The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027805	Lactobacillus reuteri strain WHH1689 chromosome, complete genome	2044184	16050	47974	2044184	protease,transposase	Bacillus_phage(27.27%)	38	NA	NA
AWD61383.1|16050_16518_-|transposase	transposase	transposase	NA	NA	NA	NA
AWD61384.1|16564_16939_-	hypothetical protein	NA	NA	NA	NA	NA
AWD61385.1|17294_17729_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWD61386.1|17816_18860_+	ABC transporter permease	NA	W8CYL7	Bacillus_phage	60.8	3.1e-26
AWD61387.1|19201_19909_+	PhoP family transcriptional regulator	NA	W8CYM9	Bacillus_phage	39.6	2.5e-40
AWD61388.1|19922_21788_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	34.7	3.2e-34
AWD61389.1|21765_23061_+	hypothetical protein	NA	NA	NA	NA	NA
AWD61390.1|23073_23916_+	hypothetical protein	NA	NA	NA	NA	NA
AWD61391.1|23933_24740_+	metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.1	3.3e-36
AWD61392.1|24842_26120_+|protease	serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.6	2.1e-21
AWD61393.1|26224_26722_+	phosphatidylglycerophosphatase	NA	A0A291I9Q0	Lactobacillus_phage	51.9	8.0e-41
AWD61394.1|27404_28787_+	RNA-directed DNA polymerase	NA	A0A0U4J920	Pseudomonas_phage	27.2	3.6e-30
AWD61395.1|28940_29327_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWD61396.1|29488_29842_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWD61397.1|30280_30790_+	50S rRNA methyltransferase	NA	NA	NA	NA	NA
AWD61398.1|30954_31152_+	hypothetical protein	NA	NA	NA	NA	NA
AWD61399.1|31225_31762_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
AWD61400.1|31980_33153_+	1,3-propanediol dehydrogenase	NA	NA	NA	NA	NA
AWD61401.1|33225_34002_-	sulfurtransferase	NA	NA	NA	NA	NA
AWD61402.1|34003_34309_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
AWD61403.1|34462_34834_+|transposase	transposase putative transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	52.2	9.8e-28
AWD61404.1|34806_35238_+|transposase	putative transposase for insertion sequence element IS6501	transposase	NA	NA	NA	NA
AWD61405.1|35230_35671_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
AWD61406.1|35971_36670_+	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AWD61407.1|36856_38251_+	hypothetical protein	NA	NA	NA	NA	NA
AWD61408.1|38264_38363_+	hypothetical protein	NA	NA	NA	NA	NA
AWD61409.1|38373_38529_+	hypothetical protein	NA	NA	NA	NA	NA
AWD61410.1|38540_39179_+	hypothetical protein	NA	NA	NA	NA	NA
AWD61411.1|39209_39389_+	hypothetical protein	NA	NA	NA	NA	NA
AWD61412.1|39515_39845_+	hypothetical protein	NA	NA	NA	NA	NA
AWD61413.1|39852_40527_+	hypothetical protein	NA	NA	NA	NA	NA
AWD61414.1|40711_41140_-	peroxiredoxin	NA	NA	NA	NA	NA
AWD61415.1|41207_42203_-	lactate dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	31.2	1.9e-33
AWD61416.1|42214_42664_-	aspartate aminotransferase	NA	NA	NA	NA	NA
AWD61417.1|43099_43393_-	aromatic amino acid aminotransferase	NA	NA	NA	NA	NA
AWD61418.1|43899_44121_+	hypothetical protein	NA	NA	NA	NA	NA
AWD61419.1|44238_46476_+|protease	ATP-dependent Clp protease ATP-binding protein	protease	H6X3M6	Enterobacteria_phage	38.6	2.1e-120
AWD61420.1|46642_47974_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.4	5.1e-50
>prophage 2
CP027805	Lactobacillus reuteri strain WHH1689 chromosome, complete genome	2044184	85012	123171	2044184	tRNA,integrase,transposase	Paenibacillus_phage(30.0%)	38	96873:96892	105453:105472
AWD61451.1|85012_85384_+|transposase	transposase putative transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.1	1.5e-28
AWD61452.1|85356_85788_+|transposase	putative transposase for insertion sequence element IS6501	transposase	NA	NA	NA	NA
AWD61453.1|86370_86928_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWD61454.1|87031_88219_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.3	5.2e-38
AWD61455.1|88231_88378_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWD61456.1|88443_88848_-	hypothetical protein	NA	NA	NA	NA	NA
AWD61457.1|88986_90528_+	poly(glycerol-phosphate) alpha-glucosyltransferase	NA	NA	NA	NA	NA
AWD61458.1|90529_92032_+	poly(glycerol-phosphate) alpha-glucosyltransferase	NA	NA	NA	NA	NA
AWD61459.1|92146_94081_+	hypothetical protein	NA	NA	NA	NA	NA
AWD61460.1|94241_94643_+	oligo-1,6-glucosidase	NA	NA	NA	NA	NA
AWD61461.1|94587_95934_+	oligo-1,6-glucosidase	NA	NA	NA	NA	NA
AWD61462.1|95951_97337_+	major facilitator transporter	NA	NA	NA	NA	NA
96873:96892	attL	CAAGCTGCCGGTAACTGGTA	NA	NA	NA	NA
AWD61463.1|97859_98549_+	RNA-directed DNA polymerase	NA	A0A0C5K882	ANMV-1_virus	26.4	2.2e-09
AWD61464.1|98558_99242_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
AWD61465.1|99327_102498_-	carbamoyl phosphate synthase large subunit	NA	NA	NA	NA	NA
AWD61466.1|102490_103579_-	carbamoylphosphate synthase small subunit	NA	NA	NA	NA	NA
AWD61467.1|104007_104931_+|integrase	integrase	integrase	H7BVY4	unidentified_phage	30.7	9.6e-32
AWD61468.1|105016_106390_-	major facilitator transporter	NA	NA	NA	NA	NA
105453:105472	attR	TACCAGTTACCGGCAGCTTG	NA	NA	NA	NA
AWD61469.1|106402_107476_-	LacI family transcription regulator	NA	NA	NA	NA	NA
AWD61470.1|107617_109021_-	RNA methyltransferase	NA	A0A2K5B251	Erysipelothrix_phage	36.2	5.0e-80
AWD61471.1|109091_109241_+	hypothetical protein	NA	NA	NA	NA	NA
AWD61472.1|109276_109849_+	NADPH-dependent FMN reductase	NA	A0A2P0ZL82	Lactobacillus_phage	45.7	1.1e-41
AWD61473.1|109848_111099_+	NADPH-dependent FMN reductase	NA	A0A2P0ZL77	Lactobacillus_phage	44.0	8.4e-39
AWD61474.1|111101_112004_+	thiamine biosynthesis lipoprotein ApbE	NA	NA	NA	NA	NA
AWD61475.1|111984_113187_-|transposase	transposase	transposase	A0A146ICT8	Staphylococcus_phage	50.2	6.8e-62
AWD61476.1|113304_113730_-|transposase	transposase	transposase	NA	NA	NA	NA
AWD61477.1|113992_114364_+|transposase	transposase putative transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	51.3	9.2e-26
AWD61478.1|114336_114768_+|transposase	putative transposase for insertion sequence element IS6501	transposase	NA	NA	NA	NA
AWD61479.1|114760_114991_-	hypothetical protein	NA	NA	NA	NA	NA
AWD61480.1|115024_115474_-	hypothetical protein	NA	NA	NA	NA	NA
AWD61481.1|115509_115746_-	hypothetical protein	NA	NA	NA	NA	NA
AWD61482.1|115813_115975_-	hypothetical protein	NA	NA	NA	NA	NA
AWD61483.1|116095_117478_-	hypothetical protein	NA	NA	NA	NA	NA
AWD61484.1|117988_118198_+	cell wall/surface protein	NA	NA	NA	NA	NA
AWD61485.1|118231_119602_+	cell wall/surface protein	NA	NA	NA	NA	NA
AWD61486.1|120136_120358_+	LPXTG-motif cell wall anchor domain protein	NA	NA	NA	NA	NA
AWD61487.1|121061_121229_-	hypothetical protein	NA	NA	NA	NA	NA
AWD61488.1|121863_123171_+|tRNA	seryl-tRNA synthetase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.1	2.3e-95
>prophage 3
CP027805	Lactobacillus reuteri strain WHH1689 chromosome, complete genome	2044184	282360	321938	2044184	tRNA,integrase,transposase	Pseudomonas_phage(16.67%)	36	277548:277563	330738:330753
277548:277563	attL	AATTAAACAGTATTCC	NA	NA	NA	NA
AWD61648.1|282360_282711_+|transposase	transposase	transposase	NA	NA	NA	NA
AWD61649.1|282858_282975_+|integrase	integrase	integrase	NA	NA	NA	NA
AWD61650.1|283030_283909_-|integrase	putative integrase	integrase	A0A1P8CWQ3	Bacillus_phage	36.4	2.0e-42
AWD61651.1|283932_284220_-	hypothetical protein	NA	NA	NA	NA	NA
AWD61652.1|284317_284662_+	glutaminase	NA	NA	NA	NA	NA
AWD61653.1|284705_285995_-	DltD domain protein	NA	NA	NA	NA	NA
AWD61654.1|285987_286227_-	cytochrome C552	NA	NA	NA	NA	NA
AWD61655.1|286246_287464_-	alanine transporter	NA	A0A125RNP0	Pseudomonas_phage	29.7	1.1e-22
AWD61656.1|287463_288990_-	D-alanine--poly(phosphoribitol) ligase	NA	A0A2K9KZV5	Tupanvirus	27.3	5.5e-40
AWD61657.1|289011_289152_-	cytochrome C554	NA	NA	NA	NA	NA
AWD61658.1|289482_289845_+	4'-phosphopantetheinyl transferase	NA	NA	NA	NA	NA
AWD61659.1|289845_290973_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	1.1e-29
AWD61660.1|290991_291366_+	growth inhibitor PemK	NA	A0A291I9M9	Lactobacillus_phage	36.0	2.1e-09
AWD61661.1|291557_291911_+	cytochrome C oxidase subunit III	NA	NA	NA	NA	NA
AWD61662.1|291950_292934_+	cytochrome C oxidase subunit III	NA	NA	NA	NA	NA
AWD61663.1|292924_294163_+	cytosine deaminase	NA	NA	NA	NA	NA
AWD61664.1|294547_295339_+	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
AWD61665.1|295447_296086_-	hypothetical protein	NA	NA	NA	NA	NA
AWD61666.1|296291_296852_+|tRNA	peptidyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AWD61667.1|296870_300410_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
AWD61668.1|300406_300679_+	hypothetical protein	NA	NA	NA	NA	NA
AWD61669.1|300779_301136_+	septation inhibitor protein	NA	NA	NA	NA	NA
AWD61670.1|301334_301829_+	RNA-binding protein	NA	NA	NA	NA	NA
AWD61671.1|301830_303225_+|tRNA	tRNA(Ile)-lysidine synthetase	tRNA	A0A0N7G7K4	Chrysochromulina_ericina_virus	27.1	2.8e-14
AWD61672.1|303217_303760_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	28.6	1.6e-10
AWD61673.1|303993_306102_+	cell division protein FtsH	NA	H8ZJI5	Ostreococcus_tauri_virus	48.4	4.6e-106
AWD61674.1|306192_307113_+	heat shock protein Hsp33	NA	NA	NA	NA	NA
AWD61675.1|307220_308222_+|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
AWD61676.1|308242_309760_+|tRNA	lysyl-tRNA synthetase	tRNA	A0A2K9KZX5	Tupanvirus	42.1	2.0e-90
AWD61677.1|310297_310609_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
AWD61678.1|310656_311679_+	RNA-directed DNA polymerase	NA	A0A0U4J920	Pseudomonas_phage	25.4	2.7e-19
AWD61679.1|317772_319059_+|transposase	transposase	transposase	NA	NA	NA	NA
AWD61680.1|319292_319505_+	hypothetical protein	NA	NA	NA	NA	NA
AWD61681.1|319562_320024_+	GNAT family acetyltransferase	NA	E9LUK4	Lactobacillus_phage	94.8	2.2e-77
AWD61682.1|320229_321390_+|transposase	transposase IS4 family protein	transposase	A0ZS58	Staphylococcus_virus	38.3	8.3e-65
AWD61683.1|321536_321938_+|transposase	transposase	transposase	NA	NA	NA	NA
330738:330753	attR	AATTAAACAGTATTCC	NA	NA	NA	NA
>prophage 4
CP027805	Lactobacillus reuteri strain WHH1689 chromosome, complete genome	2044184	454493	499345	2044184	integrase,protease,transposase	unidentified_phage(21.43%)	47	464137:464196	499387:499487
AWD61817.1|454493_455417_-|integrase	integrase	integrase	H7BVY4	unidentified_phage	31.0	1.9e-32
AWD61818.1|455616_456585_+|integrase	integrase	integrase	NA	NA	NA	NA
AWD61819.1|456750_456921_+	major facilitator superfamily MFS_1	NA	NA	NA	NA	NA
AWD61820.1|456917_457190_+	glycerol-3-phosphatase transporter	NA	NA	NA	NA	NA
AWD61821.1|457162_457627_+	glycerol-3-phosphatase transporter	NA	NA	NA	NA	NA
AWD61822.1|457626_458091_+	major facilitator superfamily MFS_1	NA	NA	NA	NA	NA
AWD61823.1|458286_458880_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	54.3	8.0e-56
AWD61824.1|459383_460391_+	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AWD61825.1|460481_461687_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
AWD61826.1|461805_462555_+	triosephosphate isomerase	NA	NA	NA	NA	NA
AWD61827.1|462645_463968_+	enolase	NA	A0A1X9I5Z8	Streptococcus_phage	69.9	8.9e-172
464137:464196	attL	GGCAGATTGTAAAATTTGAGTTGAACATTTAAGTGGACAGAAAAACCCATCAAGGTCTTT	NA	NA	NA	NA
AWD61828.1|464237_465161_+|integrase	integrase	integrase	H7BVY4	unidentified_phage	31.0	2.5e-32
AWD61829.1|465222_466605_+	alanine glycine permease	NA	NA	NA	NA	NA
AWD61830.1|466722_468273_+	ATP synthase F0 subunit A	NA	NA	NA	NA	NA
AWD61831.1|468339_468579_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
AWD61832.1|468657_469434_+	carboxylesterase	NA	NA	NA	NA	NA
AWD61833.1|469420_471820_+	exoribonuclease R	NA	Q0GXV6	Lactococcus_phage	38.5	2.6e-89
AWD61834.1|471837_472311_+	single-stranded DNA-binding protein	NA	W5RAM5	Staphylococcus_phage	54.4	5.3e-42
AWD61835.1|472367_472952_-	hypothetical protein	NA	NA	NA	NA	NA
AWD61836.1|473102_473792_+	uracil-DNA glycosylase	NA	A0A0A8IL23	Epstein-Barr_virus	48.7	1.7e-41
AWD61837.1|473852_474827_+	phosphotransacetylase	NA	NA	NA	NA	NA
AWD61838.1|474946_475405_+	ATP/GTP hydrolase	NA	NA	NA	NA	NA
AWD61839.1|475404_475914_+	GCN5 family acetyltransferase	NA	NA	NA	NA	NA
AWD61840.1|475945_476368_-	hypothetical protein	NA	NA	NA	NA	NA
AWD61841.1|476379_476916_-	DNA polymerase III subunit alpha	NA	A0A0K2SUJ2	Clostridium_phage	26.4	2.8e-07
AWD61842.1|477043_477940_+	UDP-N-acetylenolpyruvoylglucosamine reductase	NA	NA	NA	NA	NA
AWD61843.1|478272_479196_+	ribokinase	NA	NA	NA	NA	NA
AWD61844.1|479207_479603_+	ribose pyranase	NA	NA	NA	NA	NA
AWD61845.1|479623_480979_+	sugar:proton symporter	NA	NA	NA	NA	NA
AWD61846.1|481138_481990_+	membrane protein	NA	NA	NA	NA	NA
