The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	0	8767	4221270	tRNA,protease	Organic_Lake_phycodnavirus(20.0%)	7	NA	NA
AWC92151.1|696_2463_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.9	2.0e-17
AWC92152.1|2440_3160_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AWC92153.1|3310_3529_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AWC92154.1|3605_5891_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.5	3.7e-173
AWC92155.1|5924_6245_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	46.7	2.6e-16
AWC92156.1|6503_6734_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	56.7	2.6e-15
AWC92157.1|6820_8767_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.3	1.5e-37
>prophage 2
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	14293	19753	4221270		Planktothrix_phage(33.33%)	8	NA	NA
AWC92162.1|14293_15022_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.8	1.2e-29
AWC92163.1|15061_15796_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWC92164.1|15811_16516_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
AWC92165.1|16512_17187_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
AWC92166.1|17250_18375_-	23S rRNA (uracil(747)-C(5))-methyltransferase	NA	A0A1X9I6F4	Streptococcus_phage	26.4	2.5e-26
AWC92167.1|18410_18899_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
AWC95872.1|19004_19316_-	DUF1418 domain-containing protein	NA	NA	NA	NA	NA
AWC92168.1|19489_19753_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	70.5	5.9e-27
>prophage 3
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	27482	31631	4221270		Stx2-converting_phage(50.0%)	5	NA	NA
AWC92175.1|27482_28685_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.5	1.7e-97
AWC92176.1|28899_29520_+	glutathione S-transferase	NA	NA	NA	NA	NA
AWC92177.1|29523_30351_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AWC95873.1|30549_30597_+	histidine operon leader peptide	NA	NA	NA	NA	NA
AWC92178.1|30731_31631_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	89.5	1.7e-09
>prophage 4
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	41536	44758	4221270		Moraxella_phage(50.0%)	2	NA	NA
AWC92189.1|41536_43108_-	hypothetical protein	NA	A0A0R6PEZ3	Moraxella_phage	46.3	1.9e-40
AWC92190.1|43345_44758_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.6	3.9e-40
>prophage 5
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	49932	54901	4221270	tRNA	Catovirus(66.67%)	5	NA	NA
AWC92196.1|49932_50514_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.6	1.9e-30
AWC92197.1|50582_51227_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.0	1.8e-37
AWC92198.1|51498_52611_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
AWC92199.1|52638_52827_+	hypothetical protein	NA	NA	NA	NA	NA
AWC92200.1|52867_54901_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	25.8	2.9e-28
>prophage 6
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	61821	62481	4221270		Vibrio_phage(100.0%)	1	NA	NA
AWC92208.1|61821_62481_-	GTP cyclohydrolase I FolE	NA	R9TJA5	Vibrio_phage	58.0	8.9e-56
>prophage 7
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	73748	79280	4221270		Enterococcus_phage(33.33%)	5	NA	NA
AWC92218.1|73748_74324_-	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	35.1	1.3e-18
AWC92219.1|74572_75472_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
AWC92220.1|75614_76118_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YTY5	Streptomyces_phage	28.7	7.6e-07
AWC92221.1|76450_77155_+	molecular chaperone	NA	NA	NA	NA	NA
AWC92222.1|77171_79280_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	25.8	1.6e-45
>prophage 8
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	82900	87941	4221270		Diachasmimorpha_longicaudata_entomopoxvirus(50.0%)	4	NA	NA
AWC92227.1|82900_84247_-	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.3	5.5e-52
AWC92228.1|84461_85148_+	transcriptional regulator	NA	NA	NA	NA	NA
AWC92229.1|85187_86186_+	secretion protein HlyD	NA	NA	NA	NA	NA
AWC92230.1|86195_87941_+	multidrug ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.2	6.9e-23
>prophage 9
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	95469	96378	4221270		Streptococcus_phage(100.0%)	1	NA	NA
AWC92240.1|95469_96378_+	hypothetical protein	NA	A1IMD5	Streptococcus_phage	28.2	4.3e-24
>prophage 10
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	102660	107887	4221270		Klosneuvirus(50.0%)	5	NA	NA
AWC92246.1|102660_103962_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	33.0	6.5e-18
AWC92247.1|104142_105132_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
AWC92248.1|105354_106176_+	pyridoxal phosphatase	NA	NA	NA	NA	NA
AWC92249.1|106264_106621_-	hypothetical protein	NA	NA	NA	NA	NA
AWC92250.1|106819_107887_-	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.8	1.2e-22
>prophage 11
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	113612	120104	4221270	protease	Cedratvirus(33.33%)	6	NA	NA
AWC92257.1|113612_115064_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	29.6	2.5e-10
AWC92258.1|115250_116069_+|protease	CPBP family intramembrane metalloprotease domain-containing protein	protease	NA	NA	NA	NA
AWC92259.1|116306_117059_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
AWC92260.1|117133_118186_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	48.0	8.0e-83
AWC92261.1|118384_119314_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AWC92262.1|119402_120104_-	nicotinamide riboside transporter PnuC	NA	I6W764	Vibriophage	36.0	1.7e-25
>prophage 12
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	141727	143494	4221270		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AWC92284.1|141727_143494_-	succinate dehydrogenase flavoprotein subunit	NA	M1HTN0	Paramecium_bursaria_Chlorella_virus	26.2	5.2e-18
>prophage 13
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	152585	222827	4221270	tRNA,portal,tail,holin,head,capsid,terminase,integrase	Morganella_phage(33.33%)	78	167016:167032	228583:228599
AWC92295.1|152585_153365_+	esterase	NA	E0YQD5	Mycobacterium_phage	35.3	1.2e-06
AWC92296.1|153394_153649_-	hypothetical protein	NA	NA	NA	NA	NA
AWC95875.1|153958_154252_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
AWC92297.1|154398_154929_+	flavodoxin FldA	NA	NA	NA	NA	NA
AWC92298.1|155108_155558_+	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
AWC92299.1|155687_157355_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	85.0	2.3e-286
AWC92300.1|157529_159563_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	46.8	2.1e-10
AWC92301.1|159991_160801_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
AWC92302.1|160884_162048_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
AWC92303.1|162061_163297_+	transcriptional regulator	NA	NA	NA	NA	NA
AWC92304.1|163312_163510_+	hypothetical protein	NA	NA	NA	NA	NA
AWC92305.1|164319_165501_-	2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase	NA	NA	NA	NA	NA
AWC92306.1|165704_167144_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
167016:167032	attL	CGCGGCCGCGTGATCCG	NA	NA	NA	NA
AWC92307.1|167196_168279_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	47.4	1.2e-49
AWC92308.1|168271_168736_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
AWC92309.1|168914_169199_+	hypothetical protein	NA	A0A1W6JP10	Morganella_phage	88.8	1.9e-39
AWC92310.1|169278_169554_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWC92311.1|169646_170489_-	DUF3800 domain-containing protein	NA	A5X9G9	Aeromonas_virus	44.5	5.5e-58
AWC95876.1|170681_171218_-	hypothetical protein	NA	A0A1W6JNW0	Morganella_phage	97.5	9.4e-88
AWC92312.1|172327_173383_-	hypothetical protein	NA	NA	NA	NA	NA
AWC92313.1|173379_176592_-	host specificity protein	NA	A0A1W6JNZ7	Morganella_phage	95.0	0.0e+00
AWC92314.1|176624_177227_-|tail	phage tail protein	tail	A0A1W6JNY8	Morganella_phage	98.0	2.9e-106
AWC92315.1|177277_177934_+	hypothetical protein	NA	A0A2L1IV31	Escherichia_phage	35.2	7.3e-26
AWC92316.1|177930_178629_-	peptidase P60	NA	A0A1W6JP31	Morganella_phage	95.2	6.6e-134
AWC92317.1|178631_179390_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	95.2	5.0e-143
AWC92318.1|179386_179722_-|tail	phage tail protein	tail	A0A1W6JP11	Morganella_phage	78.4	1.0e-47
AWC92319.1|179724_183024_-|tail	phage tail tape measure protein	tail	B7SE05	Pseudomonas_virus	47.6	3.4e-55
AWC92320.1|183053_183338_-	hypothetical protein	NA	NA	NA	NA	NA
AWC92321.1|183334_183751_-	hypothetical protein	NA	NA	NA	NA	NA
AWC92322.1|183815_184520_-	hypothetical protein	NA	NA	NA	NA	NA
AWC95877.1|184529_184871_-	hypothetical protein	NA	NA	NA	NA	NA
AWC92323.1|184870_185347_-	hypothetical protein	NA	A0A0R6PHU8	Moraxella_phage	30.5	2.2e-08
AWC95878.1|185339_185678_-|head,tail	head-tail adaptor protein	head,tail	A0A1W6JP44	Morganella_phage	38.6	1.1e-09
AWC92324.1|185685_186012_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	36.1	1.6e-10
AWC92325.1|186008_186965_-|portal	phage portal protein	portal	A0A0P0ZCZ4	Stx2-converting_phage	53.8	2.5e-38
AWC92326.1|186948_188280_-|portal	phage portal protein	portal	S4TTG7	Salmonella_phage	53.2	4.8e-125
AWC92327.1|188326_188602_-	hypothetical protein	NA	NA	NA	NA	NA
AWC92328.1|188654_190601_-|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	62.4	7.3e-215
AWC92329.1|190638_192303_-|terminase	terminase	terminase	S4TSQ6	Salmonella_phage	78.8	1.9e-267
AWC92330.1|192299_192761_-|terminase	terminase	terminase	S4TNN3	Salmonella_phage	48.4	7.9e-27
AWC92331.1|192919_193216_-	HNH endonuclease	NA	A0A2P1JT81	Streptomyces_phage	52.0	6.9e-08
AWC92332.1|193212_193464_-	hypothetical protein	NA	NA	NA	NA	NA
AWC92333.1|193713_193932_-	hypothetical protein	NA	NA	NA	NA	NA
AWC92334.1|193928_194150_-	peptidase	NA	A0A1W6JNV7	Morganella_phage	73.2	3.3e-15
AWC92335.1|194067_194445_-	hypothetical protein	NA	A0A1W6JP00	Morganella_phage	89.6	7.3e-55
AWC92336.1|194581_195058_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	91.7	4.4e-81
AWC92337.1|195038_195263_-|holin	holin	holin	A0A1W6JNY9	Morganella_phage	77.1	1.2e-23
AWC95879.1|195701_196997_-	hypothetical protein	NA	NA	NA	NA	NA
AWC92338.1|197236_198292_-	DNA adenine methylase	NA	A0A1W6JP25	Morganella_phage	95.2	1.6e-179
AWC92339.1|198893_199673_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	38.9	8.1e-48
AWC92340.1|199672_200659_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	60.1	2.9e-111
AWC92341.1|200655_202233_-	helicase	NA	A0A286N2P9	Klebsiella_phage	67.0	3.6e-212
AWC92342.1|202497_202776_-	hypothetical protein	NA	A0A0N7BYT1	Escherichia_phage	50.0	1.7e-16
AWC92343.1|202744_202984_-	transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	59.7	2.9e-17
AWC92344.1|203088_203733_+	LexA family transcriptional repressor	NA	K7PH19	Enterobacteria_phage	61.9	9.0e-77
AWC92345.1|203941_204169_+	hypothetical protein	NA	NA	NA	NA	NA
AWC92346.1|204170_204359_+	hypothetical protein	NA	NA	NA	NA	NA
AWC92347.1|204526_204922_+	hypothetical protein	NA	NA	NA	NA	NA
AWC92348.1|204924_205422_+	hypothetical protein	NA	NA	NA	NA	NA
AWC92349.1|205911_206250_+	hypothetical protein	NA	NA	NA	NA	NA
AWC92350.1|206272_206980_+	DNA-binding protein	NA	Q8W645	Enterobacteria_phage	68.0	5.6e-88
AWC95880.1|206979_207552_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	38.4	7.8e-32
AWC92351.1|207564_207786_+	hypothetical protein	NA	NA	NA	NA	NA
AWC92352.1|207782_208040_+	hypothetical protein	NA	NA	NA	NA	NA
AWC92353.1|208163_208481_+	hypothetical protein	NA	NA	NA	NA	NA
AWC92354.1|208477_208684_+	hypothetical protein	NA	NA	NA	NA	NA
AWC92355.1|208640_209903_-|integrase	integrase	integrase	A5LH57	Enterobacteria_phage	47.8	3.3e-107
AWC92356.1|210168_211059_+	magnesium/cobalt transporter CorC	NA	NA	NA	NA	NA
AWC92357.1|211055_212609_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
AWC92358.1|212679_213177_-	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
AWC92359.1|213176_213905_-	DsbA family protein	NA	NA	NA	NA	NA
AWC95881.1|213901_215938_-	protein-disulfide reductase	NA	NA	NA	NA	NA
AWC92360.1|215995_216364_-	copper-binding protein	NA	NA	NA	NA	NA
AWC92361.1|216790_217693_+	glutamate/aspartate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWC92362.1|217891_218629_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWC92363.1|218628_219306_+	glutamate/aspartate ABC transporter permease GltK	NA	NA	NA	NA	NA
AWC92364.1|219302_220028_+	arginine transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	37.8	4.9e-31
AWC92365.1|220244_222827_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.5	2.8e-193
228583:228599	attR	CGCGGCCGCGTGATCCG	NA	NA	NA	NA
>prophage 14
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	230917	233214	4221270		Synechococcus_phage(50.0%)	2	NA	NA
AWC92373.1|230917_231907_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	43.2	2.2e-10
AWC92374.1|231999_233214_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.8	3.1e-102
>prophage 15
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	236654	244709	4221270	tRNA	Mycobacterium_phage(40.0%)	8	NA	NA
AWC92379.1|236654_236864_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	78.1	4.5e-22
AWC92380.1|237063_237531_-	cysteine methyltransferase	NA	NA	NA	NA	NA
AWC92381.1|237712_238795_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
AWC92382.1|239103_239322_+	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	51.4	2.3e-16
AWC92383.1|239343_239760_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
AWC92384.1|239791_241912_+	ribonucleotide-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	52.4	1.4e-206
AWC92385.1|241935_242898_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	73.4	2.2e-135
AWC92386.1|243503_244709_+	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.5	4.2e-27
>prophage 16
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	270260	274680	4221270		Enterobacteria_phage(50.0%)	3	NA	NA
AWC92400.1|270260_272834_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	36.6	7.6e-127
AWC92401.1|272949_273693_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AWC92402.1|273702_274680_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	A0A2H4UV25	Bodo_saltans_virus	27.0	2.1e-05
>prophage 17
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	277785	281062	4221270		Catovirus(50.0%)	3	NA	NA
AWC92406.1|277785_278763_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	26.3	2.9e-26
AWC92407.1|278827_279949_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AWC92408.1|279967_281062_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A2I6UFP9	Klebsiella_phage	52.0	6.0e-89
>prophage 18
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	290731	295830	4221270	tRNA	Vibrio_phage(25.0%)	4	NA	NA
AWC92418.1|290731_290923_-	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	3.9e-12
AWC92419.1|291152_293780_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	36.8	6.0e-79
AWC92420.1|294151_295222_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.9	1.2e-113
AWC92421.1|295308_295830_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	47.4	2.0e-26
>prophage 19
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	300031	302401	4221270		Streptococcus_phage(100.0%)	2	NA	NA
AWC92425.1|300031_301285_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.6	7.0e-94
AWC92426.1|301297_302401_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.2	4.5e-60
>prophage 20
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	306463	307519	4221270		Streptococcus_phage(100.0%)	1	NA	NA
AWC92431.1|306463_307519_-	DNA polymerase IV	NA	E4ZFJ2	Streptococcus_phage	23.6	3.4e-09
>prophage 21
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	319076	319655	4221270		Caulobacter_phage(100.0%)	1	NA	NA
AWC92440.1|319076_319655_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.4e-12
>prophage 22
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	346663	347593	4221270		Caulobacter_phage(100.0%)	1	NA	NA
AWC92467.1|346663_347593_-	DNA primase	NA	A0A1V0EEV1	Caulobacter_phage	40.1	1.8e-49
>prophage 23
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	351688	359635	4221270		Moraxella_phage(100.0%)	1	NA	NA
AWC92472.1|351688_359635_-	hypothetical protein	NA	A0A0R6PJK4	Moraxella_phage	37.3	1.3e-47
>prophage 24
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	371827	373318	4221270		Aeromonas_phage(100.0%)	1	NA	NA
AWC92481.1|371827_373318_+	acetylneuraminate ABC transporter	NA	A0A240F3J2	Aeromonas_phage	26.8	5.9e-23
>prophage 25
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	378006	378705	4221270		Planktothrix_phage(100.0%)	1	NA	NA
AWC92487.1|378006_378705_-	ABC transporter	NA	G9BWD6	Planktothrix_phage	34.2	6.4e-28
>prophage 26
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	386582	387401	4221270		Grouper_iridovirus(100.0%)	1	NA	NA
AWC92491.1|386582_387401_-	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	41.9	1.3e-59
>prophage 27
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	401498	403499	4221270	holin	Vibrio_phage(100.0%)	1	NA	NA
AWC92504.1|401498_403499_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	26.5	2.1e-23
>prophage 28
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	410454	419338	4221270		Caulobacter_phage(33.33%)	10	NA	NA
AWC92510.1|410454_411030_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	39.6	1.8e-28
AWC92511.1|411090_411669_-	TerD family protein	NA	A0A2P1N0C0	Streptomyces_phage	38.1	4.8e-05
AWC92512.1|411711_412746_-	tellurium resistance protein TerC	NA	K7QKE8	Escherichia_phage	49.3	3.4e-78
AWC92513.1|412768_413224_-	Tellurium resistance protein TerB	NA	NA	NA	NA	NA
AWC92514.1|413243_414401_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
AWC92515.1|414400_414988_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	28.0	7.0e-12
AWC92516.1|415282_416341_+	carbamoyl-phosphate synthase large chain	NA	NA	NA	NA	NA
AWC92517.1|416327_417491_+	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	29.6	5.6e-37
AWC92518.1|417480_418266_+	hypothetical protein	NA	NA	NA	NA	NA
AWC92519.1|418258_419338_+	hypothetical protein	NA	A0A172Q0S8	Acinetobacter_phage	35.3	5.0e-40
>prophage 29
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	427002	438317	4221270		Enterobacteria_phage(16.67%)	10	NA	NA
AWC92526.1|427002_428340_-	hypothetical protein	NA	Q9KX94	Enterobacteria_phage	28.8	5.7e-25
AWC95893.1|428837_429095_-	hypothetical protein	NA	NA	NA	NA	NA
AWC92527.1|429091_429826_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.4	5.0e-39
AWC92528.1|429887_430358_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	57.2	1.5e-49
AWC92529.1|430361_431093_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWC95894.1|431133_431889_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AWC92530.1|431972_433370_+	murein transglycosylase D	NA	C1KFN7	Lactobacillus_virus	38.4	5.4e-10
AWC92531.1|433587_434973_-	Anion transporter	NA	NA	NA	NA	NA
AWC92532.1|435307_436606_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.1	1.2e-131
AWC92533.1|436679_438317_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.9	3.6e-154
>prophage 30
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	441605	442988	4221270		Erysipelothrix_phage(100.0%)	1	NA	NA
AWC92536.1|441605_442988_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	25.7	1.1e-28
>prophage 31
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	448100	450466	4221270		Pseudomonas_phage(50.0%)	3	NA	NA
AWC92541.1|448100_449069_+	hypothetical protein	NA	A0A1Y0STI6	Pseudomonas_phage	31.8	2.7e-16
AWC92542.1|449120_449975_-	dimethyl sulfoxide reductase	NA	NA	NA	NA	NA
AWC92543.1|449986_450466_-	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	57.1	4.3e-52
>prophage 32
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	457394	464893	4221270		Escherichia_phage(60.0%)	8	NA	NA
AWC92549.1|457394_457739_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	48.6	1.3e-26
AWC92550.1|457978_459259_+	glutamate-1-semialdehyde-2,1-aminomutase	NA	NA	NA	NA	NA
AWC95895.1|459316_459553_-	hypothetical protein	NA	NA	NA	NA	NA
AWC92551.1|459762_460128_-	DUF2778 domain-containing protein	NA	A0A1S6L3A5	Erwinia_phage	38.7	4.2e-15
AWC92552.1|460351_460924_-	DmsD	NA	A0A077SLS7	Escherichia_phage	33.7	1.7e-18
AWC92553.1|460935_461838_-	reductase	NA	NA	NA	NA	NA
AWC92554.1|461834_462476_-	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	56.5	1.8e-61
AWC92555.1|462472_464893_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	38.6	5.1e-141
>prophage 33
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	475816	485894	4221270	tRNA	Escherichia_phage(25.0%)	8	NA	NA
AWC92564.1|475816_476167_-	addiction module antidote protein, HigA family	NA	A0A0N7BS23	Escherichia_phage	42.7	3.1e-15
AWC92565.1|476264_478772_-	bifunctional glycosyl transferase/transpeptidase	NA	NA	NA	NA	NA
AWC92566.1|478906_481357_-	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	28.6	1.4e-37
AWC92567.1|481449_482160_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
AWC92568.1|482347_482803_+	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
AWC95896.1|482858_483761_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AWC92569.1|483840_485397_+	polynucleotide adenylyltransferase	NA	G3MAR3	Bacillus_virus	36.3	5.8e-29
AWC92570.1|485393_485894_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4W084	Pandoravirus	40.6	1.2e-17
>prophage 34
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	489433	498494	4221270		Bacillus_phage(25.0%)	8	NA	NA
AWC92574.1|489433_491140_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	29.2	1.8e-23
AWC92575.1|491210_491633_-	hypothetical protein	NA	NA	NA	NA	NA
AWC92576.1|491607_493062_-	serine 3-dehydrogenase	NA	NA	NA	NA	NA
AWC92577.1|493357_494128_-	ABC transporter permease	NA	NA	NA	NA	NA
AWC92578.1|494124_495051_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	1.9e-19
AWC92579.1|495235_495895_+	carbonate dehydratase	NA	NA	NA	NA	NA
AWC92580.1|496196_496712_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	2.0e-15
AWC92581.1|496889_498494_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	58.9	2.4e-22
>prophage 35
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	506042	507092	4221270		Bacillus_virus(100.0%)	1	NA	NA
AWC92588.1|506042_507092_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.1	1.6e-30
>prophage 36
