e-28
AVZ83552.1|3336503_3337205_-|terminase	terminase	terminase	A5X9H6	Aeromonas_virus	47.9	8.3e-52
AVZ83553.1|3337161_3338247_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	56.9	1.0e-93
AVZ83554.1|3338261_3339161_-|capsid	capsid scaffolding protein	capsid	R9TRS3	Vibrio_phage	36.4	1.5e-42
AVZ83555.1|3339348_3341154_+|terminase	terminase	terminase	A5X9H3	Aeromonas_virus	55.5	4.4e-190
AVZ84107.1|3341185_3342184_+|portal	phage portal protein	portal	Q94MZ7	Haemophilus_virus	52.8	1.6e-85
AVZ83556.1|3342248_3342512_+	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	46.5	8.3e-13
AVZ83557.1|3342859_3343969_+	cobyrinic acid a,c-diamide synthase	NA	Q7M293	Enterobacteria_phage	31.8	1.6e-25
AVZ83558.1|3343971_3344628_+	(p)ppGpp synthetase	NA	NA	NA	NA	NA
AVZ83559.1|3344966_3347573_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	57.7	1.1e-221
AVZ83560.1|3347576_3348035_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ84108.1|3348027_3348612_-	hypothetical protein	NA	K7PLX4	Enterobacteria_phage	52.3	6.8e-15
AVZ83561.1|3348724_3349030_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ83562.1|3349026_3349563_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ83563.1|3349953_3350136_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ83564.1|3350372_3350654_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ83565.1|3350672_3350984_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ83566.1|3351028_3351238_-	DNA-binding protein	NA	U3PFJ1	Vibrio_phage	46.4	4.1e-07
AVZ83567.1|3351250_3351442_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ83568.1|3351526_3351916_+	transcriptional regulator	NA	A0A2H4JFL3	uncultured_Caudovirales_phage	51.6	3.1e-16
AVZ83569.1|3351956_3352313_-	type II toxin-antitoxin system RnlB family antitoxin	NA	NA	NA	NA	NA
AVZ83570.1|3352782_3353376_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ83571.1|3353413_3354451_+|integrase	integrase	integrase	P79671	Haemophilus_phage	54.6	3.3e-97
AVZ83572.1|3354705_3355716_-|integrase	integrase	integrase	K7PLZ2	Enterobacterial_phage	60.1	1.3e-117
AVZ83573.1|3355715_3355982_-	DUF4224 domain-containing protein	NA	K7PHA0	Enterobacterial_phage	53.2	3.3e-09
AVZ83574.1|3355978_3357373_-	ATP-dependent helicase	NA	Q3LZN8	Bacteriophage	73.6	2.7e-211
AVZ83575.1|3357440_3358466_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AVZ83576.1|3358804_3360013_-|transposase	IS256-like element ISEic2 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	1.1e-46
AVZ83577.1|3360071_3361171_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	39.2	1.5e-44
3358771:3360086	attR	GACCCTGTACACGATTCTGTGTAAATGCCTTTTCTCAGAAGTGACCGTCCAGACGATCACCGAACTCGATAATAAAGCGGCTCATTGCCATACGCCAGTCCCTCAGCGGCATGGTCCATTTCTGTGATGCCGCCTGGATCGCTAACCACACCACCTTTTTCACTGCTTCGTCCGTCGGGAACACCTTACGCTTTTTGATGGCATGCCGGATCACGCTGTTCAGCGACTCGATAGCATTCGTTGTGTAGATCACCTTGCGGATGTCTGCCGGGTAAGCGAAGAACGTCGCCAGGTTAGCCCAGTTTGTCTGCCAGCTACGGCTTATCTGCGGGTAGCGGTTGTCCCATGCGCTGGCGAACGCTTCCAGCGCCTGCTGCCCTGCGTCTTCCGTGGGGGCCTGATAAATGGCTTTCAGGTCGCGGGTGACGGCTTTGTAGTCCTTCCAGGAGACGAACCGCAGGCTGTTACGCACCATATGCACGATGCACAGCTGGATGCGGGCTTCCGGATACACCGTATTGATCGCGTCCGGGAAGCCTTTCAGACCATCGACACAGGCGATGAGGATATCGTTCAGGCCGCGATTCTTCAGCTCTGTCAGCACATTGAGCCAGAACTTCGCGCCTTCGTTTTCGGCCAGCCACATACCCAGCAGTTCTTTCTGGCCTTCGAGGTTGATACCCAGGGCAAGGAACACGGATTTATTAATGACGCGACTGTCCTGCCGGACCTTCAGGACGATACAGTCAAGGTAAACAATGGGATAGACTGCATCCAGTGGACGATTCTGCCATTCGGTAACCTGCTCCATTACGGCGTCGGTGACCTTCGAGACCAGCGCCGGTGAGACATCAGCGTCATACAGCTCTTTGAACGCGGCCGCTATCTCGCGGGTGGTCATCCCTTTGGCGTACAACGATAAAATCTGGTTATCCATACCGGTGATCCGGGTCTGGTTTTTCTTCACCAGTTGCGGTTCGAAAGAGCCATCACGATCACGCGGCGTGCGTAGTTCCAGAGGGCCATCACCGGTGGTAACGGTCTTTGTGGAATAGCCATTGCGGGAGTTGGCACCCGGTTTAGGCTGATTTTTATCGTAGCCCAGATGGTGGGACATTTCGGCGTTGAGAGCCGCCTCAACGCTGATTTTCTTCAGCAGGCGATCGAACTGACTGAGATCGTCAGGGGTTTTGAGATTTTTGGCCAGTTCGTTAGCCAGAGCCTGCAACTGTTTTTCGTTCATAAAGTAACCTGCTTTTGATGTTGGATTGAACATATCAAAATCAGGCAATTACACAAATTTATGTACAGGCTCG	NA	NA	NA	NA
AVZ83578.1|3361164_3361967_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	35.5	1.6e-27
>prophage 247
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3369874	3438393	3837027	transposase	uncultured_virus(33.33%)	57	NA	NA
AVZ84109.1|3369874_3370726_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	30.8	1.5e-10
AVZ83586.1|3371001_3371259_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ83587.1|3371468_3372166_-|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	55.8	6.3e-76
AVZ83588.1|3372198_3372591_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	56.7	7.4e-34
AVZ83589.1|3374578_3375763_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