AWD61847.1|481973_482870_+	hypothetical protein	NA	NA	NA	NA	NA
AWD61848.1|482897_484253_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AWD61849.1|484461_486282_+	glucosamine--fructose-6-phosphate aminotransferase	NA	Q76DQ7	Chlorella_virus	36.5	1.4e-90
AWD61850.1|486542_486854_+	hypothetical protein	NA	NA	NA	NA	NA
AWD61851.1|486915_488781_+	acyltransferase 3	NA	C6ZR20	Salmonella_phage	27.8	1.4e-21
AWD61852.1|488791_489247_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWD61853.1|489251_490058_+	COF family hydrolase	NA	NA	NA	NA	NA
AWD61854.1|490380_490983_+	peptidoglycan-binding protein LysM	NA	A0A249XZV3	Enterococcus_phage	54.7	1.1e-28
AWD61855.1|491603_492323_+	PhoP family transcriptional regulator	NA	W8CYM9	Bacillus_phage	36.8	7.2e-35
AWD61856.1|492322_493810_+	signal transduction histidine kinase	NA	W8CYF6	Bacillus_phage	32.6	5.7e-34
AWD61857.1|493978_494839_+	sugar transporter	NA	NA	NA	NA	NA
AWD61858.1|494870_495485_-|transposase	transposase	transposase	NA	NA	NA	NA
AWD61859.1|495450_495825_-	hypothetical protein	NA	NA	NA	NA	NA
AWD61860.1|495977_496592_-	acetyltransferase	NA	NA	NA	NA	NA
AWD61861.1|496772_498131_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
AWD61862.1|498207_498438_+	hypothetical protein	NA	NA	NA	NA	NA
AWD61863.1|498421_499345_-|integrase	integrase	integrase	H7BVY4	unidentified_phage	31.0	1.5e-32
499387:499487	attR	AAAGACCTTGATGGGTTTTTCTGTCCACTTAAATGTTCAACTCAAATTTTACAATCTGCCGAATTTAAAATTTTGCATCGCCGTTTGTAAAATTAAGTTAG	NA	NA	NA	NA
>prophage 5
CP027805	Lactobacillus reuteri strain WHH1689 chromosome, complete genome	2044184	512702	558928	2044184	integrase,transposase	Paenibacillus_phage(36.36%)	49	558540:558599	568052:568172
AWD61882.1|512702_513671_-|integrase	integrase	integrase	NA	NA	NA	NA
AWD61883.1|514005_516618_+	hypothetical protein	NA	NA	NA	NA	NA
AWD61884.1|516774_517002_+	hypothetical protein	NA	NA	NA	NA	NA
AWD61885.1|517011_517830_-	hypothetical protein	NA	A0A0C5AEA5	Paenibacillus_phage	32.1	8.0e-22
AWD61886.1|517859_518573_-|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	35.2	1.9e-27
AWD61887.1|518735_519335_-	hypothetical protein	NA	NA	NA	NA	NA
AWD61888.1|519586_520360_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	35.2	2.1e-27
AWD61889.1|520389_521208_+	hypothetical protein	NA	A0A0C5AEA5	Paenibacillus_phage	32.1	8.0e-22
AWD61890.1|521284_522046_+	hypothetical protein	NA	NA	NA	NA	NA
AWD61891.1|522144_522666_+	hypothetical protein	NA	NA	NA	NA	NA
AWD61892.1|522781_523801_+	beta-lactamase	NA	NA	NA	NA	NA
AWD61893.1|524009_525242_+	arginine deiminase	NA	NA	NA	NA	NA
AWD61894.1|525352_525814_+	arginine repressor	NA	NA	NA	NA	NA
AWD61895.1|525834_527256_+	amino acid permease	NA	NA	NA	NA	NA
AWD61896.1|527313_528711_+	putative arginine/ornithine antiporter	NA	NA	NA	NA	NA
AWD61897.1|528775_528925_-	hypothetical protein	NA	NA	NA	NA	NA
AWD61898.1|528946_529072_+	hypothetical protein	NA	NA	NA	NA	NA
AWD61899.1|529092_529800_-	glutamine amidotransferase	NA	NA	NA	NA	NA
AWD61900.1|529799_531137_-	UDP-N-acetylmuramyl peptide synthase	NA	NA	NA	NA	NA
AWD61901.1|531366_531942_+	thymidine kinase	NA	C1KFH3	Lactobacillus_virus	53.5	1.0e-47
AWD61902.1|531957_533046_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	44.6	4.1e-05
AWD61903.1|533038_533905_+	N5-glutamine S-adenosyl-L-methionine-dependent methyltransferase	NA	NA	NA	NA	NA
AWD61904.1|533910_534939_+	translation factor Sua5	NA	S4VW33	Pandoravirus	39.8	1.5e-54
AWD61905.1|535052_536288_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.6	6.1e-98
AWD61906.1|536381_537017_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AWD61907.1|537146_538874_+	phosphoenolpyruvate-protein phosphotransferase	NA	NA	NA	NA	NA
AWD61908.1|538976_540092_+	membrane protein	NA	NA	NA	NA	NA
AWD61909.1|540088_540862_+	membrane protein	NA	NA	NA	NA	NA
AWD61910.1|541020_542292_+	uracil transporter	NA	Q9KX94	Enterobacteria_phage	36.5	4.4e-67
AWD61911.1|542605_543313_+	ATP synthase subunit A	NA	NA	NA	NA	NA
AWD61912.1|543337_543556_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
AWD61913.1|543598_544117_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
AWD61914.1|544106_544649_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
AWD61915.1|544680_546210_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
AWD61916.1|546245_547190_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
AWD61917.1|547217_548645_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
AWD61918.1|548656_549088_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
AWD61919.1|549363_550287_+|integrase	integrase	integrase	H7BVY4	unidentified_phage	31.0	1.9e-32
AWD61920.1|550382_550613_+	hypothetical protein	NA	NA	NA	NA	NA
AWD61921.1|550631_551948_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AWD61922.1|552054_553038_+	rod shape-determining protein MreB	NA	NA	NA	NA	NA
AWD61923.1|553313_553538_+	hypothetical protein	NA	NA	NA	NA	NA
AWD61924.1|553586_554780_+	cell division protein FtsW	NA	NA	NA	NA	NA
AWD61925.1|554792_555086_+	glycine cleavage system protein H	NA	NA	NA	NA	NA
AWD61926.1|555574_555886_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
AWD61927.1|555933_556956_+	RNA-directed DNA polymerase	NA	A0A0U4J920	Pseudomonas_phage	25.4	2.7e-19
AWD61928.1|557128_558265_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
558540:558599	attL	GTTAGAAAGAAAATAGTTGCTCATCAGTGACGTAAGACATGAATACTTCATATGGAGTTC	NA	NA	NA	NA
AWD61929.1|558540_558657_-|integrase	integrase	integrase	NA	NA	NA	NA
AWD61930.1|558661_558928_-|integrase	integrase	integrase	NA	NA	NA	NA
568052:568172	attR	GAACTCCATATGAAGTATTCATGTCTTACGTCACTGATGAGCAACTATTTTCTTTCTAACTTAAATTGACATTTCGGGGATATTAATAGCAGTCATTTCCTCGTCGCTTAATGTGAAGTCA	NA	NA	NA	NA
>prophage 6
CP027805	Lactobacillus reuteri strain WHH1689 chromosome, complete genome	2044184	668072	715426	2044184	tRNA,integrase,transposase	unidentified_phage(20.0%)	45	670969:671028	725712:725811
AWD62041.1|668072_668996_+|integrase	integrase	integrase	H7BVY4	unidentified_phage	31.0	1.9e-32
AWD62042.1|669260_669899_-	dithiol-disulfide isomerase	NA	NA	NA	NA	NA
AWD62043.1|670013_670628_-|transposase	transposase	transposase	NA	NA	NA	NA
AWD62044.1|670593_670968_-	hypothetical protein	NA	NA	NA	NA	NA
670969:671028	attL	TTGTGGTTTCCTTTCTTTTGTTTAGGGGTATTCAAAAGTCTACCACAAATGGCTTTTCTA	NA	NA	NA	NA
AWD62045.1|671140_671794_+	GTP pyrophosphokinase	NA	NA	NA	NA	NA
AWD62046.1|671797_672610_+	inorganic polyphosphate/ATP-NAD kinase	NA	NA	NA	NA	NA
AWD62047.1|672609_673515_+	23S rRNA pseudouridine synthase	NA	NA	NA	NA	NA
AWD62048.1|679652_680372_+|transposase	transposase	transposase	NA	NA	NA	NA
AWD62049.1|680378_680543_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62050.1|680829_681858_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62051.1|681972_682830_+	23S rRNA methyltransferase	NA	NA	NA	NA	NA
AWD62052.1|683002_683512_+	RNA methyltransferase	NA	NA	NA	NA	NA
AWD62053.1|683533_685864_+	cell division protein FtsK	NA	S5VNE3	Mycobacterium_phage	48.7	7.2e-84
AWD62054.1|685925_686045_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62055.1|686170_686527_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62056.1|686671_687100_+	cell division protein MraZ	NA	NA	NA	NA	NA
AWD62057.1|687115_688072_+	16S rRNA methyltransferase	NA	NA	NA	NA	NA
AWD62058.1|688068_688209_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62059.1|688079_688451_+	cell division protein FtsL	NA	NA	NA	NA	NA
AWD62060.1|688450_690610_+	penicillin-binding protein 2B	NA	NA	NA	NA	NA
AWD62061.1|690634_691606_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
AWD62062.1|691618_692989_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate synthetase	NA	NA	NA	NA	NA
AWD62063.1|692990_694103_+	UDP-diphospho-muramoylpentapeptide beta-N- acetylglucosaminyltransferase	NA	NA	NA	NA	NA
AWD62064.1|694130_694979_+	cell division protein FtsQ	NA	NA	NA	NA	NA
AWD62065.1|695099_696473_+	cell division protein FtsA	NA	NA	NA	NA	NA
AWD62066.1|696490_697738_+	cell division protein FtsZ	NA	NA	NA	NA	NA
AWD62067.1|697807_698224_+	cell division protein SepF	NA	NA	NA	NA	NA
AWD62068.1|698242_698503_+	membrane protein	NA	NA	NA	NA	NA
AWD62069.1|698525_699311_+	RNA-binding protein	NA	NA	NA	NA	NA
AWD62070.1|699332_700076_+	cell division protein DivIVA	NA	NA	NA	NA	NA
AWD62071.1|700316_703172_+|tRNA	isoleucyl-tRNA synthetase	tRNA	A0A2I2L3Y0	Orpheovirus	26.1	6.8e-84
AWD62072.1|703282_703486_+	cold-shock protein	NA	NA	NA	NA	NA
AWD62073.1|703498_704050_+	ADP-ribose pyrophosphatase	NA	NA	NA	NA	NA
AWD62074.1|704042_704312_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62075.1|704327_705023_+	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
AWD62076.1|705043_706198_+	cysteine desulfurase	NA	NA	NA	NA	NA
AWD62077.1|706184_706538_+	cysteine desulfurase	NA	NA	NA	NA	NA
AWD62078.1|706645_707779_+	thiouridylase	NA	NA	NA	NA	NA
AWD62079.1|707915_708572_+	phosphoglycerate mutase	NA	NA	NA	NA	NA
AWD62080.1|708584_709268_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62081.1|709289_711785_+	hypothetical protein	NA	A0A1P8DII4	Virus_Rctr197k	27.8	1.5e-47
AWD62082.1|711854_712829_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	33.7	7.3e-38
AWD62083.1|713021_713153_+|transposase	transposase	transposase	NA	NA	NA	NA
AWD62084.1|713229_714198_+|integrase	integrase	integrase	NA	NA	NA	NA
AWD62085.1|714235_715426_+|transposase	transposase	transposase	NA	NA	NA	NA
725712:725811	attR	TAGAAAAGCCATTTGTGGTAGACTTTTGAATACCCCTAAACAAAAGAAAGGAAACCACAAATGACTTACACCCATCTTACCACAAACGAGCTGACAATCA	NA	NA	NA	NA
>prophage 7
CP027805	Lactobacillus reuteri strain WHH1689 chromosome, complete genome	2044184	739042	767090	2044184	integrase,protease,transposase	Paenibacillus_phage(36.36%)	30	738614:738641	769420:769447
738614:738641	attL	TCGCCGTTTGTAAAATTAAGTTAGAAAA	NA	NA	NA	NA
AWD62110.1|739042_739657_+|transposase	transposase	transposase	NA	NA	NA	NA
AWD62111.1|739827_740109_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62112.1|740111_740885_+	fructose-1 6-bisphosphatase	NA	NA	NA	NA	NA
AWD62113.1|740991_742836_+	GTP-binding protein	NA	NA	NA	NA	NA
AWD62114.1|742930_744154_+	cell division protein FtsW	NA	NA	NA	NA	NA
AWD62115.1|744146_744431_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62116.1|744427_744991_+	rRNA methyltransferase	NA	NA	NA	NA	NA
AWD62117.1|744990_745512_+	phosphopantetheine adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	36.6	1.4e-24
AWD62118.1|745495_746548_+	peptidase	NA	NA	NA	NA	NA
AWD62119.1|746643_747276_+	competence protein ComEA	NA	NA	NA	NA	NA
AWD62120.1|747339_747825_+	competence protein ComE	NA	A7KUY9	Bacillus_phage	59.2	4.9e-35
AWD62121.1|748110_750102_+	DNA internalization-related competence protein ComEC	NA	Q332C0	Clostridium_botulinum_C_phage	33.7	1.0e-30
AWD62122.1|750071_751109_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
AWD62123.1|751166_751955_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	35.2	2.1e-27
AWD62124.1|751984_752614_+|integrase	integrase	integrase	A0A0C5AEA5	Paenibacillus_phage	33.3	9.5e-15
AWD62125.1|752850_753729_-|integrase	putative integrase	integrase	A0A1P8CWQ3	Bacillus_phage	36.4	2.0e-42
AWD62126.1|753752_754040_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62127.1|754253_754508_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
AWD62128.1|754770_755040_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
AWD62129.1|755220_756981_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
AWD62130.1|757116_758022_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62131.1|758200_759391_+	elongation factor Tu	NA	A0A1V0SGC3	Hokovirus	27.6	1.5e-32
AWD62132.1|759488_760664_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.5	1.7e-44
AWD62133.1|760822_761674_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	35.2	2.3e-27
AWD62134.1|761703_762522_+	hypothetical protein	NA	A0A0C5AEA5	Paenibacillus_phage	32.1	8.0e-22
AWD62135.1|762641_763370_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62136.1|763468_763990_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62137.1|764000_764120_-|transposase	transposase	transposase	NA	NA	NA	NA
AWD62138.1|764351_765662_+	trigger factor	NA	NA	NA	NA	NA
AWD62139.1|765839_767090_+|protease	ATP-dependent protease	protease	G3M9Z9	Bacillus_virus	59.2	1.8e-137
769420:769447	attR	TTTTCTAACTTAATTTTACAAACGGCGA	NA	NA	NA	NA
>prophage 9
CP027805	Lactobacillus reuteri strain WHH1689 chromosome, complete genome	2044184	845649	895417	2044184	tRNA,integrase,transposase	Staphylococcus_phage(11.76%)	48	861447:861461	880027:880041