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	516018	518130	4221270		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AWC92596.1|516018_518130_+	colicin V synthesis protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.5	4.5e-16
>prophage 37
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	557773	560293	4221270		Erwinia_phage(50.0%)	3	NA	NA
AWC92622.1|557773_558325_+	RNA 2'-phosphotransferase	NA	A0A2H4IBJ2	Erwinia_phage	41.4	1.1e-30
AWC92623.1|558331_559162_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AWC92624.1|559183_560293_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	3.6e-33
>prophage 38
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	579071	580439	4221270		Moraxella_phage(100.0%)	1	NA	NA
AWC92638.1|579071_580439_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	72.8	8.3e-157
>prophage 39
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	635095	635944	4221270		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
AWC92691.1|635095_635944_+	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	27.6	1.1e-10
>prophage 40
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	659654	665996	4221270		uncultured_Mediterranean_phage(40.0%)	5	NA	NA
AWC92711.1|659654_662216_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	21.0	7.3e-29
AWC92712.1|662306_663299_-	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	32.9	9.4e-33
AWC92713.1|663348_664470_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.1	2.2e-06
AWC92714.1|664611_665238_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	44.2	1.1e-34
AWC92715.1|665234_665996_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	50.8	6.7e-63
>prophage 41
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	671680	672352	4221270		Vibrio_phage(100.0%)	1	NA	NA
AWC92722.1|671680_672352_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1B0Z0A9	Vibrio_phage	29.3	3.5e-15
>prophage 42
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	682929	683964	4221270		Planktothrix_phage(100.0%)	1	NA	NA
AWC92728.1|682929_683964_+	D-methionine ABC transporter, ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	1.4e-34
>prophage 43
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	692225	696312	4221270		Saccharomonospora_phage(50.0%)	2	NA	NA
AWC92738.1|692225_695705_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.4	1.3e-201
AWC92739.1|695715_696312_-	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	46.6	4.9e-29
>prophage 44
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	705146	705920	4221270		Flavobacterium_phage(100.0%)	1	NA	NA
AWC92747.1|705146_705920_-	(2E,6E)-farnesyl- diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	40.0	7.3e-25
>prophage 45
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	719471	722575	4221270		Vibrio_phage(50.0%)	3	NA	NA
AWC92761.1|719471_720323_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	35.1	7.8e-36
AWC92762.1|720383_721751_+	LOG family protein	NA	NA	NA	NA	NA
AWC92763.1|721807_722575_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	28.9	4.3e-09
>prophage 46
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	726316	741912	4221270	tRNA	environmental_halophage(16.67%)	9	NA	NA
AWC92767.1|726316_727528_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	35.8	1.5e-69
AWC92768.1|727537_727984_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
AWC92769.1|727989_728805_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	31.6	1.0e-16
AWC92770.1|728899_729997_-	murein transglycosylase A	NA	NA	NA	NA	NA
AWC92771.1|730697_731948_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A067ZJB6	Vibrio_phage	28.5	3.8e-15
AWC92772.1|732228_733557_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
AWC92773.1|733566_735399_-	exodeoxyribonuclease V subunit alpha	NA	A0A2P0VMS9	Tetraselmis_virus	24.8	2.1e-17
AWC92774.1|735398_739016_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	22.3	3.3e-11
AWC92775.1|739020_741912_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	24.7	8.7e-71
>prophage 47
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	747651	751916	4221270		Vibrio_phage(50.0%)	3	NA	NA
AWC92781.1|747651_748587_+	thymidylate synthase	NA	H9EB68	Vibrio_phage	62.4	4.7e-111
AWC92782.1|748663_749560_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AWC92783.1|749669_751916_-	phosphoenolpyruvate-protein phosphotransferase PtsP	NA	A0A1V0SGR7	Hokovirus	26.8	1.0e-10
>prophage 48
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	755410	761677	4221270		Planktothrix_phage(33.33%)	3	NA	NA
AWC92786.1|755410_756109_+	thiamine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.0	3.1e-22
AWC92787.1|756181_758557_+	DNA polymerase II	NA	L7TKF2	Halovirus	23.1	4.4e-20
AWC92788.1|758770_761677_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	36.1	3.2e-20
>prophage 49
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	769544	770968	4221270		Microcystis_phage(50.0%)	2	NA	NA
AWC92796.1|769544_770378_+	diadenosine tetraphosphatase	NA	A0A075BTY6	Microcystis_phage	44.3	2.1e-09
AWC92797.1|770473_770968_-	type 3 dihydrofolate reductase	NA	A0A1I9S5V6	Bacillus_phage	44.8	7.4e-31
>prophage 50
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	775052	779252	4221270		Bacillus_virus(100.0%)	2	NA	NA
AWC92801.1|775052_777314_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.2	2.2e-85
AWC92802.1|777356_779252_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.7	2.8e-94
>prophage 51
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	783395	789125	4221270		Erwinia_phage(25.0%)	6	NA	NA
AWC92807.1|783395_784076_+	hypothetical protein	NA	A0A173GEW8	Erwinia_phage	43.6	5.4e-32
AWC92808.1|784081_785242_+	hypothetical protein	NA	B2ZXR7	Ralstonia_phage	47.3	3.1e-96
AWC92809.1|785316_786096_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
AWC92810.1|786282_786936_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.2	1.9e-42
AWC92811.1|787390_787651_+	cytoplasmic protein	NA	NA	NA	NA	NA
AWC92812.1|787697_789125_-	bifunctional heptose 7-phosphate kinase/heptose 1-phosphate adenyltransferase	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.7	6.0e-41
>prophage 52
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	793936	795115	4221270		Sinorhizobium_phage(100.0%)	1	NA	NA
AWC92816.1|793936_795115_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	40.4	5.3e-67
>prophage 53
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	798881	799706	4221270		Staphylococcus_phage(100.0%)	1	NA	NA
AWC92821.1|798881_799706_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	43.2	6.1e-62
>prophage 54
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	804713	805853	4221270		Halovirus(100.0%)	1	NA	NA
AWC92824.1|804713_805853_-	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.9	7.4e-50
>prophage 55
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	809361	824381	4221270	tRNA	Tupanvirus(20.0%)	12	NA	NA
AWC92830.1|809361_812175_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	27.3	1.5e-80
AWC92831.1|812202_813147_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
AWC95908.1|813487_813748_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
AWC92832.1|813809_814739_-	transcriptional activator NhaR	NA	NA	NA	NA	NA
AWC92833.1|814830_816009_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	48.1	2.7e-79
AWC92834.1|816261_817104_+	EamA family transporter	NA	NA	NA	NA	NA
AWC92835.1|817100_817700_-	hypothetical protein	NA	NA	NA	NA	NA
AWC92836.1|817832_818978_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	32.3	7.0e-24
AWC92837.1|819080_821003_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.1	1.4e-146
AWC92838.1|821316_822615_-	MFS transporter	NA	NA	NA	NA	NA
AWC92839.1|822736_823321_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
AWC92840.1|823427_824381_-	transaldolase	NA	A0A127KNC6	Cyanophage	32.1	7.4e-11
>prophage 56
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	837013	842792	4221270		Bacillus_phage(33.33%)	3	NA	NA
AWC92853.1|837013_838939_-	murein transglycosylase	NA	A0A0S2SXL7	Bacillus_phage	38.8	2.6e-10
AWC92854.1|839515_841183_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	26.1	3.9e-39
AWC92855.1|841529_842792_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	45.3	7.1e-86
>prophage 57
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	847300	847684	4221270		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AWC92861.1|847300_847684_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.3	1.1e-24
>prophage 58
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	867318	876046	4221270		Bacillus_virus(33.33%)	5	NA	NA
AWC92879.1|867318_869019_+	ABC transporter ATP-binding protein/permease	NA	G3M9Y6	Bacillus_virus	28.3	1.0e-10
AWC92880.1|869008_871795_+	peptidase M16	NA	A0A2K9LA15	Tupanvirus	30.1	9.1e-17
AWC92881.1|872649_873369_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
AWC92882.1|873437_874661_-	phosphopentomutase	NA	NA	NA	NA	NA
AWC95912.1|874723_876046_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.4	4.0e-79
>prophage 59
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	881380	882970	4221270		Streptococcus_phage(100.0%)	1	NA	NA
AWC92887.1|881380_882970_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	26.8	8.8e-33
>prophage 60
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	908292	908919	4221270		Streptococcus_phage(100.0%)	1	NA	NA
AWC92904.1|908292_908919_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	35.4	8.0e-22
>prophage 61
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	917776	927940	4221270		uncultured_Mediterranean_phage(25.0%)	11	NA	NA
AWC92912.1|917776_918532_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	1.1e-25
AWC92913.1|918554_919085_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
AWC92914.1|919088_919349_-	twin-arginine translocase subunit TatA	NA	NA	NA	NA	NA
AWC92915.1|919454_921092_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	27.8	2.5e-38
AWC92916.1|921078_921753_-	hypothetical protein	NA	NA	NA	NA	NA
AWC92917.1|921754_922510_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
AWC92918.1|922570_923995_-	DNA recombination protein RmuC	NA	R9RFD7	Alteromonas_phage	62.5	6.5e-11
AWC92919.1|924133_924667_-	DedA family protein	NA	NA	NA	NA	NA
AWC92920.1|924690_925473_-	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
AWC92921.1|925605_926361_-	uridine phosphorylase	NA	NA	NA	NA	NA
AWC92922.1|926803_927940_+	RNA ligase RtcB family protein	NA	B2ZXV2	Ralstonia_phage	28.5	5.2e-27
>prophage 62
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	934675	956560	4221270	tRNA	Shigella_phage(18.18%)	22	NA	NA
AWC92926.1|934675_936022_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	69.6	5.5e-153
AWC92927.1|936067_936283_+	hypothetical protein	NA	NA	NA	NA	NA
AWC92928.1|936283_937078_+	hypothetical protein	NA	NA	NA	NA	NA
AWC92929.1|937084_937834_-	permease	NA	NA	NA	NA	NA
AWC92930.1|938004_938562_+	XRE family transcriptional regulator	NA	S5FUZ3	Shigella_phage	31.7	1.2e-05
AWC92931.1|938604_938889_-	acetolactate synthase isozyme 1 small subunit	NA	NA	NA	NA	NA
AWC92932.1|938906_940598_-	acetolactate synthase catalytic subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	31.2	6.0e-64
AWC92933.1|940708_940816_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
AWC92934.1|941792_942311_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	86.0	2.2e-49
AWC92935.1|942587_945422_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.5	0.0e+00
AWC92936.1|945553_945820_+	DksA/TraR family C4-type zinc finger protein	NA	A0A2C9CZU7	Yersinia_phage	55.7	2.1e-16
AWC92937.1|945871_947068_-	aromatic amino acid aminotransferase	NA	NA	NA	NA	NA
AWC92938.1|947123_948203_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	26.7	7.6e-28
AWC92939.1|948282_949689_-	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	75.0	3.3e-193
AWC92940.1|949921_950905_+	quinone oxidoreductase	NA	NA	NA	NA	NA
AWC92941.1|950969_952016_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	A0A1W6JP59	Morganella_phage	79.1	4.0e-10
AWC95917.1|952102_953284_-	Bcr/CflA family drug resistance efflux transporter	NA	NA	NA	NA	NA
AWC92942.1|954014_954257_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWC92943.1|954305_954665_+	XRE family transcriptional regulator	NA	A0A223W054	Agrobacterium_phage	36.5	1.6e-06
AWC92944.1|954701_955172_-|tRNA	cys-tRNA(pro)/cys-tRNA(cys) deacylase	tRNA	NA	NA	NA	NA
AWC92945.1|955348_955867_+	transcriptional regulator Zur	NA	NA	NA	NA	NA
AWC92946.1|955945_956560_-	repressor LexA	NA	U5P451	Shigella_phage	45.6	1.1e-12
>prophage 63
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	966587	970268	4221270		Dickeya_phage(100.0%)	1	NA	NA
AWC92953.1|966587_970268_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	77.8	5.6e-22
>prophage 64
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	980259	984151	4221270		Prochlorococcus_phage(50.0%)	4	NA	NA
AWC92955.1|980259_981849_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/inosine monophosphate cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.9e-67
AWC92956.1|981865_983149_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
AWC92957.1|983174_983831_-	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
AWC92958.1|983878_984151_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	1.5e-20
>prophage 65
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	991431	994789	4221270		Bacillus_virus(50.0%)	3	NA	NA
AWC92966.1|991431_992460_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.2	5.7e-33
AWC92967.1|992469_993144_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
AWC92968.1|993211_994789_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.2	5.7e-16
>prophage 66
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1007188	1023028	4221270		Vibrio_phage(20.0%)	10	NA	NA
AWC92979.1|1007188_1011415_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.6	1.5e-66
AWC92980.1|1011523_1015552_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.4	7.2e-23
AWC92981.1|1015900_1016266_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
AWC92982.1|1016332_1016830_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
AWC92983.1|1017150_1017852_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
AWC92984.1|1017855_1018284_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
AWC92985.1|1018432_1018978_-	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	27.2	5.0e-12
AWC92986.1|1018988_1019366_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
AWC92987.1|1019639_1020824_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	25.7	2.2e-12
AWC92988.1|1020901_1023028_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.1	2.9e-55
>prophage 67
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1031108	1033037	4221270		Tupanvirus(100.0%)	1	NA	NA
AWC93001.1|1031108_1033037_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	31.8	1.2e-71
>prophage 68
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1041682	1049609	4221270		Klosneuvirus(20.0%)	6	NA	NA
AWC93012.1|1041682_1042903_-	bifunctional succinylornithine transaminase/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.9	8.3e-31
AWC93013.1|1043015_1043591_-	aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	62.6	2.3e-68
AWC93014.1|1043856_1044423_-	peptidylprolyl isomerase A	NA	A0A2H4UTF4	Bodo_saltans_virus	34.0	2.2e-10
AWC93015.1|1044978_1045602_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
AWC93016.1|1046051_1046564_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	1.1e-16
AWC93017.1|1046816_1049609_-	DNA polymerase I	NA	A0A142F1Q9	Bacillus_phage	32.6	3.4e-72
>prophage 69
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1055359	1056712	4221270		Erysipelothrix_phage(100.0%)	1	NA	NA
AWC95926.1|1055359_1056712_-	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.4	1.1e-39
>prophage 70
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1065312	1067287	4221270		Bacillus_virus(50.0%)	2	NA	NA
AWC95927.1|1065312_1066329_-	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.9	5.7e-17
AWC93033.1|1066303_1067287_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
>prophage 71
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1081591	1084668	4221270		Abalone_herpesvirus(50.0%)	3	NA	NA
AWC93044.1|1081591_1082215_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	36.9	2.0e-20
AWC93045.1|1082269_1082545_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AWC93046.1|1082562_1084668_+	guanosine-3',5'-bis(diphosphate) 3'-diphosphatase	NA	A0A2I2L310	Orpheovirus	36.0	1.3e-10
>prophage 72
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1088997	1090383	4221270		environmental_Halophage(100.0%)	1	NA	NA
AWC93050.1|1088997_1090383_+	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	76.1	1.8e-50
>prophage 73
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1093469	1200312	4221270	tRNA,portal,transposase,lysis,tail,integrase,capsid,terminase,plate,protease	Salmonella_phage(39.53%)	106	1109588:1109603	1187073:1187088
AWC93053.1|1093469_1093907_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
AWC93054.1|1093940_1094558_-	glucose-1-phosphatase	NA	NA	NA	NA	NA
AWC93055.1|1094779_1096600_-	translational GTPase TypA	NA	NA	NA	NA	NA
AWC93056.1|1097161_1098571_+	glutamine synthetase	NA	NA	NA	NA	NA
AWC93057.1|1098725_1099775_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	23.9	9.3e-07
AWC93058.1|1099793_1101248_+	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
AWC93059.1|1101244_1102615_-	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AWC93060.1|1102747_1103026_-	hypothetical protein	NA	NA	NA	NA	NA
AWC93061.1|1103288_1103792_-	Der GTPase-activating protein YihI	NA	NA	NA	NA	NA
AWC93062.1|1104007_1105480_+	glycosyltransferase	NA	NA	NA	NA	NA
AWC93063.1|1105543_1105918_-	hypothetical protein	NA	NA	NA	NA	NA
AWC95930.1|1105941_1106592_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
AWC93064.1|1106805_1108206_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
AWC93065.1|1108202_1109114_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
AWC93066.1|1109229_1110432_-	MFS transporter	NA	NA	NA	NA	NA
1109588:1109603	attL	AACACTTTTTCTGCTG	NA	NA	NA	NA
AWC93067.1|1110923_1112132_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	49.2	5.4e-51
AWC93068.1|1112165_1112609_-	hypothetical protein	NA	NA	NA	NA	NA
AWC93069.1|1112806_1113028_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.6	3.9e-16
AWC93070.1|1113090_1114470_-	argininosuccinate lyase	NA	NA	NA	NA	NA
AWC93071.1|1114547_1115771_-	argininosuccinate synthase	NA	NA	NA	NA	NA
AWC93072.1|1115840_1116614_-	acetylglutamate kinase	NA	NA	NA	NA	NA
AWC93073.1|1116656_1117667_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
AWC93074.1|1117764_1118925_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
AWC93075.1|1119144_1120044_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
AWC93076.1|1120175_1120814_-	hypothetical protein	NA	NA	NA	NA	NA
AWC93077.1|1121010_1121643_-	hypothetical protein	NA	NA	NA	NA	NA
AWC93078.1|1121787_1122123_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AWC93079.1|1122270_1124904_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
AWC93080.1|1125622_1128055_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
AWC93081.1|1128063_1129224_-	O-succinylhomoserine (thiol)-lyase	NA	NA	NA	NA	NA
AWC93082.1|1129407_1129725_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
AWC93083.1|1129845_1130061_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
AWC95931.1|1130349_1132566_+	primosomal protein N'	NA	NA	NA	NA	NA
AWC93084.1|1132817_1133846_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
AWC93085.1|1133923_1134730_+	cell division protein FtsN	NA	NA	NA	NA	NA
AWC93086.1|1134830_1135361_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
AWC93087.1|1135372_1136707_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	28.3	8.4e-45
AWC93088.1|1136821_1137751_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
AWC93089.1|1137878_1138412_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
AWC93090.1|1138767_1139010_-	cell division protein ZapB	NA	NA	NA	NA	NA
AWC93091.1|1139325_1140144_+	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	30.3	1.1e-18
AWC93092.1|1140213_1141740_+	glycerol kinase	NA	NA	NA	NA	NA
AWC93093.1|1142063_1143416_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
AWC93094.1|1143468_1144656_-	multidrug transporter EmrD	NA	S4TR35	Salmonella_phage	27.7	3.8e-12
AWC93095.1|1144981_1145731_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AWC93096.1|1145765_1146194_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
AWC93097.1|1146251_1146872_+	DUF1454 domain-containing protein	NA	NA	NA	NA	NA
AWC93098.1|1147005_1147776_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
AWC93099.1|1148158_1149136_-	6-phosphofructokinase	NA	NA	NA	NA	NA
AWC93100.1|1150041_1152567_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AWC93101.1|1152853_1153591_+	hypothetical protein	NA	NA	NA	NA	NA
AWC93102.1|1153638_1153890_-	hypothetical protein	NA	NA	NA	NA	NA
AWC93103.1|1153940_1155065_-	hypothetical protein	NA	A0A0M4REC6	Salmonella_phage	67.9	2.0e-124
AWC93104.1|1155214_1156405_+|tail	phage tail protein	tail	A0A0M4S6M1	Salmonella_phage	63.7	9.8e-146
AWC93105.1|1156408_1156921_+|tail	phage major tail tube protein	tail	A0A0M5M1I5	Salmonella_phage	62.4	1.5e-55
AWC93106.1|1156982_1157282_+|tail	phage tail protein	tail	A0A0M4RCV2	Salmonella_phage	46.9	1.4e-11
AWC93107.1|1157305_1157434_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	53.8	1.1e-05
AWC93108.1|1157430_1160316_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	37.6	9.7e-139
AWC93109.1|1160321_1160765_+	oxidoreductase	NA	A0A0A7NV65	Enterobacteria_phage	63.6	6.6e-47
AWC93110.1|1160800_1161367_-	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	72.8	2.3e-68
AWC93111.1|1161356_1161962_+	hypothetical protein	NA	NA	NA	NA	NA
AWC93112.1|1161961_1162390_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
AWC93113.1|1162361_1162724_-|tail	phage tail protein	tail	A0A218M4J2	Erwinia_phage	41.6	4.5e-09
AWC93114.1|1164228_1164837_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	66.7	1.5e-73
AWC93115.1|1164829_1165738_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	66.2	2.8e-108
AWC93116.1|1165740_1166079_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	51.4	1.2e-24