AVZ83590.1|3375792_3377115_-	TIGR00366 family protein	NA	NA	NA	NA	NA
AVZ83591.1|3377111_3377762_-	CoA transferase subunit B	NA	NA	NA	NA	NA
AVZ83592.1|3377761_3378424_-	acetate CoA-transferase subunit alpha	NA	NA	NA	NA	NA
AVZ83593.1|3378656_3380033_-	two-component system response regulator	NA	NA	NA	NA	NA
AVZ83594.1|3380029_3381856_-	two-component system sensor histidine kinase AtoS	NA	NA	NA	NA	NA
AVZ83595.1|3381930_3382692_-	peptide transporter	NA	NA	NA	NA	NA
AVZ83596.1|3383102_3383904_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AVZ84110.1|3384746_3385613_-	GHMP kinase	NA	NA	NA	NA	NA
AVZ83597.1|3386179_3387559_+	cobyrinate a,c-diamide synthase	NA	NA	NA	NA	NA
AVZ83598.1|3387555_3388515_+	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
AVZ83599.1|3388527_3389160_+	cobalt-precorrin-8 methylmutase	NA	NA	NA	NA	NA
AVZ83600.1|3389156_3390296_+	cobalt-precorrin-5B (C(1))-methyltransferase	NA	NA	NA	NA	NA
AVZ83601.1|3390289_3390895_+	cobalt-precorrin-7 (C(5))-methyltransferase	NA	NA	NA	NA	NA
AVZ83602.1|3390884_3391454_+	decarboxylating cobalt-precorrin-6B (C(15))-methyltransferase	NA	NA	NA	NA	NA
AVZ83603.1|3391446_3392220_+	cobalt-precorrin-4 methyltransferase	NA	NA	NA	NA	NA
AVZ83604.1|3392200_3393262_+	cobalt-precorrin 5A hydrolase	NA	NA	NA	NA	NA
AVZ83605.1|3393255_3393981_+	precorrin-3B C(17)-methyltransferase	NA	NA	NA	NA	NA
AVZ83606.1|3393977_3394763_+	cobalt-precorrin-6A reductase	NA	NA	NA	NA	NA
AVZ83607.1|3394773_3395568_+	sirohydrochlorin cobaltochelatase	NA	NA	NA	NA	NA
AVZ83608.1|3395564_3396278_+	cobalt-factor II C(20)-methyltransferase	NA	NA	NA	NA	NA
AVZ83609.1|3396537_3398067_+	cobyric acid synthase	NA	NA	NA	NA	NA
AVZ83610.1|3398063_3398609_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
AVZ83611.1|3398868_3399273_-	inhibitor of g-type lysozyme	NA	NA	NA	NA	NA
AVZ83612.1|3399274_3399580_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ83613.1|3399678_3399984_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ83614.1|3400325_3401627_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ83615.1|3401805_3403755_-	PAS domain-containing protein	NA	NA	NA	NA	NA
AVZ83616.1|3403842_3405018_-	3-methylitaconate isomerase	NA	NA	NA	NA	NA
AVZ83617.1|3405007_3405511_-	3-isopropylmalate dehydratase	NA	NA	NA	NA	NA
AVZ83618.1|3405519_3406785_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
AVZ84111.1|3406833_3407760_-	hydroxymethylglutaryl-CoA lyase	NA	NA	NA	NA	NA
AVZ83619.1|3407800_3408994_-	CoA transferase	NA	NA	NA	NA	NA
AVZ83620.1|3409212_3409668_-	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
AVZ83621.1|3410353_3410479_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
AVZ83622.1|3410653_3411538_-	transcriptional regulator	NA	NA	NA	NA	NA
AVZ83623.1|3411600_3412020_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ83624.1|3412539_3413301_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ83625.1|3413630_3414074_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVZ83626.1|3414462_3414726_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ83627.1|3415129_3416338_+|transposase	IS256-like element ISEic2 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	1.1e-46
AVZ83628.1|3418395_3422295_+	hypothetical protein	NA	A7RB24	Paramecium_bursaria_Chlorella_virus	33.9	2.0e-86
AVZ84112.1|3422438_3424574_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	28.3	1.5e-43
AVZ83629.1|3424545_3426021_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
AVZ83630.1|3425984_3426323_-	adhesin	NA	A0A2L1IV32	Escherichia_phage	55.8	3.5e-16
AVZ83631.1|3427913_3429083_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
AVZ83632.1|3429581_3430946_+	adenylosuccinate lyase	NA	NA	NA	NA	NA
AVZ84113.1|3431058_3432459_+	MmgE/PrpD family protein	NA	NA	NA	NA	NA
AVZ84114.1|3432504_3433386_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
AVZ84115.1|3433382_3434303_-	transcriptional regulator LrhA	NA	NA	NA	NA	NA
AVZ83633.1|3435041_3436250_-|transposase	IS256 family transposase ISEic2	transposase	A0A218MNI5	uncultured_virus	44.1	8.1e-47
AVZ83634.1|3436813_3437005_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ83635.1|3437184_3438393_+|transposase	IS256-like element ISEic2 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	1.4e-46
>prophage 248
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3441932	3450795	3837027	transposase	uncultured_virus(33.33%)	6	NA	NA
AVZ83637.1|3441932_3443141_-|transposase	IS256 family transposase ISEic2	transposase	A0A218MNI5	uncultured_virus	44.1	8.1e-47
AVZ83638.1|3443523_3445029_+	methylmalonate-semialdehyde dehydrogenase (CoA acylating)	NA	NA	NA	NA	NA
