The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP020752	Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2009K-0792 chromosome, complete genome	4597370	1154235	1218866	4597370	portal,tRNA,head,integrase,capsid,plate,tail	Salmonella_phage(89.13%)	69	1155680:1155726	1189879:1189925
AVZ67553.1|1154235_1155477_-|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	47.1	8.5e-100
AVZ67554.1|1155567_1155765_+	hypothetical protein	NA	NA	NA	NA	NA
1155680:1155726	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
AVZ67555.1|1155841_1157068_-	hypothetical protein	NA	E5G6K9	Salmonella_phage	65.4	3.6e-151
AVZ67556.1|1157074_1158091_-|integrase	integrase	integrase	A0A1S6L016	Salmonella_phage	95.0	5.0e-191
AVZ67557.1|1158092_1158725_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	96.7	5.8e-113
AVZ67558.1|1158844_1159087_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AVZ67559.1|1159119_1159629_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	93.5	3.5e-84
AVZ67560.1|1159715_1159991_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ67561.1|1160075_1160270_+	hypothetical protein	NA	E5G6L4	Salmonella_phage	84.1	5.3e-25
AVZ67562.1|1160233_1160575_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	84.1	6.0e-48
AVZ67563.1|1160642_1160870_+	hypothetical protein	NA	A0A0M3UL87	Salmonella_phage	64.0	8.1e-17
AVZ67564.1|1160869_1161097_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	66.7	5.4e-21
AVZ67565.1|1161093_1161951_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	69.8	4.6e-113
AVZ67566.1|1161947_1164341_+	endonuclease	NA	A0A1S6L028	Salmonella_phage	88.8	0.0e+00
AVZ67567.1|1164360_1164588_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ67568.1|1164725_1164914_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	91.7	5.7e-24
AVZ67569.1|1165244_1166447_+	DNA (cytosine-5-)-methyltransferase	NA	M1PSQ0	Streptococcus_phage	37.1	5.6e-64
AVZ67570.1|1166409_1167327_+	restriction endonuclease	NA	NA	NA	NA	NA
AVZ67571.1|1167373_1168408_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	94.8	4.1e-188
AVZ67572.1|1168407_1170174_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	96.6	0.0e+00
AVZ67573.1|1170316_1171150_+|capsid	capsid protein	capsid	E5G6M5	Salmonella_phage	97.1	1.1e-127
AVZ67574.1|1171166_1172234_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	98.0	2.8e-192
AVZ67575.1|1172237_1172888_+	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	98.6	1.6e-113
AVZ67576.1|1172981_1173446_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	96.8	7.9e-83
AVZ67577.1|1173445_1173649_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AVZ67578.1|1173652_1173868_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
AVZ67579.1|1173848_1174358_+	glycoside hydrolase	NA	A0A1S6KZY9	Salmonella_phage	97.6	3.2e-93
AVZ67580.1|1174362_1174737_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ67581.1|1174733_1175162_+	hypothetical protein	NA	A0A1S6KZX8	Salmonella_phage	95.0	2.6e-64
AVZ67582.1|1175091_1175295_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	97.0	3.4e-30
AVZ67583.1|1175257_1175689_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	95.1	4.0e-73
AVZ67584.1|1175681_1176128_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	89.7	3.8e-66
AVZ67585.1|1176196_1176775_+|plate	baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.0	1.5e-107
AVZ67586.1|1176771_1177131_+|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	92.4	6.3e-56
AVZ67587.1|1177117_1178026_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.7	7.2e-157
AVZ67588.1|1178018_1178624_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	98.5	1.1e-116
AVZ67589.1|1178620_1180195_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	60.9	3.3e-157
AVZ67590.1|1180164_1180782_+|tail	tail assembly chaperone	tail	A0A1B0VCD0	Salmonella_phage	84.1	1.6e-94
