The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP020488	Enterococcus faecium strain CFSAN059071 chromosome, complete genome	2883830	518277	585240	2883830	transposase,protease,tRNA,integrase	Streptococcus_phage(15.38%)	58	513830:513849	592089:592108
513830:513849	attL	GACAAGACTTTTGTCACAGC	NA	NA	NA	NA
AWV60573.1|518277_519399_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AWV60574.1|519644_521066_+	arginine-ornithine antiporter	NA	NA	NA	NA	NA
AWV60575.1|521079_522198_+	aminotransferase	NA	NA	NA	NA	NA
AWV60576.1|522257_523550_-	MFS transporter	NA	NA	NA	NA	NA
AWV62780.1|523699_524260_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AWV60577.1|524388_524766_+	DUF1033 family protein	NA	NA	NA	NA	NA
AWV60578.1|524698_526771_+	DNA topoisomerase III	NA	NA	NA	NA	NA
AWV60579.1|526981_527929_-	glycosyltransferase	NA	V5USA4	Oenococcus_phage	51.0	5.0e-84
AWV60580.1|528174_528639_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	38.7	8.8e-18
AWV60581.1|528700_529744_-	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
AWV60582.1|530120_531086_-	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AWV60583.1|531319_532165_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWV60584.1|532173_532371_+	hypothetical protein	NA	NA	NA	NA	NA
AWV60585.1|532355_533543_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
AWV60586.1|533548_533905_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	42.3	2.7e-22
AWV60587.1|533906_534245_+	glycine cleavage system protein H	NA	NA	NA	NA	NA
AWV62781.1|534639_535674_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	35.1	4.2e-28
AWV60588.1|535666_536353_+	ABC transporter permease	NA	NA	NA	NA	NA
AWV60589.1|536376_537225_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWV60590.1|537421_538195_+	Fe-S cluster assembly ATPase SufC	NA	A0A2R8FG22	Brazilian_cedratvirus	28.8	2.1e-08
AWV60591.1|538207_539494_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
AWV60592.1|539490_540726_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	47.7	3.9e-113
AWV60593.1|540712_541183_+	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
AWV60594.1|541187_542579_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
AWV60595.1|542694_543990_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
AWV60596.1|544195_545338_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	34.8	3.3e-58
AWV60597.1|545376_546111_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWV60598.1|546112_546298_+	hypothetical protein	NA	NA	NA	NA	NA
AWV60599.1|546342_546618_+	DNA-binding protein	NA	NA	NA	NA	NA
AWV60600.1|546715_548713_+	hypothetical protein	NA	A0A1Z1LZK7	Bacillus_phage	24.4	5.5e-24
AWV60601.1|548788_549124_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWV60602.1|549502_549865_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
AWV60603.1|549910_550237_+	hypothetical protein	NA	NA	NA	NA	NA
AWV60604.1|550572_550800_+	hypothetical protein	NA	NA	NA	NA	NA
AWV60605.1|551079_552903_+	PTS beta-glucoside transporter subunit EIIBCA	NA	NA	NA	NA	NA
AWV60606.1|552916_554326_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	27.6	3.2e-42
AWV60607.1|554343_555180_+	PRD domain-containing protein	NA	NA	NA	NA	NA
AWV60608.1|555244_556027_+	hypothetical protein	NA	NA	NA	NA	NA
AWV60609.1|556430_557556_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	54.1	2.3e-75
AWV60610.1|558908_559109_+	sensor histidine kinase	NA	NA	NA	NA	NA
AWV60611.1|559184_559382_+	hypothetical protein	NA	NA	NA	NA	NA
AWV60612.1|559330_559561_+	hypothetical protein	NA	NA	NA	NA	NA
AWV60613.1|559678_561226_-	bifunctional metallophosphatase/5'-nucleotidase	NA	S4VPC4	Pandoravirus	25.7	4.6e-10
AWV60614.1|561309_562113_-	metallophosphoesterase	NA	NA	NA	NA	NA
AWV60615.1|562115_562898_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
AWV60616.1|562894_563674_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
AWV60617.1|563645_564437_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	1.3e-21
AWV60618.1|564497_565427_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWV60619.1|565621_566305_+	cyclic nucleotide-binding protein	NA	NA	NA	NA	NA
AWV60620.1|566465_567509_+	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWV60621.1|569448_570627_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
AWV60622.1|570847_571756_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
AWV60623.1|571884_572484_+	DUF1819 family protein	NA	NA	NA	NA	NA
AWV60624.1|572483_573059_+	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
AWV60625.1|573083_576755_+	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
AWV60626.1|576818_580451_+	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
AWV62782.1|580566_583089_+	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
AWV60627.1|583206_585240_+|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
592089:592108	attR	GACAAGACTTTTGTCACAGC	NA	NA	NA	NA
>prophage 2
CP020488	Enterococcus faecium strain CFSAN059071 chromosome, complete genome	2883830	727719	736191	2883830		Streptococcus_phage(66.67%)	9	NA	NA
AWV60759.1|727719_728364_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.6	4.2e-58
AWV60760.1|728378_728708_+	hypothetical protein	NA	NA	NA	NA	NA
AWV60761.1|728721_729660_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	34.4	3.3e-35
AWV60762.1|729695_730520_+	signal peptidase	NA	NA	NA	NA	NA
AWV60763.1|730512_730860_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	41.1	5.1e-18
AWV60764.1|730928_731801_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	60.4	3.1e-88
AWV60765.1|731909_733031_+	DNA polymerase IV	NA	NA	NA	NA	NA
AWV60766.1|733084_733687_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	58.6	1.7e-53
AWV60767.1|734001_736191_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	66.6	1.8e-286
>prophage 3
CP020488	Enterococcus faecium strain CFSAN059071 chromosome, complete genome	2883830	789200	886714	2883830	capsid,portal,head,tRNA,terminase,integrase,transposase,protease,tail,plate,holin	uncultured_Caudovirales_phage(13.95%)	112	782472:782487	823273:823288
782472:782487	attL	GAAAATGGAACAGTAT	NA	NA	NA	NA
AWV60821.1|789200_791999_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	26.4	1.6e-74
AWV60822.1|792047_793574_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	35.3	8.9e-75
AWV60823.1|793588_794236_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
AWV62792.1|794419_794749_-	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
AWV60824.1|794925_795654_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
AWV60825.1|795669_796683_+	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AWV60826.1|796682_797960_+	ATP-dependent helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	28.8	5.8e-35
AWV60827.1|798022_800725_+	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
AWV60828.1|800876_801194_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
AWV60829.1|801223_801544_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
AWV60830.1|801651_803112_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
AWV60831.1|803179_803401_+	hypothetical protein	NA	NA	NA	NA	NA
AWV60832.1|803431_803614_+	DUF3188 domain-containing protein	NA	NA	NA	NA	NA
AWV60833.1|803613_804027_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
AWV60834.1|804149_805331_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWV60835.1|805861_807001_-|integrase	site-specific integrase	integrase	Q9AZR0	Lactococcus_phage	47.1	2.6e-95
AWV60836.1|807299_807935_-	hypothetical protein	NA	NA	NA	NA	NA
AWV60837.1|808047_808683_-	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
AWV60838.1|808716_809178_-	DUF4429 domain-containing protein	NA	A0A0F6N4L7	Staphylococcus_phage	34.8	4.5e-06
AWV60839.1|809307_809739_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
AWV60840.1|809756_810077_-	XRE family transcriptional regulator	NA	A0A1S5SDR1	Streptococcus_phage	40.2	2.0e-13
AWV60841.1|810375_811152_+	phage antirepressor	NA	A0A1Q1PVU2	Staphylococcus_phage	53.8	1.1e-73
AWV60842.1|811166_811370_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWV60843.1|811385_811724_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
AWV60844.1|811710_811890_+	hypothetical protein	NA	NA	NA	NA	NA
AWV62793.1|811932_812403_-	hypothetical protein	NA	NA	NA	NA	NA
AWV60845.1|812489_813188_+	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	34.6	1.7e-25
AWV60846.1|813365_813707_+	hypothetical protein	NA	NA	NA	NA	NA
AWV60847.1|813699_814371_+	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
AWV60848.1|814376_815069_+	hypothetical protein	NA	C9E2N1	Enterococcus_phage	69.1	3.2e-88
AWV60849.1|815065_815815_+	helix-turn-helix domain-containing protein	NA	A0A1L2BY83	Clostridium_phage	54.0	1.7e-31
AWV60850.1|815826_816096_+	hypothetical protein	NA	NA	NA	NA	NA
AWV60851.1|816258_816558_+	hypothetical protein	NA	NA	NA	NA	NA
AWV60852.1|816557_816860_+	hypothetical protein	NA	D2IZY1	Enterococcus_phage	70.7	2.8e-33
AWV60853.1|816899_817265_+	hypothetical protein	NA	NA	NA	NA	NA
AWV60854.1|817891_818074_+	hypothetical protein	NA	NA	NA	NA	NA
AWV60855.1|818086_818281_+	hypothetical protein	NA	NA	NA	NA	NA
AWV60856.1|818313_818526_-	hypothetical protein	NA	NA	NA	NA	NA
AWV60857.1|818650_818854_+	hypothetical protein	NA	NA	NA	NA	NA
AWV60858.1|818850_819123_+	DUF3850 domain-containing protein	NA	C9E2N9	Enterococcus_phage	61.6	5.5e-20
AWV60859.1|819123_819309_+	hypothetical protein	NA	NA	NA	NA	NA
AWV60860.1|819602_820079_+	DUF1492 domain-containing protein	NA	A0A2H4JFW6	uncultured_Caudovirales_phage	50.8	2.2e-27
AWV60861.1|820070_820256_-	hypothetical protein	NA	NA	NA	NA	NA
AWV60862.1|820224_820953_-	DUF4145 domain-containing protein	NA	A0A1X9I5M7	Streptococcus_phage	52.4	1.2e-58
AWV60863.1|821000_821279_+	hypothetical protein	NA	NA	NA	NA	NA
AWV60864.1|821280_821667_+	hypothetical protein	NA	A0A1B1P7N8	Bacillus_phage	36.7	1.9e-10
AWV60865.1|821663_822044_+	HNH endonuclease	NA	A0A1B1P7N1	Bacillus_phage	64.0	4.7e-41
AWV60866.1|822155_822608_+|terminase	terminase small subunit	terminase	A0A2H4JFK0	uncultured_Caudovirales_phage	66.2	6.8e-47
AWV60867.1|822604_824332_+|terminase	terminase large subunit	terminase	A0A2H4JDG5	uncultured_Caudovirales_phage	73.3	6.9e-265
823273:823288	attR	GAAAATGGAACAGTAT	NA	NA	NA	NA
AWV60868.1|824353_825583_+|portal	phage portal protein	portal	A0A2H4J9C7	uncultured_Caudovirales_phage	65.0	1.7e-145
AWV60869.1|825548_826124_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1B2APW1	Phage_Wrath	71.7	3.6e-69
AWV60870.1|826136_827501_+|capsid	phage major capsid protein	capsid	A0A1B2APY9	Phage_Wrath	69.1	2.2e-125
AWV60871.1|827502_827784_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1C8E967	Bacillus_phage	62.7	4.7e-22
AWV60872.1|827761_828088_+|head,tail	phage head-tail joining protein	head,tail	A0A0N7IRA3	Lactobacillus_phage	53.4	2.9e-23