AWC93117.1|1166075_1166705_-|plate	phage baseplate assembly protein V	plate	A0A2I8TV69	Erwinia_phage	57.9	7.0e-58
AWC93118.1|1166701_1167343_-|tail	phage tail protein	tail	A0A0M4RCU1	Salmonella_phage	47.6	3.5e-41
AWC93119.1|1167352_1167775_-|tail	phage tail protein	tail	A0A0M4R2U5	Salmonella_phage	44.5	3.3e-27
AWC93120.1|1167926_1168541_-|lysis	lysis protein	lysis	A0A1B0VMJ3	Pseudomonas_phage	40.0	2.2e-16
AWC93121.1|1168425_1168971_-	lysozyme	NA	K7PM52	Enterobacteria_phage	69.9	4.8e-71
AWC93122.1|1168970_1169231_-	hypothetical protein	NA	A0A1V0E5R8	Salmonella_phage	53.3	9.3e-09
AWC93123.1|1169233_1169434_-|tail	phage tail protein	tail	A0A0M4RTN6	Salmonella_phage	59.1	6.1e-16
AWC93124.1|1169433_1169919_-|capsid	capsid assembly protein	capsid	A0A0M4QWR7	Salmonella_phage	45.6	1.2e-25
AWC93125.1|1170014_1170806_-|terminase	terminase	terminase	A0A0M4R523	Salmonella_phage	47.6	2.1e-51
AWC93126.1|1170857_1171913_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	52.6	2.8e-99
AWC93127.1|1171925_1172771_-|capsid	phage capsid protein	capsid	F1BUR1	Erwinia_phage	34.4	1.5e-26
AWC93128.1|1172917_1174636_+	oxidoreductase	NA	A0A0M4S6K7	Salmonella_phage	62.2	1.3e-194
AWC93129.1|1174638_1175673_+|portal	phage portal protein	portal	A0A0M5M1H6	Salmonella_phage	57.6	6.8e-111
AWC93130.1|1176077_1176512_-	hypothetical protein	NA	Q6DMX0	Streptococcus_phage	67.9	8.8e-52
AWC93131.1|1176496_1177075_-	hypothetical protein	NA	NA	NA	NA	NA
AWC93132.1|1177208_1179932_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	36.3	2.1e-114
AWC93133.1|1179931_1180738_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	52.3	2.2e-64
AWC93134.1|1180730_1181060_-	RNA-binding protein	NA	NA	NA	NA	NA
AWC93135.1|1181061_1181283_-	hypothetical protein	NA	NA	NA	NA	NA
AWC93136.1|1181275_1181497_-	hypothetical protein	NA	NA	NA	NA	NA
AWC93137.1|1181566_1181986_-	hypothetical protein	NA	NA	NA	NA	NA
AWC93138.1|1181998_1182214_-	hypothetical protein	NA	NA	NA	NA	NA
AWC93139.1|1182223_1182496_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	59.1	7.0e-23
AWC93140.1|1182622_1182916_+	transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	50.5	8.3e-22
AWC93141.1|1182985_1183963_+|integrase	integrase	integrase	A0A0M4RTQ0	Salmonella_phage	60.8	2.1e-109
AWC93142.1|1184192_1184690_-	stress adaptor protein CpxP	NA	NA	NA	NA	NA
AWC93143.1|1184844_1185549_+	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	1.4e-06
AWC93144.1|1185545_1186916_+	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	26.1	4.0e-18
AWC93145.1|1187436_1188336_+	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	32.8	2.8e-28
1187073:1187088	attR	AACACTTTTTCTGCTG	NA	NA	NA	NA
AWC93146.1|1188339_1189212_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	61.7	3.7e-102
AWC93147.1|1189213_1189756_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	59.4	6.9e-54
AWC93148.1|1189955_1190948_+	oligosaccharide repeat unit polymerase	NA	NA	NA	NA	NA
AWC93149.1|1190922_1191753_+	rhamnosyl transferase	NA	NA	NA	NA	NA
AWC93150.1|1192921_1194175_+	glycosyltransferase WbuB	NA	NA	NA	NA	NA
AWC95932.1|1194179_1194803_+	sugar transferase	NA	NA	NA	NA	NA
AWC93151.1|1194821_1196039_+	decarboxylase	NA	NA	NA	NA	NA
AWC93152.1|1196044_1196959_+	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
AWC93153.1|1196975_1197770_+	aldolase	NA	NA	NA	NA	NA
AWC93154.1|1197864_1199763_+	polysaccharide biosynthesis protein	NA	L7Y3T9	Megavirus	28.8	3.7e-22
AWC93155.1|1199805_1200312_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
>prophage 74
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1204779	1209200	4221270		Planktothrix_phage(50.0%)	3	NA	NA
AWC95933.1|1204779_1206024_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	33.8	2.0e-11
AWC93162.1|1206030_1207089_+	hypothetical protein	NA	NA	NA	NA	NA
AWC93163.1|1208261_1209200_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	36.3	6.1e-34
>prophage 75
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1217822	1219118	4221270		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
AWC93171.1|1217822_1218308_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	40.1	8.3e-27
AWC93172.1|1218308_1219118_-	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	34.1	8.5e-24
>prophage 76
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1223266	1238764	4221270	integrase	Morganella_phage(80.0%)	21	1224723:1224737	1244773:1244787
AWC93178.1|1223266_1224481_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	35.1	2.5e-43
AWC93179.1|1224458_1224917_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.3	4.6e-51
1224723:1224737	attL	ATTGACTCTGATTAT	NA	NA	NA	NA
AWC93180.1|1225021_1225615_+	nucleoid occlusion factor SlmA	NA	NA	NA	NA	NA
AWC93181.1|1225686_1226334_-	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	25.0	1.3e-06
AWC93182.1|1226414_1227143_-	ribonuclease PH	NA	NA	NA	NA	NA
AWC93183.1|1227267_1228131_+	YicC family protein	NA	NA	NA	NA	NA
AWC93184.1|1228320_1229586_+|integrase	integrase	integrase	A0A1W6JPG6	Morganella_phage	99.8	3.6e-247
AWC93185.1|1229678_1230587_+	hypothetical protein	NA	NA	NA	NA	NA
AWC93186.1|1230688_1230925_+	AlpA family phage regulatory protein	NA	A0A1W6JPE9	Morganella_phage	96.2	6.2e-36
AWC93187.1|1230924_1231353_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	98.6	1.6e-77
AWC93188.1|1231366_1231960_+	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	99.0	1.2e-107
AWC95935.1|1232286_1233057_+	hypothetical protein	NA	A0A1W6JPK3	Morganella_phage	85.5	2.4e-116
AWC93189.1|1233053_1233314_+	hypothetical protein	NA	NA	NA	NA	NA
AWC93190.1|1233310_1233502_+	hypothetical protein	NA	A0A1W6JPF0	Morganella_phage	95.2	6.8e-25
AWC93191.1|1233498_1233708_+	hypothetical protein	NA	A0A1W6JPF1	Morganella_phage	100.0	3.2e-28
AWC93192.1|1233704_1233902_+	hypothetical protein	NA	A0A1W6JPE5	Morganella_phage	100.0	1.7e-26
AWC93193.1|1233898_1234441_+	hypothetical protein	NA	A0A1W6JPH2	Morganella_phage	97.8	5.9e-98
AWC93194.1|1234452_1234803_+	hypothetical protein	NA	A0A1W6JPD8	Morganella_phage	96.6	4.6e-59
AWC93195.1|1234799_1235174_+	hypothetical protein	NA	NA	NA	NA	NA
AWC93196.1|1235160_1237872_+	DNA primase	NA	A0A1W6JPG0	Morganella_phage	94.9	0.0e+00
AWC95936.1|1238341_1238764_+	osmoprotectant transporter ProQ	NA	A0A1W6JPI6	Morganella_phage	63.9	6.2e-18
1244773:1244787	attR	ATTGACTCTGATTAT	NA	NA	NA	NA
>prophage 77
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1243884	1246357	4221270		Morganella_phage(50.0%)	3	NA	NA
AWC95937.1|1243884_1244172_+	hypothetical protein	NA	A0A1W6JPH4	Morganella_phage	80.9	9.9e-36
AWC93203.1|1244554_1244905_+	hypothetical protein	NA	NA	NA	NA	NA
AWC93204.1|1244956_1246357_-	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	43.7	2.0e-20
>prophage 78
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1254561	1256424	4221270	tRNA	Tupanvirus(100.0%)	1	NA	NA
AWC93213.1|1254561_1256424_-|tRNA	selenocysteinyl-tRNA-specific translation elongation factor SelB	tRNA	A0A2K9KZ60	Tupanvirus	27.3	2.9e-11
>prophage 79
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1277015	1284539	4221270		Staphylococcus_phage(33.33%)	8	NA	NA
AWC93229.1|1277015_1277273_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	53.5	1.3e-15
AWC93230.1|1277236_1277596_-	ribonuclease P protein component	NA	NA	NA	NA	NA
AWC93231.1|1277614_1277755_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
AWC93232.1|1278043_1278289_+	hypothetical protein	NA	NA	NA	NA	NA
AWC93233.1|1278507_1279905_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
AWC93234.1|1279909_1281010_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.2	6.9e-53
AWC93235.1|1281014_1282097_+	DNA replication and repair protein RecF	NA	NA	NA	NA	NA
AWC93236.1|1282124_1284539_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.2	3.1e-114
>prophage 80
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1296695	1302993	4221270	integrase	Virus_Rctr41k(33.33%)	7	1295476:1295489	1302520:1302533
1295476:1295489	attL	ACAATGAAATGGTT	NA	NA	NA	NA
AWC93248.1|1296695_1298237_+	hypothetical protein	NA	A0A1B0V854	Salmonella_phage	45.4	4.4e-37
AWC93249.1|1298227_1299211_-	chemoreceptor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.1	3.4e-11
AWC93250.1|1300164_1300404_+	DUF1819 domain-containing protein	NA	NA	NA	NA	NA
AWC93251.1|1300591_1300918_-|integrase	integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	52.0	2.1e-18
AWC93252.1|1301032_1301569_-|integrase	class 2 integron integrase IntI2	integrase	A0A1P8DJJ6	Virus_Rctr41k	34.4	6.9e-14
AWC93253.1|1301900_1302374_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	34.4	1.6e-19
AWC93254.1|1302468_1302993_+	streptothricin N-acetyltransferase Sat2	NA	E4ZFP7	Streptococcus_phage	38.9	4.2e-16
1302520:1302533	attR	AACCATTTCATTGT	NA	NA	NA	NA
>prophage 81
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1313747	1317045	4221270		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
AWC93265.1|1313747_1315577_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	44.3	1.2e-134
AWC93266.1|1315671_1317045_-	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	37.2	6.2e-35
>prophage 82
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1331229	1334969	4221270		Sulfolobus_monocaudavirus(50.0%)	3	NA	NA
AWC93282.1|1331229_1332741_-	ATPase RavA	NA	A0A0N9NIH9	Sulfolobus_monocaudavirus	34.8	1.2e-18
AWC93283.1|1333036_1333456_+	D-ribose pyranase	NA	NA	NA	NA	NA
AWC93284.1|1333463_1334969_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	7.6e-18
>prophage 83
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1347699	1349634	4221270		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AWC93292.1|1347699_1349634_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.3	1.4e-11
>prophage 84
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1355024	1355861	4221270		Yersinia_phage(100.0%)	1	NA	NA
AWC93297.1|1355024_1355861_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.4	1.1e-45
>prophage 85
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1362568	1365312	4221270		Staphylococcus_phage(100.0%)	2	NA	NA
AWC93307.1|1362568_1364125_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	41.4	1.6e-100
AWC93308.1|1364121_1365312_+	restriction endonuclease	NA	A0A2H4PQP5	Staphylococcus_phage	31.1	2.9e-28
>prophage 86
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1371762	1375568	4221270	integrase	Enterobacteria_phage(50.0%)	2	1365400:1365414	1379453:1379467
1365400:1365414	attL	CAGACCAAAACCATC	NA	NA	NA	NA
AWC93314.1|1371762_1372971_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	68.1	4.6e-159
AWC93315.1|1373519_1375568_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	21.1	9.6e-40
1379453:1379467	attR	GATGGTTTTGGTCTG	NA	NA	NA	NA
>prophage 87
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1383752	1385372	4221270		Staphylococcus_phage(100.0%)	1	NA	NA
AWC93323.1|1383752_1385372_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	53.3	1.8e-142
>prophage 88
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1394624	1395683	4221270		Vibrio_phage(100.0%)	1	NA	NA
AWC93332.1|1394624_1395683_+	transporter	NA	R9TEZ5	Vibrio_phage	23.4	1.8e-13
>prophage 89
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1399029	1413537	4221270	tRNA	Escherichia_phage(50.0%)	14	NA	NA
AWC95940.1|1399029_1399848_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	50.2	3.0e-69
AWC93336.1|1399888_1400563_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
AWC93337.1|1400559_1401279_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
AWC93338.1|1401281_1402310_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AWC93339.1|1402369_1403098_-	hypothetical protein	NA	G0YQD8	Erwinia_phage	39.8	5.0e-07
AWC93340.1|1403493_1404339_-	ferredoxin	NA	NA	NA	NA	NA
AWC93341.1|1404689_1407143_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.7	2.9e-216
AWC93342.1|1407154_1407772_+	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	59.6	1.0e-74
AWC93343.1|1407773_1408634_+	dimethylsulfoxide reductase	NA	A0A077SK59	Escherichia_phage	35.7	6.7e-27
AWC93344.1|1408719_1409331_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.2	1.9e-23
AWC93345.1|1409398_1409689_-	hypothetical protein	NA	NA	NA	NA	NA
AWC93346.1|1409816_1410503_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AWC93347.1|1410591_1411212_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	56.0	6.0e-62
AWC93348.1|1411581_1413537_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.4	3.3e-82
>prophage 90
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1429753	1431220	4221270		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AWC93361.1|1429753_1431220_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.2	2.2e-46
>prophage 91
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1436276	1437662	4221270		Feldmannia_irregularis_virus(100.0%)	1	NA	NA
AWC93365.1|1436276_1437662_+	two-component system response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	28.0	4.0e-05
>prophage 92
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1442363	1445947	4221270		Morganella_phage(50.0%)	3	NA	NA
AWC93370.1|1442363_1442699_+	XRE family transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	50.0	4.1e-09
AWC93371.1|1442676_1442877_-	hypothetical protein	NA	NA	NA	NA	NA
AWC93372.1|1442857_1445947_-	hypothetical protein	NA	A0A2L1IV18	Escherichia_phage	46.2	3.5e-94
>prophage 93
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1451465	1456014	4221270		Bandra_megavirus(33.33%)	3	NA	NA
AWC93376.1|1451465_1452905_-	deoxyribodipyrimidine photo-lyase	NA	A0A2K9V7Z5	Bandra_megavirus	31.6	4.8e-54
AWC93377.1|1452969_1454472_-	proline/glycine betaine transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.5	4.8e-57
AWC93378.1|1455702_1456014_+	XRE family transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	48.4	2.3e-09
>prophage 94
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1459134	1460856	4221270		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AWC95944.1|1459134_1460856_+	ubiquinone-dependent pyruvate dehydrogenase	NA	M4QSI1	Ostreococcus_lucimarinus_virus	22.2	5.8e-22
>prophage 95
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1476703	1482824	4221270		Bacillus_phage(75.0%)	6	NA	NA
AWC93395.1|1476703_1477423_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	35.6	1.3e-31
AWC93396.1|1477419_1478754_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	22.2	6.5e-13
AWC93397.1|1479049_1480090_+	phosphate ABC transporter substrate-binding protein PstS	NA	H6WG65	Cyanophage	37.5	5.7e-49
AWC93398.1|1480170_1481127_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
AWC93399.1|1481128_1482016_+	phosphate ABC transporter permease PtsA	NA	NA	NA	NA	NA
AWC93400.1|1482047_1482824_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.4	1.3e-13
>prophage 96
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1492853	1494899	4221270		Moraxella_phage(50.0%)	2	NA	NA
AWC93410.1|1492853_1494188_+	adenine permease PurP	NA	A0A0R6PHV4	Moraxella_phage	38.0	2.1e-64
AWC93411.1|1494254_1494899_-	cobalt ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	26.5	1.2e-09
>prophage 97
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1499272	1501123	4221270		Acinetobacter_phage(100.0%)	1	NA	NA
AWC93417.1|1499272_1501123_+	vitamin B12/cobalamin outer membrane transporter	NA	A0A0P0I887	Acinetobacter_phage	30.7	2.0e-12
>prophage 98
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1509907	1512969	4221270		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
AWC93422.1|1509907_1510852_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	33.5	1.4e-30
AWC93423.1|1511784_1512969_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	25.7	2.2e-12
>prophage 99
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1533044	1535925	4221270		Synechococcus_phage(50.0%)	4	NA	NA
AWC93460.1|1533044_1533554_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	39.5	2.2e-17
AWC93461.1|1533684_1534791_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
AWC93462.1|1534817_1535363_+	hypothetical protein	NA	NA	NA	NA	NA
AWC95946.1|1535352_1535925_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	A0A291ATS8	Pandoravirus	30.6	7.6e-11
>prophage 100
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1547131	1548778	4221270		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AWC93469.1|1547131_1548778_+	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.2	1.8e-68
>prophage 101
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1558027	1563438	4221270		Bacillus_phage(33.33%)	4	NA	NA
AWC93479.1|1558027_1560058_+	ATP-dependent DNA helicase Rep	NA	A7KV33	Bacillus_phage	36.7	2.4e-115
AWC93480.1|1560179_1561688_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
AWC93481.1|1561696_1562992_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.4	1.2e-35
AWC93482.1|1563111_1563438_+	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	45.7	1.3e-20
>prophage 102
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1567636	1573807	4221270		Enterobacteria_phage(40.0%)	6	NA	NA
AWC93486.1|1567636_1568767_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	30.6	9.7e-26
AWC93487.1|1568763_1570026_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HFY9	Paramecium_bursaria_Chlorella_virus	25.8	3.8e-23
AWC95949.1|1570022_1571096_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
AWC93488.1|1571105_1571987_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	66.7	1.1e-106
AWC93489.1|1571964_1572690_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
AWC93490.1|1572676_1573807_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	35.4	3.0e-19
>prophage 103
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1589431	1598032	4221270		Gordonia_phage(33.33%)	7	NA	NA
AWC93503.1|1589431_1590349_+	tyrosine recombinase XerC	NA	A0A2P1CCU8	Gordonia_phage	36.1	3.1e-14
AWC93504.1|1590348_1591065_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
AWC93505.1|1591151_1593323_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.6	2.3e-116
AWC93506.1|1593435_1594386_+	magnesium transporter CorA	NA	NA	NA	NA	NA
AWC93507.1|1594395_1594905_-	hypothetical protein	NA	NA	NA	NA	NA
AWC93508.1|1594957_1595854_-	EamA family transporter RarD	NA	NA	NA	NA	NA
AWC93509.1|1596205_1598032_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	38.2	1.9e-84
>prophage 104
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1607523	1608069	4221270		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AWC93516.1|1607523_1608069_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.1	4.7e-26
>prophage 105
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1611103	1614314	4221270		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AWC93519.1|1611103_1612396_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	28.7	1.7e-13
AWC93520.1|1612415_1614314_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.7	3.7e-62
>prophage 106
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1619608	1624007	4221270		Powai_lake_megavirus(50.0%)	3	NA	NA
AWC93526.1|1619608_1620907_+	adenylosuccinate synthase	NA	A0A160ER07	Powai_lake_megavirus	33.0	9.9e-67
AWC93527.1|1621112_1621541_+	HTH-type transcriptional repressor NsrR	NA	NA	NA	NA	NA
AWC93528.1|1621568_1624007_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.7	4.6e-65
>prophage 107
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1637704	1639344	4221270		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AWC93543.1|1637704_1638235_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	3.6e-55
AWC93544.1|1638330_1639344_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	46.0	7.2e-73
>prophage 108
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1642882	1645132	4221270		Vibrio_phage(33.33%)	3	NA	NA
AWC93548.1|1642882_1643149_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.6	1.2e-16
AWC93549.1|1643731_1644118_+	DNA-binding protein	NA	C9DGL1	Escherichia_phage	45.6	1.2e-07
AWC93550.1|1644160_1645132_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.7	6.0e-08
>prophage 109
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1650900	1653839	4221270	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
AWC93558.1|1650900_1652850_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	42.1	3.7e-118
AWC93559.1|1652990_1653839_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	30.9	7.0e-21
>prophage 110
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1658262	1660995	4221270		Bodo_saltans_virus(100.0%)	1	NA	NA
AWC93564.1|1658262_1660995_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.4	2.3e-28
>prophage 111
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1666378	1670803	4221270		Diachasmimorpha_longicaudata_entomopoxvirus(50.0%)	3	NA	NA
AWC93570.1|1666378_1668286_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	8.6e-51
AWC93571.1|1668361_1669075_-	two-component system response regulator YehT	NA	NA	NA	NA	NA
AWC93572.1|1669093_1670803_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	70.6	3.9e-220
>prophage 112
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1678174	1682175	4221270		Vibrio_phage(66.67%)	5	NA	NA
AWC95953.1|1678174_1678477_-	endonuclease	NA	S6DF82	Invertebrate_iridovirus	51.3	3.3e-13
AWC93581.1|1678769_1679021_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AWC93582.1|1679129_1679585_+	hypothetical protein	NA	NA	NA	NA	NA
AWC93583.1|1679565_1680033_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A2D0YLR2	Vibrio_phage	60.0	1.9e-52
AWC95954.1|1680036_1682175_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.3	2.7e-263
>prophage 113
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1685416	1686352	4221270		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AWC93588.1|1685416_1686352_-	aspartate carbamoyltransferase	NA	Q84489	Paramecium_bursaria_Chlorella_virus	40.1	1.1e-51
>prophage 114
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1689368	1694340	4221270	tRNA	Klosneuvirus(50.0%)	3	NA	NA
AWC93591.1|1689368_1692266_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	38.6	6.7e-148
AWC93592.1|1692282_1692732_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AWC93593.1|1692828_1694340_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.6	3.2e-48
>prophage 115