AVZ67591.1|1180785_1181193_-|tail	phage tail protein	tail	A0A1B0V844	Salmonella_phage	85.2	6.7e-62
AVZ67592.1|1181199_1182279_-	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	91.8	1.2e-182
AVZ67593.1|1182248_1182806_+	DNA-invertase	NA	A0A1S6L009	Salmonella_phage	98.9	9.4e-99
AVZ67594.1|1182908_1184081_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	3.7e-222
AVZ67595.1|1184090_1184606_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AVZ67596.1|1184660_1184963_+	hypothetical protein	NA	A0A1S6KZZ9	Salmonella_phage	100.0	2.5e-45
AVZ67597.1|1184977_1185097_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
AVZ67598.1|1185089_1187897_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	98.3	0.0e+00
AVZ67599.1|1187893_1188379_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	99.2	8.3e-67
AVZ67600.1|1188375_1189476_+	late control protein D	NA	E5G6Q3	Salmonella_phage	95.6	9.0e-194
AVZ67601.1|1189544_1189763_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
AVZ70758.1|1190314_1191478_-	secretion protein HlyD	NA	NA	NA	NA	NA
1189879:1189925	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
AVZ67602.1|1191485_1193666_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	9.9e-19
AVZ67603.1|1193662_1195072_-	type I secretion protein TolC	NA	NA	NA	NA	NA
AVZ67604.1|1195136_1206611_-	Ig-like domain repeat protein	NA	NA	NA	NA	NA
AVZ70759.1|1207225_1207708_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
AVZ67605.1|1207857_1208334_+	ubiquinone-binding protein	NA	NA	NA	NA	NA
AVZ67606.1|1208323_1208614_+	RnfH family protein	NA	NA	NA	NA	NA
AVZ67607.1|1208775_1209114_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AVZ67608.1|1209262_1210924_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AVZ67609.1|1211009_1211888_-	NAD(+) kinase	NA	NA	NA	NA	NA
AVZ70760.1|1211819_1212014_+	molecular chaperone GrpE	NA	NA	NA	NA	NA
AVZ67610.1|1212010_1212601_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AVZ67611.1|1212635_1213241_-	cytoplasmic protein	NA	NA	NA	NA	NA
AVZ67612.1|1213361_1214603_-	magnesium/cobalt efflux protein	NA	NA	NA	NA	NA
AVZ67613.1|1214667_1215459_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AVZ67614.1|1215404_1215701_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ67615.1|1215624_1216986_+	signal recognition particle protein	NA	NA	NA	NA	NA
AVZ67616.1|1217238_1217487_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AVZ67617.1|1217505_1218054_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AVZ67618.1|1218098_1218866_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 2
CP020752	Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2009K-0792 chromosome, complete genome	4597370	1714534	1723705	4597370	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AVZ68060.1|1714534_1715482_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
AVZ68061.1|1715465_1716197_+	ABC transporter permease	NA	NA	NA	NA	NA
AVZ68062.1|1716177_1716285_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ68063.1|1716344_1717076_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AVZ68064.1|1717298_1718984_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
AVZ68065.1|1718980_1719700_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AVZ68066.1|1719746_1720214_+	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AVZ68067.1|1720270_1720801_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ68068.1|1720972_1721431_-	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	73.2	7.6e-54
AVZ68069.1|1721671_1723705_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 3
CP020752	Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2009K-0792 chromosome, complete genome	4597370	1880879	1888146	4597370		Morganella_phage(33.33%)	8	NA	NA