AWV60873.1|828077_828416_+	hypothetical protein	NA	A0A1B1P7P2	Bacillus_phage	45.9	9.6e-22
AWV60874.1|828405_828771_+	hypothetical protein	NA	NA	NA	NA	NA
AWV60875.1|828777_829404_+|tail	phage tail protein	tail	A0A2H4JGN2	uncultured_Caudovirales_phage	34.5	5.7e-28
AWV60876.1|829403_829868_+	hypothetical protein	NA	A0A2H4J956	uncultured_Caudovirales_phage	38.9	1.4e-15
AWV60877.1|830062_832372_+|tail	phage tail tape measure protein	tail	Q8W5Z7	Listeria_phage	50.1	5.5e-84
AWV62794.1|832383_833088_+|tail	phage tail protein	tail	NA	NA	NA	NA
AWV60878.1|833084_835844_+	CHAP domain-containing protein	NA	D7RWE0	Brochothrix_phage	55.7	1.6e-50
AWV60879.1|835856_836765_+|plate	phage baseplate upper protein	plate	A0A1P8BLW0	Lactococcus_phage	25.2	7.8e-10
AWV60880.1|836764_837382_+	hypothetical protein	NA	NA	NA	NA	NA
AWV60881.1|837385_837835_+	hypothetical protein	NA	NA	NA	NA	NA
AWV60882.1|837834_838329_+	hypothetical protein	NA	NA	NA	NA	NA
AWV60883.1|838342_838774_+	hypothetical protein	NA	NA	NA	NA	NA
AWV60884.1|838775_838913_+	XkdX family protein	NA	NA	NA	NA	NA
AWV60885.1|838949_839243_+	hypothetical protein	NA	NA	NA	NA	NA
AWV60886.1|839239_839464_+|holin	holin	holin	NA	NA	NA	NA
AWV60887.1|839460_840480_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1G5SA77	Enterococcus_phage	66.1	2.4e-60
AWV60888.1|841256_841556_-	hypothetical protein	NA	NA	NA	NA	NA
AWV60889.1|841561_841792_-	hypothetical protein	NA	NA	NA	NA	NA
AWV60890.1|842041_842242_-	hypothetical protein	NA	Q9AZR0	Lactococcus_phage	75.7	4.6e-08
AWV60891.1|842558_843746_+|transposase	IS256 family transposase IS16	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
AWV60892.1|844020_845253_-	aminopeptidase	NA	NA	NA	NA	NA
AWV60893.1|845507_846077_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AWV60894.1|846254_846695_-	flavodoxin	NA	NA	NA	NA	NA
AWV60895.1|846852_847617_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
AWV60896.1|847648_848572_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
AWV60897.1|848647_849787_+	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
AWV60898.1|849779_850580_+	glycosyltransferase	NA	NA	NA	NA	NA
AWV60899.1|850579_851407_+	glycosyltransferase	NA	NA	NA	NA	NA
AWV60900.1|851384_852119_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AWV60901.1|852218_853085_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	62.5	3.7e-102
AWV60902.1|853098_853671_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	49.2	8.3e-42
AWV60903.1|853692_854721_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	42.9	6.4e-69
AWV60904.1|854818_855670_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.0	1.7e-38
AWV60905.1|855703_857737_+	hypothetical protein	NA	NA	NA	NA	NA
AWV60906.1|857780_859061_+	hypothetical protein	NA	NA	NA	NA	NA
AWV60907.1|859270_860077_+	ABC transporter permease	NA	NA	NA	NA	NA
AWV60908.1|860088_861309_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.1e-11
AWV60909.1|861298_862885_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
AWV60910.1|862923_865062_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AWV60911.1|865429_866413_-	serine hydrolase	NA	NA	NA	NA	NA
AWV60912.1|866790_868182_+	sugar transferase	NA	NA	NA	NA	NA
AWV60913.1|868197_869238_+	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	35.3	2.4e-07
AWV60914.1|869256_870342_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AWV60915.1|870374_871337_+	glycosyl transferase	NA	NA	NA	NA	NA
AWV60916.1|871329_872757_+	O-antigen ligase domain-containing protein	NA	NA	NA	NA	NA
AWV60917.1|872758_873829_+	hypothetical protein	NA	NA	NA	NA	NA
AWV60918.1|873815_875237_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AWV60919.1|875249_876257_+	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	35.9	1.2e-40
AWV60920.1|876268_877273_+	N-acetylneuraminate synthase	NA	NA	NA	NA	NA
AWV60921.1|877269_878418_+	UDP-N-acetylglucosamine 2-epimerase (hydrolyzing)	NA	NA	NA	NA	NA
AWV60922.1|878390_879068_+	transferase	NA	NA	NA	NA	NA
AWV60923.1|879057_880200_+	pyridoxal phosphate-dependent aminotransferase	NA	A0A2K9L0G1	Tupanvirus	27.9	2.4e-24
AWV60924.1|880212_881190_+	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AWV60925.1|881189_882098_+	dehydrogenase	NA	NA	NA	NA	NA
AWV60926.1|882098_882851_+	acylneuraminate cytidylyltransferase family protein	NA	NA	NA	NA	NA
AWV60927.1|882855_883803_+	UDP-glucose 4-epimerase	NA	A0A1V0SKV4	Klosneuvirus	37.7	2.8e-50
AWV60928.1|883976_885272_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.2	1.5e-54
AWV60929.1|885760_886714_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 4
CP020488	Enterococcus faecium strain CFSAN059071 chromosome, complete genome	2883830	1162062	1171605	2883830		unidentified_phage(16.67%)	10	NA	NA
AWV61181.1|1162062_1163451_-	group II intron reverse transcriptase/maturase	NA	H7BVW2	unidentified_phage	26.0	7.0e-10
AWV61182.1|1163818_1164007_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61183.1|1164019_1164397_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61184.1|1164652_1165381_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	41.4	4.6e-45
AWV61185.1|1165380_1165635_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AWV61186.1|1165636_1166308_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AWV61187.1|1166308_1168531_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.3	1.9e-150
AWV61188.1|1168515_1169955_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	5.3e-53
AWV62802.1|1169986_1171030_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.7	2.7e-62
AWV61189.1|1171026_1171605_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	1.3e-26
>prophage 5
CP020488	Enterococcus faecium strain CFSAN059071 chromosome, complete genome	2883830	1332946	1400740	2883830	tail,transposase,integrase	Streptococcus_phage(33.33%)	59	1370285:1370301	1395317:1395333
AWV61336.1|1332946_1333900_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
AWV61337.1|1333949_1334573_+	hypothetical protein	NA	NA	NA	NA	NA
AWV61338.1|1335022_1336072_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWV61339.1|1336068_1336950_+	ABC transporter permease	NA	NA	NA	NA	NA
AWV61340.1|1336952_1337723_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.3	9.6e-09
AWV61341.1|1338001_1338856_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
AWV61342.1|1339033_1340197_+	LytR family transcriptional regulator	NA	NA	NA	NA	NA
AWV61343.1|1340313_1340724_+	VOC family protein	NA	NA	NA	NA	NA
AWV61344.1|1340897_1343126_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	52.6	1.6e-128
AWV61345.1|1343263_1343581_+	hypothetical protein	NA	NA	NA	NA	NA
AWV61346.1|1343740_1343977_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
AWV61347.1|1343973_1344372_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
AWV61348.1|1345038_1345983_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
AWV62811.1|1346278_1347223_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AWV61349.1|1347442_1348657_+	MFS transporter	NA	NA	NA	NA	NA
AWV61350.1|1348678_1350694_+	alpha-rhamnosidase	NA	NA	NA	NA	NA
AWV61351.1|1350776_1352150_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
AWV61352.1|1352175_1352460_-	PTS lactose transporter subunit IIB	NA	NA	NA	NA	NA
AWV61353.1|1352461_1354477_-	PRD domain-containing protein	NA	NA	NA	NA	NA
AWV61354.1|1354655_1354961_-	rRNA processing protein	NA	NA	NA	NA	NA
AWV61355.1|1356286_1357162_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AWV61356.1|1357313_1358156_-	class C sortase	NA	NA	NA	NA	NA
AWV61357.1|1358247_1360125_-	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
AWV61358.1|1360121_1361543_-	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
AWV61359.1|1361545_1364935_-	VWA domain-containing protein	NA	NA	NA	NA	NA
AWV62812.1|1365191_1366583_+	HTH domain-containing protein	NA	NA	NA	NA	NA
AWV61360.1|1366513_1366705_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61361.1|1366711_1367986_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.4	9.2e-57
AWV61362.1|1368164_1368812_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AWV61363.1|1368819_1369506_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.0	1.9e-29
AWV61364.1|1369511_1370585_-	ABC transporter permease	NA	NA	NA	NA	NA
1370285:1370301	attL	CATTTTCTTTGTTTTTT	NA	NA	NA	NA
AWV61365.1|1370806_1371481_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.3	1.1e-29
AWV61366.1|1371485_1372826_+	sensor histidine kinase	NA	NA	NA	NA	NA
AWV61367.1|1372974_1373961_-	DUF2382 domain-containing protein	NA	NA	NA	NA	NA
AWV61368.1|1374684_1375716_+|integrase	integrase	integrase	NA	NA	NA	NA
AWV61369.1|1375824_1377357_+	acetate--CoA ligase	NA	NA	NA	NA	NA
AWV61370.1|1377495_1378308_+	hydroxymethylpyrimidine/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AWV61371.1|1378297_1378783_+	ECF transporter S component	NA	NA	NA	NA	NA
AWV61372.1|1378805_1379351_+	TIGR01440 family protein	NA	NA	NA	NA	NA
AWV61373.1|1379423_1381067_-	alpha-glucosidase	NA	NA	NA	NA	NA
AWV61374.1|1381195_1383424_-	VWA domain-containing protein	NA	NA	NA	NA	NA
AWV61375.1|1383456_1383936_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61376.1|1384200_1385160_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
AWV61377.1|1385328_1386624_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
AWV61378.1|1386742_1387591_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	37.4	9.8e-15
AWV61379.1|1387747_1389358_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AWV61380.1|1389601_1389919_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
AWV61381.1|1389911_1390691_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWV61382.1|1390823_1391759_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
AWV61383.1|1391834_1392227_-	DUF4430 domain-containing protein	NA	NA	NA	NA	NA
AWV61384.1|1392207_1392726_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61385.1|1392873_1393947_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61386.1|1393939_1394857_-	viral A-type inclusion protein	NA	NA	NA	NA	NA
AWV61387.1|1395059_1395251_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61388.1|1395409_1396918_+	DUF1846 domain-containing protein	NA	NA	NA	NA	NA
1395317:1395333	attR	CATTTTCTTTGTTTTTT	NA	NA	NA	NA
AWV61389.1|1397153_1398335_+	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
AWV61390.1|1398423_1398972_+	guanylate kinase	NA	S4W1R9	Pandoravirus	29.4	3.3e-11
AWV61391.1|1399227_1399740_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWV61392.1|1399783_1400740_-|tail	phage tail protein	tail	NA	NA	NA	NA
>prophage 6
CP020488	Enterococcus faecium strain CFSAN059071 chromosome, complete genome	2883830	1447410	1490095	2883830	protease,transposase	Streptococcus_phage(23.08%)	51	NA	NA
AWV61436.1|1447410_1448559_-|transposase	transposase	transposase	A0A288TXV8	Enterococcus_phage	93.4	1.2e-204