AVZ83639.1|3445040_3446966_+	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	E5EQ70	Micromonas_sp._RCC1109_virus	23.3	1.1e-26
AVZ83640.1|3447241_3448228_+	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
AVZ83641.1|3448266_3449196_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVZ83642.1|3449247_3450795_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.2	1.6e-07
>prophage 249
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3469198	3471362	3837027		Bacillus_phage(100.0%)	2	NA	NA
AVZ83653.1|3469198_3470689_-	Cu(+)/Ag(+) sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.4	2.9e-22
AVZ83654.1|3470678_3471362_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	27.6	5.9e-18
>prophage 250
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3478463	3479678	3837027		Salmonella_phage(100.0%)	1	NA	NA
AVZ83658.1|3478463_3479678_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	24.4	2.7e-13
>prophage 251
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3482946	3486180	3837027		Enterobacteria_phage(50.0%)	4	NA	NA
AVZ83662.1|3482946_3483972_-	PurR family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	30.8	4.5e-30
AVZ83663.1|3484325_3484415_+	YnhF family membrane protein	NA	NA	NA	NA	NA
AVZ83664.1|3484480_3485059_-	superoxide dismutase [Fe]	NA	NA	NA	NA	NA
AVZ83665.1|3485325_3486180_-	peptidoglycan endopeptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	6.6e-19
>prophage 252
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3494487	3495762	3837027	tRNA	Pectobacterium_phage(100.0%)	1	NA	NA
AVZ83675.1|3494487_3495762_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	42.5	1.1e-83
>prophage 253
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3520130	3521072	3837027		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVZ83696.1|3520130_3521072_+	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	40.5	7.1e-06
>prophage 254
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3525728	3646897	3837027	capsid,protease,bacteriocin,terminase,transposase,holin,portal,integrase	Shigella_phage(20.51%)	103	3536588:3536647	3590461:3591775
AVZ83699.1|3525728_3526937_+|transposase	IS256-like element ISEic2 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	1.1e-46
AVZ84119.1|3527674_3527797_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ83700.1|3528721_3529024_+	urease subunit gamma	NA	NA	NA	NA	NA
AVZ83701.1|3529070_3529493_+	urease subunit beta	NA	NA	NA	NA	NA
AVZ83702.1|3531312_3531990_+	urease accessory protein UreE	NA	NA	NA	NA	NA
AVZ84120.1|3532007_3532694_+	urease accessory protein UreF	NA	NA	NA	NA	NA
AVZ83703.1|3532708_3533338_+	urease accessory protein UreG	NA	NA	NA	NA	NA
AVZ84121.1|3533443_3534307_+	urease accessory protein	NA	NA	NA	NA	NA
AVZ83704.1|3534417_3535395_+	urea transporter	NA	NA	NA	NA	NA
AVZ83705.1|3535720_3536413_+	ammonium transporter	NA	NA	NA	NA	NA
3536588:3536647	attL	GACCCTGTACACGATTCTGTGTAAATGCCTTTTCTCAGAAGTGACCGTCCAGACGATCAC	NA	NA	NA	NA
AVZ83706.1|3536621_3537830_-|transposase	IS256 family transposase ISEic2	transposase	A0A218MNI5	uncultured_virus	44.1	8.1e-47
AVZ83707.1|3537878_3539048_-|transposase	IS256-like element ISEic2 family transposase	transposase	A0A218MNI5	uncultured_virus	44.4	9.0e-43
AVZ83708.1|3540037_3541132_-|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	41.1	1.4e-61
AVZ83709.1|3541118_3541367_-	excisionase	NA	NA	NA	NA	NA
AVZ83710.1|3542333_3543548_-	DUF1028 domain-containing protein	NA	NA	NA	NA	NA
AVZ83711.1|3544199_3544667_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ83712.1|3544695_3544845_-	potassium transporter 7	NA	NA	NA	NA	NA
AVZ83713.1|3544901_3545207_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ83714.1|3545225_3546296_-	enterohemolysin	NA	A0A193GYL3	Enterobacter_phage	61.6	1.8e-82
AVZ83715.1|3546306_3548787_-	DNA breaking-rejoining protein	NA	H6WRX1	Salmonella_phage	53.2	1.4e-90
AVZ83716.1|3548894_3549197_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ83717.1|3550034_3552893_+	archaeal ATPase	NA	NA	NA	NA	NA
AVZ83718.1|3552919_3555319_+	adenosine deaminase	NA	NA	NA	NA	NA
AVZ83719.1|3555843_3556536_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	48.7	2.5e-56
AVZ83720.1|3556640_3556856_+	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	49.2	3.5e-09
AVZ83721.1|3556953_3557310_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ83722.1|3557306_3557537_+	porin	NA	NA	NA	NA	NA
AVZ83723.1|3557568_3557829_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ83724.1|3557838_3558027_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ83725.1|3558030_3558969_+	helix-turn-helix domain-containing protein	NA	Q76H52	Enterobacteria_phage	66.3	1.1e-30