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1698652	1708507	4221270	integrase	Pseudomonas_phage(40.0%)	8	1690750:1690764	1706463:1706477
1690750:1690764	attL	TTTTCCGGCCAGCCC	NA	NA	NA	NA
AWC93597.1|1698652_1699879_+	RNA-splicing ligase RtcB	NA	A0A1V0EEW8	Caulobacter_phage	62.1	6.0e-138
AWC93598.1|1699882_1700695_+	nucleotidyltransferase	NA	A0A2D1GQQ2	Pseudomonas_phage	44.8	3.9e-45
AWC93599.1|1700715_1701939_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	NA	NA	NA	NA
AWC93600.1|1703003_1704263_+|integrase	integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.5	3.5e-69
AWC93601.1|1704595_1705453_+	HNH endonuclease	NA	NA	NA	NA	NA
AWC93602.1|1705750_1707784_-	DNA primase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	61.6	4.6e-119
1706463:1706477	attR	GGGCTGGCCGGAAAA	NA	NA	NA	NA
AWC93603.1|1707776_1708307_-	hypothetical protein	NA	NA	NA	NA	NA
AWC93604.1|1708303_1708507_-	transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	45.1	1.1e-07
>prophage 116
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1725389	1727768	4221270		Streptococcus_phage(66.67%)	3	NA	NA
AWC93620.1|1725389_1726088_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	28.4	8.4e-12
AWC93621.1|1726094_1726565_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	50.4	1.8e-34
AWC93622.1|1726646_1727768_-	DNA (cytosine-5-)-methyltransferase	NA	Q6DMX0	Streptococcus_phage	55.1	1.3e-99
>prophage 117
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1761483	1763040	4221270		Escherichia_phage(100.0%)	1	NA	NA
AWC93652.1|1761483_1763040_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.1	4.6e-18
>prophage 118
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1770289	1771766	4221270		Bacillus_phage(50.0%)	2	NA	NA
AWC93656.1|1770289_1770991_+	two-component system response regulator NarL	NA	W8CYM9	Bacillus_phage	30.1	3.1e-06
AWC93657.1|1771028_1771766_+	glycerophosphoryl diester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	29.7	2.3e-20
>prophage 119
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1798018	1802603	4221270		Bacillus_virus(66.67%)	4	NA	NA
AWC93671.1|1798018_1799593_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	32.4	1.1e-38
AWC93672.1|1799664_1800228_-	alkyl hydroperoxide reductase subunit C	NA	NA	NA	NA	NA
AWC93673.1|1800643_1801759_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	36.9	5.2e-32
AWC93674.1|1801742_1802603_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	30.6	7.1e-13
>prophage 120
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1827455	1828730	4221270		Pandoravirus(100.0%)	1	NA	NA
AWC93702.1|1827455_1828730_+	O-acetylhomoserine aminocarboxypropyltransferase	NA	A0A0B5JD48	Pandoravirus	28.6	4.9e-18
>prophage 121
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1839861	1840635	4221270		Planktothrix_phage(100.0%)	1	NA	NA
AWC93712.1|1839861_1840635_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.3	5.1e-18
>prophage 122
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1849572	1855699	4221270	tRNA	Catopsilia_pomona_nucleopolyhedrovirus(33.33%)	5	NA	NA
AWC93721.1|1849572_1850622_-	ADP-ribosylglycohydrolase family protein	NA	A0A172WZB4	Catopsilia_pomona_nucleopolyhedrovirus	21.9	2.1e-06
AWC93722.1|1850841_1851579_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWC93723.1|1851634_1852906_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	25.1	5.6e-22
AWC93724.1|1852916_1854359_-	histidine-histamine antiporter	NA	NA	NA	NA	NA
AWC93725.1|1854562_1855699_-	histidine decarboxylase	NA	A0A2P0VP20	Tetraselmis_virus	38.3	2.4e-64
>prophage 123
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1861847	1863266	4221270		Pseudomonas_phage(100.0%)	1	NA	NA
AWC93729.1|1861847_1863266_-	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	30.7	5.2e-45
>prophage 124
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1872357	1879701	4221270		Escherichia_phage(100.0%)	1	NA	NA
AWC93738.1|1872357_1879701_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	32.9	6.6e-91
>prophage 125
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1886641	1889916	4221270		Enterobacteria_phage(50.0%)	3	NA	NA
AWC93744.1|1886641_1887796_+	porin	NA	Q1MVN1	Enterobacteria_phage	54.7	8.2e-105
AWC93745.1|1888222_1889173_-	ribonucleoside hydrolase	NA	NA	NA	NA	NA
AWC93746.1|1889352_1889916_-	DNA recombinase	NA	A0A2L1IV36	Escherichia_phage	50.8	2.4e-49
>prophage 126
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1898019	1898580	4221270		Escherichia_phage(100.0%)	1	NA	NA
AWC93756.1|1898019_1898580_+	DNA recombinase	NA	A0A2L1IV36	Escherichia_phage	50.5	1.2e-48
>prophage 127
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1907894	1909147	4221270	integrase	Escherichia_phage(50.0%)	2	1905139:1905152	1914483:1914496
1905139:1905152	attL	AACCGCTGAAATTA	NA	NA	NA	NA
AWC95964.1|1907894_1908446_-|integrase	integrase	integrase	A0A2L1IV36	Escherichia_phage	51.6	1.4e-46
AWC93766.1|1908817_1909147_+	XRE family transcriptional regulator	NA	K4K6E9	Caulobacter_phage	35.8	2.9e-07
1914483:1914496	attR	AACCGCTGAAATTA	NA	NA	NA	NA
>prophage 128
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1913351	1923888	4221270		Escherichia_phage(50.0%)	9	NA	NA
AWC93771.1|1913351_1914146_+	nickel import ATP-binding protein NikD	NA	A0A2R8FFL6	Cedratvirus	26.7	1.9e-07
AWC93772.1|1914142_1914952_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	31.1	1.4e-15
AWC93773.1|1915009_1915942_-	hypothetical protein	NA	NA	NA	NA	NA
AWC93774.1|1916123_1916462_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWC93775.1|1917422_1920077_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	46.8	4.6e-95
AWC93776.1|1920151_1920397_-	hypothetical protein	NA	NA	NA	NA	NA
AWC93777.1|1920927_1921815_+	ParA family protein	NA	NA	NA	NA	NA
AWC93778.1|1921892_1922324_-	hypothetical protein	NA	NA	NA	NA	NA
AWC93779.1|1922535_1923888_+	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	53.5	6.6e-122
>prophage 129
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1930751	1935101	4221270	transposase	Streptococcus_phage(50.0%)	5	NA	NA
AWC93787.1|1930751_1932806_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	28.6	7.4e-40
AWC93788.1|1933056_1933257_-	hypothetical protein	NA	NA	NA	NA	NA
AWC93789.1|1933499_1933706_+	hypothetical protein	NA	NA	NA	NA	NA
AWC93790.1|1933689_1934157_+	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
AWC93791.1|1934177_1935101_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	44.0	7.3e-56
>prophage 130
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1949356	1972227	4221270		Bacillus_phage(40.0%)	8	NA	NA
AWC93803.1|1949356_1949545_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	45.1	1.6e-05
AWC93804.1|1950766_1951516_-	4-phosphopantetheinyl transferase	NA	NA	NA	NA	NA
AWC93805.1|1951528_1953256_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	7.8e-35
AWC93806.1|1953248_1955015_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.0	1.8e-34
AWC93807.1|1955033_1955807_-	thioesterase	NA	NA	NA	NA	NA
AWC93808.1|1955806_1956895_-	siderophore biosynthesis protein	NA	NA	NA	NA	NA
AWC93809.1|1956894_1966110_-	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	39.7	1.0e-48
AWC93810.1|1966122_1972227_-	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	29.0	1.3e-36
>prophage 131
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	1992983	1995209	4221270		Yersinia_phage(100.0%)	1	NA	NA
AWC93833.1|1992983_1995209_+	adhesin	NA	A0A1V0DXR3	Yersinia_phage	40.2	4.4e-06
>prophage 132
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2007481	2008456	4221270		Caulobacter_phage(100.0%)	1	NA	NA
AWC95966.1|2007481_2008456_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	37.5	2.8e-45
>prophage 133
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2018197	2024316	4221270		Vibrio_phage(50.0%)	5	NA	NA
AWC93859.1|2018197_2018491_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	36.8	4.3e-10
AWC93860.1|2018555_2020202_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	67.9	8.4e-188
AWC93861.1|2020363_2021104_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AWC93862.1|2021377_2022934_+	PTS trehalose transporter subunit IIC	NA	A0A2I7SAJ6	Vibrio_phage	32.1	4.8e-07
AWC93863.1|2022945_2024316_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	26.6	6.5e-08
>prophage 134
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2031127	2031748	4221270		Escherichia_phage(100.0%)	1	NA	NA
AWC93870.1|2031127_2031748_+	electron transporter	NA	A0A077SL61	Escherichia_phage	28.7	1.9e-07
>prophage 135
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2042567	2042882	4221270		Cellulophaga_phage(100.0%)	1	NA	NA
AWC95968.1|2042567_2042882_+	hypothetical protein	NA	M1PRT9	Cellulophaga_phage	60.4	1.4e-27
>prophage 136
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2049361	2051515	4221270		Escherichia_phage(100.0%)	1	NA	NA
AWC95969.1|2049361_2051515_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.0	1.4e-25
>prophage 137
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2055257	2056670	4221270		Bacillus_phage(100.0%)	1	NA	NA
AWC93891.1|2055257_2056670_+	glycosyl hydrolase family 32	NA	F8WPR5	Bacillus_phage	24.4	3.9e-16
>prophage 138
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2066925	2073318	4221270		Dickeya_phage(50.0%)	6	NA	NA
AWC93900.1|2066925_2067594_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	61.9	1.1e-58
AWC93901.1|2067708_2068827_-	choloylglycine hydrolase	NA	NA	NA	NA	NA
AWC93902.1|2068978_2069233_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	72.2	5.3e-09
AWC93903.1|2069255_2070095_+	DUF817 domain-containing protein	NA	NA	NA	NA	NA
AWC93904.1|2070139_2072545_-	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	37.7	5.5e-119
AWC93905.1|2072685_2073318_-	hypothetical protein	NA	A0A140XAH6	Dickeya_phage	43.0	8.6e-16
>prophage 139
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2076985	2083635	4221270		Staphylococcus_phage(33.33%)	7	NA	NA
AWC93910.1|2076985_2077651_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.4	2.1e-12
AWC93911.1|2077643_2078615_+	cell division protein FtsX	NA	NA	NA	NA	NA
AWC93912.1|2078785_2079640_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.1	1.7e-43
AWC93913.1|2079715_2079961_+	Pathogenicity locus	NA	NA	NA	NA	NA
AWC93914.1|2079962_2081084_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWC93915.1|2081218_2082487_+	gluconate:proton symporter	NA	NA	NA	NA	NA
AWC93916.1|2082498_2083635_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.0	1.7e-41
>prophage 140
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2088472	2089944	4221270		Cedratvirus(50.0%)	2	NA	NA
AWC93921.1|2088472_2089243_+	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	27.1	1.2e-14
AWC93922.1|2089242_2089944_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	29.0	7.3e-16
>prophage 141
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2093441	2095490	4221270		Streptococcus_phage(100.0%)	1	NA	NA
AWC93928.1|2093441_2095490_+	K(+)-transporting ATPase subunit B	NA	E4ZFI9	Streptococcus_phage	26.4	1.6e-34
>prophage 142
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2101034	2102591	4221270		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AWC93933.1|2101034_2102591_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.1	1.6e-15
>prophage 143
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2115562	2116606	4221270		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AWC93944.1|2115562_2116606_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	3.5e-06
>prophage 144
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2134009	2142816	4221270		Thermobifida_phage(20.0%)	12	NA	NA
AWC93959.1|2134009_2134861_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.3	1.1e-05
AWC93960.1|2134930_2135398_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AWC93961.1|2135517_2135805_-	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
AWC93962.1|2135828_2137265_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
AWC93963.1|2137289_2138015_-	lipopolysaccharide ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.5	4.6e-21
AWC93964.1|2138021_2138558_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
AWC93965.1|2138538_2139120_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AWC93966.1|2139160_2139724_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	82.2	3.1e-57
AWC93967.1|2139733_2140702_-	arabinose-5-phosphate isomerase KdsD	NA	E5E465	Acinetobacter_phage	36.5	1.2e-16
AWC93968.1|2140753_2141713_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
AWC93969.1|2141711_2141894_+	hypothetical protein	NA	NA	NA	NA	NA
AWC93970.1|2142012_2142816_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	32.2	2.3e-21
>prophage 145
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2149927	2150701	4221270		Bacillus_virus(100.0%)	1	NA	NA
AWC93980.1|2149927_2150701_-	taurine ABC transporter ATP-binding subunit	NA	G3M9Y6	Bacillus_virus	36.4	7.6e-30
>prophage 146
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2155677	2157072	4221270		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AWC93984.1|2155677_2157072_-	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	26.5	7.5e-20
>prophage 147
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2161104	2161593	4221270	protease	Pseudomonas_phage(100.0%)	1	NA	NA
AWC93990.1|2161104_2161593_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	56.0	1.9e-26
>prophage 148
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2168174	2179863	4221270		Hokovirus(25.0%)	11	NA	NA
AWC95973.1|2168174_2170508_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	29.9	8.9e-42
AWC93993.1|2170749_2171400_+	isoprenoid biosynthesis protein ElbB	NA	NA	NA	NA	NA
AWC93994.1|2171406_2172129_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AWC93995.1|2172366_2172939_-	osmotically-inducible protein OsmY	NA	NA	NA	NA	NA
AWC93996.1|2172948_2173539_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	32.9	1.2e-11
AWC93997.1|2173573_2173936_-	YraN family protein	NA	NA	NA	NA	NA
AWC93998.1|2174003_2175758_-	LppC family lipoprotein	NA	NA	NA	NA	NA
AWC93999.1|2175818_2176691_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.6	3.6e-52
AWC94000.1|2177189_2177888_-	pirin family protein	NA	NA	NA	NA	NA
AWC94001.1|2177994_2178891_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWC94002.1|2179098_2179863_+	glycosyltransferase	NA	A0A2H4UUT1	Bodo_saltans_virus	30.7	1.8e-23
>prophage 149
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2208797	2209937	4221270		Catovirus(100.0%)	1	NA	NA
AWC94024.1|2208797_2209937_+	hypothetical protein	NA	A0A1V0SAV8	Catovirus	33.7	4.1e-08
>prophage 150
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2216598	2218959	4221270		Liberibacter_phage(100.0%)	1	NA	NA
AWC94028.1|2216598_2218959_+	restriction endonuclease subunit M	NA	A0A220A2U5	Liberibacter_phage	24.7	1.8e-29
>prophage 151
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2225189	2230757	4221270	tRNA	Vibrio_phage(33.33%)	4	NA	NA
AWC94034.1|2225189_2227040_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.9	4.2e-34
AWC94035.1|2227224_2229024_-	DNA primase	NA	A0A1S5RG58	Helicobacter_phage	33.8	2.4e-50
AWC94036.1|2229072_2229288_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AWC94037.1|2229737_2230757_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.8	9.1e-108
>prophage 152
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2239806	2250008	4221270		Bacillus_phage(50.0%)	7	NA	NA
AWC94048.1|2239806_2240715_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	60.9	1.1e-96
AWC94049.1|2240894_2241803_+	fructokinase	NA	NA	NA	NA	NA
AWC94050.1|2241939_2242542_-	nitroreductase	NA	NA	NA	NA	NA
AWC94051.1|2242737_2246424_-	exonuclease subunit SbcC	NA	M1U9H5	Synechococcus_phage	31.7	1.4e-09
AWC94052.1|2246420_2247713_-	exonuclease subunit SbcD	NA	NA	NA	NA	NA
AWC94053.1|2247992_2248682_+	phosphate regulon transcriptional regulatory protein PhoB	NA	W8CYM9	Bacillus_phage	39.7	1.1e-37
AWC94054.1|2248712_2250008_+	two-component system sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	32.7	1.3e-26
>prophage 153
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2254526	2261218	4221270	tRNA	uncultured_Mediterranean_phage(60.0%)	7	NA	NA
AWC94059.1|2254526_2255651_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.4	2.2e-91
AWC94060.1|2255752_2256088_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	31.4	1.6e-05
AWC94061.1|2256123_2257971_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
AWC94062.1|2257981_2258950_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	41.5	6.5e-47
AWC94063.1|2259061_2259511_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AWC94064.1|2259513_2260626_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	33.3	1.1e-50
AWC94065.1|2260747_2261218_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	45.0	3.3e-28
>prophage 154
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2283821	2288878	4221270	protease	Agrobacterium_phage(25.0%)	4	NA	NA
AWC94086.1|2283821_2284442_+	ATP-dependent Clp endopeptidase, proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	64.9	2.2e-64
AWC94087.1|2284550_2285831_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.8	2.0e-128
AWC94088.1|2286024_2288382_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	53.2	7.2e-225
AWC94089.1|2288602_2288878_+	DNA-binding protein HU-beta	NA	A4JWM7	Burkholderia_virus	59.6	1.7e-21
>prophage 155
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2291929	2299714	4221270		Bacillus_phage(50.0%)	7	NA	NA
AWC94093.1|2291929_2292628_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.5	1.3e-84
AWC94094.1|2292674_2293715_-	cysteine synthase	NA	NA	NA	NA	NA
AWC95975.1|2293829_2294306_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AWC94095.1|2294336_2296076_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.3	5.8e-46
AWC94096.1|2296068_2297865_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.9	9.3e-39
AWC94097.1|2298066_2298405_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
AWC95976.1|2298424_2299714_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	27.7	1.8e-28
>prophage 156
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2312617	2318222	4221270		Klosneuvirus(33.33%)	5	NA	NA
AWC95979.1|2312617_2313169_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.2	6.6e-28
AWC94107.1|2313263_2315195_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	39.1	6.0e-44
AWC94108.1|2315239_2315569_+	nucleoid-associated protein, YbaB/EbfC family	NA	NA	NA	NA	NA
AWC94109.1|2315568_2316186_+	recombination protein RecR	NA	NA	NA	NA	NA
AWC94110.1|2316347_2318222_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.1	7.0e-114
>prophage 157
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2333877	2343717	4221270		uncultured_virus(50.0%)	4	NA	NA
AWC94121.1|2333877_2336616_-	Cu+ exporting ATPase	NA	A0A218MNH6	uncultured_virus	37.0	3.7e-111
AWC94122.1|2336757_2337174_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AWC94123.1|2337357_2339046_+	hemolysin activation protein	NA	NA	NA	NA	NA
AWC94124.1|2339082_2343717_+	hemolysin	NA	A0A0R6PJK4	Moraxella_phage	27.3	3.5e-21
>prophage 158
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2351856	2352549	4221270		Planktothrix_phage(100.0%)	1	NA	NA
AWC94130.1|2351856_2352549_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.0	6.3e-20
>prophage 159
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2367100	2367787	4221270		Planktothrix_phage(100.0%)	1	NA	NA
AWC94141.1|2367100_2367787_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	4.3e-29
>prophage 160
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2374034	2378517	4221270	tRNA	Aureococcus_anophage(25.0%)	6	NA	NA
AWC94147.1|2374034_2374529_-	peptidylprolyl isomerase	NA	A0A076FI46	Aureococcus_anophage	34.0	3.1e-13
AWC94148.1|2374802_2376191_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L4N2	Tupanvirus	33.3	1.4e-39
AWC94149.1|2376366_2376756_+	cytochrome b562	NA	NA	NA	NA	NA
AWC94150.1|2376836_2377370_-	cytochrome B	NA	A0A0U2QLA7	Escherichia_phage	43.9	2.9e-20
AWC94151.1|2377438_2377651_-	ribosome-associated protein	NA	NA	NA	NA	NA
AWC95982.1|2377653_2378517_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	33.9	2.2e-30
>prophage 161
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2393725	2413871	4221270		Organic_Lake_phycodnavirus(28.57%)	17	NA	NA
AWC94164.1|2393725_2394697_+	hypothetical protein	NA	A0A240FFP8	Salmonella_phage	56.9	3.0e-68
AWC94165.1|2394979_2395255_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94166.1|2395865_2396087_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94167.1|2396233_2397520_+	colicin V secretion protein CvaA	NA	NA	NA	NA	NA
AWC94168.1|2397554_2399678_+	colicin V synthesis protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.5	4.5e-16
AWC94169.1|2399941_2400421_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94170.1|2400944_2402489_+	hypothetical protein	NA	NA	NA	NA	NA
AWC95984.1|2402488_2404636_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	33.5	1.5e-19
AWC95985.1|2404661_2405861_+	secretion protein HlyD	NA	NA	NA	NA	NA
AWC94171.1|2406006_2406900_+	pirin family protein	NA	NA	NA	NA	NA
AWC94172.1|2407073_2408090_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	24.8	1.8e-23
AWC94173.1|2408399_2408615_-	hypothetical protein	NA	A0A292GJ55	Xanthomonas_phage	49.1	2.7e-09
AWC94174.1|2409054_2409711_+	glycosyl hydrolase family 25	NA	A0A2H4UUT1	Bodo_saltans_virus	33.8	9.0e-24
AWC94175.1|2409749_2410235_-	T6SS protein Cts1W	NA	NA	NA	NA	NA
AWC94176.1|2410260_2411901_-	hypothetical protein	NA	NA	NA	NA	NA
AWC94177.1|2411901_2412531_-	hypothetical protein	NA	NA	NA	NA	NA
AWC94178.1|2412524_2413871_-	glycosyltransferase	NA	A0A292GJ55	Xanthomonas_phage	33.5	5.1e-58
>prophage 162
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2419907	2422688	4221270		Enterobacteria_phage(100.0%)	1	NA	NA
AWC94183.1|2419907_2422688_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	31.0	8.6e-84
>prophage 163
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2438497	2448194	4221270	plate	Ralstonia_phage(33.33%)	7	NA	NA
AWC94196.1|2438497_2441107_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.4e-30
AWC94197.1|2441426_2442260_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94198.1|2442278_2443109_+	ImpE family T6SS protein Cts1E	NA	NA	NA	NA	NA