AWV61437.1|1448575_1448980_-|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
AWV61438.1|1450096_1450570_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
AWV61439.1|1450578_1450806_+	transcriptional regulator	NA	NA	NA	NA	NA
AWV61440.1|1451441_1451813_+	hypothetical protein	NA	NA	NA	NA	NA
AWV61441.1|1452068_1452311_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AWV61442.1|1452342_1453245_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
AWV61443.1|1453257_1453446_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
AWV61444.1|1453459_1454023_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
AWV61445.1|1454060_1454954_-	SDR family NAD(P)-dependent oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	46.0	5.2e-59
AWV61446.1|1455031_1455970_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
AWV61447.1|1456003_1456354_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
AWV61448.1|1456386_1457289_-	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
AWV61449.1|1457281_1458139_-	glycosyltransferase family 8 protein	NA	A0ZYL4	Archaeal_BJ1_virus	27.1	1.3e-19
AWV61450.1|1458472_1459282_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
AWV61451.1|1459321_1459819_+	cysteine hydrolase	NA	NA	NA	NA	NA
AWV61452.1|1460463_1460787_+	hypothetical protein	NA	NA	NA	NA	NA
AWV61453.1|1460950_1461205_+	hypothetical protein	NA	NA	NA	NA	NA
AWV61454.1|1461274_1461520_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWV61455.1|1461595_1461961_+	hypothetical protein	NA	NA	NA	NA	NA
AWV61456.1|1462021_1462585_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61457.1|1463236_1464532_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
AWV61458.1|1464552_1464732_+	hypothetical protein	NA	NA	NA	NA	NA
AWV61459.1|1464770_1466072_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
AWV61460.1|1466175_1466376_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	77.3	3.9e-23
AWV61461.1|1467127_1467841_-	HAD family phosphatase	NA	A0A1D8KPI1	Synechococcus_phage	23.0	5.4e-06
AWV61462.1|1467833_1468919_-	mannonate dehydratase	NA	NA	NA	NA	NA
AWV61463.1|1468935_1469379_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
AWV62814.1|1469412_1469766_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61464.1|1469877_1470279_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61465.1|1470315_1470825_-	PTS mannose/fructose/sorbose transporter subunit IIB	NA	NA	NA	NA	NA
AWV61466.1|1470846_1471704_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
AWV61467.1|1471721_1472555_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
AWV61468.1|1472568_1473366_-	oxidoreductase	NA	NA	NA	NA	NA
AWV61469.1|1473398_1473683_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
AWV61470.1|1473679_1474681_-	hydroxyacid dehydrogenase	NA	M1H9J0	Paramecium_bursaria_Chlorella_virus	29.0	2.8e-24
AWV62815.1|1474682_1475585_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	A0A1D8KGX1	Synechococcus_phage	35.3	3.3e-53
AWV61471.1|1475748_1476597_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AWV61472.1|1477242_1477449_+	DUF3955 domain-containing protein	NA	NA	NA	NA	NA
AWV61473.1|1477650_1478652_-	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	31.8	2.5e-09
AWV61474.1|1478656_1480570_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
AWV61475.1|1480737_1481244_-	cysteine hydrolase	NA	NA	NA	NA	NA
AWV61476.1|1481403_1481844_+	transcriptional regulator	NA	NA	NA	NA	NA
AWV61477.1|1481869_1483027_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61478.1|1483029_1483386_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61479.1|1483683_1484658_-	peptidase	NA	NA	NA	NA	NA
AWV61480.1|1484853_1485693_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWV61481.1|1485877_1486765_+	rotamase	NA	NA	NA	NA	NA
AWV62816.1|1487358_1488054_-	fructose-6-phosphate aldolase	NA	E3SKN5	Synechococcus_phage	31.5	1.0e-22
AWV61482.1|1488037_1488436_-	PTS sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
AWV61483.1|1488844_1490095_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
>prophage 7
CP020488	Enterococcus faecium strain CFSAN059071 chromosome, complete genome	2883830	1497945	1544784	2883830	transposase,integrase	Streptococcus_phage(44.44%)	43	1493135:1493150	1502856:1502871
1493135:1493150	attL	AAAGGATACTTTTTTT	NA	NA	NA	NA
AWV61495.1|1497945_1499124_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
AWV61496.1|1499279_1500233_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
AWV61497.1|1500289_1501417_+|integrase	site-specific integrase	integrase	A0A2I7SCV1	Paenibacillus_phage	55.5	1.8e-109
AWV61498.1|1501634_1502777_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	32.4	4.5e-39
AWV61499.1|1502781_1502967_-	DUF3173 domain-containing protein	NA	NA	NA	NA	NA
1502856:1502871	attR	AAAAAAAGTATCCTTT	NA	NA	NA	NA
AWV61500.1|1503320_1503566_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AWV61501.1|1503559_1503961_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AWV61502.1|1504147_1505956_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	48.4	2.3e-154
AWV61503.1|1505978_1507745_-	beta-hexosaminidase	NA	NA	NA	NA	NA
AWV61504.1|1507757_1508552_-	HAD family hydrolase	NA	NA	NA	NA	NA
AWV61505.1|1508561_1509938_-	MFS transporter	NA	NA	NA	NA	NA
AWV61506.1|1510057_1510705_-	bifunctional 2-keto-4-hydroxyglutarate aldolase/2-keto-3-deoxy-6-phosphogluconate aldolase	NA	NA	NA	NA	NA
AWV61507.1|1510788_1512216_-	glucuronate isomerase	NA	NA	NA	NA	NA
AWV61508.1|1512289_1513369_-	mannonate dehydratase	NA	NA	NA	NA	NA
AWV61509.1|1513371_1515003_-	mannitol dehydrogenase family protein	NA	NA	NA	NA	NA
AWV61510.1|1515306_1515978_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWV61511.1|1516990_1518310_+|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	4.8e-210
AWV61512.1|1518818_1519271_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61513.1|1519277_1519826_-	peptidase	NA	NA	NA	NA	NA
AWV61514.1|1520079_1521399_-|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	4.8e-210
AWV61515.1|1521554_1521887_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61516.1|1521900_1522158_-	hypothetical protein	NA	NA	NA	NA	NA
AWV62817.1|1522352_1522895_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61517.1|1522915_1524007_-	CHAP domain-containing protein	NA	A0A0B5A7F4	Streptococcus_phage	29.9	4.6e-25
AWV61518.1|1524014_1526225_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61519.1|1526240_1528769_-	ATPase	NA	NA	NA	NA	NA
AWV61520.1|1528820_1529231_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61521.1|1529243_1529462_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61522.1|1529458_1530451_-	conjugal transfer protein	NA	NA	NA	NA	NA
AWV61523.1|1530529_1531441_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
AWV61524.1|1531459_1531804_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61525.1|1532460_1532961_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61526.1|1532961_1533507_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61527.1|1533503_1534760_-	transcriptional regulator	NA	NA	NA	NA	NA
AWV61528.1|1535120_1535432_-	hypothetical protein	NA	NA	NA	NA	NA
AWV62818.1|1535454_1536765_-	cell division protein FtsK	NA	A0A1S5SFB5	Streptococcus_phage	36.8	1.3e-61
AWV61529.1|1537378_1537831_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61530.1|1537832_1538198_-	hypothetical protein	NA	NA	NA	NA	NA
AWV62819.1|1538296_1541596_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
AWV61531.1|1542726_1542966_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61532.1|1543055_1543328_-	hypothetical protein	NA	A0A1W6JN36	Lactococcus_phage	57.4	1.6e-19
AWV61533.1|1543410_1543662_-	hypothetical protein	NA	D2IZL0	Enterococcus_phage	58.5	1.1e-06
AWV61534.1|1543824_1544784_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 8
CP020488	Enterococcus faecium strain CFSAN059071 chromosome, complete genome	2883830	1648979	1771182	2883830	tRNA,protease,transposase,integrase	Streptococcus_phage(35.14%)	110	1661540:1661557	1685026:1685043
AWV61625.1|1648979_1649933_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
AWV61626.1|1649929_1650511_-	DUF443 family protein	NA	NA	NA	NA	NA
AWV61627.1|1650697_1651348_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61628.1|1651338_1651539_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61629.1|1651890_1652826_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.1	2.0e-53
AWV61630.1|1652859_1653858_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	62.9	2.6e-115
AWV61631.1|1653854_1654739_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	31.4	5.4e-08
AWV61632.1|1654873_1655605_-	amino acid racemase	NA	NA	NA	NA	NA
AWV61633.1|1655608_1656874_-	D-aspartate ligase	NA	NA	NA	NA	NA
AWV61634.1|1657136_1659953_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.4	3.6e-311
AWV61635.1|1659962_1661957_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
1661540:1661557	attL	CATTTCTTTCTAATAATG	NA	NA	NA	NA
AWV61636.1|1662215_1663718_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
AWV61637.1|1663719_1664457_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	44.7	2.8e-34
AWV61638.1|1664627_1665821_-|integrase	site-specific integrase	integrase	A0A1S5SEW7	Streptococcus_phage	63.8	3.9e-142
AWV61639.1|1665899_1666106_-	excisionase	NA	A0A1S5SF07	Streptococcus_phage	87.3	1.1e-25
AWV61640.1|1666098_1667241_-	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	35.4	1.5e-63
AWV61641.1|1667752_1668388_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWV61642.1|1668893_1668980_+	tetracycline resistance protein	NA	NA	NA	NA	NA
AWV61643.1|1668995_1670915_+	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	99.5	0.0e+00
AWV61644.1|1671015_1671201_+	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	67.9	3.9e-17
AWV61645.1|1671260_1671614_-	XRE family transcriptional regulator	NA	A0A1S5SFA6	Streptococcus_phage	100.0	1.3e-58
AWV62821.1|1671818_1671890_+	hypothetical protein	NA	NA	NA	NA	NA
AWV61646.1|1672117_1672537_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AWV61647.1|1672562_1672769_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AWV61648.1|1673181_1673811_+	sugar diacid utilization regulator	NA	NA	NA	NA	NA
AWV61649.1|1673892_1675059_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	25.7	1.9e-24
AWV61650.1|1675209_1677039_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	48.8	2.2e-136
AWV61651.1|1677089_1677653_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AWV61652.1|1677746_1678790_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
AWV61653.1|1680204_1680432_-	adenosine deaminase	NA	NA	NA	NA	NA
AWV61654.1|1680915_1681506_+	glutamine amidotransferase	NA	NA	NA	NA	NA
AWV61655.1|1681695_1682409_+	hypothetical protein	NA	NA	NA	NA	NA
AWV61656.1|1682588_1683884_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