AWD62219.1|845649_846636_+|tRNA	glycyl-tRNA synthase subunit alpha	tRNA	NA	NA	NA	NA
AWD62220.1|846637_848713_+|tRNA	glycine-tRNA synthetase subunit beta	tRNA	NA	NA	NA	NA
AWD62221.1|848847_850713_+	DNA primase	NA	I6P4U6	Helicobacter_phage	34.2	4.6e-49
AWD62222.1|850714_851857_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	36.6	1.5e-37
AWD62223.1|852057_853242_+	amino acid aminotransferase	NA	NA	NA	NA	NA
AWD62224.1|853380_854799_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62225.1|854918_855626_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWD62226.1|855612_856437_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62227.1|856461_857712_+	peptidase T	NA	NA	NA	NA	NA
AWD62228.1|857753_857957_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62229.1|858078_861426_+	DNA polymerase III DnaE	NA	R4TB75	Streptomyces_phage	33.0	6.6e-147
861447:861461	attL	AGTTAGAAAAAATAA	NA	NA	NA	NA
AWD62230.1|861611_863033_+	pyruvate kinase	NA	NA	NA	NA	NA
AWD62231.1|863174_864056_+	S1 RNA-binding protein	NA	NA	NA	NA	NA
AWD62232.1|864055_864949_+|integrase	integrase	integrase	A0A0K2CP59	Brevibacillus_phage	24.4	2.2e-20
AWD62233.1|864963_865320_+	reductase	NA	NA	NA	NA	NA
AWD62234.1|865312_866104_+	segregation and condensation protein A	NA	NA	NA	NA	NA
AWD62235.1|866066_866672_+	segregation protein A	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	30.3	1.1e-12
AWD62236.1|866671_867388_+	ribosomal large subunit pseudouridine synthase B	NA	NA	NA	NA	NA
AWD62237.1|867777_868356_+	membrane protein	NA	NA	NA	NA	NA
AWD62238.1|868431_868965_+|transposase	transposase	transposase	NA	NA	NA	NA
AWD62239.1|868964_869861_+|integrase	integrase	integrase	A0A1B1P773	Bacillus_phage	34.2	5.3e-35
AWD62240.1|869983_871009_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62241.1|870998_872438_+	ATP-dependent DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	39.5	2.8e-62
AWD62242.1|872522_873095_+	peptidoglycan-binding protein LysM	NA	NA	NA	NA	NA
AWD62243.1|873168_873855_+	cytidylate kinase	NA	NA	NA	NA	NA
AWD62244.1|873927_875178_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
AWD62245.1|875407_876721_+	GTP-binding protein Der	NA	NA	NA	NA	NA
AWD62246.1|876930_877206_+	transcriptional regulator	NA	A0A0H3UZA0	Geobacillus_virus	68.5	2.6e-25
AWD62247.1|877206_877518_-|transposase	transposase	transposase	NA	NA	NA	NA
AWD62248.1|877664_878825_-|transposase	transposase IS4 family protein	transposase	A0ZS58	Staphylococcus_virus	38.3	1.9e-64
AWD62249.1|879001_879970_-|integrase	integrase	integrase	NA	NA	NA	NA
AWD62250.1|880186_881452_+	hypothetical protein	NA	NA	NA	NA	NA
880027:880041	attR	TTATTTTTTCTAACT	NA	NA	NA	NA
AWD62251.1|881577_882789_+|tRNA	tRNA CCA-pyrophosphorylase	tRNA	G3MAR3	Bacillus_virus	39.7	5.0e-36
AWD62252.1|882790_884701_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	9.8e-55
AWD62253.1|884718_885681_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	60.6	1.0e-113
AWD62254.1|885696_886185_+	diacylglycerol kinase	NA	A0A1B2IBQ4	Erwinia_phage	38.4	4.8e-22
AWD62255.1|886173_886818_-	hemolysin III	NA	NA	NA	NA	NA
AWD62256.1|886997_887840_+	hypothetical protein	NA	A0A0N9SI50	Staphylococcus_phage	34.1	1.0e-16
AWD62257.1|888013_888940_+	GDSL family lipase	NA	NA	NA	NA	NA
AWD62258.1|888942_889545_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62259.1|889563_889785_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62260.1|889805_890678_+	ribosome biogenesis GTPase A	NA	NA	NA	NA	NA
AWD62261.1|890670_891462_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	36.1	1.3e-21
AWD62262.1|891539_891866_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62263.1|891819_892494_+|transposase	transposase	transposase	NA	NA	NA	NA
AWD62264.1|892568_893402_+	DNA processing protein DprA	NA	NA	NA	NA	NA
AWD62265.1|893642_894893_-|transposase	IS605 family transposase OrfB	transposase	A0A288TXV8	Enterococcus_phage	38.1	9.3e-54
AWD62266.1|894967_895417_+|transposase	transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.8	1.0e-31
>prophage 10
CP027805	Lactobacillus reuteri strain WHH1689 chromosome, complete genome	2044184	964072	1055110	2044184	integrase,holin,transposase	Bacillus_phage(14.81%)	97	1017454:1017477	1055513:1055536
AWD62342.1|964072_964813_+|holin	antiholin	holin	NA	NA	NA	NA
AWD62343.1|964840_965815_+	lactate dehydrogenase	NA	NA	NA	NA	NA
AWD62344.1|965889_966768_-	fructokinase	NA	NA	NA	NA	NA
AWD62345.1|966889_967909_-	LacI family transcription regulator	NA	NA	NA	NA	NA
AWD62346.1|968072_970262_+	alpha-galactosidase	NA	NA	NA	NA	NA
AWD62347.1|970308_970797_-	membrane protein	NA	NA	NA	NA	NA
AWD62348.1|970857_971901_-	isopentenyl pyrophosphate isomerase	NA	NA	NA	NA	NA
AWD62349.1|971919_973047_-	phosphomevalonate kinase	NA	NA	NA	NA	NA
AWD62350.1|973074_974046_-	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
AWD62351.1|974045_974996_-	mevalonate kinase	NA	NA	NA	NA	NA
AWD62352.1|975176_976559_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62353.1|976789_979654_+	XRE family transcriptional regulator	NA	A0A1X9I5C8	Streptococcus_phage	35.3	7.3e-62
AWD62354.1|979747_980266_+	peptidase	NA	NA	NA	NA	NA
AWD62355.1|980349_981054_+	DNA replication protein DnaD	NA	A0T2N5	Geobacillus_phage	32.3	2.0e-05
AWD62356.1|981076_981994_+	membrane protein	NA	NA	NA	NA	NA
AWD62357.1|982070_984335_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
AWD62358.1|984346_984961_-	recombination protein RecU	NA	A0A1C8E9C3	Bacillus_phage	36.0	2.0e-25
AWD62359.1|985078_985651_+	UPF0398 protein ypsA	NA	NA	NA	NA	NA
AWD62360.1|985722_986085_+	cell division protein GpsB	NA	NA	NA	NA	NA
AWD62361.1|986793_986994_+	NrdI family protein	NA	NA	NA	NA	NA
AWD62362.1|986990_987269_+	NrdI family protein	NA	NA	NA	NA	NA
AWD62363.1|987419_988574_+	RNA methyltransferase	NA	NA	NA	NA	NA
AWD62364.1|988758_989154_-	ribonuclease HI	NA	A0A1C3S7E2	Escherichia_phage	29.5	7.3e-05
AWD62365.1|989193_989586_+	VPDSG-CTERM exosortase interaction domain protein	NA	NA	NA	NA	NA
AWD62366.1|989586_990033_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
AWD62367.1|990036_990948_+	RNA pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.0	2.4e-11
AWD62368.1|991024_992110_+	carbamoyl phosphate synthase small subunit	NA	NA	NA	NA	NA
AWD62369.1|992106_994584_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
AWD62370.1|994632_996315_-	Fibronectin-binding A domain protein	NA	M1I5P2	Paramecium_bursaria_Chlorella_virus	38.0	1.2e-08
AWD62371.1|996524_997322_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62372.1|997420_997942_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62373.1|998108_998987_+	degV family protein	NA	A0A0N9SI50	Staphylococcus_phage	40.5	1.0e-14
AWD62374.1|998950_999625_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62375.1|1000117_1001500_+	RNA-directed DNA polymerase	NA	A0A0U4J920	Pseudomonas_phage	27.0	2.7e-30
AWD62376.1|1001924_1002209_+|transposase	transposase IS200-family protein	transposase	A0A1P8BMC0	Lactococcus_phage	43.9	7.6e-12
AWD62377.1|1002344_1003001_-	phosphohydrolase	NA	S4W232	Pandoravirus	25.6	1.4e-05
AWD62378.1|1003099_1003948_+	glycosyl transferase	NA	NA	NA	NA	NA
AWD62379.1|1003921_1004767_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWD62380.1|1004926_1005451_+	GNAT family acetyltransferase	NA	M1PSC3	Streptococcus_phage	31.6	4.3e-13
AWD62381.1|1005505_1006849_-	UPF0210 protein	NA	NA	NA	NA	NA
AWD62382.1|1006873_1007140_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62383.1|1007278_1008169_-	MFS transporter	NA	A0A2H4PQR8	Staphylococcus_phage	43.1	6.4e-57
AWD62384.1|1008226_1008760_-|transposase	transposase	transposase	NA	NA	NA	NA
AWD62385.1|1008806_1009181_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62386.1|1009764_1010184_+	cupin	NA	NA	NA	NA	NA
AWD62387.1|1010255_1010711_+	membrane protein	NA	NA	NA	NA	NA
AWD62388.1|1011003_1011708_-|transposase	transposase	transposase	A0A1X9I619	Streptococcus_phage	39.1	2.1e-42
AWD62389.1|1011737_1012223_-|transposase	transposase	transposase	NA	NA	NA	NA
AWD62390.1|1012475_1012754_-	putative permease	NA	NA	NA	NA	NA
AWD62391.1|1012772_1013858_-	DSBA oxidoreductase	NA	NA	NA	NA	NA
AWD62392.1|1014012_1014441_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AWD62393.1|1014500_1015862_-	hemolysin	NA	NA	NA	NA	NA
AWD62394.1|1016026_1016458_-|transposase	putative transposase for insertion sequence element IS6501	transposase	NA	NA	NA	NA
AWD62395.1|1016430_1016802_-|transposase	transposase putative transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	52.2	9.8e-28
AWD62396.1|1016895_1017462_+	2-octaprenylphenol hydroxylase	NA	C7U092	Ostreococcus_tauri_virus	40.9	8.8e-20
1017454:1017477	attL	CGTTTGTAAAATTAAGTTAGAAAA	NA	NA	NA	NA
AWD62397.1|1017538_1018507_+|integrase	integrase	integrase	NA	NA	NA	NA
AWD62398.1|1018571_1019672_+	2-octaprenylphenol hydroxylase	NA	NA	NA	NA	NA
AWD62399.1|1019675_1020491_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62400.1|1020542_1020935_-	glyoxalase	NA	NA	NA	NA	NA
AWD62401.1|1021042_1021420_+	camphor resistance protein CrcB	NA	NA	NA	NA	NA
AWD62402.1|1021412_1021751_+	camphor resistance protein CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	35.0	1.9e-09
AWD62403.1|1021766_1024280_+	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	31.7	3.4e-132
AWD62404.1|1024343_1025036_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62405.1|1025038_1026289_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62406.1|1026456_1028232_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AWD62407.1|1028360_1029170_+	cell wall anchor	NA	NA	NA	NA	NA
AWD62408.1|1029456_1030848_+	D-alanine/D-serine/glycine permease	NA	NA	NA	NA	NA
AWD62409.1|1030957_1031812_+	DNA-entry nuclease	NA	NA	NA	NA	NA
AWD62410.1|1031992_1034317_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62411.1|1034357_1034627_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62412.1|1034745_1035189_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62413.1|1035198_1035837_+	membrane protein	NA	NA	NA	NA	NA
AWD62414.1|1035911_1036775_+	hydrolase	NA	NA	NA	NA	NA
AWD62415.1|1036776_1036932_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62416.1|1037078_1037957_-|integrase	putative integrase	integrase	A0A1P8CWQ3	Bacillus_phage	36.1	1.3e-41
AWD62417.1|1037980_1038268_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62418.1|1038410_1038815_+	nucleoside deoxyribosyltransferase	NA	A0A0A7DMT2	Lactobacillus_phage	63.6	6.0e-47
AWD62419.1|1038890_1040273_-	RNA-directed DNA polymerase	NA	A0A0U4J920	Pseudomonas_phage	27.2	1.2e-30
AWD62420.1|1040787_1041606_-	HAD family hydrolase	NA	NA	NA	NA	NA
AWD62421.1|1041626_1041989_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62422.1|1042159_1043083_-|integrase	integrase	integrase	H7BVY4	unidentified_phage	31.0	2.5e-32
AWD62423.1|1043622_1044258_+|transposase	transposase	transposase	NA	NA	NA	NA
AWD62424.1|1044476_1045010_+|transposase	transposase	transposase	NA	NA	NA	NA
AWD62425.1|1045009_1045906_+|integrase	integrase	integrase	A0A1B1P773	Bacillus_phage	34.2	5.3e-35
AWD62426.1|1046207_1046807_+|transposase	transposase	transposase	NA	NA	NA	NA
AWD62427.1|1046803_1047649_+|integrase	integrase catalytic subunit	integrase	Q8W6R2	Burkholderia_virus	23.8	3.4e-07
AWD62428.1|1047880_1048207_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62429.1|1048211_1049069_-	alpha/beta hydrolase	NA	A0A088FQA2	Mycobacterium_phage	28.6	3.2e-13
AWD62430.1|1049315_1049963_+	DSBA oxidoreductase	NA	NA	NA	NA	NA
AWD62431.1|1050093_1050558_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62432.1|1050584_1051463_-|integrase	putative integrase	integrase	A0A1P8CWQ3	Bacillus_phage	36.4	2.0e-42
AWD62433.1|1051486_1051774_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62434.1|1051959_1052076_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62435.1|1052096_1052834_-	IstB ATP binding domain-containing protein	NA	A0A059NT77	Lactococcus_phage	46.7	1.6e-53
AWD62436.1|1052835_1054056_-|integrase	integrase catalytic subunit	integrase	A0A059NT83	Lactococcus_phage	44.0	2.6e-85
AWD62437.1|1054235_1054352_+|transposase	transposase	transposase	NA	NA	NA	NA
AWD62438.1|1054474_1055110_-|transposase	transposase	transposase	NA	NA	NA	NA
1055513:1055536	attR	TTTTCTAACTTAATTTTACAAACG	NA	NA	NA	NA
>prophage 11
CP027805	Lactobacillus reuteri strain WHH1689 chromosome, complete genome	2044184	1072068	1128346	2044184	integrase,transposase	Bacillus_phage(30.77%)	53	1119007:1119030	1129589:1129612