AVZ83726.1|3558965_3560348_+	replicative DNA helicase	NA	I6R0N4	Salmonella_phage	66.0	2.1e-163
AVZ83727.1|3560356_3560725_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ83728.1|3560834_3561479_+	DUF1367 domain-containing protein	NA	A0A0U2RT94	Escherichia_phage	31.7	1.2e-15
AVZ83729.1|3561481_3561781_+	DUF1364 domain-containing protein	NA	A0A2I7R6Q3	Vibrio_phage	46.2	3.1e-16
AVZ83730.1|3561925_3562966_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ83731.1|3562966_3563476_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ83732.1|3563608_3563791_+	transcriptional regulator	NA	NA	NA	NA	NA
AVZ83733.1|3563842_3564355_-	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
AVZ83734.1|3564457_3564766_-	XRE family transcriptional regulator	NA	A0A088CD40	Shigella_phage	90.2	9.0e-43
AVZ84122.1|3564755_3565085_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	88.5	1.3e-39
AVZ83735.1|3566437_3566953_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ83736.1|3567041_3567860_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ83737.1|3568341_3568572_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ83738.1|3568546_3568876_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AVZ83739.1|3568959_3569307_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	48.6	3.3e-25
AVZ83740.1|3569309_3569861_+	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	70.8	2.8e-71
AVZ83741.1|3570703_3571480_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	49.3	1.5e-06
AVZ84123.1|3571472_3573134_+|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	69.7	7.6e-229
AVZ83742.1|3573130_3575245_+|portal	portal protein	portal	A0A088CE71	Shigella_phage	63.1	4.7e-223
AVZ83743.1|3575316_3575598_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	1.4e-18
AVZ83744.1|3575587_3575839_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AVZ83745.1|3576126_3577128_+	hypothetical protein	NA	A0A1I9KFD1	Aeromonas_phage	33.3	6.8e-31
AVZ83746.1|3577145_3578402_+|capsid	N4-gp56 family major capsid protein	capsid	A0A088CC32	Shigella_phage	72.2	5.1e-169
AVZ83747.1|3578559_3578955_+	hypothetical protein	NA	A0A088CD63	Shigella_phage	37.7	1.1e-13
AVZ83748.1|3578996_3579440_+	hypothetical protein	NA	A0A2L1IV43	Escherichia_phage	47.2	1.9e-25
AVZ83749.1|3579439_3580021_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ83750.1|3580020_3580683_+	hypothetical protein	NA	Q08J85	Stx2-converting_phage	55.0	1.4e-61
AVZ83751.1|3580679_3582803_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	52.5	1.5e-19
AVZ83752.1|3582817_3582997_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ84124.1|3583007_3584612_+	hypothetical protein	NA	A0A088CBK0	Shigella_phage	53.6	2.3e-158
AVZ83753.1|3584608_3586147_+	DUF1983 domain-containing protein	NA	A0A2L1IV54	Escherichia_phage	45.0	2.8e-68
AVZ83754.1|3586143_3586515_+	hypothetical protein	NA	A0A088CC37	Shigella_phage	39.0	1.7e-16
AVZ83755.1|3586525_3587101_+	hypothetical protein	NA	A0A1I9KFE8	Aeromonas_phage	50.3	8.1e-45
AVZ83756.1|3587188_3587569_+	hypothetical protein	NA	A0A1I9KFD7	Aeromonas_phage	48.4	7.2e-26
AVZ83757.1|3587568_3587829_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
AVZ83758.1|3589277_3590486_+|transposase	IS256 family transposase ISEic2	transposase	A0A218MNI5	uncultured_virus	44.1	8.1e-47
AVZ83759.1|3599056_3600265_-|transposase	IS256 family transposase ISEic2	transposase	A0A218MNI5	uncultured_virus	44.1	8.1e-47
3590461:3591775	attR	GTGATCGTCTGGACGGTCACTTCTGAGAAAAGGCATTTACACAGAATCGTGTACAGGGTCGGGAGTTAATGCGCCGTCAGGGGAAAAGCGATCGCCTGGAGCCCCTGATCCATCCGCAGGGGATGGCCTTACCCCCCTCATTGAGTGCACCGCGCCAAACGGAGTGACGGCGCCGATACCTATCCTCATCGTCTTGCTACCCGCCGCCATTTGGCGGCTTTTTTACGCCTGAAATTTAGGCATTCCCCTCTGGCCGGAGGCATACCGTGGCGAATTACCCTCAAGATCTGCGCCCTGAACAGCAACGATACGCTGTCGAGCGGCAGTCGTTGAATATCCAGCAGCCGGATGAAGGCCTGGCGCGCTACTGGGACAGTTATGATCCCCGGAAATACGCCGGGCTTTCTGATGAGTCAGCGGAAAACAGCGGCAATATTTTTTCCGATACCGGTCATCTGCTGTGGAGCGGACTGACCTCGACAGCCGCCAGTCTACGCGAGGCCACGGGGAAAGTACCGCTGGTCGGCGGGGCGATCGTTTCTGGGCTGGATGTCATCGATCAGTATGTTTTGGGTCATGAGGATAGCGAGTCATTTTTGCGCGCCGATCAGCAAAACTCGCTGAGTCAGCTCTCGCCAGCCATGCAACAGGCGCGGGAGAAATCTTTCTGGGAGAGCGGGAAAGGGCTGGGGGACGCCTGGGTCGATCCACGCAGCTATTTCGCCGGGGTTGTCGAGTCGGCGCCGGGCATGGCGGTGACCATGGGACCTGCGTTGAGGTTGGCTAAGCTTGCCTACAGCGCGAAGGTAGCGCAAGGGGTTGCGGCGAAAGAAGCGGCGGCCAGCGCGGCGCGGGTCGCCTCGTTGACTGGACGTATCACCGAGGGTGTATTGGCTGGTGGGGCCTCATCTAATGAGGTCAAGGCAGCGATTTATGCGCTACCGGACGAGATCTTGCAAGGTTCGGAGGCCGCGCAGAATTTGCTGGCTTCGGGGATGTCGGTCGATGAGATGCGCAAGGCGTTGGCGGAAGATGCGTCAACTAAGGCGTTTATCCTGTCTGCCGTAGCGACGGGAATGTTCGGCGGCCAAGGTGATAAGGTGATCGCCAAAATTATGACCGGTCAGCTCAAACAGGGCGTGATGAGGCGCTTTGCCAAAGGGGCGGTGGCTGAGGGGCTTTTTGAGGAAGTCCCGCAGTCGGCTCTTAGCCAGATGGCGGAAAACTATGCCTTACAATCCGCCGACCCGCAGCGCCCGCTCTCCGATGAGGTAATGAATCAGGCGCTCGCTGGACTGGCCATCGGCGGCGTGAT	NA	NA	NA	NA