AWV61657.1|1684045_1685056_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
1685026:1685043	attR	CATTTCTTTCTAATAATG	NA	NA	NA	NA
AWV61658.1|1685092_1685575_-|tRNA	prolyl-tRNA editing protein	tRNA	NA	NA	NA	NA
AWV61659.1|1685724_1686093_+	iron chaperone	NA	NA	NA	NA	NA
AWV61660.1|1686557_1687010_+	DNA-binding protein	NA	NA	NA	NA	NA
AWV61661.1|1687133_1687985_-	sugar transporter	NA	NA	NA	NA	NA
AWV61662.1|1687997_1688783_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AWV61663.1|1689134_1690076_-	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
AWV61664.1|1690079_1691003_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
AWV61665.1|1694180_1694354_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
AWV61666.1|1694624_1695920_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
AWV61667.1|1696114_1696462_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
AWV61668.1|1696488_1698795_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.7	3.6e-19
AWV61669.1|1698807_1699119_-	YlxQ-related RNA-binding protein	NA	NA	NA	NA	NA
AWV61670.1|1699115_1699409_-	YlxR family protein	NA	NA	NA	NA	NA
AWV61671.1|1699430_1700606_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
AWV61672.1|1700628_1701102_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
AWV61673.1|1701246_1705605_-	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	40.8	1.9e-21
AWV61674.1|1705816_1707526_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AWV61675.1|1707593_1708862_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
AWV61676.1|1709022_1709823_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
AWV61677.1|1709819_1710632_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	46.8	2.0e-25
AWV61678.1|1711040_1712291_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
AWV61679.1|1712622_1713795_+|transposase	IS256 family transposase IS1542	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
AWV61680.1|1713941_1714499_-	ribosome recycling factor	NA	NA	NA	NA	NA
AWV61681.1|1714501_1715224_-	UMP kinase	NA	NA	NA	NA	NA
AWV61682.1|1715359_1716241_-	elongation factor Ts	NA	NA	NA	NA	NA
AWV61683.1|1716339_1717122_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
AWV61684.1|1717480_1717960_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
AWV62822.1|1718176_1719268_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
AWV61685.1|1720391_1722083_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.6	2.9e-74
AWV61686.1|1722502_1723450_-	carbamate kinase	NA	NA	NA	NA	NA
AWV61687.1|1723564_1724584_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
AWV61688.1|1724674_1725904_-	arginine deiminase	NA	NA	NA	NA	NA
AWV61689.1|1726364_1727066_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AWV61690.1|1727674_1728691_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.0	5.4e-60
AWV61691.1|1728687_1729152_-	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
AWV61692.1|1729158_1729701_-	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
AWV62823.1|1729684_1730509_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AWV61693.1|1730597_1731578_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.9	5.8e-19
AWV61694.1|1731601_1733086_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
AWV61695.1|1733097_1734087_-	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	36.8	2.1e-48
AWV61696.1|1734334_1734502_+	DUF3042 family protein	NA	NA	NA	NA	NA
AWV61697.1|1734563_1736375_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AWV61698.1|1736371_1736737_-	DUF488 family protein	NA	NA	NA	NA	NA
AWV61699.1|1736899_1737295_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AWV61700.1|1737312_1738275_-	ROK family protein	NA	NA	NA	NA	NA
AWV61701.1|1738274_1738487_-	DUF910 family protein	NA	NA	NA	NA	NA
AWV61702.1|1738507_1739206_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AWV61703.1|1739225_1739768_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
AWV61704.1|1739899_1740904_-	iron ABC transporter permease	NA	NA	NA	NA	NA
AWV61705.1|1740900_1741890_-	iron ABC transporter permease	NA	NA	NA	NA	NA
AWV61706.1|1741886_1742693_-	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	32.1	1.0e-13
AWV61707.1|1742858_1743815_+	ferrichrome ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWV61708.1|1743891_1744410_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	39.1	7.1e-24
AWV61709.1|1744497_1744647_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
AWV61710.1|1744874_1745321_+	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
AWV61711.1|1745515_1747411_-	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y2L7	Organic_Lake_phycodnavirus	26.2	6.0e-20
AWV61712.1|1747735_1748710_-	linear amide C-N hydrolase	NA	M1H001	Paramecium_bursaria_Chlorella_virus	29.7	3.0e-23
AWV61713.1|1749275_1749842_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AWV61714.1|1750097_1751429_+	DUF1576 domain-containing protein	NA	NA	NA	NA	NA
AWV61715.1|1751394_1751745_+	hypothetical protein	NA	NA	NA	NA	NA
AWV61716.1|1752256_1752601_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AWV61717.1|1752866_1753826_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
AWV61718.1|1754015_1754612_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	41.7	8.7e-34
AWV61719.1|1754735_1756535_+	glycerophosphodiester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	26.5	5.3e-10
AWV61720.1|1756812_1757025_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61721.1|1757888_1758848_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	27.2	7.5e-11
AWV61722.1|1759060_1759969_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
AWV61723.1|1760017_1760404_+	YxeA family protein	NA	NA	NA	NA	NA
AWV61724.1|1760711_1762058_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
AWV61725.1|1762169_1763519_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
AWV61726.1|1763635_1764889_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	55.3	7.7e-24
AWV61727.1|1764959_1765445_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
AWV61728.1|1765467_1766226_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.4	1.9e-25
AWV61729.1|1766241_1767420_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	48.9	3.9e-102
AWV61730.1|1767649_1769770_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	58.0	8.2e-220
AWV61731.1|1769886_1771182_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
>prophage 9
CP020488	Enterococcus faecium strain CFSAN059071 chromosome, complete genome	2883830	1776885	1947900	2883830	capsid,portal,head,transposase,integrase,terminase,tRNA,protease,tail,holin	Streptococcus_phage(21.13%)	184	1769805:1769864	1932428:1933941
1769805:1769864	attL	GGCTCTTTGTCAATAAGGACTGATGGGTTGTACAAAATCAAATCTGGGTCAGAATGAACC	NA	NA	NA	NA
AWV61738.1|1776885_1778181_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
AWV61739.1|1778499_1778802_+	hypothetical protein	NA	NA	NA	NA	NA
AWV61740.1|1779549_1779732_+	hypothetical protein	NA	NA	NA	NA	NA
AWV61741.1|1779945_1780260_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61742.1|1780376_1781555_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
AWV61743.1|1781891_1782131_+	hypothetical protein	NA	NA	NA	NA	NA
AWV61744.1|1782492_1782753_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61745.1|1782937_1783435_-	GAF domain-containing protein	NA	NA	NA	NA	NA
AWV61746.1|1783564_1784275_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
AWV61747.1|1784287_1785952_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
AWV61748.1|1786156_1786819_-	DUF624 domain-containing protein	NA	NA	NA	NA	NA
AWV61749.1|1786828_1787644_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
AWV61750.1|1787905_1788349_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWV61751.1|1788482_1788821_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWV61752.1|1788808_1789186_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AWV61753.1|1789409_1790603_+	MFS transporter	NA	NA	NA	NA	NA
AWV61754.1|1790768_1791191_-	HTH domain-containing protein	NA	NA	NA	NA	NA
AWV61755.1|1791585_1791780_+	hypothetical protein	NA	NA	NA	NA	NA
AWV61756.1|1791776_1792271_+	hypothetical protein	NA	NA	NA	NA	NA
AWV61757.1|1792238_1792436_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61758.1|1792432_1793605_-	class C sortase	NA	NA	NA	NA	NA
AWV61759.1|1793810_1794626_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
AWV61760.1|1794775_1795222_-	cell wall anchor protein	NA	NA	NA	NA	NA
AWV61761.1|1795218_1796232_-	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
AWV61762.1|1796262_1796721_-	cell wall anchor protein	NA	NA	NA	NA	NA
AWV61763.1|1796717_1799045_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
AWV61764.1|1799686_1799800_+|protease	CAAX protease	protease	NA	NA	NA	NA
AWV61765.1|1799887_1800181_-	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
AWV61766.1|1800217_1800403_+	hypothetical protein	NA	NA	NA	NA	NA
AWV61767.1|1800583_1801762_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	31.1	1.4e-30
AWV61768.1|1801865_1802180_-	DNA-binding protein	NA	NA	NA	NA	NA
AWV61769.1|1802286_1802502_+	hypothetical protein	NA	NA	NA	NA	NA
AWV62824.1|1802801_1803044_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AWV61770.1|1803030_1803459_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AWV61771.1|1803610_1805158_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
AWV61772.1|1805259_1805613_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AWV61773.1|1805602_1805797_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61774.1|1805927_1807090_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
AWV61775.1|1807654_1808029_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
AWV61776.1|1808051_1809452_-	beta-fructofuranosidase	NA	NA	NA	NA	NA
AWV61777.1|1809455_1809866_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
AWV61778.1|1809883_1810375_-	PTS mannose/fructose/sorbose transporter subunit IIB	NA	NA	NA	NA	NA
AWV61779.1|1810384_1811176_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
AWV61780.1|1811168_1811942_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
AWV61781.1|1812097_1814632_-	PRD domain-containing protein	NA	NA	NA	NA	NA
AWV61782.1|1814713_1815586_-	ROK family protein	NA	NA	NA	NA	NA
AWV61783.1|1815621_1816089_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
AWV61784.1|1816098_1817568_-	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
AWV61785.1|1817638_1819057_-	beta-fructofuranosidase	NA	NA	NA	NA	NA
AWV61786.1|1819178_1820159_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AWV61787.1|1820438_1821601_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	53.5	1.6e-79
AWV61788.1|1821693_1822203_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWV61789.1|1822541_1823495_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