AWD62459.1|1072068_1072947_+|integrase	putative integrase	integrase	A0A1P8CWQ3	Bacillus_phage	36.4	2.0e-42
AWD62460.1|1072969_1073326_+	hydrolase	NA	NA	NA	NA	NA
AWD62461.1|1073342_1073990_+|integrase	integrase	integrase	D2XR58	Bacillus_phage	30.7	2.5e-18
AWD62462.1|1074214_1074535_+|transposase	transposase	transposase	NA	NA	NA	NA
AWD62463.1|1074500_1075115_+|transposase	transposase	transposase	NA	NA	NA	NA
AWD62464.1|1075189_1075870_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AWD62465.1|1076039_1077938_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62466.1|1077938_1078244_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62467.1|1078523_1078802_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
AWD62468.1|1079008_1079332_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
AWD62469.1|1079370_1080144_+	phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AWD62470.1|1080140_1080788_+	thiamine-phosphate pyrophosphorylase	NA	NA	NA	NA	NA
AWD62471.1|1080850_1082110_-	chloride channel protein	NA	NA	NA	NA	NA
AWD62472.1|1082267_1084574_-	alpha-glucosidase	NA	NA	NA	NA	NA
AWD62473.1|1084717_1085359_+	phosphoesterase	NA	NA	NA	NA	NA
AWD62474.1|1085455_1086412_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62475.1|1086547_1086655_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62476.1|1092646_1093654_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62477.1|1093841_1094123_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62478.1|1094238_1094487_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AWD62479.1|1094668_1095373_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
AWD62480.1|1095369_1095939_-	cell filamentation protein Fic	NA	S4TP71	Salmonella_phage	28.0	1.5e-06
AWD62481.1|1095931_1096345_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62482.1|1096475_1097399_+|integrase	integrase	integrase	H7BVY4	unidentified_phage	30.7	7.4e-32
AWD62483.1|1097513_1099772_-	5'-nucleotidase	NA	NA	NA	NA	NA
AWD62484.1|1099975_1100638_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62485.1|1101048_1101285_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62486.1|1101274_1104373_-	chromosome segregation protein SMC	NA	A0A0E3HXG6	Synechococcus_phage	25.3	8.9e-05
AWD62487.1|1104376_1105495_-	exonuclease SbcD subunit D	NA	J9PM68	Bacillus_phage	25.1	2.5e-05
AWD62488.1|1105648_1105816_-	glycoside hydrolase family 25	NA	A0A0A1ERA5	Lactobacillus_phage	67.3	2.5e-15
AWD62489.1|1105847_1106552_-	glycoside hydrolase family 25	NA	A0A0A1ERA5	Lactobacillus_phage	54.6	7.3e-72
AWD62490.1|1106735_1107659_-|integrase	integrase	integrase	H7BVY4	unidentified_phage	31.3	5.1e-33
AWD62491.1|1107763_1108540_-	tyrosine protein phosphatase	NA	NA	NA	NA	NA
AWD62492.1|1108636_1112122_-	DEAD/DEAH box helicase	NA	Q9YNZ9	Choristoneura_fumiferana_nuclear_polyhedrosis_virus	27.5	6.9e-38
AWD62493.1|1112186_1114037_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62494.1|1114219_1114462_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62495.1|1114461_1114836_+	MazF family transcriptional regulator	NA	NA	NA	NA	NA
AWD62496.1|1114946_1115204_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62497.1|1115282_1116686_-	amino acid transporter	NA	NA	NA	NA	NA
AWD62498.1|1116678_1117611_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
AWD62499.1|1118151_1118415_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62500.1|1118529_1118961_-	GepA protein	NA	NA	NA	NA	NA
1119007:1119030	attL	CGTTTGTAAAATTAAGTTAGAAAA	NA	NA	NA	NA
AWD62501.1|1119091_1120060_+|integrase	integrase	integrase	NA	NA	NA	NA
AWD62502.1|1120061_1120319_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62503.1|1120579_1121962_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62504.1|1122001_1122775_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	35.2	2.1e-27
AWD62505.1|1122804_1123623_+	hypothetical protein	NA	A0A0C5AEA5	Paenibacillus_phage	32.1	8.0e-22
AWD62506.1|1123820_1124291_+|transposase	transposase IS66	transposase	NA	NA	NA	NA
AWD62507.1|1124306_1124813_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AWD62508.1|1125094_1125634_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62509.1|1125646_1126831_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62510.1|1126814_1127375_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62511.1|1127467_1128346_-|integrase	putative integrase	integrase	A0A1P8CWQ3	Bacillus_phage	36.1	1.3e-41
1129589:1129612	attR	CGTTTGTAAAATTAAGTTAGAAAA	NA	NA	NA	NA
>prophage 12
CP027805	Lactobacillus reuteri strain WHH1689 chromosome, complete genome	2044184	1132325	1184616	2044184	integrase,transposase	Streptococcus_phage(23.08%)	54	1140485:1140501	1186142:1186158
AWD62517.1|1132325_1133027_-|transposase	transposase	transposase	NA	NA	NA	NA
AWD62518.1|1133209_1134430_+|integrase	integrase catalytic subunit	integrase	A0A059NT83	Lactococcus_phage	44.0	2.6e-85
AWD62519.1|1134431_1135169_+	IstB ATP binding domain-containing protein	NA	A0A059NT77	Lactococcus_phage	46.7	1.6e-53
AWD62520.1|1135212_1136001_-|transposase	transposase IS66	transposase	NA	NA	NA	NA
AWD62521.1|1136071_1136428_-|transposase	transposase	transposase	NA	NA	NA	NA
AWD62522.1|1136417_1136606_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62523.1|1136770_1137889_-	UDP-galactopuranose mutase	NA	E4ZFQ1	Streptococcus_phage	77.0	2.3e-168
AWD62524.1|1137891_1139283_-	heteropolysaccharide repeat unit export protein	NA	NA	NA	NA	NA
AWD62525.1|1139300_1140581_-	hypothetical protein	NA	NA	NA	NA	NA
1140485:1140501	attL	CACAAAATAAAAAGGCA	NA	NA	NA	NA
AWD62526.1|1140599_1141592_-	glycosyl transferase family 2	NA	NA	NA	NA	NA
AWD62527.1|1141581_1142577_-	glycosyl transferase family 2	NA	NA	NA	NA	NA
AWD62528.1|1142579_1143662_-	Glycosyltransferase	NA	NA	NA	NA	NA
AWD62529.1|1143737_1144778_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	39.3	8.5e-61
AWD62530.1|1144789_1145371_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A1D8EQH2	Escherichia_phage	41.7	2.5e-33
AWD62531.1|1145384_1146254_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	60.4	1.3e-102
AWD62532.1|1146265_1146916_-	multidrug MFS transporter	NA	NA	NA	NA	NA
AWD62533.1|1146938_1147685_-	exopolysaccharide biosynthesis protein	NA	A0A1X9I5D6	Streptococcus_phage	34.7	3.3e-22
AWD62534.1|1147697_1148573_-	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AWD62535.1|1148592_1149588_-	transcriptional regulator	NA	NA	NA	NA	NA
AWD62536.1|1150163_1150562_-	HxlR family transcriptional regulator	NA	NA	NA	NA	NA
AWD62537.1|1150667_1151192_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62538.1|1151328_1152504_-|transposase	transposase IS605	transposase	A0A0P0ICY9	Lactobacillus_phage	54.3	1.4e-112
AWD62539.1|1152503_1152848_-	hypothetical protein	NA	A0A286QN76	Streptococcus_phage	62.3	9.7e-38
AWD62540.1|1152992_1153211_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62541.1|1153427_1154003_+	RNA polymerase sigma24 factor	NA	NA	NA	NA	NA
AWD62542.1|1154012_1154249_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62543.1|1154290_1154794_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62544.1|1154847_1156350_-	glycerol kinase	NA	NA	NA	NA	NA
AWD62545.1|1156483_1156669_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
AWD62546.1|1156749_1158579_-	potassium transporter	NA	NA	NA	NA	NA
AWD62547.1|1158716_1160120_+	peptidase U34	NA	NA	NA	NA	NA
AWD62548.1|1160139_1161540_-	cell wall protein	NA	NA	NA	NA	NA
AWD62549.1|1161651_1162788_-	LPXTG-motif cell wall anchor domain protein	NA	NA	NA	NA	NA
AWD62550.1|1162759_1163191_-|transposase	putative transposase for insertion sequence element IS6501	transposase	NA	NA	NA	NA
AWD62551.1|1163163_1163535_-|transposase	transposase putative transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	52.2	9.8e-28
AWD62552.1|1163559_1164057_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62553.1|1164096_1164873_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62554.1|1165996_1167664_-	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	41.7	8.0e-53
AWD62555.1|1167677_1168241_-	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
AWD62556.1|1168340_1169222_-	serine dehydratase subunit alpha	NA	NA	NA	NA	NA
AWD62557.1|1169233_1169896_-	serine dehydratase	NA	NA	NA	NA	NA
AWD62558.1|1169967_1170606_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62559.1|1170839_1171109_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
AWD62560.1|1171254_1172106_-	metallophosphoesterase	NA	NA	NA	NA	NA
AWD62561.1|1172263_1173487_+	multidrug transporter	NA	NA	NA	NA	NA
AWD62562.1|1173507_1174215_+	ubiquinone/menaquinone biosynthesis methyltransferase	NA	NA	NA	NA	NA
AWD62563.1|1174290_1175673_-	RNA-directed DNA polymerase	NA	A0A0U4J920	Pseudomonas_phage	27.2	7.2e-31
AWD62564.1|1176154_1177054_-	1,4-dihydroxy-2-naphthoate prenyltransferase	NA	NA	NA	NA	NA
AWD62565.1|1177134_1178115_+	farnesyl pyrophosphate synthetase	NA	NA	NA	NA	NA
AWD62566.1|1178161_1180180_-	beta-galactosidase	NA	NA	NA	NA	NA
AWD62567.1|1180189_1180873_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AWD62568.1|1180923_1182111_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AWD62569.1|1182269_1183289_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AWD62570.1|1183692_1184616_+|integrase	integrase	integrase	H7BVY4	unidentified_phage	30.7	7.4e-32
1186142:1186158	attR	TGCCTTTTTATTTTGTG	NA	NA	NA	NA
>prophage 13
CP027805	Lactobacillus reuteri strain WHH1689 chromosome, complete genome	2044184	1337235	1542939	2044184	tail,integrase,capsid,protease,holin,terminase,tRNA,portal,head,transposase	Erysipelothrix_phage(23.29%)	220	1423086:1423145	1546831:1546844
AWD62745.1|1337235_1338009_+|transposase	transposase	transposase	NA	NA	NA	NA
AWD62746.1|1338200_1338833_+	deoxyadenosine kinase	NA	C1KFI3	Lactobacillus_virus	46.8	4.3e-47
AWD62747.1|1338871_1339891_-	mannosyl-glycoprotein endo-beta-N-acetylglucosamidase	NA	A0A249Y0X5	Enterococcus_phage	32.2	2.3e-10
AWD62748.1|1339999_1340497_-	universal stress protein A	NA	NA	NA	NA	NA
AWD62749.1|1340537_1341941_-	dipeptidase PepV	NA	NA	NA	NA	NA
AWD62750.1|1342029_1342890_+	carbohydrate kinase	NA	NA	NA	NA	NA
AWD62751.1|1342954_1344604_-	transporter	NA	NA	NA	NA	NA
AWD62752.1|1344718_1344982_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62753.1|1345044_1347465_-|tRNA	leucyl-tRNA synthetase	tRNA	A0A2H4PQS0	Staphylococcus_phage	68.1	0.0e+00
AWD62754.1|1347787_1348975_-	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	67.7	4.7e-148
AWD62755.1|1349135_1349675_-	3-methyladenine DNA glycosylase	NA	NA	NA	NA	NA
AWD62756.1|1349754_1351194_-	MFS transporter	NA	NA	NA	NA	NA
AWD62757.1|1351317_1351773_+	Fur family transcriptional regulator	NA	NA	NA	NA	NA
AWD62758.1|1351804_1353151_-	alanine glycine permease	NA	NA	NA	NA	NA
AWD62759.1|1353287_1353854_+	teicoplanin resistance protein VanZ	NA	NA	NA	NA	NA
AWD62760.1|1353865_1354033_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62761.1|1354201_1354726_+	membrane protein	NA	NA	NA	NA	NA
AWD62762.1|1354749_1355193_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62763.1|1355192_1356695_-	LytTR family transcriptional regulator	NA	Q6DMX4	Streptococcus_phage	27.4	4.4e-34
AWD62764.1|1356850_1358233_-	RNA-directed DNA polymerase	NA	A0A0C5K882	ANMV-1_virus	27.6	1.1e-20
AWD62765.1|1358731_1359163_-	heat shock protein Hsp20	NA	NA	NA	NA	NA
AWD62766.1|1359295_1360144_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62767.1|1360248_1360632_-	dihydropyrimidine dehydrogenase subunit B	NA	NA	NA	NA	NA
AWD62768.1|1360582_1361548_-	dihydropyrimidine dehydrogenase subunit B	NA	NA	NA	NA	NA
AWD62769.1|1361540_1362782_-	dihydropyrimidine dehydrogenase subunit A	NA	NA	NA	NA	NA
AWD62770.1|1363050_1363758_-	peptidoglycan-binding protein LysM	NA	A0A0E3XCL7	Enterococcus_phage	45.9	1.2e-26
AWD62771.1|1364097_1365798_-	phosphoenolpyruvate carboxykinase	NA	NA	NA	NA	NA
AWD62772.1|1365902_1366019_-|integrase	integrase	integrase	NA	NA	NA	NA
AWD62773.1|1366166_1366868_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62774.1|1367030_1367783_-	peptidoglycan-binding protein LysM	NA	NA	NA	NA	NA
AWD62775.1|1368165_1369056_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62776.1|1369067_1369646_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A0C5K925	Enterococcus_phage	59.7	3.6e-53
AWD62777.1|1369711_1371946_-	ribonucleoside triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	59.4	1.1e-249