AVZ83760.1|3600261_3601070_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	34.2	8.2e-27
AVZ83761.1|3601079_3601691_+	ammonium transporter	NA	NA	NA	NA	NA
AVZ83762.1|3602019_3603441_+	MFS transporter	NA	NA	NA	NA	NA
AVZ83763.1|3603470_3603743_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AVZ83764.1|3603759_3604125_-	DUF1283 domain-containing protein	NA	NA	NA	NA	NA
AVZ83765.1|3604228_3604978_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
AVZ83766.1|3605133_3605370_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ83767.1|3606282_3606702_-	universal stress protein	NA	NA	NA	NA	NA
AVZ83768.1|3608442_3608823_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ83769.1|3610382_3610610_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ83770.1|3610745_3611144_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ83771.1|3611416_3612346_-	cation transporter	NA	NA	NA	NA	NA
AVZ83772.1|3612401_3612713_-	transcriptional regulator	NA	NA	NA	NA	NA
AVZ83773.1|3614218_3614806_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ83774.1|3615141_3616932_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	35.9	2.1e-14
AVZ83775.1|3617151_3617511_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVZ83776.1|3617529_3617826_-	DUF406 family protein	NA	NA	NA	NA	NA
AVZ83777.1|3619488_3621453_-|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	26.9	7.3e-21
AVZ83778.1|3621995_3622754_+	transcriptional regulator FNR	NA	NA	NA	NA	NA
AVZ83779.1|3622929_3623889_+	universal stress protein UspE	NA	NA	NA	NA	NA
AVZ83780.1|3623962_3625354_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
AVZ83781.1|3625366_3626893_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AVZ83782.1|3627412_3628363_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AVZ83783.1|3628603_3629995_+	amino acid permease	NA	NA	NA	NA	NA
AVZ83784.1|3630248_3630650_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ83785.1|3631290_3631902_+	dihydromonapterin reductase	NA	NA	NA	NA	NA
AVZ83786.1|3631898_3632701_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AVZ83787.1|3632895_3633618_+	two-component system response regulator RstA	NA	NA	NA	NA	NA
AVZ83788.1|3633623_3634934_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	25.4	5.6e-17
AVZ83789.1|3634980_3636486_+	carboxypeptidase M32	NA	NA	NA	NA	NA
AVZ83790.1|3636795_3637521_-	type III secretion system effector phosphothreonine lyase	NA	NA	NA	NA	NA
AVZ83791.1|3637655_3638352_+|transposase	IS1-like element ISEic1 family transposase	transposase	A0A077SLN4	Escherichia_phage	56.7	3.3e-77
AVZ83792.1|3639302_3640104_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AVZ83793.1|3641057_3641741_-	type VI secretion protein	NA	NA	NA	NA	NA
AVZ83794.1|3642182_3642995_+|protease	serine protease	protease	NA	NA	NA	NA
AVZ84125.1|3643012_3646897_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	28.2	3.4e-54
>prophage 255
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3650374	3653471	3837027		Acanthocystis_turfacea_Chlorella_virus(50.0%)	5	NA	NA
AVZ83798.1|3650374_3651367_+	2-hydroxyacid dehydrogenase	NA	M1I636	Acanthocystis_turfacea_Chlorella_virus	40.6	1.6e-61
AVZ83799.1|3651439_3651646_-	glycogen synthase	NA	NA	NA	NA	NA
AVZ83800.1|3651936_3652356_+	META domain-containing protein	NA	NA	NA	NA	NA
AVZ83801.1|3652370_3652613_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AVZ83802.1|3652817_3653471_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	45.4	1.7e-19
>prophage 256
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3660614	3661550	3837027	tRNA	Escherichia_phage(100.0%)	1	NA	NA
AVZ83807.1|3660614_3661550_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	88.3	7.0e-131
>prophage 257
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3668206	3673072	3837027		Hokovirus(50.0%)	3	NA	NA
AVZ83813.1|3668206_3670582_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.0	7.9e-171
AVZ83814.1|3670992_3671814_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
AVZ83815.1|3672025_3673072_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	47.5	1.2e-83
>prophage 258
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3681058	3681841	3837027		Planktothrix_phage(100.0%)	1	NA	NA
AVZ83824.1|3681058_3681841_+	heme ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	1.1e-12
>prophage 259
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3685503	3700802	3837027	tRNA	Bacillus_phage(11.11%)	17	NA	NA