AWV61790.1|1823447_1823684_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWV61791.1|1824103_1825225_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AWV62825.1|1825552_1826962_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
AWV61792.1|1826958_1827687_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	37.1	5.1e-36
AWV61793.1|1827814_1828726_-	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	42.2	1.1e-59
AWV61794.1|1828742_1829750_-	lipoprotein	NA	A0A1S5SEZ8	Streptococcus_phage	63.9	4.8e-117
AWV61795.1|1829746_1831876_-	FUSC family protein	NA	A0A1S5SF30	Streptococcus_phage	60.3	1.8e-182
AWV61796.1|1832176_1833364_-|transposase	IS256 family transposase IS16	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
AWV61797.1|1834408_1836235_-	group II intron reverse transcriptase/maturase	NA	H7BVW2	unidentified_phage	26.8	3.7e-11
AWV61798.1|1838468_1838858_-	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	65.9	1.4e-40
AWV61799.1|1838907_1839804_-	phosphoesterase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	29.7	1.1e-16
AWV61800.1|1839806_1841654_-	PHP domain-containing protein	NA	NA	NA	NA	NA
AWV61801.1|1841750_1842251_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.6	7.0e-53
AWV61802.1|1842263_1842485_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	87.7	4.5e-28
AWV61803.1|1842489_1842627_-	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
AWV61804.1|1842623_1843808_-	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	60.8	1.9e-141
AWV61805.1|1844063_1844318_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61806.1|1844342_1845485_-	DNA (cytosine-5-)-methyltransferase	NA	A0A1S5SEK0	Streptococcus_phage	62.1	1.7e-126
AWV61807.1|1845544_1846897_-	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	64.4	3.8e-162
AWV61808.1|1846967_1847321_-	DNA-damage-inducible protein J	NA	NA	NA	NA	NA
AWV61809.1|1847321_1847696_-	DUF961 domain-containing protein	NA	A0A1S5SF96	Streptococcus_phage	62.9	1.1e-34
AWV61810.1|1847708_1848023_-	DUF961 domain-containing protein	NA	A0A1S5SF38	Streptococcus_phage	53.4	1.7e-25
AWV61811.1|1848136_1851364_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
AWV61812.1|1851442_1852105_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61813.1|1852721_1852952_+	hypothetical protein	NA	NA	NA	NA	NA
AWV61814.1|1852957_1853257_+	hypothetical protein	NA	NA	NA	NA	NA
AWV61815.1|1854251_1855460_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61816.1|1855574_1856591_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1G5SA77	Enterococcus_phage	66.7	9.8e-62
AWV61817.1|1856601_1856799_-|holin	holin	holin	A0A0S2MYF6	Enterococcus_phage	85.9	7.8e-24
AWV61818.1|1856814_1857057_-|holin	holin	holin	D2J075	Enterococcus_phage	63.3	1.2e-21
AWV61819.1|1857091_1857229_-	XkdX family protein	NA	NA	NA	NA	NA
AWV61820.1|1857230_1857677_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61821.1|1857839_1859900_-	DUF2479 domain-containing protein	NA	A0A249XZH9	Enterococcus_phage	44.9	1.7e-65
AWV61822.1|1859917_1860742_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61823.1|1860745_1861795_-	hypothetical protein	NA	Q5K5I4	Oenococcus_phage	27.9	1.9e-31
AWV61824.1|1861791_1862664_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61825.1|1862664_1866513_-|tail	phage tail protein	tail	A0A0M5M3L4	Enterococcus_phage	76.0	0.0e+00
AWV61826.1|1866512_1866704_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61827.1|1866727_1867039_-	hypothetical protein	NA	A0A0S2MY76	Enterococcus_phage	44.8	4.0e-14
AWV61828.1|1867163_1867724_-|tail	phage tail protein	tail	V5UQL2	Enterococcus_phage	46.2	3.4e-40
AWV61829.1|1867739_1868111_-	hypothetical protein	NA	A0A060ANH4	Enterococcus_phage	46.2	2.5e-23
AWV61830.1|1868107_1868503_-	hypothetical protein	NA	C0LZZ2	Enterococcus_phage	44.5	4.3e-21
AWV61831.1|1868499_1868835_-|head,tail	head-tail adaptor protein	head,tail	A0A249XUC8	Enterococcus_phage	44.1	2.2e-18
AWV61832.1|1868838_1869165_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
AWV61833.1|1869179_1870373_-|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	55.4	1.5e-114
AWV61834.1|1870369_1871047_-|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	51.0	4.9e-49
AWV61835.1|1871081_1872302_-|portal	phage portal protein	portal	A0A0U3SQF0	Bacillus_phage	38.5	1.2e-61
AWV61836.1|1873856_1874636_-	hypothetical protein	NA	A0A220BXN1	Staphylococcus_phage	45.9	8.1e-40
AWV61837.1|1874710_1874869_+	ribbon-helix-helix domain-containing protein	NA	A0A0A7RUX5	Clostridium_phage	65.9	5.3e-07
AWV61838.1|1875335_1875857_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	34.2	1.1e-16
AWV61839.1|1875958_1876123_+	YjzC family protein	NA	A0A0A7RTS6	Clostridium_phage	69.8	3.6e-14
AWV61840.1|1876279_1876597_-	HNH endonuclease	NA	A0A1B1P8D2	Bacillus_phage	39.8	2.0e-13
AWV61841.1|1876597_1877143_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWV61842.1|1877142_1877331_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61843.1|1877327_1877558_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61844.1|1878338_1878752_-	autolysin	NA	C9E2P5	Enterococcus_phage	81.0	1.1e-56
AWV61845.1|1878954_1879206_+	hypothetical protein	NA	NA	NA	NA	NA
AWV61846.1|1879238_1879526_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61847.1|1879522_1879726_-	toxin PIN	NA	NA	NA	NA	NA
AWV61848.1|1879655_1879925_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61849.1|1879921_1880452_-	DUF1642 domain-containing protein	NA	A0A059T7S4	Listeria_phage	37.2	1.8e-11
AWV61850.1|1880444_1880759_-	hypothetical protein	NA	D2IZY1	Enterococcus_phage	72.7	4.6e-34
AWV61851.1|1880758_1881064_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61852.1|1881060_1881222_-	antitoxin	NA	NA	NA	NA	NA
AWV61853.1|1881218_1881536_-	VRR-NUC domain-containing protein	NA	A0A1B0YA93	Lactobacillus_phage	61.5	3.6e-31
AWV61854.1|1881782_1884095_-	DNA primase	NA	R4IBW2	Listeria_phage	55.9	1.3e-250
AWV61855.1|1884109_1884610_-	DUF669 domain-containing protein	NA	A8ATF2	Listeria_phage	52.9	1.1e-34
AWV61856.1|1884611_1885085_-	transcriptional regulator	NA	A8ATW6	Listeria_phage	43.9	7.7e-09
AWV61857.1|1885075_1886425_-	ATP-dependent helicase	NA	A0A0P0ID30	Lactobacillus_phage	53.4	4.1e-132
AWV61858.1|1886399_1887086_-	DNA-binding protein	NA	A0A1P8VVS4	Streptococcus_phage	52.7	1.1e-61
AWV61859.1|1887204_1887531_-	hypothetical protein	NA	F0PIH7	Enterococcus_phage	57.8	1.6e-26
AWV61860.1|1887527_1887959_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61861.1|1888408_1888888_-	hypothetical protein	NA	E5DV79	Deep-sea_thermophilic_phage	49.0	5.3e-34
AWV61862.1|1888820_1889138_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61863.1|1889305_1889764_+	hypothetical protein	NA	NA	NA	NA	NA
AWV61864.1|1890066_1890315_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61865.1|1890327_1890513_-	XRE family transcriptional regulator	NA	Q5YAA3	Bacillus_phage	56.7	8.4e-12
AWV61866.1|1890816_1891191_+	XRE family transcriptional regulator	NA	O03970	Lactobacillus_phage	38.7	3.2e-18
AWV61867.1|1891195_1891624_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
AWV61868.1|1891673_1892327_+	hypothetical protein	NA	NA	NA	NA	NA
AWV61869.1|1892462_1893029_+	hypothetical protein	NA	A0A0P0IXE0	Lactobacillus_phage	92.3	1.9e-06
AWV61870.1|1893144_1894281_+|integrase	site-specific integrase	integrase	A0A1P8BMN3	Lactococcus_phage	36.8	8.4e-54
AWV61871.1|1894412_1894760_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AWV61872.1|1894895_1895657_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AWV61873.1|1895646_1896168_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AWV61874.1|1896337_1897129_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61875.1|1897253_1897505_-	KH domain-containing protein	NA	NA	NA	NA	NA
AWV61876.1|1897516_1897792_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AWV61877.1|1898044_1898599_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	29.3	2.3e-12
AWV61878.1|1898677_1899199_-	dihydrofolate reductase	NA	NA	NA	NA	NA
AWV61879.1|1899202_1899781_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
AWV61880.1|1899892_1901311_-	signal recognition particle protein	NA	NA	NA	NA	NA
AWV61881.1|1901331_1901670_-	putative DNA-binding protein	NA	NA	NA	NA	NA
AWV61882.1|1901629_1902133_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
AWV61883.1|1902263_1902968_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.2	1.4e-38
AWV61884.1|1902964_1904701_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	34.1	1.2e-27
AWV61885.1|1904803_1907275_-	HAD family hydrolase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	29.2	3.1e-45
AWV61886.1|1907599_1908490_-	phosphate ABC transporter substrate-binding protein PstS family protein	NA	NA	NA	NA	NA
AWV61887.1|1908686_1909169_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61888.1|1909376_1909742_+	hypothetical protein	NA	NA	NA	NA	NA
AWV61889.1|1909945_1910263_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61890.1|1910992_1911967_-	linear amide C-N hydrolase	NA	M1HVK5	Paramecium_bursaria_Chlorella_virus	31.8	5.4e-25
AWV61891.1|1912376_1913627_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
AWV61892.1|1913912_1914170_+	hypothetical protein	NA	NA	NA	NA	NA
AWV61893.1|1914401_1914815_-	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
AWV61894.1|1915093_1916433_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
AWV61895.1|1916502_1917078_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9MCC6	Lactobacillus_phage	35.9	4.8e-13
AWV61896.1|1917158_1918320_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	2.7e-79
AWV61897.1|1918694_1919264_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AWV61898.1|1919337_1920627_-	hypothetical protein	NA	NA	NA	NA	NA
AWV62826.1|1920980_1921829_+	MoxR family ATPase	NA	NA	NA	NA	NA
AWV61899.1|1921842_1922916_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
AWV61900.1|1922905_1925077_+	transglutaminase domain-containing protein	NA	NA	NA	NA	NA
AWV62827.1|1925188_1927345_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	32.3	2.9e-71
AWV61901.1|1927487_1929674_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.7	1.4e-121
AWV61902.1|1929673_1929883_-	copper-binding protein	NA	NA	NA	NA	NA
AWV61903.1|1929895_1930336_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
AWV62828.1|1930409_1930883_-	topology modulation family protein	NA	A0A097BYE2	Leuconostoc_phage	28.8	1.1e-10
AWV61904.1|1931109_1932405_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
AWV61905.1|1932714_1934181_-	amino acid permease	NA	NA	NA	NA	NA