AWC94199.1|2443098_2443593_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AWC94200.1|2443637_2444468_-	FkbM family methyltransferase	NA	A0A0P0CQZ1	Ostreococcus_lucimarinus_virus	30.7	4.6e-09
AWC94201.1|2445007_2446408_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94202.1|2446832_2448194_+	purine permease	NA	Q9KX94	Enterobacteria_phage	28.8	9.9e-25
>prophage 164
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2457786	2459268	4221270		environmental_Halophage(100.0%)	1	NA	NA
AWC94211.1|2457786_2459268_-	purine permease	NA	H9YQ34	environmental_Halophage	45.2	1.2e-20
>prophage 165
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2473950	2475600	4221270		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AWC94224.1|2473950_2475600_-	indole-3-pyruvate decarboxylase	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	21.2	4.7e-13
>prophage 166
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2479647	2481147	4221270		Staphylococcus_phage(100.0%)	1	NA	NA
AWC94229.1|2479647_2481147_-	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	22.7	1.4e-11
>prophage 167
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2487673	2490433	4221270		Staphylococcus_phage(100.0%)	1	NA	NA
AWC94238.1|2487673_2490433_-	multidrug ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	5.5e-22
>prophage 168
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2500396	2500615	4221270		Agrobacterium_phage(100.0%)	1	NA	NA
AWC94249.1|2500396_2500615_+	XRE family transcriptional regulator	NA	A0A223W054	Agrobacterium_phage	39.3	6.9e-05
>prophage 169
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2524085	2525240	4221270		Staphylococcus_phage(100.0%)	1	NA	NA
AWC94270.1|2524085_2525240_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	61.7	9.3e-125
>prophage 170
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2529884	2531399	4221270		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
AWC94275.1|2529884_2531399_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	22.6	1.3e-09
>prophage 171
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2536032	2537130	4221270		Brochothrix_phage(100.0%)	1	NA	NA
AWC94279.1|2536032_2537130_+	DUF4172 domain-containing protein	NA	D7RWK9	Brochothrix_phage	24.6	5.7e-07
>prophage 172
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2555285	2559102	4221270		Catovirus(50.0%)	3	NA	NA
AWC94295.1|2555285_2557094_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.7	1.6e-46
AWC94296.1|2557097_2557307_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94297.1|2557380_2559102_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.4	4.7e-32
>prophage 173
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2583158	2583554	4221270		Rhizoctonia_fumigata_mycovirus(100.0%)	1	NA	NA
AWC94319.1|2583158_2583554_+	8-oxo-dGTP diphosphatase MutT	NA	A0A0B5CYJ3	Rhizoctonia_fumigata_mycovirus	31.5	2.3e-06
>prophage 174
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2595548	2596976	4221270		Erysipelothrix_phage(100.0%)	1	NA	NA
AWC94329.1|2595548_2596976_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	8.4e-43
>prophage 175
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2605632	2606883	4221270		Catovirus(100.0%)	1	NA	NA
AWC94337.1|2605632_2606883_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.7	8.3e-103
>prophage 176
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2614839	2617716	4221270		Prochlorococcus_phage(100.0%)	1	NA	NA
AWC94346.1|2614839_2617716_+	glycine dehydrogenase (aminomethyl-transferring)	NA	E3SN07	Prochlorococcus_phage	51.2	1.0e-265
>prophage 177
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2621223	2627329	4221270	tRNA	Brevibacillus_phage(33.33%)	5	NA	NA
AWC94352.1|2621223_2622138_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.5	3.6e-31
AWC94353.1|2622150_2622843_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
AWC94354.1|2622865_2624599_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.2	3.4e-62
AWC94355.1|2624703_2625801_+	peptide chain release factor 2	NA	NA	NA	NA	NA
AWC94356.1|2625811_2627329_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	37.5	7.7e-87
>prophage 178
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2648461	2654115	4221270		Pithovirus(25.0%)	10	NA	NA
AWC94377.1|2648461_2649085_+	iron ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.3	1.0e-16
AWC94378.1|2649181_2650219_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94379.1|2650290_2650845_+	GNAT family N-acetyltransferase	NA	G9BWD5	Planktothrix_phage	28.2	1.8e-09
AWC94380.1|2650835_2651192_-	nitrous oxide-stimulated promoter family protein	NA	NA	NA	NA	NA
AWC94381.1|2651311_2651563_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	39.5	2.8e-10
AWC94382.1|2651638_2651887_-	hypothetical protein	NA	NA	NA	NA	NA
AWC94383.1|2652033_2652246_-	DUF465 domain-containing protein	NA	NA	NA	NA	NA
AWC94384.1|2652569_2653094_+	ecotin	NA	NA	NA	NA	NA
AWC94385.1|2653226_2653628_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
AWC94386.1|2653677_2654115_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	46.2	5.4e-25
>prophage 179
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2662422	2667997	4221270		Herpes_simplex_virus(50.0%)	3	NA	NA
AWC94395.1|2662422_2665485_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	33.4	3.8e-157
AWC94396.1|2665748_2666738_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
AWC94397.1|2666980_2667997_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	49.2	3.0e-87
>prophage 180
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2673137	2675177	4221270		Acinetobacter_phage(100.0%)	1	NA	NA
AWC94403.1|2673137_2675177_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	32.3	3.4e-13
>prophage 181
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2687412	2726620	4221270	portal,lysis,tail,holin,terminase,coat,integrase	Salmonella_phage(25.58%)	63	2687336:2687383	2726797:2726844
2687336:2687383	attL	TCATTCGTAATGAAAAGGTCACCAGTTCGAATCCGGTATCCGGCACCA	NA	NA	NA	NA
AWC94413.1|2687412_2688480_-|integrase	integrase	integrase	G8C7S0	Escherichia_phage	52.9	1.5e-113
AWC94414.1|2688380_2688737_-	hypothetical protein	NA	NA	NA	NA	NA
AWC94415.1|2688726_2688939_-	hypothetical protein	NA	A0A1P8DTI1	Proteus_phage	56.9	5.6e-12
AWC94416.1|2688947_2689490_-	phage N-6-adenine-methyltransferase	NA	A0A1W6JP96	Morganella_phage	63.7	7.3e-56
AWC94417.1|2689711_2690080_-	recombinase	NA	E9NID9	Enterobacter_phage	42.1	4.4e-12
AWC94418.1|2690063_2690336_-	hypothetical protein	NA	NA	NA	NA	NA
AWC94419.1|2690490_2690739_-	hypothetical protein	NA	NA	NA	NA	NA
AWC94420.1|2690738_2690939_-	hypothetical protein	NA	NA	NA	NA	NA
AWC94421.1|2690957_2691242_-	hypothetical protein	NA	A0A1P8DTG9	Proteus_phage	62.4	3.7e-27
AWC94422.1|2691244_2692141_-	DNA cytosine methyltransferase	NA	W0LM09	Edwardsiella_phage	63.1	2.0e-114
AWC94423.1|2692188_2692887_-	exonuclease	NA	A0A0P0ZBV6	Stx2-converting_phage	60.4	4.4e-77
AWC94424.1|2692886_2693810_-	recombinase RecT	NA	F1C5B8	Cronobacter_phage	66.9	8.5e-113
AWC94425.1|2693806_2694052_-	hypothetical protein	NA	NA	NA	NA	NA
AWC94426.1|2694048_2694312_-	hypothetical protein	NA	NA	NA	NA	NA
AWC94427.1|2694493_2694727_-	hypothetical protein	NA	A0A088F844	Salmonella_phage	53.8	2.1e-15
AWC94428.1|2695229_2695496_-	hypothetical protein	NA	S4TU79	Salmonella_phage	48.4	2.2e-21
AWC94429.1|2695734_2695923_-	hypothetical protein	NA	A0A068C8G2	Acinetobacter_phage	44.4	4.5e-05
AWC94430.1|2696005_2696287_-	hypothetical protein	NA	NA	NA	NA	NA
AWC94431.1|2696790_2697303_-	hypothetical protein	NA	NA	NA	NA	NA
AWC94432.1|2697315_2697651_-	hypothetical protein	NA	NA	NA	NA	NA
AWC94433.1|2697671_2698382_-	LexA family transcriptional repressor	NA	A0A2R2X2B0	Escherichia_phage	65.7	1.3e-81
AWC94434.1|2698477_2698669_+	hypothetical protein	NA	A0A2K8HL98	Pseudomonas_phage	50.8	1.3e-07
AWC94435.1|2698788_2699121_+	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	91.2	6.9e-41
AWC94436.1|2699083_2699338_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94437.1|2699515_2700367_+	replication protein	NA	A0A1W6JNY0	Morganella_phage	50.7	2.3e-64
AWC94438.1|2700366_2701095_+	DNA replication protein DnaC	NA	A0A1W6JP39	Morganella_phage	97.1	3.9e-129
AWC94439.1|2701224_2701515_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94440.1|2701989_2702244_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94441.1|2702278_2702722_+	hypothetical protein	NA	A0A1P8DTD8	Proteus_phage	83.6	1.4e-28
AWC94442.1|2702885_2703071_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94443.1|2703067_2703265_+	hypothetical protein	NA	A0A1W6JP14	Morganella_phage	89.2	1.6e-29
AWC94444.1|2703261_2703672_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94445.1|2703862_2704153_+	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	76.0	1.5e-36
AWC94446.1|2704149_2704515_+	hypothetical protein	NA	E5AGG1	Erwinia_phage	62.0	1.3e-37
AWC94447.1|2704504_2704705_+	NinH	NA	NA	NA	NA	NA
AWC94448.1|2704701_2705310_+	hypothetical protein	NA	A0A2H4JCH5	uncultured_Caudovirales_phage	48.1	3.8e-45
AWC95996.1|2705854_2706163_+|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	66.7	2.4e-35
AWC94449.1|2706155_2706638_+	TIGR02594 family protein	NA	A0A1U9ZAE8	Proteus_phage	71.8	4.7e-62
AWC94450.1|2706639_2707089_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	55.7	2.0e-35
AWC94451.1|2707118_2707334_-	KTSC domain-containing protein	NA	A0A0K1LMB5	Caulobacter_phage	48.6	3.1e-10
AWC94452.1|2707647_2707854_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94453.1|2708054_2708282_+	hypothetical protein	NA	A0A192Y6S9	Salmonella_phage	56.2	3.5e-12
AWC94454.1|2708335_2708803_+	hypothetical protein	NA	A0A1B2I9W9	Erwinia_phage	36.7	7.5e-17
AWC94455.1|2708810_2709302_+	DNA-packaging protein	NA	C6ZR06	Salmonella_phage	82.8	5.4e-74
AWC94456.1|2709276_2710776_+|terminase	terminase	terminase	A0A192Y824	Salmonella_phage	81.8	1.2e-254
AWC94457.1|2710775_2712863_+|portal	portal protein	portal	G5DA97	Enterobacteria_phage	68.7	2.3e-238
AWC94458.1|2712877_2713792_+	scaffolding protein	NA	A0A2D1GLN7	Escherichia_phage	74.8	1.8e-115
AWC94459.1|2713791_2715075_+|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	64.8	1.9e-163
AWC94460.1|2715128_2715404_+	hypothetical protein	NA	A0A141E1X7	Streptococcus_phage	47.1	5.8e-17
AWC94461.1|2715507_2715693_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94462.1|2715680_2716178_+	recombinase RmuC	NA	Q76H19	Enterobacteria_phage	60.9	2.2e-46
AWC94463.1|2716149_2717568_+	hypothetical protein	NA	I1TEJ1	Salmonella_phage	69.9	9.4e-204
AWC94464.1|2717567_2718311_+|tail	phage tail protein	tail	C6ZR14	Salmonella_phage	64.5	3.8e-39
AWC94465.1|2718318_2718777_+	hypothetical protein	NA	G5DA79	Enterobacteria_phage	85.4	5.0e-74
AWC94466.1|2718779_2719475_+	DNA transfer protein	NA	I6S1K1	Salmonella_phage	62.7	9.1e-67
AWC94467.1|2719484_2720873_+	DNA transfer protein	NA	A0A2H4FND5	Salmonella_phage	51.2	1.1e-103
AWC94468.1|2720872_2722969_+	DNA transfer protein	NA	A0A2I7QW93	Vibrio_phage	44.8	4.3e-144
AWC94469.1|2722958_2723285_-	hypothetical protein	NA	NA	NA	NA	NA
AWC94470.1|2723297_2723657_-	hypothetical protein	NA	NA	NA	NA	NA
AWC94471.1|2723709_2724033_-	hypothetical protein	NA	NA	NA	NA	NA
AWC94472.1|2724052_2724304_-	toxin-antitoxin system HicB family antitoxin	NA	E7C9U8	Salmonella_phage	65.8	7.9e-21
AWC94473.1|2724414_2726391_+	hypothetical protein	NA	Q716G1	Shigella_phage	56.8	3.0e-62
AWC94474.1|2726395_2726620_-	DNA polymerase II	NA	H9C187	Pectobacterium_phage	61.2	4.3e-18
2726797:2726844	attR	TCATTCGTAATGAAAAGGTCACCAGTTCGAATCCGGTATCCGGCACCA	NA	NA	NA	NA
>prophage 182
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2733689	2744605	4221270		Morganella_phage(33.33%)	12	NA	NA
AWC94479.1|2733689_2734124_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	51.4	1.1e-30
AWC94480.1|2734256_2734604_-	DUF3024 domain-containing protein	NA	A0A1W6JP12	Morganella_phage	35.1	1.1e-12
AWC94481.1|2734890_2735400_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
AWC94482.1|2735449_2737174_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	31.9	3.6e-16
AWC94483.1|2737296_2737554_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AWC94484.1|2737830_2738787_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.9	9.5e-75
AWC94485.1|2738976_2739729_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
AWC94486.1|2739966_2740938_+	cell division protein ZipA	NA	NA	NA	NA	NA
AWC95999.1|2741013_2743032_+	DNA ligase	NA	A0A289ZTZ3	Serratia_phage	50.8	1.8e-144
AWC94487.1|2743091_2743313_+	cytoplasmic protein	NA	NA	NA	NA	NA
AWC94488.1|2743306_2743729_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWC94489.1|2743852_2744605_+	short-chain dehydrogenase	NA	A0A0M4JSW6	Mollivirus	28.2	5.6e-14
>prophage 183
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2748581	2749046	4221270		Rock_bream_iridovirus(100.0%)	1	NA	NA
AWC94492.1|2748581_2749046_-	diadenosine tetraphosphate hydrolase	NA	Q5YEY9	Rock_bream_iridovirus	36.1	3.6e-19
>prophage 184
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2754847	2755603	4221270		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
AWC94500.1|2754847_2755603_-	3-oxoacyl-ACP reductase FabG	NA	F2NZ40	Diadromus_pulchellus_ascovirus	27.4	2.6e-11
>prophage 185
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2764212	2767691	4221270	tail	Salmonella_phage(75.0%)	4	NA	NA
AWC94507.1|2764212_2764398_-	transcriptional regulator	NA	Q37973	Salmonella_virus	59.0	7.3e-16
AWC94508.1|2764394_2765486_-	late control protein D	NA	E5G6Q3	Salmonella_phage	55.8	6.3e-107
AWC96001.1|2765482_2765965_-|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	50.6	4.5e-41
AWC94509.1|2767187_2767691_-	hypothetical protein	NA	A0A1S6KZY7	Salmonella_phage	64.8	8.6e-51
>prophage 186
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2776267	2778119	4221270		Vibrio_phage(100.0%)	2	NA	NA
AWC94515.1|2776267_2777089_+	CRISPR-associated protein Csy2	NA	A0A2I7RCX5	Vibrio_phage	21.5	2.3e-05
AWC94516.1|2777102_2778119_+	type I-F CRISPR-associated protein Csy3	NA	A0A2D0YRR8	Vibrio_phage	34.5	3.5e-43
>prophage 187
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2797686	2854168	4221270	portal,tail,holin,terminase,head,capsid,protease	Morganella_phage(75.0%)	72	NA	NA
AWC94532.1|2797686_2797899_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	78.6	5.8e-25
AWC94533.1|2798026_2798761_+	SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	40.7	2.1e-45
AWC94534.1|2798789_2799341_-	DedA family protein	NA	NA	NA	NA	NA
AWC94535.1|2799353_2800031_-	DUF1345 domain-containing protein	NA	NA	NA	NA	NA
AWC94536.1|2800180_2800909_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94537.1|2800922_2801243_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94538.1|2801460_2802090_-	hypothetical protein	NA	A0A0F7L444	uncultured_marine_virus	51.2	9.4e-55
AWC94539.1|2802108_2803335_-	phosphoadenosine phosphosulfate reductase	NA	L0P6Z6	Lactobacillus_phage	34.2	2.2e-63
AWC96006.1|2803561_2804041_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
AWC94540.1|2804278_2805451_-	recombinase	NA	A0A2H4J1K3	uncultured_Caudovirales_phage	29.3	4.7e-31
AWC96007.1|2805452_2805668_-	hypothetical protein	NA	NA	NA	NA	NA
AWC94541.1|2805698_2806268_-	3'-5' exoribonuclease	NA	A0A1W6JP74	Morganella_phage	85.6	1.3e-92
AWC96008.1|2806260_2806740_-	SAM-dependent methyltransferase	NA	A0A1W6JP48	Morganella_phage	92.2	8.1e-83
AWC94542.1|2806757_2807018_-	antitoxin	NA	NA	NA	NA	NA
AWC94543.1|2807020_2807548_-	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	93.6	8.3e-89
AWC94544.1|2807656_2808484_-	hypothetical protein	NA	U5P439	Shigella_phage	54.2	5.5e-79
AWC94545.1|2808550_2808913_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	61.2	1.8e-34
AWC94546.1|2809647_2809971_-	hypothetical protein	NA	NA	NA	NA	NA
AWC94547.1|2810030_2810243_-	hypothetical protein	NA	A0A1W6JP89	Morganella_phage	84.3	2.4e-26
AWC94548.1|2810394_2811282_+	NAD-dependent DNA ligase	NA	NA	NA	NA	NA
AWC94549.1|2811267_2811954_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	43.5	4.8e-44
AWC96009.1|2812079_2812316_+	cytoplasmic chaperone TorD	NA	NA	NA	NA	NA
AWC94550.1|2812373_2812853_+	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	91.8	9.3e-79
AWC94551.1|2812916_2813117_+	hypothetical protein	NA	A0A1W6JP45	Morganella_phage	100.0	1.2e-32
AWC94552.1|2813109_2813301_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	96.8	1.6e-29
AWC94553.1|2813297_2814182_+	primosomal protein I	NA	A0A1W6JP36	Morganella_phage	96.3	8.9e-144
AWC94554.1|2815920_2816319_+	hypothetical protein	NA	A0A1W6JP58	Morganella_phage	40.5	3.8e-17
AWC94555.1|2816311_2816515_+	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
AWC96010.1|2816511_2816907_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1W6JP40	Morganella_phage	98.1	1.6e-55
AWC94556.1|2816924_2817710_+	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	86.6	1.2e-120
AWC94557.1|2817709_2818726_+	cytoplasmic protein	NA	A0A1W6JP62	Morganella_phage	83.4	5.8e-171
AWC94558.1|2818756_2819134_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94559.1|2819375_2819570_+	hypothetical protein	NA	A0A1W6JP28	Morganella_phage	93.8	4.3e-27
AWC94560.1|2819708_2820764_+	DNA adenine methylase	NA	A0A1W6JP25	Morganella_phage	93.7	4.0e-175
AWC94561.1|2821074_2821266_+|holin	holin	holin	A0A1W6JNY9	Morganella_phage	98.4	1.9e-30
AWC94562.1|2821258_2821735_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	94.3	3.6e-83
AWC94563.1|2821871_2822249_+	hypothetical protein	NA	A0A1W6JP00	Morganella_phage	83.2	4.2e-50
AWC94564.1|2822166_2822394_+	peptidase	NA	A0A1W6JP52	Morganella_phage	75.9	4.0e-16
AWC94565.1|2822390_2822681_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94566.1|2823130_2823481_+	HNH endonuclease	NA	A0A1W6JP27	Morganella_phage	99.1	9.5e-65
AWC94567.1|2823477_2823681_+	hypothetical protein	NA	A0A1W6JP16	Morganella_phage	100.0	2.7e-32
AWC94568.1|2823823_2824318_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	75.0	5.3e-69
AWC94569.1|2824314_2826045_+|terminase	terminase	terminase	U5P0Q5	Shigella_phage	81.3	2.4e-286
AWC94570.1|2826192_2827416_+|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	99.3	2.0e-234
AWC94571.1|2827405_2828014_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1W6JP53	Morganella_phage	98.5	1.4e-108
AWC94572.1|2828023_2829244_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	97.3	5.1e-222
AWC94573.1|2829324_2829627_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	99.0	1.3e-49
AWC94574.1|2829636_2829960_+|head,tail	head-tail adaptor	head,tail	A0A1W6JP44	Morganella_phage	96.3	3.7e-55
AWC94575.1|2829952_2830402_+	hypothetical protein	NA	A0A1W6JP15	Morganella_phage	98.7	3.4e-75
AWC94576.1|2830398_2830734_+	hypothetical protein	NA	A0A1W6JP05	Morganella_phage	96.4	1.1e-57
AWC94577.1|2830793_2831261_+|tail	phage tail protein	tail	A0A1W6JP06	Morganella_phage	100.0	1.0e-82
AWC94578.1|2831264_2831648_+|tail	phage tail protein	tail	A0A1W6JP08	Morganella_phage	100.0	1.6e-65
AWC94579.1|2831659_2831944_+|tail	phage tail protein	tail	A0A1W6JP68	Morganella_phage	97.9	2.3e-45
AWC94580.1|2831968_2835226_+|tail	phage tail tape measure protein	tail	A0A1W6JP49	Morganella_phage	98.0	0.0e+00
AWC94581.1|2835222_2835558_+|tail	phage tail protein	tail	A0A1W6JP11	Morganella_phage	97.3	3.6e-61
AWC94582.1|2835554_2836313_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	95.2	2.4e-145
AWC94583.1|2836315_2837029_+	peptidase P60	NA	A0A1W6JP31	Morganella_phage	92.6	9.8e-133
AWC94584.1|2837030_2837510_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94585.1|2837567_2838170_+|tail	phage tail protein	tail	A0A1W6JNY8	Morganella_phage	96.0	2.3e-103
AWC94586.1|2838202_2841409_+	host specificity protein	NA	A0A1W6JNZ7	Morganella_phage	94.7	0.0e+00
AWC94587.1|2841405_2842461_+	hypothetical protein	NA	NA	NA	NA	NA
AWC96011.1|2843570_2844110_+	hypothetical protein	NA	A0A1W6JNW0	Morganella_phage	96.8	4.2e-88
AWC94588.1|2844149_2844434_-	hypothetical protein	NA	A0A1W6JP10	Morganella_phage	85.4	4.0e-37
AWC94589.1|2844938_2846708_-	hypothetical protein	NA	NA	NA	NA	NA
AWC94590.1|2846735_2846963_-	hypothetical protein	NA	NA	NA	NA	NA
AWC94591.1|2847195_2848200_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.0	3.7e-85
AWC94592.1|2848278_2848560_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
AWC94593.1|2848732_2850493_-	ATP-dependent helicase	NA	M4Q3N1	Vibrio_phage	43.7	3.3e-97
AWC94594.1|2850724_2851420_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
AWC94595.1|2851457_2852642_+	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	24.7	1.5e-24
AWC94596.1|2853154_2853499_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94597.1|2853613_2854168_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A217EQL1	Bacillus_phage	34.8	1.9e-11
>prophage 188
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2860250	2861093	4221270		Catovirus(100.0%)	1	NA	NA
AWC94604.1|2860250_2861093_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.8	1.6e-25
>prophage 189
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2867566	2870639	4221270		Bacillus_virus(50.0%)	2	NA	NA
AWC94610.1|2867566_2868385_+	iron ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.2	1.6e-14
AWC94611.1|2868665_2870639_+	ligand-gated channel protein	NA	A0A0P0I887	Acinetobacter_phage	29.9	1.0e-09
>prophage 190
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2887496	2888623	4221270		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
AWC94628.1|2887496_2888231_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.9	1.9e-14
AWC94629.1|2888386_2888623_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	50.0	6.9e-11
>prophage 191
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2891975	2892614	4221270		Erwinia_phage(100.0%)	1	NA	NA
AWC94633.1|2891975_2892614_+	dTMP kinase	NA	W8D0J5	Erwinia_phage	35.7	9.6e-23
>prophage 192
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2900543	2901713	4221270		Pacmanvirus(100.0%)	1	NA	NA
AWC94643.1|2900543_2901713_-	aminotransferase class I	NA	A0A1X6WGT4	Pacmanvirus	23.5	8.5e-17
>prophage 193
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2906735	2909609	4221270		Planktothrix_phage(50.0%)	3	NA	NA
AWC94645.1|2906735_2907431_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.0	7.7e-34