AVZ68214.1|1880879_1881299_+	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
AVZ68215.1|1881301_1882570_+	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.2	1.9e-227
AVZ68216.1|1883024_1883237_+	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
AVZ70776.1|1883247_1883436_+	cold-shock protein	NA	NA	NA	NA	NA
AVZ68217.1|1883694_1884906_-	porin	NA	Q1MVN1	Enterobacteria_phage	56.2	2.6e-109
AVZ68218.1|1885555_1885855_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ68219.1|1885946_1886642_+	phosphohydrolase	NA	S4W232	Pandoravirus	28.0	1.6e-07
AVZ68220.1|1886715_1888146_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
>prophage 4
CP020752	Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2009K-0792 chromosome, complete genome	4597370	2174358	2181259	4597370		Salmonella_phage(33.33%)	9	NA	NA
AVZ68508.1|2174358_2175165_-	peptide transport system ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
AVZ68509.1|2175166_2176159_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AVZ68510.1|2176158_2177049_-	peptide ABC transporter permease	NA	NA	NA	NA	NA
AVZ68511.1|2177953_2178841_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	37.7	2.1e-36
AVZ68512.1|2179146_2179320_+	hypothetical protein	NA	S4TSR3	Salmonella_phage	80.6	4.9e-22
AVZ68513.1|2179735_2179876_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	77.1	6.5e-09
AVZ68514.1|2179914_2180214_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	55.7	8.5e-14
AVZ68515.1|2180140_2180566_+	subtilase cytotoxin subunit B-like protein	NA	NA	NA	NA	NA
AVZ68516.1|2180944_2181259_+	hypothetical protein	NA	A0A1S6L009	Salmonella_phage	86.1	4.3e-40
>prophage 5
CP020752	Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2009K-0792 chromosome, complete genome	4597370	2215298	2224040	4597370	tRNA,integrase	Escherichia_phage(33.33%)	10	2211271:2211283	2225455:2225467
2211271:2211283	attL	GGCATCGGTGGTA	NA	NA	NA	NA
AVZ68550.1|2215298_2216453_+	chemoreceptor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.8	2.0e-10
AVZ68551.1|2216598_2217582_+	zinc transporter ZntB	NA	NA	NA	NA	NA
AVZ68552.1|2217857_2218040_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ68553.1|2218068_2219442_+	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	1.6e-51
AVZ68554.1|2219484_2220420_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	9.4e-144
AVZ68555.1|2220471_2220663_-|integrase	integrase	integrase	A0A0U2JGI6	Escherichia_phage	96.8	1.2e-29
AVZ68556.1|2221107_2222940_+	DUF4765 domain-containing protein	NA	A0A0N7KZG3	Stx2-converting_phage	35.4	1.1e-47
AVZ68557.1|2223111_2223222_+	multidrug transporter	NA	NA	NA	NA	NA
AVZ68558.1|2223214_2223553_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AVZ68559.1|2223605_2224040_-	universal stress protein F	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
2225455:2225467	attR	GGCATCGGTGGTA	NA	NA	NA	NA
>prophage 6
CP020752	Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2009K-0792 chromosome, complete genome	4597370	2637692	2651974	4597370	tail	Escherichia_phage(50.0%)	18	NA	NA
AVZ68965.1|2637692_2637932_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	87.3	2.5e-32
AVZ68966.1|2638149_2638350_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ70811.1|2638811_2639621_+	cytolethal distending toxin subunit B	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AVZ68967.1|2639693_2640071_+|tail	phage tail protein	tail	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AVZ68968.1|2640218_2640761_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	66.5	8.1e-71
AVZ68969.1|2640953_2641682_-	pertussis toxin-like subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	52.5	1.2e-61
AVZ68970.1|2641698_2642112_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	37.7	5.5e-19