1932428:1933941	attR	GGTTCATTCTGACCCAGATTTGATTTTGTACAACCCATCAGTCCTTATTGACAAAGAGCCAAAAAACAAGGGACTGTGACAAAAGTCGTGTCAAAGTCCCTTGTTTCGAATAAATGGTGTTCAATCAGCTGACCTTCAGCATTAGCTCAAAAAACGGCAAAATATGAGGAGCTATTTTTGTTTGGCTGTTCTTATTACTTGATGCAGGACAGCTTTTTCACAACCTCTGATTCACGGTGTTCCAGAAGTAGCTTCTGTCACAACCTCTTGTAACAAGTATTTCTATTTTAAGGCTGAACCACTGTTTCTGGTTCAGTAATTTCTTTGTTTTTGTCTCGACGAGCAATTGCTGGCAAGATCATACCTAATAAGATCAAGACAATTGGTGTGATGATATTCGTGAATAATTGGAACCACCATGCTTTAGGATCAGCAGTATAATCTACTTTTGGCACCATTCCTAGGATACATGCAAACGCAGTGAAGGCAAAGCACCAAGCACCAAAGATAAAACCGATTTTTGGATTTTTAACAAATTTATATTCAGAATTGAATTTCTTATAAGCTTTATTCAACATCATATATGCCAAGAACACCCATAGGTAACGCATTGGCATGACAACTGAGTTCAAGTTCGTCAACCATTTTACTAATTCATTCATATCTTTGATACCAAAGATCGGCAACAAAATAATGATTCCTACTAGTATACCTGTCAGAAGATAACCATTCACCAATGTACCTTTACGATTACGTTTACGTAGCCAGTTTGGTACAAATTCTGGATCCGCATCTGCTAACAAGATTTTTAGTGGTGCATCAATTGAAAAGGCTAATGCGGAGATTTGTCCAATCATGTTTGTCAATGCGTAAATGATCATCAATGAGTTACCGATACCATAGTAATTACCTAAAATTTGAAAAGCACTGTATGCCCCATTTGCCATCAAGTCTTTAGGGATATTATCGCTAGCAAACAGCATACCCATTGCGACTGAGCCTAATACAGCACAAATCCCTACCATTGCTGCTAAGAAGATCATCCCTTTAGGAAATTCCTTTGCAGGATTTCTTGTAGAGTTGACATAAGGGGATATTTTTTCCGCCCCTCCAACTGCAAATACTAGCATCGAAACGGTTGTGAAATAACTGAAATCAAATGTTGGAATATATGTTTTCACTTGATTCATATGTGGTGTGGCAAATTCCATCGTTGGATTGATGAACGGTGCCGTTACAGCTAAAAGAATAAATAAGATCGACATGACGAACATCGCTGTTCCGGCCAGTCCGCCAATCACTTTCAAAGTAGAAAGTCCTTTTGTTGATAAATATAAAAAGGCAAGAAATATAATAAGTGAAATAACTGCTACCATTTGTACTGACATCGTATTTACGATATTTCCATTTCCTTGGACTGCCCAACCACCAGCAATCAGAATTGCTTGAGGCTTTTGTGCCAAATAAGGAATATGGACGACCCAGTAAGTCCAAGCGGCATAGTATGCCAGTCG	NA	NA	NA	NA
AWV61906.1|1934491_1936576_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.7	9.9e-117
AWV61907.1|1937099_1937459_-	YccF domain-containing protein	NA	NA	NA	NA	NA
AWV61908.1|1937488_1937830_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61909.1|1937826_1938501_-	GDSL family lipase	NA	NA	NA	NA	NA
AWV61910.1|1939295_1940594_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.3	1.2e-59
AWV62829.1|1940633_1941824_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AWV61911.1|1941844_1942372_-	peptidase	NA	NA	NA	NA	NA
AWV61912.1|1942418_1945208_-	DNA polymerase III subunit epsilon	NA	A0A1X9I5C8	Streptococcus_phage	30.9	1.1e-89
AWV61913.1|1945354_1945555_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	74.2	2.5e-22
AWV61914.1|1946006_1946327_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61915.1|1946604_1947900_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
>prophage 10
CP020488	Enterococcus faecium strain CFSAN059071 chromosome, complete genome	2883830	1984043	2047655	2883830	holin,transposase,tRNA	Bacillus_phage(28.57%)	60	NA	NA
AWV61951.1|1984043_1984961_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
AWV61952.1|1985346_1986165_-	DNA repair protein RecO	NA	NA	NA	NA	NA
AWV61953.1|1986307_1987207_-	GTPase Era	NA	NA	NA	NA	NA
AWV61954.1|1987221_1987623_-	diacylglycerol kinase family protein	NA	NA	NA	NA	NA
AWV61955.1|1987600_1988077_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
AWV61956.1|1988105_1990298_-	HDIG domain-containing protein	NA	NA	NA	NA	NA
AWV61957.1|1990321_1991293_-	PhoH family protein	NA	W8D063	Erwinia_phage	49.8	3.5e-48
AWV61958.1|1991997_1993377_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
AWV61959.1|1993658_1994999_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.0	1.9e-65
AWV61960.1|1995155_1996451_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
AWV61961.1|1996585_1997032_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	38.8	1.6e-19
AWV61962.1|1997058_1997235_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AWV61963.1|1997396_1997825_-	transcriptional repressor	NA	NA	NA	NA	NA
AWV61964.1|1997916_1998777_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
AWV61965.1|1998870_1999164_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AWV61966.1|1999236_2000964_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	62.9	2.4e-209
AWV61967.1|2001176_2002103_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	52.8	2.3e-89
AWV61968.1|2002247_2003681_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AWV61969.1|2003680_2005084_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AWV61970.1|2005023_2005245_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61971.1|2005313_2006216_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AWV61972.1|2006256_2008143_-	PTS beta-glucoside transporter subunit EIIBCA	NA	NA	NA	NA	NA
AWV61973.1|2009426_2011211_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.6	7.1e-47
AWV61974.1|2011210_2012962_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.4	1.6e-56
AWV61975.1|2013103_2013328_-	YneF family protein	NA	NA	NA	NA	NA
AWV61976.1|2013383_2013608_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61977.1|2013578_2015165_+	divalent metal cation transporter	NA	NA	NA	NA	NA
AWV61978.1|2015230_2017006_-	glucosyltransferase	NA	NA	NA	NA	NA
AWV61979.1|2017216_2018119_-	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	30.7	1.5e-21
AWV61980.1|2018397_2020743_+	penicillin-binding protein	NA	NA	NA	NA	NA
AWV61981.1|2020983_2022162_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
AWV61982.1|2022251_2022518_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61983.1|2022510_2022834_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61984.1|2022845_2024102_-	lipase	NA	NA	NA	NA	NA
AWV61985.1|2024098_2024494_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61986.1|2024536_2024788_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61987.1|2024787_2025183_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61988.1|2025537_2026539_-	catabolite control protein A	NA	NA	NA	NA	NA
AWV61989.1|2026748_2027852_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
AWV61990.1|2027914_2028517_-	YtxH domain-containing protein	NA	NA	NA	NA	NA
AWV61991.1|2028519_2028960_-	DUF948 domain-containing protein	NA	NA	NA	NA	NA
AWV61992.1|2029084_2030023_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	51.2	5.5e-75
AWV61993.1|2030037_2031063_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AWV61994.1|2031106_2031937_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AWV61995.1|2031951_2032890_-	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
AWV61996.1|2033056_2033407_-|holin	phage holin family protein	holin	NA	NA	NA	NA
AWV61997.1|2033406_2033724_-	PspC domain-containing protein	NA	NA	NA	NA	NA
AWV61998.1|2033749_2033947_-	hypothetical protein	NA	NA	NA	NA	NA
AWV61999.1|2034023_2035592_-	hypothetical protein	NA	NA	NA	NA	NA
AWV62000.1|2035691_2036459_-	YibE/F family protein	NA	NA	NA	NA	NA
AWV62001.1|2036455_2037496_-	YibE/F family protein	NA	NA	NA	NA	NA
AWV62002.1|2037617_2038913_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
AWV62003.1|2039231_2039909_-	phosphate transport system regulatory protein PhoU	NA	NA	NA	NA	NA
AWV62004.1|2039921_2040680_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	1.2e-19
AWV62005.1|2040695_2041502_-	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.4	1.0e-13
AWV62006.1|2041516_2042401_-	phosphate ABC transporter permease PtsA	NA	NA	NA	NA	NA
AWV62007.1|2042400_2043321_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
AWV62008.1|2043435_2044293_-	phosphate ABC transporter substrate-binding protein PstS family protein	NA	NA	NA	NA	NA
AWV62009.1|2044629_2046078_-	cardiolipin synthase	NA	NA	NA	NA	NA
AWV62010.1|2046359_2047655_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
>prophage 11
CP020488	Enterococcus faecium strain CFSAN059071 chromosome, complete genome	2883830	2524698	2646058	2883830	portal,head,tRNA,transposase,terminase,integrase,protease,tail,plate,holin	Enterococcus_phage(22.86%)	112	2575779:2575794	2614728:2614743
AWV62444.1|2524698_2525658_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
AWV62445.1|2525808_2528511_-	alpha-mannosidase	NA	NA	NA	NA	NA
AWV62446.1|2528523_2529813_-	glycoside hydrolase family 125 protein	NA	NA	NA	NA	NA
AWV62447.1|2529962_2531009_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWV62448.1|2531010_2533164_+	alpha-mannosidase	NA	NA	NA	NA	NA
AWV62449.1|2533636_2535088_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AWV62450.1|2535084_2536809_-	sensor histidine kinase	NA	NA	NA	NA	NA
AWV62451.1|2536801_2537416_-	DUF624 domain-containing protein	NA	NA	NA	NA	NA
AWV62452.1|2537452_2537650_-	hypothetical protein	NA	NA	NA	NA	NA
AWV62453.1|2537760_2539218_-	DUF3502 domain-containing protein	NA	NA	NA	NA	NA
AWV62454.1|2539258_2540179_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
AWV62455.1|2540190_2541138_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AWV62456.1|2541616_2542336_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
AWV62457.1|2542384_2544031_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AWV62458.1|2544209_2544800_+	membrane protein	NA	NA	NA	NA	NA
AWV62459.1|2544891_2546397_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L- lysine ligase	NA	NA	NA	NA	NA
AWV62460.1|2546480_2547833_-	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
AWV62461.1|2547832_2548351_-	hypothetical protein	NA	NA	NA	NA	NA
AWV62462.1|2548366_2548693_-	PTS cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
AWV62463.1|2548705_2550685_-	PRD domain-containing protein	NA	NA	NA	NA	NA
AWV62464.1|2550705_2551020_-	PTS cellobiose transporter subunit IIB	NA	NA	NA	NA	NA
AWV62465.1|2551187_2551481_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AWV62466.1|2551558_2552671_-	FUSC family protein	NA	NA	NA	NA	NA
AWV62467.1|2553057_2553237_+	hypothetical protein	NA	NA	NA	NA	NA
AWV62468.1|2553230_2553443_+	hypothetical protein	NA	NA	NA	NA	NA
AWV62469.1|2553430_2553601_+	hypothetical protein	NA	NA	NA	NA	NA
AWV62841.1|2554024_2554765_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
AWV62842.1|2555190_2558232_-	hypothetical protein	NA	NA	NA	NA	NA
AWV62470.1|2559912_2561085_+|transposase	IS256 family transposase IS1542	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
AWV62471.1|2561500_2562262_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AWV62472.1|2562361_2564083_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.0	1.3e-37
AWV62473.1|2564097_2565882_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.2	2.1e-46
AWV62474.1|2566262_2567816_-	glycosyl hydrolase	NA	NA	NA	NA	NA
AWV62475.1|2568163_2570578_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	72.8	0.0e+00
AWV62476.1|2571004_2573023_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXE4	Bacillus_phage	39.6	5.8e-13
AWV62477.1|2573392_2574049_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AWV62478.1|2574048_2575005_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	57.4	3.3e-43
AWV62479.1|2575004_2575571_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	42.8	2.2e-34
2575779:2575794	attL	TTCAAATACAAATTGA	NA	NA	NA	NA
AWV62480.1|2576006_2576237_+	hypothetical protein	NA	NA	NA	NA	NA
AWV62481.1|2576242_2576542_+	hypothetical protein	NA	NA	NA	NA	NA
AWV62482.1|2576577_2576949_-	hypothetical protein	NA	NA	NA	NA	NA
AWV62483.1|2576950_2577352_-	hypothetical protein	NA	NA	NA	NA	NA
AWV62484.1|2577365_2577773_-	hypothetical protein	NA	NA	NA	NA	NA