AWD62778.1|1372340_1373738_+	EmrB/QacA family drug resistance transporter	NA	NA	NA	NA	NA
AWD62779.1|1373776_1374331_-	putative acetyltransferase	NA	NA	NA	NA	NA
AWD62780.1|1374944_1375106_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62781.1|1375130_1375346_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62782.1|1375342_1375624_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62783.1|1375786_1375882_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62784.1|1375952_1376141_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62785.1|1376130_1376487_+|transposase	transposase	transposase	NA	NA	NA	NA
AWD62786.1|1376557_1377346_+|transposase	transposase IS66	transposase	NA	NA	NA	NA
AWD62787.1|1377427_1378348_+|integrase	integrase catalytic subunit	integrase	A0A059NT83	Lactococcus_phage	48.7	8.0e-71
AWD62788.1|1378382_1378916_+|transposase	transposase	transposase	NA	NA	NA	NA
AWD62789.1|1378915_1379812_+|integrase	integrase	integrase	A0A1B1P773	Bacillus_phage	34.2	5.3e-35
AWD62790.1|1379906_1380179_+|integrase	integrase catalytic subunit	integrase	NA	NA	NA	NA
AWD62791.1|1380180_1380918_+	IstB ATP binding domain-containing protein	NA	A0A059NT77	Lactococcus_phage	46.7	1.6e-53
AWD62792.1|1381131_1381758_+|transposase	transposase	transposase	NA	NA	NA	NA
AWD62793.1|1381792_1382884_+|integrase	integrase	integrase	E9LUK6	Lactobacillus_phage	54.6	8.3e-99
AWD62794.1|1383033_1384401_+|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.8	4.0e-50
AWD62795.1|1390926_1391175_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62796.1|1391231_1392245_-	membrane protein	NA	NA	NA	NA	NA
AWD62797.1|1392244_1393273_-	glycosyltransferase	NA	NA	NA	NA	NA
AWD62798.1|1393275_1394493_-	1,2-diacylglycerol 3-glucosyltransferase	NA	NA	NA	NA	NA
AWD62799.1|1394726_1396457_-	phosphoenolpyruvate-protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.5	2.9e-13
AWD62800.1|1396456_1396723_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AWD62801.1|1396844_1397030_-	phospho-2-dehydro-3-deoxyheptonate aldolase	NA	NA	NA	NA	NA
AWD62802.1|1397163_1397289_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62803.1|1397305_1399510_+|protease	ATP-dependent Clp protease ATP-binding protein	protease	A0A223W0B1	Agrobacterium_phage	41.1	8.8e-124
AWD62804.1|1399733_1400144_+|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	54.1	2.9e-28
AWD62805.1|1400160_1400508_+|transposase	putative transposase for insertion sequence element IS6501	transposase	NA	NA	NA	NA
AWD62806.1|1400634_1401480_-|integrase	integrase catalytic subunit	integrase	Q8W6R2	Burkholderia_virus	24.1	1.3e-06
AWD62807.1|1401476_1401977_-|transposase	transposase	transposase	NA	NA	NA	NA
AWD62808.1|1402007_1402193_-|transposase	transposase	transposase	NA	NA	NA	NA
AWD62809.1|1402289_1402895_-	membrane protein	NA	NA	NA	NA	NA
AWD62810.1|1403013_1403535_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62811.1|1403633_1404395_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62812.1|1404621_1405347_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62813.1|1405520_1406381_+|transposase	transposase	transposase	NA	NA	NA	NA
AWD62814.1|1406479_1408057_+	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	26.1	4.8e-31
AWD62815.1|1408100_1409069_-|integrase	integrase	integrase	NA	NA	NA	NA
AWD62816.1|1409266_1410721_+	transcriptional regulator	NA	NA	NA	NA	NA
AWD62817.1|1410835_1412218_-	RNA-directed DNA polymerase	NA	A0A0U4J920	Pseudomonas_phage	27.0	4.6e-30
AWD62818.1|1412780_1413152_+|transposase	transposase putative transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	52.2	9.8e-28
AWD62819.1|1413124_1413556_+|transposase	putative transposase for insertion sequence element IS6501	transposase	NA	NA	NA	NA
AWD62820.1|1413589_1415146_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62821.1|1415138_1416257_-	membrane protein	NA	NA	NA	NA	NA
AWD62822.1|1416316_1418206_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62823.1|1418389_1419301_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62824.1|1419324_1420203_-|integrase	putative integrase	integrase	A0A1P8CWQ3	Bacillus_phage	36.4	2.0e-42
AWD62825.1|1420226_1420514_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62826.1|1420561_1422052_-	dextransucrase	NA	NA	NA	NA	NA
AWD62827.1|1422237_1422525_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62828.1|1422548_1423427_+|integrase	putative integrase	integrase	A0A1P8CWQ3	Bacillus_phage	36.4	2.0e-42
1423086:1423145	attL	CACAGTCGCCATATTAGCAAGCCATTAATCATGCACAGTGATCGTGGTAGTCAGTTTACG	NA	NA	NA	NA
AWD62829.1|1423523_1424600_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
1423086:1423145	attL	CACAGTCGCCATATTAGCAAGCCATTAATCATGCACAGTGATCGTGGTAGTCAGTTTACG	NA	NA	NA	NA
AWD62830.1|1424583_1425528_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62831.1|1425749_1426937_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.3	5.2e-38
AWD62832.1|1426933_1427677_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62833.1|1427669_1428716_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62834.1|1428771_1429239_-|holin	Choline binding protein A	holin	NA	NA	NA	NA
AWD62835.1|1429431_1430295_-	mannosyl-glycoprotein endo-beta-N-acetylglucosamidase	NA	NA	NA	NA	NA
AWD62836.1|1430344_1431313_-|integrase	integrase	integrase	NA	NA	NA	NA
AWD62837.1|1431500_1432448_-	glycosyl transferase	NA	NA	NA	NA	NA
AWD62838.1|1432450_1434313_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62839.1|1434403_1434997_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62840.1|1435079_1436279_-	hydrolase Nlp/P60	NA	A0A1W6DXV0	Rhodococcus_phage	44.0	1.2e-13
AWD62841.1|1436591_1437497_-	Mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase	NA	A0A059PAR2	Leuconostoc_phage	48.0	3.0e-30
AWD62842.1|1437456_1438065_-	Mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
AWD62843.1|1438218_1438956_-	IstB ATP binding domain-containing protein	NA	A0A059NT77	Lactococcus_phage	46.7	1.6e-53
AWD62844.1|1438957_1440178_-|integrase	integrase catalytic subunit	integrase	A0A059NT83	Lactococcus_phage	44.0	2.6e-85
AWD62845.1|1440481_1441729_+|transposase	transposase	transposase	Q6V7R1	Burkholderia_virus	23.9	6.7e-12
AWD62846.1|1441767_1442094_-|transposase	transposase	transposase	NA	NA	NA	NA
AWD62847.1|1442243_1443713_-	mannosyl-glycoprotein endo-beta-N-acetylglucosamidase	NA	A0A249Y0X5	Enterococcus_phage	51.0	4.0e-32
AWD62848.1|1443853_1444285_-|transposase	putative transposase for insertion sequence element IS6501	transposase	NA	NA	NA	NA
AWD62849.1|1444257_1444629_-|transposase	transposase putative transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.1	1.5e-28
AWD62850.1|1444846_1445824_+	family 2 glycosyl transferase	NA	NA	NA	NA	NA
AWD62851.1|1445832_1446891_-	galactofuranosyltransferase	NA	NA	NA	NA	NA
AWD62852.1|1446883_1447927_-	galactofuranosyltransferase	NA	NA	NA	NA	NA
AWD62853.1|1447926_1448955_-	beta-1,6-galactofuranosyltransferase	NA	NA	NA	NA	NA
AWD62854.1|1448954_1449968_-	nucleotide sugar synthetase-like protein	NA	NA	NA	NA	NA
AWD62855.1|1449995_1451066_-	membrane protein	NA	NA	NA	NA	NA
AWD62856.1|1451078_1452506_-	Polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AWD62857.1|1452644_1453763_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	77.6	2.7e-169
AWD62858.1|1453781_1454399_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AWD62859.1|1454395_1455592_-	polymerase	NA	NA	NA	NA	NA
AWD62860.1|1455619_1456267_-	multidrug MFS transporter	NA	NA	NA	NA	NA
AWD62861.1|1456278_1457208_-	glycosyl transferase family protein	NA	V5USA4	Oenococcus_phage	49.7	3.3e-80
AWD62862.1|1457225_1457993_-	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AWD62863.1|1458070_1458862_-	recombinase RecX	NA	NA	NA	NA	NA
AWD62864.1|1458963_1459179_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62865.1|1459200_1459428_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62866.1|1459478_1460369_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62867.1|1460649_1462155_-	amino acid transport protein	NA	NA	NA	NA	NA
AWD62868.1|1462513_1463131_+	amino acid permease	NA	NA	NA	NA	NA
AWD62869.1|1463224_1463908_+	amino acid permease	NA	NA	NA	NA	NA
AWD62870.1|1463923_1464088_+	aminotransferase	NA	NA	NA	NA	NA
AWD62871.1|1464091_1464742_+	aminotransferase	NA	NA	NA	NA	NA
AWD62872.1|1464767_1464914_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62873.1|1464833_1465049_+	aminotransferase	NA	NA	NA	NA	NA
AWD62874.1|1465113_1465971_-	methionine aminopeptidase	NA	NA	NA	NA	NA
AWD62875.1|1466084_1466543_+	flavodoxin	NA	NA	NA	NA	NA
AWD62876.1|1466535_1466979_+	membrane protein	NA	NA	NA	NA	NA
AWD62877.1|1467054_1468437_-	RNA-directed DNA polymerase	NA	A0A0U4J920	Pseudomonas_phage	27.2	1.2e-30
AWD62878.1|1468922_1470044_-	UDP-N-acetylglucosamine 2-epimerase	NA	NA	NA	NA	NA
AWD62879.1|1470255_1471557_-	helicase	NA	A0A1B1IS59	uncultured_Mediterranean_phage	30.3	9.4e-41
AWD62880.1|1471568_1472588_-	oxidoreductase	NA	NA	NA	NA	NA
AWD62881.1|1472748_1473111_+	membrane protein	NA	NA	NA	NA	NA
AWD62882.1|1473147_1473723_-	lysine decarboxylase	NA	NA	NA	NA	NA
AWD62883.1|1473727_1474651_-	malate dehydrogenase	NA	NA	NA	NA	NA
AWD62884.1|1474745_1476284_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AWD62885.1|1476420_1477437_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62886.1|1477441_1477897_-	N-acetyltransferase GCN5	NA	NA	NA	NA	NA
AWD62887.1|1478114_1478408_+	membrane protein	NA	NA	NA	NA	NA
AWD62888.1|1478287_1478740_+	membrane protein	NA	NA	NA	NA	NA
AWD62889.1|1478752_1478899_+	MFS transporter permease	NA	NA	NA	NA	NA
AWD62890.1|1479074_1479593_-|integrase	integrase	integrase	H7BVY4	unidentified_phage	33.5	1.5e-18
AWD62891.1|1479649_1479937_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62892.1|1479960_1480839_+|integrase	putative integrase	integrase	A0A1P8CWQ3	Bacillus_phage	36.4	2.0e-42
AWD62893.1|1480870_1481320_-|integrase	integrase	integrase	H7BVY4	unidentified_phage	27.8	1.7e-05
AWD62894.1|1481448_1481703_-	hydrophobic protein	NA	NA	NA	NA	NA
AWD62895.1|1481715_1482018_-	hydrophobic protein	NA	NA	NA	NA	NA
AWD62896.1|1482432_1482672_+	membrane protein	NA	NA	NA	NA	NA
AWD62897.1|1482761_1483685_+|integrase	integrase	integrase	H7BVY4	unidentified_phage	30.7	9.6e-32
AWD62898.1|1483831_1485157_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.0	2.9e-29
AWD62899.1|1485388_1486570_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.4	1.0e-25
AWD62900.1|1486735_1487200_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62901.1|1487245_1487797_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62902.1|1488124_1488448_-	multidrug transporter	NA	NA	NA	NA	NA
AWD62903.1|1488551_1489280_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62904.1|1489286_1489955_-|integrase	integrase	integrase	Q8W6R2	Burkholderia_virus	24.7	1.1e-05
AWD62905.1|1489951_1490131_-|transposase	transposase	transposase	NA	NA	NA	NA
AWD62906.1|1490127_1490262_-|transposase	transposase	transposase	NA	NA	NA	NA
AWD62907.1|1490258_1490726_-|transposase	transposase	transposase	NA	NA	NA	NA
AWD62908.1|1491018_1491993_-	riboflavin biosynthesis protein RibD	NA	NA	NA	NA	NA
AWD62909.1|1492164_1493229_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62910.1|1493361_1493673_-|transposase	transposase	transposase	A0A1P8CWQ3	Bacillus_phage	45.7	1.7e-17
AWD62911.1|1493702_1494479_+	hypothetical protein	NA	A0A2K5B2A8	Erysipelothrix_phage	52.3	1.1e-73
1493644:1494035	attR	CGTAAACTGACTACCACGATCACTGTGCATGATTAATGGCTTGCTAATATGGCGACTGTGTGATTGTTTCTGACCACCTACTTCATATTATCGACTTCAAATATGGGAAAGGTGTCCGAGTGGAAGCCAAGAATAATCCACAGATGAAGCTCTACGCCATTGGTGCCCTAGAAATGTTCGGTAACTTGTACAACGTTGGCGAAATCAAAACTACAATTTTTCAACCTCGCATGGCCAATATTAGTACTTGGAGGATTGATGCCAAGCAGCTCATACACTGGGCTAACACCGAACTCAAGCAAAAGGCTGAATTAGCTTTTTCTGGCAAAGGTACTATCCGTTATGGTCCCTGGTGCCAATTCTCTGCTTGTAATGCTGTGCTGCGAGCCCGA	NA	NA	NA	NA
AWD62912.1|1494480_1494807_+	hypothetical protein	NA	A0A2K5B2A9	Erysipelothrix_phage	66.3	1.8e-25
1493644:1494035	attR	CGTAAACTGACTACCACGATCACTGTGCATGATTAATGGCTTGCTAATATGGCGACTGTGTGATTGTTTCTGACCACCTACTTCATATTATCGACTTCAAATATGGGAAAGGTGTCCGAGTGGAAGCCAAGAATAATCCACAGATGAAGCTCTACGCCATTGGTGCCCTAGAAATGTTCGGTAACTTGTACAACGTTGGCGAAATCAAAACTACAATTTTTCAACCTCGCATGGCCAATATTAGTACTTGGAGGATTGATGCCAAGCAGCTCATACACTGGGCTAACACCGAACTCAAGCAAAAGGCTGAATTAGCTTTTTCTGGCAAAGGTACTATCCGTTATGGTCCCTGGTGCCAATTCTCTGCTTGTAATGCTGTGCTGCGAGCCCGA	NA	NA	NA	NA
AWD62913.1|1494861_1495284_+	DNA polymerase	NA	A0A2K5B2B0	Erysipelothrix_phage	62.6	3.4e-32