AWC94646.1|2907427_2908675_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
AWC94647.1|2908742_2909609_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	33.5	5.5e-21
>prophage 194
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2919560	2991551	4221270	tRNA,protease,portal,transposase,tail,holin,terminase,capsid,head,integrase	Morganella_phage(58.33%)	87	2917306:2917323	2974224:2974241
2917306:2917323	attL	ATACTGCTCCAGAATATC	NA	NA	NA	NA
AWC94656.1|2919560_2920928_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.4	2.2e-112
AWC94657.1|2920949_2921579_-	lysogenization regulator HflD	NA	NA	NA	NA	NA
AWC94658.1|2921581_2922685_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AWC94659.1|2922852_2923320_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AWC94660.1|2923309_2923960_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AWC94661.1|2924100_2925354_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	8.0e-21
AWC94662.1|2925707_2926949_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94663.1|2927271_2927844_-	hypothetical protein	NA	NA	NA	NA	NA
AWC94664.1|2928502_2929630_-|integrase	integrase	integrase	O21925	Phage_21	59.3	3.0e-120
AWC94665.1|2929610_2929853_-	excisionase	NA	NA	NA	NA	NA
AWC94666.1|2929915_2930143_-	hypothetical protein	NA	NA	NA	NA	NA
AWC94667.1|2930465_2931071_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94668.1|2931314_2931527_-	hypothetical protein	NA	A0A1W6JP89	Morganella_phage	75.7	1.2e-22
AWC94669.1|2931656_2932304_-	LexA family transcriptional repressor	NA	H9C160	Pectobacterium_phage	61.0	1.6e-70
AWC94670.1|2932413_2932614_+	hypothetical protein	NA	A0A1W6JP24	Morganella_phage	69.7	6.9e-20
AWC94671.1|2932643_2933108_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	48.7	2.7e-35
AWC94672.1|2933364_2933559_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	82.8	1.5e-24
AWC94673.1|2933555_2934440_+	primosomal protein I	NA	A0A1W6JP36	Morganella_phage	86.4	3.3e-130
AWC94674.1|2934439_2934835_+	hypothetical protein	NA	A0A1W6JP58	Morganella_phage	38.0	9.2e-16
AWC94675.1|2934877_2935669_+	DNA-binding protein	NA	A0A1W6JP13	Morganella_phage	87.1	2.0e-123
AWC94676.1|2935668_2936685_+	cytoplasmic protein	NA	A0A1W6JP62	Morganella_phage	88.5	2.0e-179
AWC94677.1|2936715_2937393_+	hypothetical protein	NA	A0A1W6JP37	Morganella_phage	87.1	2.1e-113
AWC94678.1|2937623_2938073_-	universal stress protein UspA	NA	A0A1W6JNV4	Morganella_phage	45.6	1.5e-22
AWC94679.1|2938963_2939203_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94680.1|2939290_2939542_-	hypothetical protein	NA	NA	NA	NA	NA
AWC94681.1|2941573_2941753_+	MbeCy	NA	A0A1W6JNZ9	Morganella_phage	68.1	1.2e-10
AWC94682.1|2941852_2942251_-	hypothetical protein	NA	NA	NA	NA	NA
AWC94683.1|2942556_2942751_-	hypothetical protein	NA	NA	NA	NA	NA
AWC94684.1|2942918_2943110_+|holin	holin	holin	A0A1W6JNY9	Morganella_phage	98.4	1.9e-30
AWC94685.1|2943102_2943579_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	91.7	3.7e-80
AWC96014.1|2943736_2944243_+	hypothetical protein	NA	H9C185	Pectobacterium_phage	41.8	7.9e-20
AWC94686.1|2944362_2944770_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
AWC94687.1|2945007_2945358_+	HNH endonuclease	NA	A0A1W6JP27	Morganella_phage	97.4	6.2e-64
AWC94688.1|2945354_2945558_+	hypothetical protein	NA	A0A1W6JP16	Morganella_phage	97.0	3.0e-31
AWC94689.1|2945687_2946158_+|terminase	phage terminase small subunit P27 family	terminase	A0A1W6JP17	Morganella_phage	95.5	4.0e-82
AWC94690.1|2946161_2947892_+|terminase	terminase	terminase	A0A1W6JP18	Morganella_phage	98.2	0.0e+00
AWC94691.1|2947891_2949229_+|portal	phage portal protein	portal	A0A1P8DTI5	Proteus_phage	83.9	8.3e-218
AWC94692.1|2949234_2950086_+|protease	Clp protease ClpP	protease	A0A1P8DTI2	Proteus_phage	74.5	2.0e-116
AWC94693.1|2950100_2951315_+|capsid	phage major capsid protein	capsid	A0A1P8DTJ7	Proteus_phage	86.6	2.8e-196
AWC94694.1|2951365_2951668_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94695.1|2951667_2951988_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	48.6	1.9e-19
AWC94696.1|2951984_2952320_+|head,tail	head-tail adaptor protein	head,tail	Q7Y406	Yersinia_phage	46.8	6.0e-16
AWC94697.1|2952306_2952696_+	hypothetical protein	NA	Q7Y405	Yersinia_phage	53.2	9.0e-32
AWC94698.1|2952689_2953106_+	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	56.5	1.9e-32
AWC94699.1|2953120_2953597_+|tail	phage tail protein	tail	Q7Y403	Yersinia_phage	77.6	1.3e-59
AWC94700.1|2953596_2953941_+|tail	phage tail protein	tail	NA	NA	NA	NA
AWC94701.1|2954160_2957112_+|tail	phage tail tape measure protein	tail	A0A1W6JP49	Morganella_phage	45.6	6.2e-48
AWC94702.1|2957108_2957444_+|tail	phage tail protein	tail	A0A1W6JP11	Morganella_phage	76.6	3.8e-47
AWC94703.1|2957440_2958199_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	95.6	3.1e-145
AWC94704.1|2958201_2958909_+	peptidase P60	NA	A0A1W6JP31	Morganella_phage	94.8	1.5e-133
AWC94705.1|2958973_2959396_+	hypothetical protein	NA	J9Q806	Salmonella_phage	42.6	7.5e-24
AWC94706.1|2959454_2960048_+|tail	tail assembly protein	tail	A0A1W6JNY8	Morganella_phage	83.0	1.0e-87
AWC94707.1|2960080_2963287_+	host specificity protein	NA	A0A1W6JNZ7	Morganella_phage	95.0	0.0e+00
AWC94708.1|2963283_2964339_+	hypothetical protein	NA	NA	NA	NA	NA
AWC96015.1|2965448_2965988_+	hypothetical protein	NA	A0A1W6JNW0	Morganella_phage	99.4	5.9e-90
AWC94709.1|2966044_2966326_-	hypothetical protein	NA	NA	NA	NA	NA
AWC94710.1|2966653_2967130_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94711.1|2967140_2967332_-|integrase	integrase	integrase	NA	NA	NA	NA
AWC94712.1|2967572_2967725_+	hypothetical protein	NA	Q77Z09	Phage_21	94.0	3.4e-19
AWC94713.1|2968028_2969825_-	ATP-dependent helicase	NA	A0A1V0SDG5	Indivirus	25.6	1.8e-05
AWC94714.1|2969827_2972038_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AWC94715.1|2972210_2973357_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.3	2.7e-148
AWC94716.1|2973524_2974652_-|integrase	integrase	integrase	O21925	Phage_21	60.1	4.2e-122
2974224:2974241	attR	ATACTGCTCCAGAATATC	NA	NA	NA	NA
AWC94717.1|2974632_2974875_-	excisionase	NA	NA	NA	NA	NA
AWC94718.1|2975469_2976264_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94719.1|2976278_2976611_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94720.1|2976631_2976943_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94721.1|2977166_2978210_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94722.1|2978209_2978923_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWC94723.1|2979024_2979597_+	serine hydrolase family protein	NA	NA	NA	NA	NA
AWC94724.1|2979990_2980335_+	hypothetical protein	NA	NA	NA	NA	NA
AWC96016.1|2980891_2981170_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94725.1|2981323_2981545_+	DUF465 domain-containing protein	NA	NA	NA	NA	NA
AWC94726.1|2981612_2982101_+	N-acetyltransferase	NA	NA	NA	NA	NA
AWC94727.1|2982219_2982405_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AWC94728.1|2982512_2983388_+	permease	NA	NA	NA	NA	NA
AWC94729.1|2983752_2983971_-	hypothetical protein	NA	NA	NA	NA	NA
AWC94730.1|2984755_2986027_+	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
AWC94731.1|2986048_2986723_+	DUF1956 domain-containing protein	NA	NA	NA	NA	NA
AWC94732.1|2986764_2987580_-	lipoprotein NlpA	NA	NA	NA	NA	NA
AWC94733.1|2988010_2988262_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94734.1|2988629_2989337_-	peptidase S24	NA	K7P8B2	Enterobacteria_phage	57.0	1.5e-69
AWC94735.1|2989702_2990140_+	hypothetical protein	NA	A0A1W6JNY5	Morganella_phage	45.3	4.9e-26
AWC94736.1|2990213_2990408_+|holin	holin	holin	A0A1W6JNY9	Morganella_phage	73.0	3.4e-24
AWC94737.1|2990397_2990874_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	78.3	2.8e-67
AWC94738.1|2991010_2991388_+	hypothetical protein	NA	A0A1W6JP00	Morganella_phage	40.0	4.8e-14
AWC94739.1|2991359_2991551_+	hypothetical protein	NA	A0A1W6JP52	Morganella_phage	66.0	5.1e-12
>prophage 195
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	2996185	2996995	4221270		Streptococcus_phage(100.0%)	1	NA	NA
AWC94745.1|2996185_2996995_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	37.2	6.4e-40
>prophage 196
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3006124	3007213	4221270		Pandoravirus(100.0%)	1	NA	NA
AWC94754.1|3006124_3007213_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.3	4.7e-86
>prophage 197
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3019496	3020627	4221270		Brazilian_cedratvirus(100.0%)	1	NA	NA
AWC94766.1|3019496_3020627_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.5	3.2e-21
>prophage 198
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3026975	3028493	4221270		Mollivirus(100.0%)	1	NA	NA
AWC94773.1|3026975_3028493_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	43.0	9.8e-90
>prophage 199
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3038438	3041667	4221270		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
AWC94782.1|3038438_3039107_+	sugar phosphatase	NA	M1H9H9	Acanthocystis_turfacea_Chlorella_virus	24.2	1.8e-08
AWC96020.1|3039223_3041053_+	SLC13 family permease	NA	NA	NA	NA	NA
AWC94783.1|3041085_3041667_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	36.1	3.7e-05
>prophage 200
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3069861	3071304	4221270		Tupanvirus(100.0%)	1	NA	NA
AWC94805.1|3069861_3071304_-	catalase	NA	A0A2K9L0T1	Tupanvirus	44.4	2.3e-96
>prophage 201
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3077279	3077930	4221270		Brazilian_cedratvirus(100.0%)	1	NA	NA
AWC94814.1|3077279_3077930_+	antibiotic acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	37.5	3.5e-20
>prophage 202
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3084969	3085179	4221270		Morganella_phage(100.0%)	1	NA	NA
AWC94822.1|3084969_3085179_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	76.2	4.5e-22
>prophage 203
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3089547	3094091	4221270		Phage_TP(50.0%)	4	NA	NA
AWC94827.1|3089547_3090939_-	U32 family peptidase	NA	Q6DW11	Phage_TP	83.8	7.6e-182
AWC94828.1|3091157_3091919_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94829.1|3091995_3092715_-	two-component system response regulator BaeR	NA	NA	NA	NA	NA
AWC94830.1|3092729_3094091_-	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	29.9	3.7e-32
>prophage 204
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3112224	3116136	4221270		Prochlorococcus_phage(66.67%)	4	NA	NA
AWC94843.1|3112224_3112857_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	40.9	1.1e-29
AWC96023.1|3112856_3113897_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	45.7	4.4e-73
AWC94844.1|3114150_3114777_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AWC94845.1|3114846_3116136_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.9	1.5e-62
>prophage 205
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3123624	3123978	4221270		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AWC94853.1|3123624_3123978_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	42.6	7.0e-15
>prophage 206
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3131659	3132373	4221270		Synechococcus_phage(100.0%)	1	NA	NA
AWC94861.1|3131659_3132373_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	37.0	1.7e-36
>prophage 207
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3136365	3138015	4221270		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AWC94866.1|3136365_3138015_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	57.6	4.9e-10
>prophage 208
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3150859	3151417	4221270		Bacillus_phage(100.0%)	1	NA	NA
AWC94878.1|3150859_3151417_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	34.0	4.5e-08
>prophage 209
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3155820	3156705	4221270		Klosneuvirus(100.0%)	1	NA	NA
AWC94884.1|3155820_3156705_-	manganese/iron ABC transporter ATP-binding protein	NA	A0A1V0SKJ1	Klosneuvirus	28.1	9.3e-08
>prophage 210
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3160913	3268753	4221270	tRNA,portal,tail,holin,terminase,capsid,head,integrase	Morganella_phage(25.49%)	121	3157526:3157543	3266392:3266409
3157526:3157543	attL	CCGCCGCCGCATACCAGC	NA	NA	NA	NA
AWC94887.1|3160913_3162845_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	6.5e-123
AWC94888.1|3162848_3163388_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	31.5	2.8e-15
AWC96025.1|3163479_3163677_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AWC94889.1|3163717_3164074_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AWC94890.1|3164148_3164433_-	hypothetical protein	NA	NA	NA	NA	NA
AWC94891.1|3164431_3165415_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	37.4	3.2e-33
AWC94892.1|3165429_3167817_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AWC94893.1|3167821_3168118_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	1.8e-11
AWC94894.1|3168229_3169240_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
AWC94895.1|3169239_3170013_+	cobalamin ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AWC94896.1|3170155_3171301_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2D2W2B8	Stenotrophomonas_phage	24.4	1.4e-11
AWC94897.1|3171301_3172291_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	U5P087	Shigella_phage	34.4	4.3e-38
AWC94898.1|3172290_3174276_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	26.7	3.0e-22
AWC94899.1|3174275_3175169_+	4-deoxy-4-formamido-L-arabinose- phosphoundecaprenol deformylase	NA	NA	NA	NA	NA
AWC94900.1|3175175_3176837_+	lipid IV(A) 4-amino-4-deoxy-L-arabinosyltransferase	NA	NA	NA	NA	NA
AWC94901.1|3176843_3177194_+	4-amino-4-deoxy-L-arabinose-phospho-UDP flippase	NA	NA	NA	NA	NA
AWC94902.1|3177193_3177586_+	4-amino-4-deoxy-L-arabinose-phospho-UDP flippase	NA	NA	NA	NA	NA
AWC94903.1|3177780_3179478_+	lipid IV(A) 4-amino-4-deoxy-L-arabinosyltransferase	NA	NA	NA	NA	NA
AWC94904.1|3179569_3180055_+	endopeptidase	NA	NA	NA	NA	NA
AWC94905.1|3180111_3181128_+	lipoate--protein ligase	NA	NA	NA	NA	NA
AWC94906.1|3181219_3181588_-	AraC family transcriptional regulator	NA	D0R0F8	Streptococcus_phage	40.0	2.2e-11
AWC94907.1|3181862_3182456_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94908.1|3182452_3183253_-	heme ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.5e-09
AWC94909.1|3184243_3185074_-	hemin ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWC94910.1|3185070_3186138_-	hemin-degrading factor	NA	NA	NA	NA	NA
AWC96026.1|3186245_3186356_-	hypothetical protein	NA	NA	NA	NA	NA
AWC94911.1|3186521_3187745_+|integrase	integrase	integrase	A5LH57	Enterobacteria_phage	50.4	4.6e-114
AWC94912.1|3187701_3187908_-	hypothetical protein	NA	NA	NA	NA	NA
AWC94913.1|3187904_3188222_-	hypothetical protein	NA	NA	NA	NA	NA
AWC94914.1|3188208_3188985_-	hypothetical protein	NA	NA	NA	NA	NA
AWC94915.1|3188974_3189226_-	hypothetical protein	NA	NA	NA	NA	NA
AWC94916.1|3189222_3189444_-	hypothetical protein	NA	NA	NA	NA	NA
AWC94917.1|3189440_3190049_-	hypothetical protein	NA	NA	NA	NA	NA
AWC94918.1|3190051_3190885_-	hypothetical protein	NA	F1C5A3	Cronobacter_phage	61.1	4.5e-97
AWC94919.1|3190884_3191091_-	hypothetical protein	NA	NA	NA	NA	NA
AWC94920.1|3191077_3191425_-	hypothetical protein	NA	NA	NA	NA	NA
AWC94921.1|3191921_3192176_-	hypothetical protein	NA	NA	NA	NA	NA
AWC94922.1|3192212_3192431_-	hypothetical protein	NA	NA	NA	NA	NA
AWC94923.1|3192432_3192621_-	hypothetical protein	NA	NA	NA	NA	NA
AWC94924.1|3192622_3192811_-	hypothetical protein	NA	NA	NA	NA	NA
AWC94925.1|3192832_3193345_-	XRE family transcriptional regulator	NA	A0A0R6PJ00	Moraxella_phage	47.8	1.5e-05
AWC94926.1|3193428_3194205_-	LexA family transcriptional repressor	NA	Q8W648	Enterobacteria_phage	53.9	3.4e-70
AWC94927.1|3194315_3194537_+	hypothetical protein	NA	Q8W647	Enterobacteria_phage	71.6	2.4e-21
AWC94928.1|3194505_3194784_+	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	56.0	3.4e-17
AWC94929.1|3195048_3196626_+	helicase	NA	A0A286N2P9	Klebsiella_phage	67.0	3.6e-212
AWC94930.1|3196622_3197609_+	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	60.1	2.9e-111
AWC94931.1|3197608_3198388_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	38.9	6.2e-48
AWC94932.1|3198696_3199752_+	DNA adenine methylase	NA	A0A1W6JP25	Morganella_phage	93.4	2.7e-171
AWC94933.1|3199860_3200067_-	thiamine biosynthesis protein ApbE	NA	NA	NA	NA	NA
AWC94934.1|3200879_3202175_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94935.1|3202613_3202838_+|holin	holin	holin	A0A1W6JNY9	Morganella_phage	77.1	1.2e-23
AWC94936.1|3202818_3203295_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	91.7	4.4e-81
AWC94937.1|3203431_3203809_+	hypothetical protein	NA	A0A1W6JP00	Morganella_phage	89.6	7.3e-55
AWC94938.1|3203726_3203948_+	peptidase	NA	A0A1W6JNV7	Morganella_phage	73.2	3.3e-15
AWC94939.1|3203944_3204163_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94940.1|3204412_3204664_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94941.1|3204660_3204957_+	HNH endonuclease	NA	A0A2P1JT81	Streptomyces_phage	52.0	6.9e-08
AWC94942.1|3205115_3205577_+|terminase	terminase	terminase	S4TNN3	Salmonella_phage	48.4	7.9e-27
AWC94943.1|3205573_3207238_+|terminase	terminase	terminase	S4TSQ6	Salmonella_phage	78.8	1.9e-267
AWC94944.1|3207275_3209222_+|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	62.4	7.3e-215
AWC94945.1|3209274_3209550_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94946.1|3209596_3210928_+|portal	phage portal protein	portal	S4TTG7	Salmonella_phage	53.2	4.8e-125
AWC94947.1|3210911_3211868_+|portal	phage portal protein	portal	A0A0P0ZCZ4	Stx2-converting_phage	53.8	2.5e-38
AWC94948.1|3211864_3212191_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	36.1	1.6e-10
AWC96027.1|3212198_3212537_+|head,tail	head-tail adaptor protein	head,tail	A0A1W6JP44	Morganella_phage	38.6	1.1e-09
AWC94949.1|3212529_3213006_+	hypothetical protein	NA	A0A0R6PHU8	Moraxella_phage	30.5	2.2e-08
AWC96028.1|3213005_3213347_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94950.1|3213356_3214061_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94951.1|3214125_3214542_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94952.1|3214538_3214823_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94953.1|3214852_3218152_+|tail	phage tail tape measure protein	tail	B7SE05	Pseudomonas_virus	47.6	3.4e-55
AWC94954.1|3218154_3218490_+|tail	phage tail protein	tail	A0A1W6JP11	Morganella_phage	78.4	1.0e-47
AWC94955.1|3218486_3219245_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	95.2	5.0e-143
AWC94956.1|3219247_3219961_+	peptidase P60	NA	A0A1W6JP31	Morganella_phage	93.0	1.2e-133
AWC94957.1|3219962_3220442_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94958.1|3220499_3221102_+|tail	phage tail protein	tail	A0A1W6JNY8	Morganella_phage	96.0	2.3e-103
AWC94959.1|3221134_3224347_+	host specificity protein	NA	A0A1W6JNZ7	Morganella_phage	94.9	0.0e+00
AWC94960.1|3224343_3225399_+	hypothetical protein	NA	NA	NA	NA	NA
AWC96029.1|3226508_3227045_+	hypothetical protein	NA	A0A1W6JNW0	Morganella_phage	97.5	9.4e-88
AWC94961.1|3227237_3228080_+	DUF3800 domain-containing protein	NA	A5X9G9	Aeromonas_virus	44.5	5.5e-58
AWC94962.1|3228172_3228448_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWC94963.1|3228527_3228812_-	hypothetical protein	NA	A0A1W6JP10	Morganella_phage	86.5	1.2e-38
AWC94964.1|3229329_3230379_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B5IW14	Pandoravirus	46.6	1.6e-78
AWC94965.1|3230525_3231389_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
AWC94966.1|3231607_3233986_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.4	3.4e-174
AWC94967.1|3234460_3235576_-	hypothetical protein	NA	NA	NA	NA	NA
AWC94968.1|3235764_3238854_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94969.1|3238888_3239314_+	esterase	NA	NA	NA	NA	NA
AWC94970.1|3239652_3240033_+	Fe-S cluster assembly scaffold SufA	NA	A0A218MM00	uncultured_virus	35.9	1.4e-13
AWC94971.1|3240048_3241533_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
AWC94972.1|3241584_3242331_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	28.8	3.8e-10
AWC94973.1|3242305_3243613_+	FeS cluster assembly protein SufD	NA	NA	NA	NA	NA
AWC94974.1|3243609_3244848_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.2	5.0e-84
AWC94975.1|3244856_3245276_+	cysteine desulfuration protein SufE	NA	NA	NA	NA	NA
AWC94976.1|3245374_3246457_+	L,D-transpeptidase	NA	NA	NA	NA	NA
AWC94977.1|3246597_3246834_-	murein lipoprotein	NA	NA	NA	NA	NA
AWC94978.1|3247159_3248572_-	pyruvate kinase PykF	NA	NA	NA	NA	NA
AWC94979.1|3249287_3250661_-	MATE family efflux transporter	NA	NA	NA	NA	NA
AWC94980.1|3250873_3251539_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	36.8	1.4e-24
AWC94981.1|3251621_3252785_-	cyclopropane-fatty-acyl-phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.5	8.0e-84
AWC94982.1|3253050_3254262_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	24.7	8.8e-17
AWC94983.1|3254383_3255286_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWC94984.1|3255289_3256315_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	32.5	3.1e-31
AWC94985.1|3256592_3256676_+	YnhF family membrane protein	NA	NA	NA	NA	NA
AWC94986.1|3256744_3257323_-	superoxide dismutase [Fe]	NA	NA	NA	NA	NA
AWC94987.1|3257446_3257665_-	hypothetical protein	NA	NA	NA	NA	NA
AWC94988.1|3257711_3258029_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94989.1|3258098_3258638_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
AWC94990.1|3258662_3259424_-	RNA pseudouridine synthase	NA	NA	NA	NA	NA
AWC94991.1|3259502_3259958_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94992.1|3259996_3260617_-	homoserine/homoserine lactone efflux protein	NA	NA	NA	NA	NA
AWC94993.1|3260899_3261241_+	monothiol glutaredoxin, Grx4 family	NA	NA	NA	NA	NA
AWC94994.1|3261379_3262135_+	hypothetical protein	NA	NA	NA	NA	NA
AWC94995.1|3262171_3262819_-	ribonuclease T	NA	NA	NA	NA	NA
AWC94996.1|3262929_3263337_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
AWC94997.1|3263489_3263726_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
AWC94998.1|3264239_3264674_+	transcriptional regulator SlyA	NA	NA	NA	NA	NA
AWC94999.1|3264733_3265201_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