AWV62485.1|2578695_2579858_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
AWV62486.1|2580797_2581823_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	2.1e-64
AWV62487.1|2581819_2582044_-|holin	holin	holin	NA	NA	NA	NA
AWV62488.1|2582040_2582334_-	hypothetical protein	NA	NA	NA	NA	NA
AWV62489.1|2582371_2582509_-	XkdX family protein	NA	NA	NA	NA	NA
AWV62490.1|2582510_2582942_-	hypothetical protein	NA	NA	NA	NA	NA
AWV62491.1|2582955_2583450_-	hypothetical protein	NA	NA	NA	NA	NA
AWV62492.1|2583449_2583899_-	hypothetical protein	NA	NA	NA	NA	NA
AWV62493.1|2583902_2584523_-	hypothetical protein	NA	NA	NA	NA	NA
AWV62494.1|2584522_2585431_-|plate	phage baseplate upper protein	plate	A0A1P8BKW9	Lactococcus_phage	24.3	1.1e-08
AWV62495.1|2585443_2588206_-	CHAP domain-containing protein	NA	Q9AZX5	Lactococcus_phage	39.5	1.1e-139
AWV62496.1|2588202_2588943_-|tail	phage tail protein	tail	NA	NA	NA	NA
AWV62843.1|2588932_2591722_-|tail	phage tail tape measure protein	tail	D7RWD8	Brochothrix_phage	38.9	5.4e-70
AWV62497.1|2591963_2592305_-	hypothetical protein	NA	NA	NA	NA	NA
AWV62498.1|2592304_2592913_-|tail	phage tail protein	tail	NA	NA	NA	NA
AWV62499.1|2592913_2593291_-	hypothetical protein	NA	NA	NA	NA	NA
AWV62500.1|2593292_2593688_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
AWV62501.1|2593680_2594052_-	hypothetical protein	NA	NA	NA	NA	NA
AWV62502.1|2594051_2594393_-	hypothetical protein	NA	NA	NA	NA	NA
AWV62503.1|2594404_2594620_-	hypothetical protein	NA	NA	NA	NA	NA
AWV62504.1|2594642_2595533_-	hypothetical protein	NA	NA	NA	NA	NA
AWV62505.1|2595547_2596249_-	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
AWV62506.1|2596167_2596359_-	hypothetical protein	NA	NA	NA	NA	NA
AWV62507.1|2596297_2596615_-	hypothetical protein	NA	NA	NA	NA	NA
AWV62844.1|2596616_2597495_-|head	phage head morphogenesis protein	head	NA	NA	NA	NA
AWV62508.1|2597586_2599116_-|portal	phage portal protein	portal	A0A0S2MVB2	Bacillus_phage	25.0	1.7e-28
AWV62509.1|2599127_2600543_-|terminase	terminase B	terminase	C9E2I7	Enterococcus_phage	79.4	1.4e-218
AWV62510.1|2600535_2601369_-|terminase	small subunit of terminase	terminase	D2IYW0	Enterococcus_phage	67.9	4.7e-78
AWV62511.1|2601527_2601758_-	hypothetical protein	NA	NA	NA	NA	NA
AWV62512.1|2602504_2602972_-	ArpU family transcriptional regulator	NA	D7RWH7	Brochothrix_phage	28.5	2.4e-07
AWV62845.1|2603046_2603487_-	transcriptional regulator	NA	D2IYV6	Enterococcus_phage	38.4	5.3e-20
AWV62513.1|2603516_2603810_-	hypothetical protein	NA	NA	NA	NA	NA
AWV62514.1|2603840_2604035_-	hypothetical protein	NA	NA	NA	NA	NA
AWV62515.1|2604140_2604593_-	hypothetical protein	NA	NA	NA	NA	NA
AWV62516.1|2604618_2605080_-	class I SAM-dependent methyltransferase	NA	A0A2H4PBJ4	Lactobacillus_phage	67.1	1.1e-60
AWV62517.1|2605080_2605284_-	hypothetical protein	NA	NA	NA	NA	NA
AWV62518.1|2605280_2606132_-	AAA family ATPase	NA	A0A0P0I3L9	Lactobacillus_phage	30.2	2.3e-27
AWV62519.1|2606146_2606947_-	replication protein	NA	B4XYS6	Lactobacillus_phage	54.9	3.0e-58
AWV62520.1|2606989_2607880_-	recombinase RecT	NA	D2IYT9	Enterococcus_phage	84.5	1.4e-136
AWV62521.1|2607881_2608823_-	endonuclease	NA	D2IZK1	Enterococcus_phage	79.2	1.0e-145
AWV62522.1|2609055_2609391_-	hypothetical protein	NA	NA	NA	NA	NA
AWV62523.1|2609716_2609905_-	hypothetical protein	NA	D2IZW5	Enterococcus_phage	60.3	7.4e-08
AWV62524.1|2609967_2610207_+	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	81.1	1.8e-27
AWV62525.1|2610203_2610359_-	hypothetical protein	NA	NA	NA	NA	NA
AWV62526.1|2610498_2610711_-	hypothetical protein	NA	NA	NA	NA	NA
AWV62527.1|2610713_2610926_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWV62528.1|2611200_2611611_+	XRE family transcriptional regulator	NA	Q5YAA4	Bacillus_phage	51.4	2.8e-31
AWV62529.1|2611623_2612076_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
AWV62846.1|2612514_2613447_+	DUF4041 domain-containing protein	NA	M1NRY5	Streptococcus_phage	53.8	1.8e-57
AWV62530.1|2613518_2614640_+|integrase	site-specific integrase	integrase	C9E2L6	Enterococcus_phage	38.5	4.0e-64
AWV62531.1|2614721_2616494_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	2.7e-54
2614728:2614743	attR	TTCAAATACAAATTGA	NA	NA	NA	NA
AWV62532.1|2616496_2618209_-	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	25.4	1.2e-14
AWV62533.1|2618323_2618992_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWV62534.1|2619058_2619847_-	esterase family protein	NA	NA	NA	NA	NA
AWV62535.1|2619929_2621402_-	MFS transporter	NA	NA	NA	NA	NA
AWV62536.1|2621531_2622725_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	72.0	1.3e-150
AWV62537.1|2628421_2628619_+	hypothetical protein	NA	NA	NA	NA	NA
AWV62538.1|2631034_2632531_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	40.9	8.7e-91
AWV62539.1|2632641_2633646_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
AWV62540.1|2633646_2634534_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
AWV62541.1|2634750_2636862_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	C7U047	Ostreococcus_tauri_virus	50.3	9.1e-110
AWV62542.1|2636951_2637497_-	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.3	4.1e-06
AWV62847.1|2637496_2638942_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	E3T4I1	Cafeteria_roenbergensis_virus	24.5	6.8e-08
AWV62543.1|2639061_2639532_-	RNA-binding protein S1	NA	NA	NA	NA	NA
AWV62544.1|2639577_2640003_-	septum formation initiator family protein	NA	NA	NA	NA	NA
AWV62545.1|2640069_2640339_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
AWV62546.1|2640349_2641945_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AWV62547.1|2641959_2645481_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
AWV62548.1|2645497_2646058_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
>prophage 12
CP020488	Enterococcus faecium strain CFSAN059071 chromosome, complete genome	2883830	2753151	2770047	2883830		Streptococcus_phage(92.86%)	18	NA	NA
AWV62650.1|2753151_2753466_+	DUF961 domain-containing protein	NA	A0A1S5SF38	Streptococcus_phage	53.4	1.0e-25
AWV62651.1|2753478_2753853_+	DUF961 domain-containing protein	NA	A0A1S5SF96	Streptococcus_phage	66.1	2.4e-34
AWV62652.1|2753853_2754198_+	damage-inducible protein J	NA	NA	NA	NA	NA
AWV62653.1|2754280_2755621_+	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	65.2	1.5e-163
AWV62654.1|2755698_2756373_+	zeta toxin family protein	NA	NA	NA	NA	NA
AWV62655.1|2756605_2757040_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1S5SDW2	Streptococcus_phage	77.1	6.5e-63
AWV62656.1|2757040_2757748_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1S5SEK0	Streptococcus_phage	50.4	5.8e-53
AWV62657.1|2757737_2758028_+	hypothetical protein	NA	NA	NA	NA	NA
AWV62658.1|2758286_2759471_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	61.6	2.9e-142
AWV62659.1|2759467_2759605_+	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
AWV62660.1|2760350_2762261_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
AWV62661.1|2762364_2762589_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.8	1.2e-23
AWV62662.1|2762601_2763105_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.9	9.2e-53
AWV62663.1|2763164_2763554_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	68.3	3.9e-43
AWV62664.1|2763540_2765988_+	ATP/GTP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	75.9	0.0e+00
AWV62665.1|2765992_2768116_+	FUSC family protein	NA	A0A1S5SF30	Streptococcus_phage	59.7	1.2e-181
AWV62666.1|2768112_2769117_+	peptidase P60	NA	A0A1S5SEZ8	Streptococcus_phage	63.5	5.6e-118
AWV62667.1|2769135_2770047_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	44.0	2.2e-65
>prophage 1
CP020489	Enterococcus faecium strain CFSAN059071 plasmid unnamed1, complete sequence	217014	2691	55756	217014	transposase,integrase	Bacillus_phage(28.57%)	50	13431:13448	56559:56576
AWV62854.1|2691_3861_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AWV62855.1|4333_4888_+|integrase	integrase	integrase	W8CYP1	Bacillus_phage	46.1	8.6e-36
AWV62856.1|5060_5534_-|integrase	integrase	integrase	A0A097PAS9	Streptococcus_pyogenes_phage	44.2	2.3e-13
AWV62857.1|5545_6082_+	glyoxalase	NA	NA	NA	NA	NA
AWV62858.1|6121_6493_+	glyoxalase	NA	NA	NA	NA	NA
AWV62859.1|6776_8048_+	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	45.0	4.1e-17
AWV62860.1|8292_9318_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AWV62861.1|9611_10721_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWV62862.1|11715_12540_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
AWV62863.1|12571_13882_+	alpha-glucosidase/alpha-galactosidase	NA	NA	NA	NA	NA
13431:13448	attL	AACAACAAATTAATGATT	NA	NA	NA	NA
AWV62864.1|14029_15289_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWV62865.1|15298_16171_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
AWV62866.1|16182_17013_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
AWV62867.1|17052_19236_+	alpha-galactosidase	NA	NA	NA	NA	NA
AWV62868.1|19296_20517_+	oligo-1,6-glucosidase	NA	NA	NA	NA	NA
AWV62869.1|20513_21974_+	sucrose phosphorylase	NA	NA	NA	NA	NA
AWV62870.1|23478_23688_+	DUF3173 domain-containing protein	NA	NA	NA	NA	NA
AWV62871.1|23680_23830_+|integrase	integrase	integrase	NA	NA	NA	NA
AWV62872.1|24932_26018_-	tyrosine recombinase XerS	NA	NA	NA	NA	NA
AWV62873.1|26351_26585_+	addiction module antitoxin	NA	NA	NA	NA	NA
AWV62874.1|26581_26989_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A0N9SKD8	Staphylococcus_phage	38.9	4.0e-14
AWV63056.1|27579_27783_-	hypothetical protein	NA	NA	NA	NA	NA
AWV62875.1|28125_28644_-	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
AWV62876.1|29010_29259_+	hypothetical protein	NA	NA	NA	NA	NA
AWV62877.1|29304_29496_+	fructokinase	NA	NA	NA	NA	NA
AWV62878.1|29761_30923_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
AWV62879.1|31421_31898_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
AWV62880.1|31910_33413_-	PTS glucose transporter subunit IIBC	NA	NA	NA	NA	NA
AWV62881.1|33426_34116_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
AWV62882.1|34276_35095_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AWV62883.1|35324_35555_+	resolvase	NA	NA	NA	NA	NA
AWV63057.1|35886_36120_-	hypothetical protein	NA	NA	NA	NA	NA
AWV62884.1|36140_36596_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.6	1.3e-13
AWV62885.1|36838_38264_+|transposase	IS3-like element ISEfa10 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.2	2.3e-48
AWV62886.1|38440_39736_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.1	1.0e-42
AWV62887.1|39756_39954_+	hypothetical protein	NA	NA	NA	NA	NA
AWV62888.1|39956_40919_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.8	2.3e-20
AWV62889.1|40920_42360_-	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.1	1.4e-16
AWV62890.1|42544_44491_+	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
AWV62891.1|44754_45627_+	ROK family protein	NA	NA	NA	NA	NA