AVZ68971.1|2643161_2644286_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ68972.1|2644732_2644897_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	9.6e-20
AVZ68973.1|2645130_2645964_-	5-methylcytosine-specific restriction enzyme A	NA	NA	NA	NA	NA
AVZ68974.1|2646070_2646625_-	DNA-invertase	NA	A0A1S6L009	Salmonella_phage	88.9	4.4e-88
AVZ68975.1|2646654_2647173_+|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	60.9	2.9e-54
AVZ68976.1|2647746_2648190_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	99.3	1.8e-81
AVZ68977.1|2648210_2648615_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	96.0	2.4e-64
AVZ68978.1|2648563_2649025_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ68979.1|2648999_2649464_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ68980.1|2649985_2650600_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ68981.1|2650723_2651974_-	isocitrate dehydrogenase (NADP(+))	NA	Q77Z09	Phage_21	100.0	3.8e-23
>prophage 7
CP020752	Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2009K-0792 chromosome, complete genome	4597370	3032064	3073439	4597370	portal,holin,coat,protease,integrase,terminase,tail,lysis	Salmonella_phage(63.64%)	68	3031794:3031816	3073505:3073527
3031794:3031816	attL	CGTTCAACTTAGTATAAAAAAGC	NA	NA	NA	NA
AVZ70822.1|3032064_3033318_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	25.9	6.7e-20
AVZ69333.1|3033381_3035133_-	hypothetical protein	NA	I6S5Y0	Salmonella_phage	88.3	3.9e-58
AVZ70823.1|3035372_3035702_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ69334.1|3035719_3037549_-	DNA transfer protein	NA	A0A192Y934	Salmonella_phage	73.9	6.8e-247
AVZ69335.1|3037548_3038898_-	DNA transfer protein	NA	B9UDL0	Salmonella_phage	96.7	1.1e-238
AVZ69336.1|3038907_3039597_-	DNA transfer protein	NA	A0A1R3Y5P8	Salmonella_virus	98.3	1.4e-88
AVZ69337.1|3039599_3040055_-	hypothetical protein	NA	I6R0L6	Salmonella_phage	99.3	8.8e-87
AVZ69338.1|3040054_3040693_-|tail	phage tail protein	tail	A0A088CPT1	Enterobacteria_phage	90.6	3.8e-80
AVZ69339.1|3040685_3041219_-	endodeoxyribonuclease	NA	A0A1V0E5R7	Salmonella_phage	47.7	7.0e-35
AVZ69340.1|3041240_3042659_-	hypothetical protein	NA	I1TEJ1	Salmonella_phage	91.3	4.9e-253
AVZ69341.1|3042618_3043119_-	hypothetical protein	NA	I1TEJ0	Salmonella_phage	100.0	3.2e-90
AVZ69342.1|3043102_3043663_-	hypothetical protein	NA	C6ZR11	Salmonella_phage	97.8	4.5e-101
AVZ69343.1|3043703_3044996_-|coat	coat protein	coat	I1TEI8	Salmonella_phage	98.8	4.0e-241
AVZ69344.1|3044995_3045907_-	scaffolding protein	NA	A0A192Y6T4	Salmonella_phage	100.0	4.9e-161
AVZ69345.1|3045920_3048098_-|portal	portal protein	portal	I6R968	Salmonella_phage	98.6	0.0e+00
AVZ69346.1|3048097_3049597_-|terminase	terminase	terminase	A0A192Y824	Salmonella_phage	99.6	4.1e-306
AVZ69347.1|3049574_3050063_-	DNA-packaging protein	NA	A8CGG1	Salmonella_phage	100.0	2.9e-88
AVZ69348.1|3050066_3050471_-	Decoration protein	NA	C6ZR73	Salmonella_phage	98.5	1.5e-66
AVZ70824.1|3050473_3050716_-	hypothetical protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
AVZ69349.1|3051018_3051705_-	hypothetical protein	NA	A0A192Y918	Salmonella_phage	99.6	1.4e-123
AVZ69350.1|3051691_3051883_-	hypothetical protein	NA	A0A1V0E5I0	Salmonella_phage	92.1	2.1e-26
AVZ69351.1|3051917_3052355_-|lysis	lysis protein	lysis	A0A0N6WGE8	Salmonella_phage	94.5	2.1e-69
AVZ69352.1|3052351_3052789_-	muraminidase	NA	Q5G8R3	Enterobacteria_phage	97.9	1.1e-73
AVZ69353.1|3052772_3053099_-|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
AVZ69354.1|3053324_3053846_-	endodeoxyribonuclease	NA	A0A1V0E5R7	Salmonella_phage	62.8	1.6e-55
AVZ69355.1|3053927_3054422_-	hypothetical protein	NA	A0A248SKL5	Klebsiella_phage	50.3	3.7e-38
AVZ69356.1|3054796_3055561_-	antitermination protein	NA	Q5G8R6	Enterobacteria_phage	98.0	6.1e-141