AWD62914.1|1495243_1496785_+	DNA polymerase	NA	A0A2K5B2B0	Erysipelothrix_phage	56.3	1.9e-173
AWD62915.1|1496869_1497256_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62916.1|1497257_1499144_+	hypothetical protein	NA	A0A1X9I6B6	Streptococcus_phage	48.7	2.6e-169
AWD62917.1|1499708_1499990_+	nuclease	NA	A0A1B0RXC4	Streptococcus_phage	52.2	1.1e-18
AWD62918.1|1499970_1501323_+	DEAD/DEAH box helicase	NA	A0A2K5B273	Erysipelothrix_phage	64.7	2.0e-150
AWD62919.1|1501319_1501787_+	restriction endonuclease	NA	NA	NA	NA	NA
AWD62920.1|1501942_1502101_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62921.1|1502430_1502973_+|terminase	terminase	terminase	A0A2K5B277	Erysipelothrix_phage	59.9	1.3e-57
AWD62922.1|1502972_1504199_+	lactate dehydrogenase	NA	A0A2I4R670	Erysipelothrix_phage	64.0	2.7e-154
AWD62923.1|1504271_1504892_+	hypothetical protein	NA	A0A2K5B280	Erysipelothrix_phage	41.7	7.9e-38
AWD62924.1|1504894_1505101_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62925.1|1505168_1506767_+|terminase	terminase	terminase	A0A2K5B285	Erysipelothrix_phage	76.9	6.0e-247
AWD62926.1|1506795_1508061_+|portal	portal protein	portal	A0A2K5B287	Erysipelothrix_phage	62.7	2.6e-152
AWD62927.1|1508057_1508729_+	peptidase	NA	E4ZFM4	Streptococcus_phage	51.3	1.5e-58
AWD62928.1|1508748_1509927_+|capsid	capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	58.0	2.3e-126
AWD62929.1|1509943_1510222_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62930.1|1510221_1510467_+|head,tail	head-tail adaptor	head,tail	NA	NA	NA	NA
AWD62931.1|1510598_1511012_+	primase	NA	A0A2K5B2A2	Erysipelothrix_phage	64.2	1.7e-41
AWD62932.1|1511008_1511308_+	1,4-beta-N-acetylmuramidase	NA	A0A2K9V3I9	Faecalibacterium_phage	38.8	4.8e-09
AWD62933.1|1511358_1511730_+|transposase	transposase putative transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.1	1.5e-28
AWD62934.1|1511702_1512134_+|transposase	putative transposase for insertion sequence element IS6501	transposase	NA	NA	NA	NA
AWD62935.1|1512220_1512742_+	1,4-beta-N-acetylmuramidase	NA	A0A2K5B2A3	Erysipelothrix_phage	40.0	2.1e-20
AWD62936.1|1512834_1513068_+	hypothetical protein	NA	NA	NA	NA	NA
AWD62937.1|1513103_1513703_+	serine recombinase	NA	D0R0F3	Streptococcus_phage	48.2	1.9e-44
AWD62938.1|1513715_1514720_+	serine recombinase	NA	A0A2K5B2B2	Erysipelothrix_phage	31.3	1.9e-41
AWD62939.1|1514712_1516290_+	serine recombinase	NA	A0A2K5B2B4	Erysipelothrix_phage	50.5	8.8e-134
AWD62940.1|1516313_1517513_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62941.1|1517623_1517764_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62942.1|1517878_1519255_-	RNA methyltransferase	NA	A0A2K5B251	Erysipelothrix_phage	53.3	1.6e-136
AWD62943.1|1519351_1520359_-	lipid kinase	NA	A0A1V0SBJ0	Catovirus	27.0	4.6e-19
AWD62944.1|1520376_1521801_-|tRNA	aspartyl/glutamyl-tRNA amidotransferase subunit B	tRNA	NA	NA	NA	NA
AWD62945.1|1521802_1523275_-|tRNA	aspartyl/glutamyl-tRNA amidotransferase subunit A	tRNA	NA	NA	NA	NA
AWD62946.1|1523274_1523592_-|tRNA	glutamyl-tRNA amidotransferase subunit C	tRNA	NA	NA	NA	NA
AWD62947.1|1523729_1525079_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62948.1|1525322_1526438_-	calcium-transporting ATPase	NA	NA	NA	NA	NA
AWD62949.1|1526441_1528484_-	NAD-dependent DNA ligase LigA	NA	A0A0A8J9A9	Ralstonia_phage	34.7	2.4e-99
AWD62950.1|1528502_1530776_-	ATP-dependent DNA helicase PcrA	NA	A7KV33	Bacillus_phage	43.2	9.4e-137
AWD62951.1|1530932_1532066_-	phosphoribosylaminoimidazole carboxylase	NA	NA	NA	NA	NA
AWD62952.1|1532082_1532658_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
AWD62953.1|1532675_1533302_-	N-acetylmuramidase	NA	S5M633	Brevibacillus_phage	48.3	4.0e-29
AWD62954.1|1533450_1534224_-	acetoin reductase	NA	NA	NA	NA	NA
AWD62955.1|1534338_1534734_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
AWD62956.1|1534747_1535191_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
AWD62957.1|1535358_1536708_-	hypothetical protein	NA	NA	NA	NA	NA
AWD62958.1|1536827_1537646_-	hypothetical protein	NA	A0A0C5AEA5	Paenibacillus_phage	32.1	8.0e-22
AWD62959.1|1537675_1538389_-|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	35.2	1.9e-27
AWD62960.1|1538567_1539332_-|tRNA	tRNA pseudouridine synthase A	tRNA	NA	NA	NA	NA
AWD62961.1|1539352_1540156_-	cobalt ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AWD62962.1|1540148_1541015_-	cobalt ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.6	2.5e-21
AWD62963.1|1540990_1541818_-	cobalt ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.1	5.6e-23
AWD62964.1|1541970_1542939_+|integrase	integrase	integrase	NA	NA	NA	NA
1546831:1546844	attR	AACTTCCTTGCTTT	NA	NA	NA	NA
>prophage 14
CP027805	Lactobacillus reuteri strain WHH1689 chromosome, complete genome	2044184	1557982	1590022	2044184	integrase,protease,transposase	Paenibacillus_phage(33.33%)	32	1562403:1562419	1582168:1582184
AWD62995.1|1557982_1558420_+|transposase	transposase	transposase	NA	NA	NA	NA
AWD62996.1|1558426_1558669_-|integrase	integrase	integrase	NA	NA	NA	NA
AWD62997.1|1558819_1559098_-|integrase	integrase	integrase	NA	NA	NA	NA
AWD62998.1|1559094_1559274_-|integrase	integrase	integrase	NA	NA	NA	NA
AWD62999.1|1559270_1559621_-|transposase	transposase putative transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	44.7	1.2e-14
AWD63000.1|1560214_1562302_-	elongation factor P	NA	E4ZFJ7	Streptococcus_phage	27.1	7.4e-64
1562403:1562419	attL	AAAACTAGTTAAATAAC	NA	NA	NA	NA
AWD63001.1|1562441_1562912_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
AWD63002.1|1562932_1563352_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
AWD63003.1|1563620_1564295_+	peptidase A24A	NA	NA	NA	NA	NA
AWD63004.1|1564334_1565510_-	ABC transporter permease	NA	NA	NA	NA	NA
AWD63005.1|1565619_1565994_+	hypothetical protein	NA	NA	NA	NA	NA
AWD63006.1|1565959_1566574_+|transposase	transposase	transposase	NA	NA	NA	NA
AWD63007.1|1566644_1570280_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.5	1.1e-65
AWD63008.1|1570323_1573932_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.2	1.5e-51
AWD63009.1|1574167_1574770_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWD63010.1|1575042_1577535_-|protease	Clp protease ClpX	protease	A0A2C9CXH0	Yersinia_phage	39.4	3.8e-123
AWD63011.1|1577549_1578017_-	CtsR family transcriptional regulator	NA	NA	NA	NA	NA
AWD63012.1|1578190_1579219_-	alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	29.4	2.9e-29
AWD63013.1|1579505_1579733_+	membrane protein	NA	NA	NA	NA	NA
AWD63014.1|1579686_1579932_+	membrane protein	NA	NA	NA	NA	NA
AWD63015.1|1579928_1580447_+	membrane protein	NA	NA	NA	NA	NA
AWD63016.1|1580461_1581430_-|integrase	integrase	integrase	NA	NA	NA	NA
AWD63017.1|1581530_1581662_+	hypothetical protein	NA	NA	NA	NA	NA
AWD63018.1|1581778_1581916_+	hypothetical protein	NA	NA	NA	NA	NA
AWD63019.1|1582399_1582591_-	hypothetical protein	NA	NA	NA	NA	NA
1582168:1582184	attR	GTTATTTAACTAGTTTT	NA	NA	NA	NA
AWD63020.1|1582750_1582960_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63021.1|1583168_1584047_-	homoserine kinase	NA	NA	NA	NA	NA
AWD63022.1|1584055_1585330_-	homoserine dehydrogenase	NA	NA	NA	NA	NA
AWD63023.1|1585427_1586921_+	threonine synthase	NA	NA	NA	NA	NA
AWD63024.1|1587636_1588278_-	deoxyadenosine kinase	NA	C1KFI3	Lactobacillus_virus	50.0	1.3e-56
AWD63025.1|1588400_1589219_-	hypothetical protein	NA	A0A0C5AEA5	Paenibacillus_phage	32.1	1.4e-21
AWD63026.1|1589248_1590022_-|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	35.2	2.1e-27
>prophage 15
CP027805	Lactobacillus reuteri strain WHH1689 chromosome, complete genome	2044184	1610037	1730916	2044184	tRNA,integrase,transposase	Paenibacillus_phage(24.0%)	129	1635787:1635817	1728693:1728793
AWD63049.1|1610037_1612623_+|tRNA	Lysyl-tRNA synthetase (class II)	tRNA	NA	NA	NA	NA
AWD63050.1|1612683_1613256_-	4-methyl-5(B-hydroxyethyl)-thiazole monophosphate biosynthesis protein	NA	NA	NA	NA	NA
AWD63051.1|1613268_1614252_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWD63052.1|1614300_1615809_-	MFS transporter	NA	NA	NA	NA	NA
AWD63053.1|1615936_1616590_-	DNA polymerase	NA	NA	NA	NA	NA
AWD63054.1|1616602_1617970_-	membrane protein	NA	NA	NA	NA	NA
AWD63055.1|1618025_1618913_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWD63056.1|1619079_1620501_-	2-oxoglutarate translocator	NA	NA	NA	NA	NA
AWD63057.1|1620573_1621785_-	cytochrome C	NA	A0A2P0ZL82	Lactobacillus_phage	35.5	4.6e-50
AWD63058.1|1621781_1621967_-	cytochrome C	NA	NA	NA	NA	NA
AWD63059.1|1622088_1623477_-	fumarate hydratase	NA	NA	NA	NA	NA
AWD63060.1|1623771_1625400_-	malate dehydrogenase	NA	NA	NA	NA	NA
AWD63061.1|1625536_1626439_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWD63062.1|1626654_1627875_+|transposase	transposase, IS116/IS110/IS902 family	transposase	A0A1X9I619	Streptococcus_phage	36.8	5.3e-70
AWD63063.1|1628163_1628757_-	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	41.4	7.3e-25
AWD63064.1|1628830_1629877_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
AWD63065.1|1629927_1631466_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63066.1|1631702_1632863_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	66.9	1.9e-146
AWD63067.1|1633043_1634441_+	hypothetical protein	NA	NA	NA	NA	NA
AWD63068.1|1634538_1635492_+|integrase	integrase	integrase	NA	NA	NA	NA
AWD63069.1|1635560_1635734_-	hypothetical protein	NA	NA	NA	NA	NA
1635787:1635817	attL	TGGCAGATTGCAAGAAATAACTTGAACGAAT	NA	NA	NA	NA
AWD63070.1|1635817_1636741_-|integrase	integrase	integrase	H7BVY4	unidentified_phage	31.0	1.9e-32
1635787:1635817	attL	TGGCAGATTGCAAGAAATAACTTGAACGAAT	NA	NA	NA	NA
AWD63071.1|1636937_1637975_+	aldose 1-epimerase	NA	NA	NA	NA	NA
AWD63072.1|1638051_1638240_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63073.1|1638314_1638491_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63074.1|1638690_1639944_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
AWD63075.1|1640128_1640926_+	penicillin-binding protein	NA	NA	NA	NA	NA
AWD63076.1|1641434_1642811_+	RNA-directed DNA polymerase	NA	A0A0U4J920	Pseudomonas_phage	26.7	1.1e-28
AWD63077.1|1642935_1644393_-	sucrose phosphorylase	NA	NA	NA	NA	NA
AWD63078.1|1644419_1645637_-	MFS family major facilitator transporter	NA	NA	NA	NA	NA
AWD63079.1|1646084_1647419_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63080.1|1647431_1648949_-	C4-dicarboxylate anaerobic carrier	NA	NA	NA	NA	NA
AWD63081.1|1649083_1650031_+	peroxidase	NA	NA	NA	NA	NA
AWD63082.1|1650052_1650913_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	35.2	2.3e-27
AWD63083.1|1650942_1651761_+	hypothetical protein	NA	A0A0C5AEA5	Paenibacillus_phage	32.1	8.0e-22
AWD63084.1|1651880_1652609_+	hypothetical protein	NA	NA	NA	NA	NA
AWD63085.1|1652707_1653229_+	hypothetical protein	NA	NA	NA	NA	NA
AWD63086.1|1653542_1655105_+	ABC transporter related protein	NA	A0A2I4R674	Erysipelothrix_phage	24.1	5.8e-21
AWD63087.1|1655105_1655822_-	esterase	NA	NA	NA	NA	NA
AWD63088.1|1656002_1657031_+	membrane protein	NA	NA	NA	NA	NA
AWD63089.1|1657112_1657649_-	NAD(P)H dehydrogenase	NA	NA	NA	NA	NA
AWD63090.1|1657739_1657844_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63091.1|1657846_1658761_-	cysteine synthase	NA	A0A1X9I5K7	Streptococcus_phage	41.8	1.5e-61
AWD63092.1|1659249_1659681_-|transposase	putative transposase for insertion sequence element IS6501	transposase	NA	NA	NA	NA
AWD63093.1|1659653_1660025_-|transposase	transposase putative transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	52.2	9.8e-28
AWD63094.1|1660029_1660998_+	ferrochelatase	NA	NA	NA	NA	NA
AWD63095.1|1661000_1661765_+	Mn2+/Fe2+ transporter, NRAMP family	NA	NA	NA	NA	NA
AWD63096.1|1661918_1662239_+	manganese transporter	NA	NA	NA	NA	NA
AWD63097.1|1662607_1663990_-	RNA-directed DNA polymerase	NA	A0A0U4J920	Pseudomonas_phage	27.2	1.2e-30
AWD63098.1|1664483_1665020_-	type 11 methyltransferase	NA	NA	NA	NA	NA
AWD63099.1|1665047_1665716_-	potassium transporter Trk	NA	NA	NA	NA	NA
AWD63100.1|1665708_1667052_-	ATP synthase subunit J	NA	NA	NA	NA	NA
AWD63101.1|1667206_1668979_+	hypothetical protein	NA	NA	NA	NA	NA
AWD63102.1|1669056_1669818_+	NADPH-flavin oxidoreductase	NA	NA	NA	NA	NA
AWD63103.1|1669814_1670954_-	beta-glucanase	NA	NA	NA	NA	NA
AWD63104.1|1670968_1672276_-	glycosyl transferase	NA	NA	NA	NA	NA
AWD63105.1|1672272_1672419_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63106.1|1672418_1673282_-	Hypothetical protein	NA	NA	NA	NA	NA
AWD63107.1|1673409_1674792_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63108.1|1675060_1676026_+	hypothetical protein	NA	NA	NA	NA	NA