AWC95000.1|3265519_3266638_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
3266392:3266409	attR	GCTGGTATGCGGCGGCGG	NA	NA	NA	NA
AWC95001.1|3266692_3267343_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
AWC95002.1|3267478_3268753_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	3.3e-83
>prophage 211
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3272664	3274466	4221270		Planktothrix_phage(100.0%)	2	NA	NA
AWC95007.1|3272664_3273474_-	peptide ABC transporter ATP-binding protein SapF	NA	G9BWD6	Planktothrix_phage	30.0	7.2e-15
AWC95008.1|3273473_3274466_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	25.0	2.1e-08
>prophage 212
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3288858	3290318	4221270	tRNA	Escherichia_phage(50.0%)	2	NA	NA
AWC95022.1|3288858_3289785_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	90.8	7.9e-135
AWC95023.1|3289976_3290318_-	XRE family transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	38.2	2.2e-05
>prophage 213
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3295582	3299756	4221270		Klosneuvirus(50.0%)	4	NA	NA
AWC95030.1|3295582_3297151_-	ABC transporter ATP-binding protein	NA	A0A1V0SKJ1	Klosneuvirus	24.2	5.6e-24
AWC95031.1|3297414_3297951_+	hypothetical protein	NA	NA	NA	NA	NA
AWC95032.1|3298085_3299306_+	sugar transporter	NA	NA	NA	NA	NA
AWC95033.1|3299423_3299756_+	multidrug DMT transporter	NA	E5EPE2	Acinetobacter_phage	33.6	7.2e-06
>prophage 214
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3314866	3332308	4221270		Bodo_saltans_virus(25.0%)	16	NA	NA
AWC95048.1|3314866_3315505_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2H4UW48	Bodo_saltans_virus	26.5	3.4e-12
AWC95049.1|3315515_3316535_-	L-asparaginase 1	NA	NA	NA	NA	NA
AWC95050.1|3316640_3318503_-	signal peptide peptidase SppA	NA	K4HZZ6	Acidithiobacillus_phage	28.1	8.8e-08
AWC95051.1|3318665_3319217_+	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
AWC96032.1|3319242_3320289_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
AWC95052.1|3320291_3322256_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	28.9	2.0e-39
AWC96033.1|3322285_3323095_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
AWC95053.1|3323509_3324373_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWC95054.1|3324632_3325481_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	41.6	7.0e-13
AWC95055.1|3325546_3326023_-	hypothetical protein	NA	NA	NA	NA	NA
AWC95056.1|3326191_3327220_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
AWC95057.1|3327383_3328289_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	46.1	1.7e-60
AWC95058.1|3328311_3329655_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	39.2	1.3e-82
AWC95059.1|3329663_3330677_+	NAD-dependent epimerase	NA	A0A2H4UUK0	Bodo_saltans_virus	27.8	7.6e-30
AWC95060.1|3330795_3331206_-	transcriptional regulator	NA	NA	NA	NA	NA
AWC96034.1|3331705_3332308_+	thymidine kinase	NA	C4MYQ7	Escherichia_phage	58.3	8.1e-56
>prophage 215
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3336578	3338166	4221270		Planktothrix_phage(100.0%)	2	NA	NA
AWC96035.1|3336578_3337295_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.3	1.7e-20
AWC95063.1|3337317_3338166_-	peptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.3e-11
>prophage 216
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3347744	3350757	4221270		Salmonella_phage(50.0%)	4	NA	NA
AWC95073.1|3347744_3348719_+	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	32.4	2.5e-14
AWC95074.1|3348718_3349717_+	oligopeptide ABC transporter ATP-binding protein OppF	NA	G3M9Y6	Bacillus_virus	28.0	6.8e-15
AWC95075.1|3349947_3350172_+	hypothetical protein	NA	J9Q735	Salmonella_phage	50.0	3.5e-12
AWC95076.1|3350199_3350757_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	59.2	2.6e-56
>prophage 217
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3354888	3356262	4221270		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AWC95082.1|3354888_3356262_-	ATP-dependent RNA helicase DbpA	NA	A0A1B1IS59	uncultured_Mediterranean_phage	30.5	7.8e-46
>prophage 218
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3367048	3370043	4221270		Acinetobacter_phage(100.0%)	3	NA	NA
AWC95095.1|3367048_3368416_-	bifunctional indole-3-glycerol phosphate synthase/phosphoribosylanthranilate isomerase	NA	A0A0P0IR83	Acinetobacter_phage	39.1	3.9e-37
AWC95096.1|3368419_3369418_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	44.8	1.1e-49
AWC95097.1|3369464_3370043_-	anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	38.0	3.2e-33
>prophage 219
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3376590	3380861	4221270	protease	Bodo_saltans_virus(50.0%)	3	NA	NA
AWC96037.1|3376590_3377643_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	25.3	1.3e-19
AWC95103.1|3377733_3377985_-	hypothetical protein	NA	NA	NA	NA	NA
AWC96038.1|3378272_3380861_+	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	35.6	3.4e-90
>prophage 220
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3385489	3386110	4221270		Staphylococcus_phage(100.0%)	1	NA	NA
AWC95107.1|3385489_3386110_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.2	2.4e-42
>prophage 221
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3390272	3392210	4221270		Bodo_saltans_virus(100.0%)	1	NA	NA
AWC95114.1|3390272_3392210_-	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	22.3	1.9e-05
>prophage 222
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3426190	3427930	4221270		Streptococcus_phage(100.0%)	1	NA	NA
AWC95144.1|3426190_3427930_-	ABC transporter ATP-binding protein	NA	Q6DMX7	Streptococcus_phage	23.9	3.3e-33
>prophage 223
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3437733	3438474	4221270		Indivirus(100.0%)	1	NA	NA
AWC95154.1|3437733_3438474_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.5	2.8e-13
>prophage 224
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3449779	3452206	4221270		Mycobacterium_phage(50.0%)	3	NA	NA
AWC95167.1|3449779_3451201_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	30.0	1.4e-26
AWC96042.1|3451311_3451707_+	VOC family virulence protein	NA	NA	NA	NA	NA
AWC95168.1|3451747_3452206_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	37.0	1.3e-08
>prophage 225
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3464402	3466010	4221270		Tupanvirus(100.0%)	1	NA	NA
AWC95180.1|3464402_3466010_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.3	2.2e-60
>prophage 226
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3474868	3475330	4221270		Enterobacteria_phage(100.0%)	1	NA	NA
AWC95190.1|3474868_3475330_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	52.7	3.1e-39
>prophage 227
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3482114	3482861	4221270		Cedratvirus(100.0%)	1	NA	NA
AWC95196.1|3482114_3482861_-	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.0	1.5e-11
>prophage 228
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3489143	3503342	4221270	capsid	Enterobacteria_phage(75.0%)	22	NA	NA
AWC95204.1|3489143_3490445_-	general secretion pathway protein GspD	NA	G4WZN6	Enterobacteria_phage	44.1	8.4e-98
AWC95205.1|3490425_3491475_-	assembly protein	NA	A7BJY0	Enterobacteria_phage	58.3	2.0e-113
AWC95206.1|3491475_3491817_-	Head virion protein G6P	NA	NA	NA	NA	NA
AWC95207.1|3491816_3492314_-	hypothetical protein	NA	NA	NA	NA	NA
AWC95208.1|3492288_3492573_+	hypothetical protein	NA	NA	NA	NA	NA
AWC95209.1|3493072_3493324_-|capsid	capsid protein	capsid	Q9T0Q8	Enterobacteria_phage	64.4	1.1e-06
AWC95210.1|3493539_3493806_-	V protein	NA	NA	NA	NA	NA
AWC95211.1|3493822_3494950_-	replication initiation protein	NA	A0A1W6UG38	Vibrio_phage	35.4	1.8e-48
AWC95212.1|3494942_3495137_-	hypothetical protein	NA	NA	NA	NA	NA
AWC95213.1|3495274_3495526_+	hypothetical protein	NA	NA	NA	NA	NA
AWC96046.1|3495732_3495993_+	hypothetical protein	NA	NA	NA	NA	NA
AWC95214.1|3496428_3496884_-	hypothetical protein	NA	NA	NA	NA	NA
AWC95215.1|3496885_3497107_-	hypothetical protein	NA	NA	NA	NA	NA
AWC95216.1|3497242_3497416_+	antitoxin	NA	NA	NA	NA	NA
AWC95217.1|3497535_3498837_-	general secretion pathway protein GspD	NA	G4WZN6	Enterobacteria_phage	44.1	8.4e-98
AWC95218.1|3498817_3499867_-	assembly protein	NA	A7BJY0	Enterobacteria_phage	58.3	2.0e-113
AWC95219.1|3499867_3500209_-	Head virion protein G6P	NA	NA	NA	NA	NA
AWC95220.1|3500208_3500706_-	hypothetical protein	NA	NA	NA	NA	NA
AWC95221.1|3500680_3500965_+	hypothetical protein	NA	NA	NA	NA	NA
AWC95222.1|3501464_3501716_-|capsid	capsid protein	capsid	Q9T0Q8	Enterobacteria_phage	64.4	1.1e-06
AWC95223.1|3501931_3502198_-	V protein	NA	NA	NA	NA	NA
AWC95224.1|3502214_3503342_-	replication initiation protein	NA	A0A1W6UG38	Vibrio_phage	35.4	1.8e-48
>prophage 229
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3506453	3509150	4221270		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
AWC95229.1|3506453_3509150_-	magnesium-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	25.0	1.0e-41
>prophage 230
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3516168	3517416	4221270		Pandoravirus(100.0%)	1	NA	NA
AWC95235.1|3516168_3517416_-	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	35.1	8.4e-63
>prophage 231
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3534523	3538417	4221270		Catovirus(100.0%)	1	NA	NA
AWC96049.1|3534523_3538417_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	32.1	5.3e-55
>prophage 232
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3542680	3543682	4221270		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AWC95253.1|3542680_3543682_+	D-lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	43.4	6.7e-63
>prophage 233
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3555287	3556028	4221270		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
AWC95262.1|3555287_3556028_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.1	1.5e-11
>prophage 234
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3566367	3571751	4221270	tRNA	Staphylococcus_phage(50.0%)	4	NA	NA
AWC95273.1|3566367_3568059_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	24.3	5.1e-31
AWC95274.1|3568363_3568954_-	hypothetical protein	NA	NA	NA	NA	NA
AWC95275.1|3569039_3569741_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AWC95276.1|3569825_3571751_-	ATP-dependent helicase	NA	A0A127AW80	Bacillus_phage	32.1	8.9e-88
>prophage 235
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3575304	3576882	4221270		Staphylococcus_phage(100.0%)	1	NA	NA
AWC95279.1|3575304_3576882_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	32.9	5.1e-25
>prophage 236
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3588379	3589048	4221270		Bacillus_phage(100.0%)	1	NA	NA
AWC96055.1|3588379_3589048_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.0	2.6e-31
>prophage 237
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3594161	3595637	4221270		Cyanophage(100.0%)	1	NA	NA
AWC95295.1|3594161_3595637_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.1	1.7e-78
>prophage 238
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3599716	3611144	4221270	tRNA	Rhodococcus_phage(20.0%)	13	NA	NA
AWC96056.1|3599716_3601087_-	murein DD-endopeptidase MepM	NA	A0A2D0ZM66	Rhodococcus_phage	37.9	1.9e-15
AWC95299.1|3601109_3602024_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
AWC95300.1|3602100_3602910_+	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.3	1.4e-15
AWC95301.1|3602902_3603688_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
AWC95302.1|3603764_3604130_-	hypothetical protein	NA	NA	NA	NA	NA
AWC95303.1|3604114_3604576_-	hypothetical protein	NA	NA	NA	NA	NA
AWC95304.1|3604813_3605548_-	GMP synthase	NA	NA	NA	NA	NA
AWC95305.1|3605745_3606756_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.3	6.9e-07
AWC95306.1|3606793_3607408_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AWC95307.1|3607507_3608032_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	30.9	6.3e-12
AWC95308.1|3608121_3608865_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AWC95309.1|3608916_3609369_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
AWC95310.1|3609374_3611144_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	25.7	1.4e-07
>prophage 239
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3617621	3619352	4221270	tRNA	Klosneuvirus(100.0%)	1	NA	NA
AWC95316.1|3617621_3619352_+|tRNA	arginine--tRNA ligase	tRNA	A0A1V0SIS8	Klosneuvirus	34.8	1.8e-84
>prophage 240
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3628996	3637440	4221270		Paramecium_bursaria_Chlorella_virus(25.0%)	8	NA	NA
AWC95325.1|3628996_3629938_-	glyoxylate/hydroxypyruvate reductase GhrA	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	27.6	7.8e-05
AWC95326.1|3630631_3632353_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	29.2	8.4e-21
AWC95327.1|3632434_3632884_+	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
AWC95328.1|3632891_3633794_-	TIGR01212 family radical SAM protein	NA	NA	NA	NA	NA
AWC95329.1|3633800_3634652_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.8	1.5e-47
AWC95330.1|3634718_3635525_-	hypothetical protein	NA	NA	NA	NA	NA
AWC95331.1|3635521_3636358_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AWC95332.1|3636357_3637440_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	3.0e-08
>prophage 241
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3640567	3641533	4221270		Tupanvirus(100.0%)	1	NA	NA
AWC95336.1|3640567_3641533_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.2	7.9e-45
>prophage 242
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3650844	3652350	4221270		Staphylococcus_phage(100.0%)	1	NA	NA
AWC95347.1|3650844_3652350_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.3	4.5e-10
>prophage 243
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3663438	3664224	4221270		Erwinia_phage(100.0%)	1	NA	NA
AWC95360.1|3663438_3664224_-	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	63.9	9.2e-84
>prophage 244
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3669020	3670045	4221270		Morganella_phage(100.0%)	2	NA	NA
AWC95367.1|3669020_3669458_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	41.4	2.6e-19
AWC95368.1|3669616_3670045_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	41.5	1.9e-22
>prophage 245
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3677898	3687689	4221270		Streptococcus_phage(20.0%)	12	NA	NA
AWC95376.1|3677898_3678414_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	39.6	5.4e-24
AWC95377.1|3678856_3680902_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	32.6	5.0e-81
AWC95378.1|3680920_3681613_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
AWC95379.1|3681708_3682206_-	GAF domain-containing protein	NA	NA	NA	NA	NA
AWC95380.1|3682584_3682923_-	hypothetical protein	NA	A0A2H4JCQ9	uncultured_Caudovirales_phage	39.4	2.7e-08
AWC95381.1|3682953_3683853_-	copper resistance protein CopD	NA	NA	NA	NA	NA
AWC95382.1|3683860_3684244_-	hypothetical protein	NA	NA	NA	NA	NA
AWC95383.1|3684435_3684942_-	H-type ferritin	NA	NA	NA	NA	NA
AWC95384.1|3685178_3685412_+	DNA polymerase III subunit theta	NA	A0A077SLL5	Escherichia_phage	66.2	1.0e-14
AWC95385.1|3685466_3685850_-	small secreted protein YebF	NA	NA	NA	NA	NA
AWC95386.1|3685990_3686185_-	YoaH family protein	NA	NA	NA	NA	NA
AWC95387.1|3686309_3687689_+	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	34.4	2.5e-36
>prophage 246
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3695668	3697919	4221270		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
AWC95396.1|3695668_3696391_+	hypothetical protein	NA	A0A0N9Q9B9	Chrysochromulina_ericina_virus	38.1	2.0e-24
AWC96059.1|3697688_3697919_+	hypothetical protein	NA	A0A2L1IV32	Escherichia_phage	59.2	1.6e-15
>prophage 247
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3706677	3753187	4221270	holin,terminase,integrase,tail	Escherichia_phage(23.68%)	52	3719831:3719847	3750471:3750487
AWC95402.1|3706677_3707154_-	structural protein	NA	A0A0A0RQM4	Escherichia_phage	48.2	6.7e-29
AWC95403.1|3707157_3707433_-|holin	phage holin family protein	holin	T1SA10	Salmonella_phage	52.2	3.2e-15
AWC95404.1|3707422_3707794_-	hypothetical protein	NA	G9L6E6	Escherichia_phage	38.6	2.5e-15
AWC95405.1|3707887_3710137_-	hypothetical protein	NA	G9L6E4	Escherichia_phage	51.0	2.4e-60
AWC95406.1|3710294_3710546_+	hypothetical protein	NA	Q858F6	Salmonella_phage	37.3	9.0e-09
AWC95407.1|3710587_3711400_-	hypothetical protein	NA	NA	NA	NA	NA
AWC95408.1|3711431_3714827_-	hypothetical protein	NA	A0A1E1GEP2	Vibrio_phage	35.5	1.6e-177
AWC95409.1|3714826_3717634_-	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	43.1	3.5e-109
AWC95410.1|3717645_3718218_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	55.3	7.8e-40
AWC95411.1|3718217_3718682_-	hypothetical protein	NA	A0A0F6R7N6	Escherichia_coli_O157_typing_phage	61.7	1.5e-49
AWC95412.1|3718685_3721148_-	hypothetical protein	NA	A0A0F6TJD3	Escherichia_coli_O157_typing_phage	69.2	0.0e+00
3719831:3719847	attL	CTTTTTCCTGCACATAT	NA	NA	NA	NA
AWC95413.1|3721147_3721753_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	62.7	7.6e-70
AWC96060.1|3721752_3722049_-	hypothetical protein	NA	T1SBJ0	Salmonella_phage	40.0	2.7e-12
AWC95414.1|3722113_3722449_-	hypothetical protein	NA	NA	NA	NA	NA
AWC95415.1|3722457_3722889_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	54.7	1.2e-29
AWC95416.1|3722943_3723924_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	62.5	2.2e-114
AWC95417.1|3723937_3724600_-	peptidase	NA	A0A193GYS7	Enterobacter_phage	53.9	7.4e-42
AWC95418.1|3724596_3724920_-	hypothetical protein	NA	Q2A090	Sodalis_phage	44.0	4.6e-13
AWC95419.1|3724916_3726578_-|tail	phage tail protein	tail	T1S9Z7	Salmonella_phage	61.2	7.9e-194
AWC95420.1|3726593_3726800_-	hypothetical protein	NA	NA	NA	NA	NA
AWC95421.1|3726997_3727363_+	hypothetical protein	NA	Q716B1	Shigella_phage	70.6	1.0e-40
AWC95422.1|3727410_3728895_-|terminase	terminase	terminase	G9L6B8	Escherichia_phage	77.5	1.1e-231
AWC95423.1|3728894_3729455_-|terminase	terminase small subunit	terminase	G9L6B7	Escherichia_phage	53.7	2.7e-45
AWC95424.1|3729514_3730111_-	hypothetical protein	NA	NA	NA	NA	NA
AWC95425.1|3730168_3730516_-	hypothetical protein	NA	H9C172	Pectobacterium_phage	60.9	2.3e-34
AWC95426.1|3730512_3730860_-	hypothetical protein	NA	F8TVJ2	EBPR_siphovirus	33.6	4.4e-06
AWC96061.1|3730869_3731199_-	hypothetical protein	NA	A0A2I7QRK6	Vibrio_phage	54.1	2.6e-24
AWC95427.1|3731310_3731496_-	hypothetical protein	NA	NA	NA	NA	NA
AWC95428.1|3731649_3732012_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	60.5	1.2e-33
AWC95429.1|3732001_3732436_-	hypothetical protein	NA	NA	NA	NA	NA
AWC96062.1|3732631_3733030_-	replication protein	NA	NA	NA	NA	NA
AWC95430.1|3733073_3734099_-	hypothetical protein	NA	A0A0D4DBT2	Acinetobacter_phage	56.6	1.8e-47
AWC96063.1|3734110_3734296_-	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	49.2	1.0e-09
AWC95431.1|3734430_3734649_-	hypothetical protein	NA	NA	NA	NA	NA
AWC95432.1|3734780_3735371_+	XRE family transcriptional regulator	NA	A0A193GYL7	Enterobacter_phage	35.0	9.2e-28
AWC95433.1|3735841_3737539_+	DNA breaking-rejoining protein	NA	A0A0U2I1R6	Escherichia_phage	46.4	8.9e-108
AWC95434.1|3737587_3738640_+	enterohemolysin	NA	H6WRX0	Salmonella_phage	50.3	1.2e-97
AWC95435.1|3738680_3738920_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
AWC95436.1|3739302_3739833_+	hypothetical protein	NA	A0A2I7R6M5	Vibrio_phage	29.9	3.4e-13
AWC95437.1|3740356_3740770_+	hypothetical protein	NA	NA	NA	NA	NA
AWC95438.1|3740753_3741092_+	hypothetical protein	NA	E9NID9	Enterobacter_phage	42.1	1.4e-12
AWC95439.1|3741078_3741681_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	60.9	4.5e-62
AWC95440.1|3741685_3741883_+	hypothetical protein	NA	A0A1P8DTH3	Proteus_phage	61.9	4.1e-17
AWC95441.1|3742069_3743272_-|integrase	integrase	integrase	T1S9J3	Salmonella_phage	64.2	1.0e-142
AWC95442.1|3743491_3745069_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
AWC95443.1|3745128_3746706_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	9.5e-88
AWC95444.1|3746767_3748144_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	37.5	2.9e-40
AWC95445.1|3748188_3750234_-	oligopeptidase B	NA	NA	NA	NA	NA
AWC95446.1|3750386_3750938_+	NADPH-dependent FMN reductase	NA	A0A2P0ZL77	Lactobacillus_phage	36.0	7.5e-16
3750471:3750487	attR	CTTTTTCCTGCACATAT	NA	NA	NA	NA
AWC95447.1|3750953_3751760_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AWC95448.1|3751951_3752410_+	hypothetical protein	NA	NA	NA	NA	NA
AWC95449.1|3752521_3753187_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	31.8	4.4e-26
>prophage 248
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3759085	3759622	4221270		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
AWC95457.1|3759085_3759622_-	DUF924 domain-containing protein	NA	E3T4R4	Cafeteria_roenbergensis_virus	30.1	5.3e-14
>prophage 249
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3767263	3834127	4221270	transposase,tail,holin,terminase,head,integrase	Morganella_phage(80.0%)	82	3791543:3791558	3835728:3835743
AWC95467.1|3767263_3768508_-|tail	phage tail protein	tail	A0A2K9V2I0	Shigella_phage	38.2	1.6e-29
AWC95468.1|3768513_3769176_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	37.8	1.6e-36
AWC95469.1|3769172_3770360_-	hypothetical protein	NA	A0A2H5BG53	Pseudoalteromonas_phage	39.7	2.0e-77
AWC95470.1|3770352_3770697_-	hypothetical protein	NA	NA	NA	NA	NA
AWC95471.1|3770693_3771386_-	hypothetical protein	NA	A1Z003	Burkholderia_virus	42.0	6.3e-36
AWC95472.1|3771402_3772218_-	hypothetical protein	NA	B5M9T8	Pseudomonas_phage	27.5	2.9e-16
AWC95473.1|3772210_3772504_-	hypothetical protein	NA	NA	NA	NA	NA
AWC95474.1|3772500_3773040_-	hypothetical protein	NA	NA	NA	NA	NA
AWC95475.1|3773036_3775007_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	22.8	5.8e-18
AWC95476.1|3775089_3775548_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	49.3	3.5e-27
AWC95477.1|3775590_3776043_-	hypothetical protein	NA	I7ATP4	Escherichia_phage	37.8	1.4e-20
AWC95478.1|3776058_3777546_-	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	37.1	7.3e-82
AWC95479.1|3777555_3778071_-	hypothetical protein	NA	NA	NA	NA	NA
AWC95480.1|3778217_3778778_+	hypothetical protein	NA	NA	NA	NA	NA