AWV62892.1|47484_47955_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	33.6	1.5e-09
AWV62893.1|47999_48167_-	transcriptional regulator	NA	NA	NA	NA	NA
AWV62894.1|48200_48500_-	hypothetical protein	NA	NA	NA	NA	NA
AWV62895.1|48540_49158_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	33.1	5.1e-13
AWV62896.1|49482_49878_-	hypothetical protein	NA	NA	NA	NA	NA
AWV62897.1|49957_52309_-	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
AWV62898.1|52433_53123_-	hypothetical protein	NA	NA	NA	NA	NA
AWV62899.1|53136_53589_-	hypothetical protein	NA	NA	NA	NA	NA
AWV62900.1|53823_54965_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	57.7	3.8e-78
AWV62901.1|55075_55756_+|transposase	IS6 family transposase IS1216E	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
56559:56576	attR	AATCATTAATTTGTTGTT	NA	NA	NA	NA
>prophage 2
CP020489	Enterococcus faecium strain CFSAN059071 plasmid unnamed1, complete sequence	217014	69251	110507	217014	transposase,protease	Streptococcus_phage(45.45%)	35	NA	NA
AWV62917.1|69251_70874_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	47.3	1.4e-121
AWV62918.1|71159_72536_-	ABC transporter permease	NA	NA	NA	NA	NA
AWV62919.1|72535_73192_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	1.3e-22
AWV62920.1|73201_74479_-	ABC transporter permease	NA	NA	NA	NA	NA
AWV62921.1|74728_75890_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
AWV62922.1|75920_76370_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
AWV62923.1|76525_76876_-	hypothetical protein	NA	NA	NA	NA	NA
AWV62924.1|78055_78742_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	7.7e-127
AWV62925.1|78989_79847_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	30.7	8.1e-33
AWV62926.1|80408_80738_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
AWV62927.1|80814_81087_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
AWV62928.1|81086_81350_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AWV62929.1|82494_83670_-	MFS transporter	NA	NA	NA	NA	NA
AWV62930.1|83672_85922_-	alpha-galactosidase	NA	NA	NA	NA	NA
AWV62931.1|86971_88120_-|transposase	transposase	transposase	A0A288TXV8	Enterococcus_phage	93.4	1.2e-204
AWV62932.1|88136_88541_-|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
AWV62933.1|89847_90783_-	hypothetical protein	NA	NA	NA	NA	NA
AWV62934.1|91341_91659_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AWV62935.1|91659_91914_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
AWV62936.1|92272_92677_+|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
AWV62937.1|92693_93842_+|transposase	transposase	transposase	A0A288TXV8	Enterococcus_phage	93.7	9.0e-205
AWV62938.1|94548_94743_-	hypothetical protein	NA	NA	NA	NA	NA
AWV62939.1|96094_97135_+	replication protein RepA	NA	NA	NA	NA	NA
AWV62940.1|97958_98291_+	conjugal transfer protein TraE	NA	NA	NA	NA	NA
AWV62941.1|98909_99251_+	hypothetical protein	NA	F0PIH7	Enterococcus_phage	62.5	1.5e-35
AWV62942.1|99487_100738_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
AWV62943.1|101147_101387_+	hypothetical protein	NA	NA	NA	NA	NA
AWV62944.1|101453_101663_+	hypothetical protein	NA	NA	NA	NA	NA
AWV62945.1|101722_102394_+	class A sortase	NA	NA	NA	NA	NA
AWV62946.1|102446_104423_+	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
AWV62947.1|104435_105191_+	class C sortase	NA	NA	NA	NA	NA
AWV62948.1|105187_106012_+	hypothetical protein	NA	NA	NA	NA	NA
AWV62949.1|106021_106270_+	hypothetical protein	NA	NA	NA	NA	NA
AWV62950.1|106300_108412_+	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
AWV62951.1|108449_110507_-|protease	serine protease	protease	NA	NA	NA	NA
>prophage 3
CP020489	Enterococcus faecium strain CFSAN059071 plasmid unnamed1, complete sequence	217014	146867	181964	217014	transposase	Streptococcus_phage(36.36%)	35	NA	NA
AWV62992.1|146867_147554_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	98.7	2.9e-126
AWV62993.1|147601_148312_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWV62994.1|148295_149030_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWV62995.1|149246_150260_+	SIS domain-containing protein	NA	NA	NA	NA	NA
AWV62996.1|150270_150681_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
AWV62997.1|150680_151148_+	PTS mannose/fructose/sorbose transporter subunit IIB	NA	NA	NA	NA	NA
AWV62998.1|151165_151912_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
AWV62999.1|151911_152721_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
AWV63000.1|154683_155085_-	hypothetical protein	NA	A0A0N9S006	Staphylococcus_phage	49.2	2.5e-24
AWV63001.1|155311_156490_+|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	27.1	2.7e-23
AWV63002.1|156537_157275_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AWV63003.1|157432_158362_-	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	23.3	1.1e-06
AWV63004.1|158434_159046_-	VanZ family protein	NA	NA	NA	NA	NA
AWV63005.1|159261_160170_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
AWV63006.1|161628_162471_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AWV63007.1|162795_163212_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
AWV63008.1|163208_163679_+	PTS mannose/fructose/sorbose transporter subunit IIB	NA	NA	NA	NA	NA
AWV63009.1|163692_164466_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
AWV63010.1|164479_165292_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
AWV63011.1|165345_166311_+	SIS domain-containing protein	NA	NA	NA	NA	NA
AWV63012.1|166446_169170_+	PRD domain-containing protein	NA	NA	NA	NA	NA
AWV63013.1|169182_169815_+	HAD family phosphatase	NA	A0A1D8KNV9	Synechococcus_phage	27.9	3.0e-08
AWV63014.1|170019_170247_+	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
AWV63015.1|170243_170582_+	antitoxin	NA	NA	NA	NA	NA
AWV63016.1|170571_170841_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5SCV8	Streptococcus_phage	48.8	8.7e-18
AWV63017.1|171019_172321_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
AWV63018.1|172549_174097_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	1.7e-44
AWV63019.1|174198_174552_-	IS66 family insertion sequence hypothetical protein	NA	S5VXZ8	Leptospira_phage	38.7	5.7e-17
AWV63020.1|174541_174736_-	hypothetical protein	NA	NA	NA	NA	NA
AWV63021.1|174814_176107_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
AWV63022.1|176869_177838_+	SIS domain-containing protein	NA	NA	NA	NA	NA
AWV63023.1|177848_178664_+	fructoselysine 6-kinase	NA	NA	NA	NA	NA
AWV63024.1|178731_179442_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWV63025.1|179477_180719_+	hydrolase	NA	NA	NA	NA	NA
AWV63026.1|180776_181964_-|transposase	IS256 family transposase IS16	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
>prophage 1
CP020490	Enterococcus faecium strain CFSAN059071 plasmid unnamed2, complete sequence	49542	0	2672	49542		Enterococcus_phage(100.0%)	4	NA	NA
AWV63062.1|50_401_+	hypothetical protein	NA	NA	NA	NA	NA
AWV63063.1|811_1006_-	hypothetical protein	NA	NA	NA	NA	NA
AWV63064.1|1471_1747_-	type III secretion system protein PrgO	NA	NA	NA	NA	NA
AWV63065.1|1718_2672_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	26.1	7.7e-16
>prophage 2
CP020490	Enterococcus faecium strain CFSAN059071 plasmid unnamed2, complete sequence	49542	6819	14865	49542	transposase	Streptococcus_phage(33.33%)	8	NA	NA
AWV63069.1|6819_7506_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
AWV63070.1|8126_9299_-|transposase	IS256 family transposase IS1542	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
AWV63071.1|9450_10146_+	VanA-type vancomycin resistance DNA-binding response regulator VanR	NA	W8CYM9	Bacillus_phage	37.7	4.9e-36
AWV63072.1|10123_11278_+	VanA-type vancomycin resistance histidine kinase VanS	NA	W8CYF6	Bacillus_phage	23.3	1.5e-13
AWV63073.1|11492_12461_+	D-lactate dehydrogenase VanH-A	NA	M1HUW8	Acanthocystis_turfacea_Chlorella_virus	33.1	3.5e-40
AWV63074.1|12453_13485_+	D-alanine--(R)-lactate ligase VanA	NA	NA	NA	NA	NA
AWV63075.1|13490_14099_+	D-Ala-D-Ala dipeptidase VanX-A	NA	NA	NA	NA	NA
AWV63076.1|14178_14865_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
>prophage 3
CP020490	Enterococcus faecium strain CFSAN059071 plasmid unnamed2, complete sequence	49542	20235	47988	49542	transposase	Streptococcus_phage(70.0%)	30	NA	NA
AWV63082.1|20235_20853_+	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	36.6	2.9e-16
AWV63083.1|22483_23131_-	type A-7 chloramphenicol O-acetyltransferase	NA	A0A1X9I6V6	Streptococcus_phage	54.4	9.0e-69
AWV63084.1|23260_24199_-	replication initiation protein	NA	NA	NA	NA	NA
AWV63085.1|26040_26280_+	peptide-binding protein	NA	A0A1X9I6D5	Streptococcus_phage	81.5	6.8e-22
AWV63113.1|26328_26397_+	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
AWV63086.1|26434_27607_-|transposase	IS256 family transposase IS1542	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
AWV63087.1|27868_28606_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.2	3.1e-134
AWV63088.1|28610_28742_+	hypothetical protein	NA	E4ZFP9	Streptococcus_phage	100.0	7.9e-17
AWV63089.1|29106_30445_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
AWV63090.1|30557_31454_+	chromosome partitioning protein ParA	NA	A0A1X9I765	Streptococcus_phage	97.9	1.1e-152
AWV63091.1|31545_31761_+	peptide-binding protein	NA	A0A1X9I6D5	Streptococcus_phage	97.1	4.2e-31
AWV63092.1|31778_32051_+	antitoxin	NA	A0A1X9I6E5	Streptococcus_phage	96.7	5.4e-07
AWV63093.1|32052_32916_+	toxin zeta	NA	NA	NA	NA	NA
AWV63094.1|33687_34374_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	1.7e-126
AWV63095.1|34762_34987_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWV63096.1|35001_35871_+	nucleotidyltransferase domain-containing protein	NA	A0A1X9I6C9	Streptococcus_phage	90.7	6.7e-152
AWV63097.1|35851_36586_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	100.0	1.5e-141
AWV63098.1|36618_37527_+	aminoglycoside nucleotidyltransferase ANT(6)-Ia	NA	E4ZFP8	Streptococcus_phage	100.0	2.8e-177
AWV63099.1|38092_38779_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
AWV63100.1|38981_39194_+	hypothetical protein	NA	NA	NA	NA	NA
AWV63101.1|39355_39874_+	hypothetical protein	NA	NA	NA	NA	NA
AWV63102.1|39880_40393_+	hypothetical protein	NA	NA	NA	NA	NA
AWV63103.1|40496_41792_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.1	1.0e-42
AWV63104.1|42185_42809_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	30.1	1.8e-13
AWV63105.1|42898_43585_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
AWV63106.1|43782_44388_+	cell filamentation protein	NA	NA	NA	NA	NA
AWV63107.1|44403_44976_+	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	46.0	6.8e-36
AWV63108.1|45227_45485_-	hypothetical protein	NA	NA	NA	NA	NA
AWV63109.1|45610_46426_-	hypothetical protein	NA	NA	NA	NA	NA
AWV63110.1|46815_47988_+|transposase	IS256 family transposase IS1542	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