AWD63109.1|1677108_1677813_-	PhoU family transcriptional regulator	NA	NA	NA	NA	NA
AWD63110.1|1677823_1678579_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.3	8.8e-15
AWD63111.1|1678589_1679471_-	phosphate ABC transporter permease	NA	NA	NA	NA	NA
AWD63112.1|1679470_1680370_-	phosphate ABC transporter permease	NA	NA	NA	NA	NA
AWD63113.1|1680374_1681247_-	phosphate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWD63114.1|1681372_1682083_+	regulator	NA	NA	NA	NA	NA
AWD63115.1|1682224_1683076_-|transposase	transposase	transposase	NA	NA	NA	NA
AWD63116.1|1683085_1683277_-|transposase	putative transposase	transposase	NA	NA	NA	NA
AWD63117.1|1683276_1683510_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63118.1|1683702_1684098_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63119.1|1684261_1685275_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63120.1|1685390_1685921_+	N-acetyltransferase GCN5	NA	NA	NA	NA	NA
AWD63121.1|1685972_1686311_-	transcriptional regulator	NA	NA	NA	NA	NA
AWD63122.1|1686389_1687007_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
AWD63123.1|1687191_1687761_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWD63124.1|1688158_1688875_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AWD63125.1|1688949_1689129_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AWD63126.1|1689368_1689641_+	hypothetical protein	NA	NA	NA	NA	NA
AWD63127.1|1689691_1689805_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63128.1|1689728_1689833_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63129.1|1689816_1690590_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63130.1|1690586_1690760_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63131.1|1690810_1691368_-	elongation factor P	NA	NA	NA	NA	NA
AWD63132.1|1691626_1692637_-	membrane protein	NA	NA	NA	NA	NA
AWD63133.1|1692584_1692737_-	membrane protein	NA	NA	NA	NA	NA
AWD63134.1|1693061_1693520_-|transposase	transposase	transposase	A0A1P8BMC0	Lactococcus_phage	36.3	1.6e-16
AWD63135.1|1693770_1694004_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63136.1|1693996_1696192_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63137.1|1696213_1699057_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63138.1|1699034_1702388_-	LPXTG-motif cell wall anchor domain protein	NA	NA	NA	NA	NA
AWD63139.1|1702571_1704230_-	bacterial surface protein	NA	NA	NA	NA	NA
AWD63140.1|1704392_1704737_-	lipoprotein	NA	NA	NA	NA	NA
AWD63141.1|1705028_1705154_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63142.1|1705405_1706269_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWD63143.1|1706384_1706861_-	S-ribosylhomocysteinase	NA	NA	NA	NA	NA
AWD63144.1|1707248_1707935_-	peptidase M10	NA	NA	NA	NA	NA
AWD63145.1|1708239_1708527_+	hypothetical protein	NA	NA	NA	NA	NA
AWD63146.1|1708550_1709429_+|integrase	putative integrase	integrase	A0A1P8CWQ3	Bacillus_phage	36.1	1.3e-41
AWD63147.1|1709460_1709895_-	sugar permease	NA	NA	NA	NA	NA
AWD63148.1|1710200_1711250_-	molecular chaperone GroES	NA	K7Z7U2	Megavirus	23.0	6.1e-06
AWD63149.1|1711607_1712531_+|integrase	integrase	integrase	H7BVY4	unidentified_phage	31.0	2.5e-32
AWD63150.1|1712588_1712915_+|transposase	transposase	transposase	NA	NA	NA	NA
1712532:1712562	attR	ATTCGTTCAAGTTATTTCTTGCAATCTGCCA	NA	NA	NA	NA
AWD63151.1|1712974_1713955_+|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.4	1.2e-43
1712532:1712562	attR	ATTCGTTCAAGTTATTTCTTGCAATCTGCCA	NA	NA	NA	NA
AWD63152.1|1714043_1714283_-	cytochrome B5	NA	NA	NA	NA	NA
AWD63153.1|1714377_1714848_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.2	1.6e-11
AWD63154.1|1715028_1715316_+	hypothetical protein	NA	NA	NA	NA	NA
AWD63155.1|1715495_1716083_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63156.1|1716149_1716266_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63157.1|1716578_1716929_+	hydrogenase expression protein	NA	NA	NA	NA	NA
AWD63158.1|1717124_1717748_+	hydrogenase expression protein	NA	NA	NA	NA	NA
AWD63159.1|1717845_1718811_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63160.1|1718888_1719431_-	N-acetyltransferase GCN5	NA	M1PSC3	Streptococcus_phage	27.6	6.7e-09
AWD63161.1|1719666_1720038_+	Mg2 transporter protein CorA family protein	NA	NA	NA	NA	NA
AWD63162.1|1720082_1720592_+	Mg2 transporter protein CorA family protein	NA	NA	NA	NA	NA
AWD63163.1|1720615_1721389_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	35.2	2.1e-27
AWD63164.1|1721418_1722237_+	hypothetical protein	NA	A0A0C5AEA5	Paenibacillus_phage	32.5	8.0e-22
AWD63165.1|1722309_1722705_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63166.1|1722789_1723584_-	peptidoglycan-binding protein LysM	NA	NA	NA	NA	NA
AWD63167.1|1723674_1723860_-	peptidoglycan-binding protein LysM	NA	NA	NA	NA	NA
AWD63168.1|1723952_1725113_-	MFS transporter	NA	NA	NA	NA	NA
AWD63169.1|1725497_1725995_+	hypothetical protein	NA	NA	NA	NA	NA
AWD63170.1|1726021_1726900_-|integrase	putative integrase	integrase	A0A1P8CWQ3	Bacillus_phage	36.4	2.0e-42
AWD63171.1|1726923_1727211_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63172.1|1727278_1727578_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63173.1|1727727_1728651_-|integrase	integrase	integrase	H7BVY4	unidentified_phage	31.3	5.1e-33
AWD63174.1|1728678_1728837_+	hypothetical protein	NA	NA	NA	NA	NA
AWD63175.1|1728969_1729842_-	rRNA methyltransferase	NA	NA	NA	NA	NA
AWD63176.1|1730140_1730512_+|transposase	transposase putative transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	52.2	9.8e-28
AWD63177.1|1730484_1730916_+|transposase	putative transposase for insertion sequence element IS6501	transposase	NA	NA	NA	NA
>prophage 16
CP027805	Lactobacillus reuteri strain WHH1689 chromosome, complete genome	2044184	1808560	1854751	2044184	tRNA,integrase,transposase	Bacillus_phage(23.08%)	49	1831979:1831995	1861886:1861902
AWD63257.1|1808560_1809067_+|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
AWD63258.1|1809154_1810591_+	peptidase U34 dipeptidase	NA	NA	NA	NA	NA
AWD63259.1|1810647_1812471_-	multidrug ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.0	1.7e-56
AWD63260.1|1812463_1814206_-	ABC transporter-like protein	NA	W8CYL7	Bacillus_phage	26.4	7.4e-41
AWD63261.1|1814375_1815380_+	D-isomer specific 2-hydroxyacid dehydrogenase NAD-binding protein	NA	M1H502	Paramecium_bursaria_Chlorella_virus	34.2	1.0e-50
AWD63262.1|1815448_1816156_-	glycerol transporter	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	30.1	2.2e-28
AWD63263.1|1816435_1817359_+|integrase	integrase	integrase	H7BVY4	unidentified_phage	31.0	1.9e-32
AWD63264.1|1817365_1817605_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63265.1|1817990_1818296_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63266.1|1818389_1819235_+	Xylose isomerase domain protein TIM barrel	NA	NA	NA	NA	NA
AWD63267.1|1819231_1820371_+	transporter	NA	NA	NA	NA	NA
AWD63268.1|1820428_1821394_+	hypothetical protein	NA	NA	NA	NA	NA
AWD63269.1|1821467_1822193_-|tRNA	tRNA synthetase subunit beta	tRNA	NA	NA	NA	NA
AWD63270.1|1822216_1822669_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWD63271.1|1822736_1823264_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63272.1|1823280_1823805_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63273.1|1823822_1824686_-	multidrug ABC transporter ATPase	NA	NA	NA	NA	NA
AWD63274.1|1824858_1826187_+	hemolysin	NA	NA	NA	NA	NA
AWD63275.1|1826298_1826766_+	ribonucleotide reductase	NA	NA	NA	NA	NA
AWD63276.1|1826814_1827240_-	3-demethylubiquinone-9 3-methyltransferase	NA	NA	NA	NA	NA
AWD63277.1|1827415_1828585_+	MFS transporter	NA	NA	NA	NA	NA
AWD63278.1|1828873_1830355_+	glucose-6-phosphate 1-dehydrogenase	NA	M4SP85	Cyanophage	36.7	1.3e-75
AWD63279.1|1830498_1831935_+	6-phosphogluconate dehydrogenase	NA	E3SPS4	Prochlorococcus_phage	31.1	8.2e-30
1831979:1831995	attL	TTTTTTATTTTAAATTT	NA	NA	NA	NA
AWD63280.1|1832059_1832311_+	hypothetical protein	NA	NA	NA	NA	NA
AWD63281.1|1832433_1834386_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AWD63282.1|1834615_1835080_-	universal stress protein UspA	NA	NA	NA	NA	NA
AWD63283.1|1835293_1835764_+	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AWD63284.1|1835804_1837118_-	proton glutamate symport protein	NA	NA	NA	NA	NA
AWD63285.1|1837367_1837979_+	alkaline phosphatase	NA	NA	NA	NA	NA
AWD63286.1|1838047_1839040_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	23.6	1.2e-11
AWD63287.1|1839077_1840529_-	peptidase S24	NA	NA	NA	NA	NA
AWD63288.1|1840555_1841734_-	galactokinase	NA	NA	NA	NA	NA
AWD63289.1|1841928_1842897_+	hypothetical protein	NA	NA	NA	NA	NA
AWD63290.1|1842926_1843709_+	protein tyrosine/serine phosphatase	NA	NA	NA	NA	NA
AWD63291.1|1843744_1844251_+	PEBP family protein	NA	NA	NA	NA	NA
AWD63292.1|1844264_1844489_+	hypothetical protein	NA	NA	NA	NA	NA
AWD63293.1|1844545_1844872_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63294.1|1844895_1846017_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63295.1|1846123_1846621_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
AWD63296.1|1846871_1847624_+	membrane protein	NA	A0A2H4PB74	Lactobacillus_phage	70.6	4.7e-93
AWD63297.1|1848334_1848937_+	hypothetical protein	NA	NA	NA	NA	NA
AWD63298.1|1848951_1849848_-|integrase	integrase	integrase	A0A1B1P773	Bacillus_phage	33.8	1.5e-34
AWD63299.1|1849847_1850378_-|transposase	transposase	transposase	NA	NA	NA	NA
AWD63300.1|1850483_1850915_-|transposase	putative transposase for insertion sequence element IS6501	transposase	NA	NA	NA	NA
AWD63301.1|1850887_1851259_-|transposase	transposase putative transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	52.2	9.8e-28
AWD63302.1|1851263_1851887_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	58.2	1.6e-54
AWD63303.1|1851944_1852910_+	hypothetical protein	NA	NA	NA	NA	NA
AWD63304.1|1853044_1853275_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AWD63305.1|1853827_1854751_-|integrase	integrase	integrase	H7BVY4	unidentified_phage	31.0	1.9e-32
1861886:1861902	attR	TTTTTTATTTTAAATTT	NA	NA	NA	NA
>prophage 17
CP027805	Lactobacillus reuteri strain WHH1689 chromosome, complete genome	2044184	1858627	1960987	2044184	tRNA,integrase,transposase	Streptococcus_phage(25.71%)	114	1850916:1850975	1968865:1969021
1850916:1850975	attL	ACATTCGGCGTTTTTTTTGCCCCAGTGGCCTTTTGATGCGCTCGAACGATCGTTGAATCT	NA	NA	NA	NA
AWD63310.1|1858627_1859161_+|transposase	transposase	transposase	NA	NA	NA	NA
1850916:1850975	attL	ACATTCGGCGTTTTTTTTGCCCCAGTGGCCTTTTGATGCGCTCGAACGATCGTTGAATCT	NA	NA	NA	NA
AWD63311.1|1859160_1860057_+|integrase	integrase	integrase	A0A1B1P773	Bacillus_phage	34.2	5.3e-35
AWD63312.1|1860071_1860341_-	XRE family transcriptional regulator	NA	A0A0S2MVM8	Bacillus_phage	40.0	8.2e-08
AWD63313.1|1860507_1860837_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	46.2	3.2e-06
AWD63314.1|1860839_1861838_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.8	2.5e-33
AWD63315.1|1861984_1863889_-	peptidase M13	NA	E3T4I7	Cafeteria_roenbergensis_virus	30.9	3.6e-73
AWD63316.1|1863962_1864256_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63317.1|1864259_1865552_-	peptidase	NA	A0A172JHT2	Bacillus_phage	26.0	1.5e-27
AWD63318.1|1865548_1866694_-	ATPase	NA	A0A097PAJ8	Delftia_phage	28.0	3.1e-11
AWD63319.1|1866697_1867123_-	3-methyladenine DNA glycosylase	NA	NA	NA	NA	NA
AWD63320.1|1867272_1867704_-|transposase	putative transposase for insertion sequence element IS6501	transposase	NA	NA	NA	NA
AWD63321.1|1867676_1868048_-|transposase	transposase putative transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	51.3	3.7e-27
AWD63322.1|1868098_1868185_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63323.1|1868247_1868619_+	hypothetical protein	NA	NA	NA	NA	NA
AWD63324.1|1868909_1869083_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63325.1|1869085_1869769_-	NAD(P)H dehydrogenase	NA	NA	NA	NA	NA
AWD63326.1|1869774_1870095_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63327.1|1870125_1871085_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63328.1|1871189_1871294_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63329.1|1871322_1872291_-|integrase	integrase	integrase	NA	NA	NA	NA
AWD63330.1|1872367_1873270_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63331.1|1873496_1873781_+	hypothetical protein	NA	NA	NA	NA	NA
AWD63332.1|1873863_1875219_-	amino acid transport protein	NA	NA	NA	NA	NA
AWD63333.1|1875221_1876130_-	proline iminopeptidase	NA	NA	NA	NA	NA