AWC96066.1|3778926_3779361_-	antitermination protein Q	NA	B6SCU4	Bacteriophage	47.8	3.5e-24
AWC95481.1|3779569_3780256_-	hypothetical protein	NA	NA	NA	NA	NA
AWC95482.1|3780649_3781798_+	glycosyl transferase	NA	NA	NA	NA	NA
AWC95483.1|3782131_3782854_-	hypothetical protein	NA	NA	NA	NA	NA
AWC95484.1|3783564_3784827_-	translesion error-prone DNA polymerase V subunit UmuC	NA	A0A1W6JNT0	Morganella_phage	97.1	1.2e-234
AWC95485.1|3784826_3785243_-	translesion error-prone DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	93.5	1.6e-66
AWC95486.1|3785689_3785947_+	hypothetical protein	NA	NA	NA	NA	NA
AWC95487.1|3785956_3787594_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWC95488.1|3788321_3788657_+	lysozyme inhibitor	NA	NA	NA	NA	NA
AWC96067.1|3788745_3789192_-	hypothetical protein	NA	NA	NA	NA	NA
AWC95489.1|3789380_3790931_-	hypothetical protein	NA	A0A1W6JNW0	Morganella_phage	73.8	1.9e-210
AWC95490.1|3791043_3791310_-	hypothetical protein	NA	A0A1W6JNS1	Morganella_phage	98.9	5.7e-46
AWC95491.1|3791312_3791999_-	hypothetical protein	NA	A0A1W6JNU1	Morganella_phage	98.2	1.3e-134
3791543:3791558	attL	TCATAGACCACATTGT	NA	NA	NA	NA
AWC95492.1|3791995_3792316_-	hypothetical protein	NA	A0A1W6JNW9	Morganella_phage	99.1	6.9e-62
AWC95493.1|3792317_3795452_-	host specificity protein J	NA	A0A1W6JNW2	Morganella_phage	98.3	0.0e+00
AWC95494.1|3795452_3796019_-|tail	tail assembly protein	tail	A0A1W6JP03	Morganella_phage	99.2	8.4e-63
AWC95495.1|3795961_3796675_-|tail	phage tail protein	tail	A0A1W6JNU8	Morganella_phage	99.2	7.7e-146
AWC95496.1|3796678_3797377_-|tail	phage minor tail protein L	tail	A0A1W6JNT8	Morganella_phage	99.6	2.3e-134
AWC95497.1|3797373_3797703_-|tail	phage tail protein	tail	A0A1W6JNT2	Morganella_phage	99.1	1.5e-59
AWC95498.1|3797742_3801066_-	tape measure protein	NA	A0A1W6JNU2	Morganella_phage	99.5	0.0e+00
AWC95499.1|3801109_3801802_-	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	99.6	1.0e-126
AWC95500.1|3801852_3802608_-	DNA breaking-rejoining protein	NA	A0A1W6JNT1	Morganella_phage	97.2	1.1e-131
AWC95501.1|3802672_3803044_-	hypothetical protein	NA	A0A1W6JNU7	Morganella_phage	98.4	2.8e-67
AWC95502.1|3803040_3803409_-	hypothetical protein	NA	A0A1W6JNX7	Morganella_phage	97.5	4.3e-60
AWC95503.1|3803410_3803752_-	hypothetical protein	NA	A0A1W6JNW7	Morganella_phage	95.6	1.2e-59
AWC95504.1|3803753_3804131_-	hypothetical protein	NA	A0A1W6JP09	Morganella_phage	98.4	4.0e-61
AWC95505.1|3804155_3805136_-	hypothetical protein	NA	A0A1W6JNV5	Morganella_phage	98.5	4.9e-175
AWC95506.1|3805141_3805828_-	hypothetical protein	NA	A0A1W6JNU9	Morganella_phage	97.4	9.2e-96
AWC95507.1|3805893_3806955_-|head	phage head morphogenesis protein	head	A0A1W6JNT7	Morganella_phage	98.9	4.3e-193
AWC95508.1|3806958_3808338_-	DUF4055 domain-containing protein	NA	A0A1W6JNV0	Morganella_phage	99.1	2.5e-262
AWC95509.1|3808339_3809824_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	99.4	2.1e-299
AWC95510.1|3809825_3810353_-|terminase	terminase small subunit	terminase	A0A1W6JNT5	Morganella_phage	99.4	1.9e-93
AWC95511.1|3810355_3810553_-	hypothetical protein	NA	A0A1W6JNV6	Morganella_phage	95.4	3.6e-29
AWC95512.1|3810822_3811338_-	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	99.4	2.1e-97
AWC95513.1|3811599_3812747_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.3	2.7e-148
AWC96068.1|3813054_3813297_-	peptidase	NA	A0A1W6JNV7	Morganella_phage	69.6	8.1e-15
AWC95514.1|3813193_3813571_-	hypothetical protein	NA	A0A1W6JP00	Morganella_phage	82.4	4.2e-50
AWC96069.1|3813707_3814157_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	93.9	9.6e-78
AWC95515.1|3814176_3814368_-|holin	holin	holin	A0A1W6JP85	Morganella_phage	100.0	4.9e-31
AWC95516.1|3814791_3815601_+	hypothetical protein	NA	Q19UP3	Mannheimia_phage	47.5	9.5e-68
AWC95517.1|3815909_3816116_+	thiamine biosynthesis protein ApbE	NA	NA	NA	NA	NA
AWC95518.1|3816262_3816472_-	hypothetical protein	NA	A0A1W6JNU4	Morganella_phage	67.2	8.5e-21
AWC95519.1|3817241_3817700_-	heat-shock protein	NA	NA	NA	NA	NA
AWC95520.1|3818006_3818447_+	universal stress protein F	NA	A0A1W6JNV4	Morganella_phage	54.0	5.2e-28
AWC95521.1|3818775_3819537_-	sel1 repeat family protein	NA	NA	NA	NA	NA
AWC95522.1|3819608_3820538_-	lipid A biosynthesis palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	98.5	1.4e-147
AWC95523.1|3820764_3820977_-	cold shock domain-containing protein	NA	A0A1W6JNX5	Morganella_phage	100.0	2.0e-33
AWC95524.1|3821352_3821790_-	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	97.2	9.4e-78
AWC95525.1|3821910_3822090_-	NinH	NA	A0A1W6JNW3	Morganella_phage	97.4	6.0e-15
AWC95526.1|3822079_3822709_-	NinG family protein	NA	A0A1W6JNX3	Morganella_phage	97.1	2.7e-102
AWC95527.1|3822818_3823262_+	universal stress protein	NA	NA	NA	NA	NA
AWC95528.1|3823289_3823694_-	hypothetical protein	NA	A0A1W6JNY5	Morganella_phage	90.2	6.9e-67
AWC95529.1|3823690_3823888_-	hypothetical protein	NA	A0A1W6JP14	Morganella_phage	96.9	1.7e-31
AWC95530.1|3823899_3824343_-	protein ninB	NA	A0A1W6JNZ4	Morganella_phage	100.0	1.1e-81
AWC95531.1|3824591_3825320_-	DNA replication protein DnaC	NA	A0A1W6JP39	Morganella_phage	99.6	1.0e-132
AWC96070.1|3825319_3826111_-	replication protein	NA	A0A1W6JNY0	Morganella_phage	99.2	3.7e-133
AWC95532.1|3826252_3826579_-	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	100.0	1.8e-54
AWC95533.1|3826709_3826919_-	XRE family transcriptional regulator	NA	A0A1W6JNW6	Morganella_phage	97.8	4.8e-16
AWC95534.1|3827018_3827666_+	phage repressor protein	NA	A0A1W6JNY2	Morganella_phage	100.0	4.0e-117
AWC95535.1|3827704_3828046_+	DUF3024 domain-containing protein	NA	A0A1W6JP12	Morganella_phage	100.0	1.6e-61
AWC95536.1|3828197_3828395_-	DUF2767 domain-containing protein	NA	A0A1W6JNW1	Morganella_phage	100.0	8.0e-29
AWC96071.1|3828791_3829100_+	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	100.0	1.3e-49
AWC95537.1|3829128_3829338_-	hypothetical protein	NA	A0A1W6JP23	Morganella_phage	100.0	5.9e-30
AWC95538.1|3829692_3829974_-	hypothetical protein	NA	NA	NA	NA	NA
AWC95539.1|3831062_3831425_+	hypothetical protein	NA	A0A1W6JNZ2	Morganella_phage	85.8	6.4e-56
AWC95540.1|3831427_3832042_+	single-stranded DNA-binding protein	NA	A0A1W6JP21	Morganella_phage	99.0	1.7e-109
AWC95541.1|3832042_3832438_+	single-stranded DNA-binding protein	NA	A0A1W6JNW8	Morganella_phage	97.7	1.0e-70
AWC95542.1|3832975_3834127_+|integrase	site-specific integrase	integrase	A0A2H5BFK7	Salmonella_phage	69.8	8.6e-155
3835728:3835743	attR	ACAATGTGGTCTATGA	NA	NA	NA	NA
>prophage 250
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3837969	3848333	4221270		Ectocarpus_siliculosus_virus(25.0%)	5	NA	NA
AWC95545.1|3837969_3840816_-	two-component system sensor histidine kinase RcsC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.9	6.8e-36
AWC95546.1|3840990_3843606_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	34.6	7.0e-104
AWC95547.1|3843793_3844519_+	bifunctional 3-demethylubiquinol 3-O-methyltransferase/2-polyprenyl-6-hydroxyphenol methylase	NA	NA	NA	NA	NA
AWC95548.1|3844895_3847190_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	64.6	3.1e-289
AWC95549.1|3847202_3848333_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	77.5	3.2e-170
>prophage 251
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3859432	3863534	4221270		Planktothrix_phage(50.0%)	3	NA	NA
AWC95561.1|3859432_3860155_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.6	7.3e-35
AWC95562.1|3860211_3861978_-	adenine deaminase	NA	NA	NA	NA	NA
AWC95563.1|3862199_3863534_+	adenine permease PurP	NA	A0A0R6PHV4	Moraxella_phage	38.7	4.1e-68
>prophage 252
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3905237	3906197	4221270		Clostridium_phage(100.0%)	1	NA	NA
AWC96075.1|3905237_3906197_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	A0A0A7RUS8	Clostridium_phage	42.8	1.6e-21
>prophage 253
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3919793	3925622	4221270		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
AWC95622.1|3919793_3920186_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	30.8	5.0e-06
AWC95623.1|3920227_3921295_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	34.4	1.1e-05
AWC95624.1|3921266_3922130_-	chemotaxis protein-glutamate O-methyltransferase	NA	NA	NA	NA	NA
AWC95625.1|3922249_3923824_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.2	5.1e-09
AWC95626.1|3923936_3925622_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	35.1	2.6e-11
>prophage 254
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3933025	3934580	4221270		Bacillus_virus(50.0%)	3	NA	NA
AWC95633.1|3933025_3933721_-	hypothetical protein	NA	G3MA03	Bacillus_virus	43.0	1.8e-14
AWC95634.1|3934069_3934282_-	hypothetical protein	NA	NA	NA	NA	NA
AWC95635.1|3934367_3934580_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	77.1	1.9e-23
>prophage 255
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3938871	3950530	4221270		Escherichia_phage(40.0%)	8	NA	NA
AWC95639.1|3938871_3941952_-	tetrathionate reductase subunit TtrA	NA	A0A077SK27	Escherichia_phage	25.9	1.9e-07
AWC95640.1|3941944_3943009_-	tetrathionate reductase subunit TtrC	NA	NA	NA	NA	NA
AWC95641.1|3943008_3943746_-	tetrathionate reductase subunit TtrB	NA	A0A077SL61	Escherichia_phage	39.1	8.5e-23
AWC95642.1|3943965_3945720_+	sensor histidine kinase	NA	NA	NA	NA	NA
AWC95643.1|3945710_3946322_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AWC95644.1|3946413_3947355_+	lipid A biosynthesis lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	43.4	3.1e-62
AWC95645.1|3947379_3948612_+	multidrug transporter MdtG	NA	A0A2H4UVM2	Bodo_saltans_virus	23.1	1.6e-05
AWC95646.1|3949006_3950530_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	56.9	3.9e-155
>prophage 256
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3957293	3959249	4221270		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AWC95655.1|3957293_3959249_-	hypothetical protein	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	26.0	4.7e-12
>prophage 257
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3965730	3967995	4221270		Escherichia_phage(100.0%)	1	NA	NA
AWC95661.1|3965730_3967995_-	type VI secretion system ATPase TssH	NA	A0A1C3S747	Escherichia_phage	40.4	2.3e-90
>prophage 258
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3978422	3980480	4221270		Streptococcus_phage(50.0%)	2	NA	NA
AWC95673.1|3978422_3979304_-	cysteine synthase B	NA	A0A1X9I5K7	Streptococcus_phage	41.0	5.4e-56
AWC95674.1|3979382_3980480_-	sulfate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.7	5.5e-34
>prophage 259
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3983545	3984442	4221270		Pandoravirus(100.0%)	1	NA	NA
AWC95678.1|3983545_3984442_-	peroxidase	NA	S4VXK8	Pandoravirus	33.7	1.2e-26
>prophage 260
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	3997542	3998477	4221270		Morganella_phage(50.0%)	2	NA	NA
AWC95693.1|3997542_3997986_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	37.4	5.1e-15
AWC95694.1|3998051_3998477_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	40.9	3.0e-20
>prophage 261
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	4006820	4013292	4221270		Mycoplasma_phage(20.0%)	8	NA	NA
AWC95698.1|4006820_4008116_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	42.1	2.5e-38
AWC95699.1|4008273_4008474_-	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AWC95700.1|4008489_4008825_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AWC95701.1|4008835_4010683_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.2	1.8e-109
AWC95702.1|4010691_4011210_-	co-chaperone HscB	NA	NA	NA	NA	NA
AWC95703.1|4011239_4011563_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	51.4	6.3e-23
AWC95704.1|4011665_4012052_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.0	2.0e-52
AWC95705.1|4012077_4013292_-	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.4	1.1e-32
>prophage 262
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	4017764	4031312	4221270		Bacillus_phage(40.0%)	9	NA	NA
AWC95711.1|4017764_4019018_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	52.3	5.6e-99
AWC95712.1|4019388_4020570_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
AWC95713.1|4020715_4020934_-	hypothetical protein	NA	NA	NA	NA	NA
AWC95714.1|4021079_4021418_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
AWC95715.1|4021430_4023053_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	36.1	6.1e-90
AWC95716.1|4023160_4024501_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	35.2	6.1e-11
AWC95717.1|4024508_4025303_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
AWC95718.1|4025324_4026764_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	28.1	5.0e-19
AWC96079.1|4027424_4031312_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	60.1	1.0e-130
>prophage 263
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	4034344	4035823	4221270		Salmonella_phage(100.0%)	1	NA	NA
AWC95722.1|4034344_4035823_-	MFS transporter	NA	S4TR35	Salmonella_phage	28.1	2.1e-12
>prophage 264
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	4044831	4051621	4221270		uncultured_Mediterranean_phage(33.33%)	8	NA	NA
AWC95732.1|4044831_4045092_+	4Fe-4S dicluster domain-containing protein	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	50.0	2.1e-16
AWC95733.1|4045125_4045512_-	holo-ACP synthase	NA	NA	NA	NA	NA
AWC96084.1|4045511_4046243_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AWC95734.1|4046277_4047036_-	DNA repair protein RecO	NA	NA	NA	NA	NA
AWC95735.1|4047043_4047952_-	GTPase Era	NA	NA	NA	NA	NA
AWC95736.1|4047948_4048629_-	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	32.6	4.8e-20
AWC95737.1|4048807_4049800_-	signal peptidase I	NA	NA	NA	NA	NA
AWC96085.1|4049827_4051621_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.9	1.0e-24
>prophage 265
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	4068440	4072254	4221270		Klosneuvirus(33.33%)	4	NA	NA
AWC95744.1|4068440_4069787_+	ATP-dependent RNA helicase SrmB	NA	A0A1V0SIR5	Klosneuvirus	31.3	1.3e-48
AWC95745.1|4069845_4070667_-	hypothetical protein	NA	NA	NA	NA	NA
AWC95746.1|4070826_4071210_-	autonomous glycyl radical cofactor GrcA	NA	A0A1W5N098	Cronobacter_phage	74.3	1.1e-34
AWC95747.1|4071555_4072254_+	uracil-DNA glycosylase	NA	A0A1R3T3N6	Sphenicid_alphaherpesvirus	45.6	1.4e-51
>prophage 266
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	4078105	4078528	4221270		Pseudomonas_phage(100.0%)	1	NA	NA
AWC95753.1|4078105_4078528_+	hypothetical protein	NA	J7I0T4	Pseudomonas_phage	55.0	1.9e-11
>prophage 267
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	4087935	4090062	4221270		Staphylococcus_phage(50.0%)	5	NA	NA
AWC96087.1|4087935_4088418_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	1.8e-29
AWC95762.1|4088429_4088630_-	hypothetical protein	NA	NA	NA	NA	NA
AWC95763.1|4088718_4089153_+	ubiquinone-binding protein	NA	NA	NA	NA	NA
AWC95764.1|4089145_4089445_+	RnfH family protein	NA	NA	NA	NA	NA
AWC95765.1|4089474_4090062_-	histidine phosphatase family protein	NA	M1HFB0	Paramecium_bursaria_Chlorella_virus	38.6	1.2e-27
>prophage 268
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	4114152	4118558	4221270		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
AWC95787.1|4114152_4115676_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	68.1	1.8e-06
AWC95788.1|4115737_4115989_+	hypothetical protein	NA	NA	NA	NA	NA
AWC95789.1|4116057_4116972_+	right origin-binding protein	NA	NA	NA	NA	NA
AWC95790.1|4116966_4117284_-	thiol reductase thioredoxin	NA	NA	NA	NA	NA
AWC95791.1|4118321_4118558_+	XRE family transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	41.7	1.5e-05
>prophage 269
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	4136924	4138133	4221270	transposase	uncultured_virus(100.0%)	1	NA	NA
AWC95811.1|4136924_4138133_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	49.2	5.4e-51
>prophage 270
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	4141630	4145918	4221270		uncultured_Caudovirales_phage(50.0%)	6	NA	NA
AWC95813.1|4141630_4141960_+	sulfurtransferase TusE	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	47.7	1.9e-22
AWC95814.1|4141967_4142246_-	acylphosphatase	NA	NA	NA	NA	NA
AWC95815.1|4142451_4142769_+	heat shock protein HspQ	NA	NA	NA	NA	NA
AWC95816.1|4142814_4143228_-	hypothetical protein	NA	NA	NA	NA	NA
AWC96093.1|4143359_4143818_+	methylglyoxal synthase	NA	NA	NA	NA	NA
AWC95817.1|4143863_4145918_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	26.5	6.7e-17
>prophage 271
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	4158358	4160278	4221270		Tupanvirus(100.0%)	1	NA	NA
AWC95829.1|4158358_4160278_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	27.3	2.5e-50
>prophage 272
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	4171600	4174470	4221270	tRNA	Bandra_megavirus(50.0%)	2	NA	NA
AWC95837.1|4171600_4173001_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	37.1	3.1e-82
AWC95838.1|4173294_4174470_+	porin	NA	Q1MVN1	Enterobacteria_phage	53.6	5.4e-104
>prophage 273
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	4192575	4197320	4221270		Bacillus_phage(100.0%)	3	NA	NA
AWC95854.1|4192575_4194321_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	32.0	7.3e-65
AWC95855.1|4194358_4196659_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
AWC95856.1|4197035_4197320_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	41.4	3.7e-11
>prophage 274
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	4201455	4202541	4221270		Streptococcus_phage(100.0%)	1	NA	NA
AWC95860.1|4201455_4202541_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.6	7.5e-84
>prophage 275
CP028956	Morganella morganii strain AR_0133 chromosome, complete genome	4221270	4205885	4220090	4221270	tRNA	Tetraselmis_virus(33.33%)	9	NA	NA
AWC95863.1|4205885_4208168_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.2	1.4e-161
AWC95864.1|4208272_4209013_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	9.5e-22
AWC95865.1|4209742_4210912_+	adenylate cyclase	NA	NA	NA	NA	NA
AWC95866.1|4210990_4212283_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.6	5.2e-100
AWC95867.1|4212349_4213693_-	recombination factor protein RarA	NA	G3MBE0	Bacillus_virus	39.6	2.0e-78
AWC95868.1|4213700_4214312_-	outer-membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AWC95869.1|4214374_4217938_-	cell division protein FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.6	1.3e-92
AWC95870.1|4218075_4218570_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
AWC95871.1|4219130_4220090_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.7	6.4e-63
>prophage 1
CP028958	Morganella morganii strain AR_0133 plasmid unnamed2, complete sequence	71304	11481	56631	71304	integrase,transposase	Escherichia_phage(21.05%)	45	14631:14648	24231:24248
AWC96115.1|11481_12201_+	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	28.9	8.6e-20
AWC96116.1|12251_13736_+	hypothetical protein	NA	NA	NA	NA	NA
AWC96117.1|14157_14727_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
14631:14648	attL	CCTGATAGATTTGCTCAC	NA	NA	NA	NA
AWC96118.1|14866_15181_-|transposase	transposase	transposase	NA	NA	NA	NA
AWC96119.1|15119_16133_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AWC96120.1|16279_16762_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	6.6e-16
AWC96121.1|16982_17249_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
AWC96122.1|17391_18156_+|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AWC96123.1|18197_18410_+	resolvase	NA	NA	NA	NA	NA
AWC96124.1|18422_19631_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
AWC96125.1|19664_21098_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
AWC96126.1|21479_21686_-	hypothetical protein	NA	NA	NA	NA	NA
AWC96127.1|21875_23375_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
AWC96128.1|23371_24127_+	hypothetical protein	NA	U5N3V8	Enterobacteria_phage	33.9	2.4e-33
AWC96166.1|24175_24748_-	restriction endonuclease	NA	NA	NA	NA	NA
24231:24248	attR	GTGAGCAAATCTATCAGG	NA	NA	NA	NA
AWC96129.1|24803_25115_-	hypothetical protein	NA	NA	NA	NA	NA
AWC96130.1|25150_25465_-	IncN plasmid KikA protein	NA	NA	NA	NA	NA
AWC96131.1|25461_25806_-	hypothetical protein	NA	NA	NA	NA	NA
AWC96167.1|25821_26172_-	KorB	NA	NA	NA	NA	NA
AWC96132.1|26235_26970_+	traL protein	NA	NA	NA	NA	NA
AWC96168.1|26978_27260_+	transcriptional regulator	NA	NA	NA	NA	NA
AWC96133.1|27269_27563_+	conjugal transfer protein TraM	NA	NA	NA	NA	NA
AWC96134.1|27612_27930_+	type IV secretion system protein VirB3	NA	NA	NA	NA	NA
AWC96135.1|27929_30530_+	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
AWC96136.1|30547_31261_+	type IV secretion system protein	NA	NA	NA	NA	NA
AWC96137.1|31268_31496_+	entry exclusion protein	NA	NA	NA	NA	NA
AWC96138.1|31511_32552_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
AWC96139.1|32634_32781_+	conjugal transfer protein TraN	NA	NA	NA	NA	NA
AWC96140.1|32770_33469_+	type IV secretion system protein VirB8	NA	NA	NA	NA	NA
AWC96141.1|33542_34364_+	conjugal transfer protein TraO	NA	NA	NA	NA	NA
AWC96142.1|34363_35524_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
AWC96143.1|35565_36561_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AWC96144.1|36560_37094_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	5.8e-21
AWC96145.1|38065_38770_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AWC96146.1|39259_40369_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	2.8e-33
AWC96147.1|40463_41648_-	tetracycline efflux MFS transporter Tet(D)	NA	NA	NA	NA	NA
AWC96148.1|41743_42400_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWC96149.1|43423_44029_-	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
AWC96150.1|44123_47021_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	5.5e-182
AWC96151.1|49126_50446_+|transposase	IS1182 family transposase ISKpn6	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
AWC96152.1|50695_51577_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
AWC96169.1|51992_53018_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
AWC96153.1|53014_53794_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
AWC96154.1|54180_55062_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
AWC96155.1|55311_56631_-|transposase	IS1182 family transposase ISKpn6	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