AVZ83828.1|3685503_3685992_-	endopeptidase	NA	S5MM68	Bacillus_phage	39.6	4.9e-11
AVZ83829.1|3686229_3686436_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ83830.1|3686994_3687933_+	cysteine synthase family protein	NA	A0A1X9I5K7	Streptococcus_phage	32.8	1.0e-33
AVZ84126.1|3687946_3688513_+	adenine phosphoribosyltransferase	NA	NA	NA	NA	NA
AVZ83831.1|3688579_3689518_+	transporter	NA	NA	NA	NA	NA
AVZ83832.1|3689514_3690756_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
AVZ83833.1|3690816_3691611_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.3	2.1e-06
AVZ84127.1|3691600_3692635_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
AVZ83834.1|3692615_3692819_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ83835.1|3692908_3693205_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	41.1	4.2e-13
AVZ83836.1|3693209_3695597_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	24.7	2.8e-06
AVZ83837.1|3695611_3696595_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.6	8.4e-34
AVZ83838.1|3696982_3697339_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AVZ83839.1|3697382_3697580_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AVZ83840.1|3697677_3698220_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	34.1	9.7e-16
AVZ83841.1|3698223_3700152_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	7.4e-127
AVZ83842.1|3700283_3700802_+	hypothetical protein	NA	A0A1B0VFY5	Salmonella_phage	47.3	4.6e-15
>prophage 260
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3706686	3711341	3837027		Enterobacteria_phage(50.0%)	3	NA	NA
AVZ83848.1|3706686_3707808_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	62.5	1.9e-122
AVZ83849.1|3708444_3709254_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
AVZ83850.1|3709286_3711341_-	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	24.2	1.1e-30
>prophage 261
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3714788	3720010	3837027		Morganella_phage(33.33%)	5	NA	NA
AVZ83855.1|3714788_3714998_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	76.6	4.5e-22
AVZ83856.1|3715490_3716645_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	47.2	1.4e-83
AVZ83857.1|3717075_3718254_+	phosphoribosylglycinamide formyltransferase 2	NA	NA	NA	NA	NA
AVZ83858.1|3718284_3718479_-	YoaH family protein	NA	NA	NA	NA	NA
AVZ83859.1|3718621_3720010_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	35.0	9.0e-50
>prophage 262
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3723243	3723816	3837027		Escherichia_phage(100.0%)	1	NA	NA
AVZ83863.1|3723243_3723816_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.6	2.1e-21
>prophage 263
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3730168	3731245	3837027		Faustovirus(100.0%)	1	NA	NA
AVZ83868.1|3730168_3731245_+	threonine-phosphate decarboxylase	NA	A0A1X7QHI1	Faustovirus	25.6	9.3e-10
>prophage 264
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3749848	3751656	3837027		Planktothrix_phage(100.0%)	2	NA	NA
AVZ83885.1|3749848_3750844_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	24.7	1.5e-06
AVZ83886.1|3750840_3751656_+	peptide ABC transporter ATP-binding protein SapF	NA	G9BWD6	Planktothrix_phage	28.9	8.8e-13
>prophage 265
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3755784	3761325	3837027		Bodo_saltans_virus(50.0%)	4	NA	NA
AVZ83890.1|3755784_3757728_+	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	29.5	7.3e-05
AVZ83891.1|3757908_3758502_+	flavodoxin family protein	NA	NA	NA	NA	NA
AVZ83892.1|3758588_3759827_-	peptidase T	NA	NA	NA	NA	NA
AVZ83893.1|3760191_3761325_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	35.9	5.9e-31
>prophage 266
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3773217	3777934	3837027		Trichoplusia_ni_ascovirus(50.0%)	4	NA	NA
AVZ83906.1|3773217_3773979_+	2-deoxy-D-gluconate 3-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.3	5.9e-19
AVZ83907.1|3774302_3774554_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ83908.1|3774779_3775631_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AVZ83909.1|3775891_3777934_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	31.7	9.4e-80
>prophage 267
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3786960	3787392	3837027		Morganella_phage(100.0%)	1	NA	NA
AVZ83916.1|3786960_3787392_-	universal stress protein UspA	NA	A0A1W6JNV4	Morganella_phage	39.9	8.0e-13
>prophage 268
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3795546	3803187	3837027	transposase	uncultured_virus(66.67%)	5	NA	NA