AVZ69357.1|3055557_3055740_-	hypothetical protein	NA	C6ZR61	Salmonella_phage	95.0	6.1e-23
AVZ69358.1|3055727_3056198_-	hypothetical protein	NA	C6ZR60	Salmonella_phage	95.5	4.8e-88
AVZ69359.1|3056178_3056415_-	hypothetical protein	NA	C6ZR59	Salmonella_phage	92.3	8.1e-36
AVZ69360.1|3056407_3056584_-	protein ninF	NA	K7P6R5	Enterobacteria_phage	91.2	9.1e-24
AVZ69361.1|3056576_3056978_-	hypothetical protein	NA	G9L690	Escherichia_phage	85.0	6.0e-63
AVZ69362.1|3056980_3057157_-	NinE family protein	NA	A0A220NRK6	Escherichia_phage	96.6	3.9e-27
AVZ69363.1|3057153_3057600_-	protein ninB	NA	I6R0N7	Salmonella_phage	98.0	7.8e-80
AVZ69364.1|3057556_3057853_-	hypothetical protein	NA	E7C9R7	Salmonella_phage	89.8	1.1e-42
AVZ69365.1|3057855_3058128_-	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	91.0	9.7e-41
AVZ69366.1|3058198_3058477_-	hypothetical protein	NA	Q5G8S7	Enterobacteria_phage	93.5	5.1e-45
AVZ69367.1|3058473_3058731_-	hypothetical protein	NA	A0A1S5RG58	Helicobacter_phage	46.0	1.3e-10
AVZ69368.1|3058748_3059015_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ69369.1|3059011_3060379_-	replicative DNA helicase	NA	Q76H51	Enterobacteria_phage	94.8	2.3e-239
AVZ70825.1|3060375_3061236_-	replication protein	NA	G9L680	Escherichia_phage	65.0	3.6e-89
AVZ69370.1|3061298_3061559_-	hypothetical protein	NA	G9L679	Escherichia_phage	74.1	3.4e-27
AVZ69371.1|3061580_3061871_-	hypothetical protein	NA	I6RSP4	Salmonella_phage	100.0	2.4e-45
AVZ69372.1|3061979_3062207_-	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	78.7	1.1e-26
AVZ69373.1|3062316_3063003_+	hypothetical protein	NA	G8C7U1	Escherichia_phage	76.4	4.7e-92
AVZ69374.1|3063064_3063502_+	hypothetical protein	NA	C6ZR46	Salmonella_phage	97.2	3.7e-74
AVZ69375.1|3063488_3063800_+	hypothetical protein	NA	C6ZR45	Salmonella_phage	99.0	1.7e-44
AVZ69376.1|3063935_3064139_-	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	100.0	2.0e-27
AVZ69377.1|3064270_3064450_-	hypothetical protein	NA	A0A075B8J1	Enterobacteria_phage	98.1	1.5e-21
AVZ69378.1|3064517_3064856_+	hypothetical protein	NA	E7C9Q7	Salmonella_phage	94.6	1.5e-54
AVZ69379.1|3064934_3065129_+	restriction endonuclease	NA	A0A2H4FS18	Salmonella_phage	100.0	2.5e-30
AVZ70826.1|3065212_3065713_+	HNH endonuclease	NA	A5H1L2	Xanthomonas_virus	44.5	1.4e-32
AVZ69380.1|3065746_3066043_+	hypothetical protein	NA	K7PH98	Enterobacteria_phage	72.4	1.9e-34
AVZ69381.1|3066360_3066534_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.6e-23
AVZ69382.1|3066514_3066703_+	protein kil	NA	I6S647	Salmonella_phage	100.0	3.7e-31
AVZ69383.1|3066832_3067540_+	recombinase	NA	I6R0N0	Salmonella_phage	97.0	1.0e-134
AVZ69384.1|3067540_3068047_+	ssDNA-binding protein	NA	C6ZR36	Salmonella_phage	98.8	8.6e-91
AVZ69385.1|3068055_3068604_+	ATPase	NA	C6ZR35	Salmonella_phage	99.5	1.0e-105
AVZ69386.1|3068619_3068913_+	RecBCD nuclease inhibitor	NA	C6ZR34	Salmonella_phage	88.7	4.5e-44
AVZ69387.1|3068923_3069097_+	DUF2737 domain-containing protein	NA	A0A2H4FUQ1	Salmonella_phage	98.2	5.6e-26
AVZ69388.1|3069093_3069609_+	hypothetical protein	NA	E7C9P6	Salmonella_phage	47.3	1.4e-19
AVZ69389.1|3069605_3070031_+	hypothetical protein	NA	A0A2H4FRZ0	Salmonella_phage	53.9	2.2e-39
AVZ69390.1|3070030_3070786_+	hypothetical protein	NA	H6WRY1	Salmonella_phage	99.6	4.2e-150
AVZ69391.1|3070796_3071114_+	hypothetical protein	NA	Q5G8V1	Enterobacteria_phage	61.1	1.2e-29
AVZ70827.1|3071472_3071730_+	hypothetical protein	NA	A5LH60	Enterobacteria_phage	94.7	3.1e-41
AVZ69392.1|3071729_3072002_+	hypothetical protein	NA	A0A2H4FNB3	Salmonella_phage	97.8	1.7e-37
AVZ69393.1|3072172_3072391_+	excisionase	NA	A0A1V0E5M4	Salmonella_phage	100.0	5.7e-36
AVZ69394.1|3072368_3073439_+|integrase	integrase	integrase	A0A1V0E5M7	Salmonella_phage	100.0	1.0e-154
3073505:3073527	attR	CGTTCAACTTAGTATAAAAAAGC	NA	NA	NA	NA