AVZ83923.1|3795546_3795906_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	49.5	6.8e-18
AVZ83924.1|3796682_3798329_-	indole-3-pyruvate decarboxylase	NA	NA	NA	NA	NA
AVZ83925.1|3798441_3799138_+|transposase	IS1-like element ISEic1 family transposase	transposase	A0A077SLN4	Escherichia_phage	57.1	3.3e-77
AVZ83926.1|3801066_3801369_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ83927.1|3801978_3803187_+|transposase	IS256-like element ISEic2 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	1.1e-46
>prophage 269
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3809121	3810330	3837027	transposase	uncultured_virus(100.0%)	1	NA	NA
AVZ83935.1|3809121_3810330_-|transposase	IS256-like element ISEic2 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	1.1e-46
>prophage 270
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3813374	3813809	3837027		Morganella_phage(100.0%)	1	NA	NA
AVZ83939.1|3813374_3813809_+	universal stress protein F	NA	A0A1W6JNV4	Morganella_phage	50.0	1.2e-27
>prophage 271
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3820399	3821197	3837027		Cedratvirus(100.0%)	1	NA	NA
AVZ83944.1|3820399_3821197_+	peptide ABC transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	29.2	1.3e-05
>prophage 272
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3826404	3827756	3837027		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
AVZ83951.1|3826404_3827064_+	hexitol phosphatase HxpB	NA	M1I5S4	Acanthocystis_turfacea_Chlorella_virus	25.3	2.4e-08
AVZ83952.1|3827210_3827756_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	31.8	1.7e-07
>prophage 273
CP028813	Edwardsiella ictaluri strain MS-17-156 chromosome, complete genome	3837027	3831858	3832494	3837027		Orpheovirus(100.0%)	1	NA	NA
AVZ83956.1|3831858_3832494_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.7	5.1e-24
>prophage 1
CP028814	Edwardsiella ictaluri strain MS-17-156 plasmid pEI-MS-17-156-1, complete sequence	135268	0	13278	135268	transposase	Escherichia_phage(60.0%)	15	NA	NA
AVZ84132.1|1212_2097_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
AVZ84133.1|2127_3621_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AVZ84134.1|3831_4056_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ84135.1|4052_4790_-	resolvase	NA	NA	NA	NA	NA
AVZ84136.1|4896_5388_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ84137.1|5421_6126_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVZ84138.1|6474_7179_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVZ84139.1|7668_8778_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	2.8e-33
AVZ84140.1|8872_10057_-	tetracycline efflux MFS transporter Tet(D)	NA	NA	NA	NA	NA
AVZ84141.1|10152_10809_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AVZ84291.1|10820_11525_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVZ84292.1|11470_11755_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ84142.1|11949_12213_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ84143.1|12316_12814_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ84144.1|12816_13278_-	DUF1643 domain-containing protein	NA	B5WZV8	Pseudomonas_phage	60.5	1.5e-46
>prophage 2
CP028814	Edwardsiella ictaluri strain MS-17-156 plasmid pEI-MS-17-156-1, complete sequence	135268	16907	22762	135268		Sodalis_phage(25.0%)	11	NA	NA
AVZ84154.1|16907_17180_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	59.6	4.2e-20
AVZ84155.1|17237_17765_-	nuclease	NA	O64020	Bacillus_phage	37.0	1.3e-09
AVZ84156.1|17781_17970_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ84157.1|17995_18853_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ84158.1|18839_19070_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ84159.1|19069_19588_-	nitrite reductase	NA	NA	NA	NA	NA
AVZ84160.1|19584_20031_-	Fe3+-siderophore ABC transporter permease	NA	NA	NA	NA	NA
AVZ84161.1|20030_20390_-	hypothetical protein	NA	A0A076G835	Escherichia_phage	49.4	5.6e-20
AVZ84162.1|20446_20875_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ84163.1|20908_21769_-	protein-disulfide isomerase	NA	NA	NA	NA	NA
AVZ84164.1|21784_22762_-	S49 family peptidase	NA	Q9JMP1	Wolbachia_phage	31.5	7.1e-17
>prophage 3
CP028814	Edwardsiella ictaluri strain MS-17-156 plasmid pEI-MS-17-156-1, complete sequence	135268	26403	27519	135268		unidentified_phage(100.0%)	1	NA	NA
AVZ84170.1|26403_27519_+	phosphohydrolase	NA	H7BVI4	unidentified_phage	29.1	4.9e-46
>prophage 4
CP028814	Edwardsiella ictaluri strain MS-17-156 plasmid pEI-MS-17-156-1, complete sequence	135268	31422	37505	135268	transposase	Bacillus_phage(33.33%)	9	NA	NA
AVZ84176.1|31422_32406_+	plasmid stability protein StbA	NA	A7KUY1	Bacillus_phage	24.4	2.1e-08
AVZ84177.1|32422_32716_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ84178.1|32717_33137_+	DNA-binding protein	NA	NA	NA	NA	NA
AVZ84179.1|33196_33748_-	regulator	NA	NA	NA	NA	NA
AVZ84180.1|33744_34353_-	transcriptional regulator	NA	NA	NA	NA	NA
AVZ84181.1|34363_34897_-	transglycosylase	NA	NA	NA	NA	NA
AVZ84182.1|34896_35169_-	nucleotide excision repair protein	NA	A0A2H4J3B6	uncultured_Caudovirales_phage	39.7	6.3e-08
AVZ84183.1|35884_36238_+	permease	NA	NA	NA	NA	NA
AVZ84184.1|36296_37505_+|transposase	IS256 family transposase ISEic2	transposase	A0A218MNI5	uncultured_virus	44.1	8.1e-47
>prophage 5
CP028814	Edwardsiella ictaluri strain MS-17-156 plasmid pEI-MS-17-156-1, complete sequence	135268	43820	45332	135268		Pseudoalteromonas_phage(100.0%)	1	NA	NA
AVZ84188.1|43820_45332_-	ATP-dependent helicase	NA	A0A2D1GN12	Pseudoalteromonas_phage	30.7	3.6e-44
>prophage 6
CP028814	Edwardsiella ictaluri strain MS-17-156 plasmid pEI-MS-17-156-1, complete sequence	135268	48501	50386	135268	integrase	Salmonella_phage(50.0%)	2	46709:46724	51629:51644
46709:46724	attL	GTAATTATCATAATTA	NA	NA	NA	NA
AVZ84193.1|48501_49371_-	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	35.1	3.5e-23
AVZ84194.1|49375_50386_-|integrase	integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
51629:51644	attR	GTAATTATCATAATTA	NA	NA	NA	NA
>prophage 7
CP028814	Edwardsiella ictaluri strain MS-17-156 plasmid pEI-MS-17-156-1, complete sequence	135268	53866	63899	135268		uncultured_Caudovirales_phage(33.33%)	8	NA	NA
AVZ84202.1|53866_58129_-	type IV secretion protein Rhs	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	53.4	5.8e-23
AVZ84203.1|58261_58987_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ84204.1|59100_59502_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ84205.1|59721_59961_-	permease	NA	NA	NA	NA	NA
AVZ84206.1|60033_60312_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ84207.1|60298_62026_-	DNA primase	NA	A0A0P0ZFY3	Escherichia_phage	32.6	9.9e-14
AVZ84208.1|62203_62590_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ84209.1|63047_63899_-	NgrC	NA	A0A219UQS0	Bacillus_phage	29.4	3.6e-09
>prophage 8
CP028814	Edwardsiella ictaluri strain MS-17-156 plasmid pEI-MS-17-156-1, complete sequence	135268	70460	72086	135268		Staphylococcus_phage(100.0%)	1	NA	NA
AVZ84219.1|70460_72086_-	DNA cytosine methyltransferase	NA	A0A0N9SK84	Staphylococcus_phage	25.8	1.2e-05
>prophage 9
CP028814	Edwardsiella ictaluri strain MS-17-156 plasmid pEI-MS-17-156-1, complete sequence	135268	81321	85957	135268		Mycobacterium_phage(25.0%)	5	NA	NA
AVZ84233.1|81321_82332_-	endonuclease	NA	E0YQ48	Mycobacterium_phage	28.7	5.6e-09
AVZ84234.1|82394_83384_-	phage recombination protein Bet	NA	B5AX97	Iodobacteriophage	39.6	1.1e-52
AVZ84235.1|83478_84009_-	single-stranded DNA-binding protein	NA	A0A291LCB6	Klebsiella_phage	71.8	2.6e-42
AVZ84236.1|84069_84978_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ84237.1|84988_85957_-	CbbQ/NirQ/NorQ/GpvN family protein	NA	L7TKP0	Rhizobium_phage	32.6	2.8e-29
>prophage 10
CP028814	Edwardsiella ictaluri strain MS-17-156 plasmid pEI-MS-17-156-1, complete sequence	135268	118108	121195	135268		Streptococcus_phage(50.0%)	3	NA	NA
AVZ84267.1|118108_120301_+	DNA topoisomerase 3	NA	A0A1X9I6W8	Streptococcus_phage	29.2	1.7e-42
AVZ84268.1|120315_120804_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ84269.1|120895_121195_-	RNA-binding protein	NA	A0A0K1LLW2	Caulobacter_phage	55.4	2.1e-20
>prophage 11
CP028814	Edwardsiella ictaluri strain MS-17-156 plasmid pEI-MS-17-156-1, complete sequence	135268	124628	132394	135268		Colwellia_phage(20.0%)	12	NA	NA
AVZ84275.1|124628_125129_-	hypothetical protein	NA	I3UMJ0	Colwellia_phage	43.3	1.7e-19
AVZ84276.1|125137_125470_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ84297.1|125454_125886_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ84277.1|125953_126628_-	thymidylate kinase	NA	NA	NA	NA	NA
AVZ84278.1|126602_126884_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ84279.1|126876_127254_-	hypothetical protein	NA	A0A2H4P7P5	Pseudomonas_phage	49.6	2.2e-22
AVZ84280.1|127807_128443_+	restriction endonuclease subunit M	NA	NA	NA	NA	NA
AVZ84281.1|128495_128768_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ84282.1|128816_129998_-	chromosome partitioning protein ParB	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
AVZ84283.1|130001_130787_-	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
AVZ84284.1|130960_131272_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ84285.1|131578_132394_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