AWD63334.1|1876429_1877509_-	phosphoesterase	NA	NA	NA	NA	NA
AWD63335.1|1877644_1878880_+	hypothetical protein	NA	NA	NA	NA	NA
AWD63336.1|1879235_1880621_+	branched-chain amino acid transporter II carrier protein	NA	NA	NA	NA	NA
AWD63337.1|1880693_1881287_-	mannosyl-glycoprotein endo-beta-N-acetylglucosamidase	NA	S5M633	Brevibacillus_phage	49.0	9.9e-30
AWD63338.1|1881363_1882143_-	membrane protein	NA	NA	NA	NA	NA
AWD63339.1|1882183_1883725_-	ABC transporter ATP-binding protein	NA	Q6DMX7	Streptococcus_phage	25.9	1.3e-41
AWD63340.1|1883932_1884367_+	XRE family transcriptional regulator	NA	A0A1B0T6A7	Bacillus_phage	38.2	2.0e-08
AWD63341.1|1884363_1885116_-|transposase	transposase	transposase	NA	NA	NA	NA
AWD63342.1|1885521_1885746_+	DNA-binding protein	NA	NA	NA	NA	NA
AWD63343.1|1885714_1885855_+	hypothetical protein	NA	NA	NA	NA	NA
AWD63344.1|1885886_1886582_+	hypothetical protein	NA	NA	NA	NA	NA
AWD63345.1|1886591_1887410_-	hypothetical protein	NA	A0A0C5AEA5	Paenibacillus_phage	32.1	8.0e-22
AWD63346.1|1887439_1888153_-|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	35.2	1.9e-27
AWD63347.1|1888239_1888737_-	acetyltransferase	NA	NA	NA	NA	NA
AWD63348.1|1888796_1889219_-|transposase	transposase	transposase	NA	NA	NA	NA
AWD63349.1|1889226_1889706_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63350.1|1889859_1890198_+	hypothetical protein	NA	NA	NA	NA	NA
AWD63351.1|1890519_1890744_-	patatin family protein	NA	NA	NA	NA	NA
AWD63352.1|1891140_1892166_+	peptidase P60	NA	NA	NA	NA	NA
AWD63353.1|1892540_1893536_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWD63354.1|1893532_1894432_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWD63355.1|1894424_1895189_+	phosphonate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.2	2.3e-10
AWD63356.1|1895254_1895818_+	membrane protein	NA	NA	NA	NA	NA
AWD63357.1|1895865_1896195_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AWD63358.1|1896260_1897091_-	Gram-positive signal peptide protein, YSIRK family	NA	NA	NA	NA	NA
AWD63359.1|1897109_1897451_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWD63360.1|1897729_1899466_+	hypothetical protein	NA	A0ZS58	Staphylococcus_virus	39.2	9.8e-94
AWD63361.1|1899666_1900281_+|transposase	transposase	transposase	NA	NA	NA	NA
AWD63362.1|1900277_1901123_+	Transposase, IS3 family	NA	NA	NA	NA	NA
AWD63363.1|1901208_1902111_-	membrane protein	NA	M1Q1P6	Streptococcus_phage	39.6	9.1e-51
AWD63364.1|1902292_1903216_-|integrase	integrase	integrase	H7BVY4	unidentified_phage	30.7	7.4e-32
AWD63365.1|1903614_1904187_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63366.1|1904187_1905051_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63367.1|1905327_1906173_+	hypothetical protein	NA	NA	NA	NA	NA
AWD63368.1|1906166_1906283_+|integrase	integrase	integrase	NA	NA	NA	NA
AWD63369.1|1906331_1907846_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWD63370.1|1907899_1908292_-|transposase	transposase	transposase	NA	NA	NA	NA
AWD63371.1|1908310_1909186_-|transposase	transposase	transposase	NA	NA	NA	NA
AWD63372.1|1909273_1910239_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63373.1|1910528_1910900_+|transposase	transposase putative transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	52.2	9.8e-28
AWD63374.1|1910872_1911301_+|transposase	putative transposase for insertion sequence element IS6501	transposase	NA	NA	NA	NA
1910813:1911220	attR	AGATTCAACGATCGTTCGAGCGCATCAAAAGGCCACTGGGGCAAAAAAAACGCCGAATGTATGGTCGAAAATCAAGCTATTGGACTAAGTCGAGGTGGCCGAACGACCAAGATTCACGCACTCGTTGACGGATTAGGGAATCCCTTGGGTTTTCGCCTAACAGGTGGTCAAGTACATGATAGCCAAGTTGCCAGTGAGTTGCTGGAAGGCTTCGATATTTCTCAATCAAATATTATCGCGGATAAAGCCTATGGCACCGCGAAACTTCGCCAGTATATTAAAGATAAAGCAGCCGTCTATACCATTCCGCCAAAGGAAAATACCAAAGACAAGTGGACCTGTGATTACCACGTTTATTGTGAGCGCCATTTGATTGAGAACTTCTTCAATCAGTTGAAGAACTTTCGT	NA	NA	NA	NA
AWD63375.1|1911645_1912182_+|transposase	transposase	transposase	NA	NA	NA	NA
1910813:1911220	attR	AGATTCAACGATCGTTCGAGCGCATCAAAAGGCCACTGGGGCAAAAAAAACGCCGAATGTATGGTCGAAAATCAAGCTATTGGACTAAGTCGAGGTGGCCGAACGACCAAGATTCACGCACTCGTTGACGGATTAGGGAATCCCTTGGGTTTTCGCCTAACAGGTGGTCAAGTACATGATAGCCAAGTTGCCAGTGAGTTGCTGGAAGGCTTCGATATTTCTCAATCAAATATTATCGCGGATAAAGCCTATGGCACCGCGAAACTTCGCCAGTATATTAAAGATAAAGCAGCCGTCTATACCATTCCGCCAAAGGAAAATACCAAAGACAAGTGGACCTGTGATTACCACGTTTATTGTGAGCGCCATTTGATTGAGAACTTCTTCAATCAGTTGAAGAACTTTCGT	NA	NA	NA	NA
AWD63376.1|1912197_1913511_+|transposase	transposase ISLasa4v	transposase	A0A1S5SBP9	Streptococcus_phage	29.8	3.5e-43
AWD63377.1|1913598_1915635_-	potassium uptake protein	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	33.6	6.1e-63
AWD63378.1|1916022_1917405_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63379.1|1917567_1917693_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63380.1|1917608_1917728_+|transposase	transposase	transposase	NA	NA	NA	NA
AWD63381.1|1917831_1918377_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63382.1|1918456_1920175_-|transposase	transposase	transposase	A0ZS58	Staphylococcus_virus	39.7	2.2e-98
AWD63383.1|1920297_1920471_-	putative MucBP binding domain protein	NA	NA	NA	NA	NA
AWD63384.1|1920776_1921982_+	multidrug transporter MatE	NA	NA	NA	NA	NA
AWD63385.1|1922168_1922486_-	thiol-disulfide isomerase	NA	A0A1X9I9P5	Staphylococcus_phage	37.8	4.6e-18
AWD63386.1|1922487_1923243_-	membrane protein	NA	S5MAL1	Bacillus_phage	41.8	7.1e-41
AWD63387.1|1923261_1924182_-	pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	26.6	1.8e-09
AWD63388.1|1924328_1925246_+	cobalt transporter	NA	NA	NA	NA	NA
AWD63389.1|1925537_1926506_-|integrase	integrase	integrase	NA	NA	NA	NA
AWD63390.1|1926548_1927181_-	peptidase C69	NA	NA	NA	NA	NA
AWD63391.1|1927363_1927798_-	peptidase C69	NA	NA	NA	NA	NA
AWD63392.1|1928166_1929495_+	xanthine permease	NA	Q9KX94	Enterobacteria_phage	30.3	1.5e-33
AWD63393.1|1929806_1931216_+	sodium:proton antiporter	NA	NA	NA	NA	NA
AWD63394.1|1931258_1931819_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63395.1|1931820_1932402_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63396.1|1932413_1932758_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63397.1|1932975_1933629_-	fructose-2,6-bisphosphatase	NA	NA	NA	NA	NA
AWD63398.1|1933760_1934024_+	hypothetical protein	NA	NA	NA	NA	NA
AWD63399.1|1934149_1936279_+	alkaline phosphatase	NA	W6LM83	Streptococcus_phage	45.7	3.7e-159
AWD63400.1|1936436_1937558_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
AWD63401.1|1937630_1938449_-	hypothetical protein	NA	A0A0C5AEA5	Paenibacillus_phage	32.1	8.0e-22
AWD63402.1|1938478_1939192_-|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	35.2	1.9e-27
AWD63403.1|1939485_1940706_+|transposase	transposase, IS116/IS110/IS902 family	transposase	A0A1X9I619	Streptococcus_phage	36.8	2.0e-69
AWD63404.1|1940993_1941818_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWD63405.1|1941915_1942671_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
AWD63406.1|1942671_1943127_-	putative D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
AWD63407.1|1943344_1944103_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63408.1|1944217_1945636_+	hypothetical protein	NA	NA	NA	NA	NA
AWD63409.1|1945862_1946444_+	hypothetical protein	NA	NA	NA	NA	NA
AWD63410.1|1946642_1947284_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63411.1|1947646_1948879_+|transposase	IS116/IS110/IS902 family transposase	transposase	M1NSC9	Streptococcus_phage	48.2	6.1e-82
AWD63412.1|1949104_1950028_-|integrase	integrase	integrase	H7BVY4	unidentified_phage	31.0	1.9e-32
AWD63413.1|1950214_1950853_+	carbohydrate kinase	NA	NA	NA	NA	NA
AWD63414.1|1950956_1951451_+	hypothetical protein	NA	NA	NA	NA	NA
AWD63415.1|1951568_1952846_-|tRNA	histidyl-tRNA synthase	tRNA	NA	NA	NA	NA
AWD63416.1|1953167_1954364_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	35.5	4.4e-53
AWD63417.1|1954365_1954986_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63418.1|1955211_1955397_+	hypothetical protein	NA	NA	NA	NA	NA
AWD63419.1|1955528_1956473_-	LacI family transcription regulator	NA	C6ZCU4	Enterobacteria_phage	26.5	3.8e-15
AWD63420.1|1956899_1958612_+	mannosyl-glycoprotein endo-beta-N-acetylglucosamidase	NA	A0A249Y0X5	Enterococcus_phage	40.9	5.6e-25
AWD63421.1|1958775_1959093_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AWD63422.1|1959197_1959434_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63423.1|1959766_1960987_-|transposase	transposase, IS116/IS110/IS902 family	transposase	A0A1X9I619	Streptococcus_phage	37.0	1.4e-70
1968865:1969021	attR	CAAATGACTTACACCCATCTTACCACAAACGAGCTGACAATCATCGCCCATTCTTTCGTGCAAAAGCTTAAAGCGTACCGAGTGGCCCAAATGATCAACCGTTGCGCCGAAACCGTTTATCGCGTTTATCGTTACCTGGAAACCGGTGCCTCAATTG	NA	NA	NA	NA
>prophage 18
CP027805	Lactobacillus reuteri strain WHH1689 chromosome, complete genome	2044184	1969242	2013694	2044184	tRNA,integrase,transposase	Streptococcus_phage(18.75%)	55	1968766:1968794	2010759:2010787
1968766:1968794	attL	CTCGCCGTTTGTAAAATTAAGTTAGAAAA	NA	NA	NA	NA
AWD63431.1|1969242_1969821_+|transposase	transposase	transposase	NA	NA	NA	NA
AWD63432.1|1970074_1970998_+|integrase	integrase	integrase	H7BVY4	unidentified_phage	31.0	1.9e-32
AWD63433.1|1971474_1973085_+	manganese transporter	NA	NA	NA	NA	NA
AWD63434.1|1973348_1974023_+	hypothetical protein	NA	NA	NA	NA	NA
AWD63435.1|1974358_1976164_+|tRNA	threonyl-tRNA synthase	tRNA	A0A2K9L6B6	Tupanvirus	32.8	1.6e-86
AWD63436.1|1976423_1976558_+	hypothetical protein	NA	NA	NA	NA	NA
AWD63437.1|1976846_1977302_-|transposase	transposase	transposase	A0A1X9I619	Streptococcus_phage	41.4	6.4e-29
AWD63438.1|1977324_1978068_-|transposase	transposase	transposase	A0A1X9I5Z0	Streptococcus_phage	36.2	3.8e-31
AWD63439.1|1978321_1979278_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AWD63440.1|1979425_1979542_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63441.1|1979726_1980431_+|integrase	integrase	integrase	NA	NA	NA	NA
AWD63442.1|1980521_1980695_+|integrase	integrase	integrase	NA	NA	NA	NA
AWD63443.1|1981117_1982254_+	5-methyltetrahydropteroyltriglutamate-- homocysteine methyltransferase	NA	A0A218MNE0	uncultured_virus	46.3	2.4e-85
AWD63444.1|1982307_1982553_-	cytochrome B5	NA	NA	NA	NA	NA
AWD63445.1|1982565_1982646_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63446.1|1982645_1982783_-	cytochrome B5	NA	NA	NA	NA	NA
AWD63447.1|1982918_1983152_-	cytochrome B5	NA	NA	NA	NA	NA
AWD63448.1|1983280_1983718_-	GCN5 family N-acetyltransferase	NA	NA	NA	NA	NA
AWD63449.1|1983896_1984190_-	NAD-dependent dehydratase	NA	NA	NA	NA	NA
AWD63450.1|1984183_1984552_-	NAD-dependent dehydratase	NA	NA	NA	NA	NA
AWD63451.1|1984679_1984991_-	HxlR family transcriptional regulator	NA	NA	NA	NA	NA
AWD63452.1|1985088_1985691_+	nitroreductase	NA	NA	NA	NA	NA
AWD63453.1|1985755_1986208_+	HxlR family transcriptional regulator	NA	NA	NA	NA	NA
AWD63454.1|1986200_1987544_-	membrane protein	NA	NA	NA	NA	NA
AWD63455.1|1987524_1988700_-	MFS transporter permease	NA	NA	NA	NA	NA
AWD63456.1|1988849_1990172_-	aminopeptidase	NA	R4TV59	Phaeocystis_globosa_virus	31.3	2.9e-66
AWD63457.1|1990388_1991030_+	NAD-dependent dehydratase	NA	NA	NA	NA	NA
AWD63458.1|1991282_1992632_+	hypothetical protein	NA	NA	NA	NA	NA
AWD63459.1|1992755_1995287_+	peptidase	NA	A0A0P0IY26	Acinetobacter_phage	25.6	1.5e-63
AWD63460.1|1995505_1996459_+	membrane protein	NA	A0A1X9I6I8	Streptococcus_phage	39.0	1.1e-19
AWD63461.1|1996835_1997846_+	asparagine synthase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	43.1	7.2e-65
AWD63462.1|1997865_1999164_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	31.7	1.6e-56
AWD63463.1|1999224_1999923_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AWD63464.1|1999938_2000325_-	diguanylate cyclase	NA	NA	NA	NA	NA
AWD63465.1|2000687_2001221_+|transposase	transposase	transposase	NA	NA	NA	NA
AWD63466.1|2001220_2002117_+|integrase	integrase	integrase	A0A1B1P773	Bacillus_phage	34.2	5.3e-35
AWD63467.1|2002285_2002399_+	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AWD63468.1|2002471_2003125_-	glutamine amidotransferase	NA	NA	NA	NA	NA
AWD63469.1|2003226_2003589_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63470.1|2003661_2004540_-	2,5-diketo-D-gluconic acid reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.5	1.5e-50
AWD63471.1|2004660_2004963_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWD63472.1|2004952_2005726_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	35.2	2.1e-27
AWD63473.1|2005755_2006574_+	hypothetical protein	NA	A0A0C5AEA5	Paenibacillus_phage	31.6	2.3e-21
AWD63474.1|2006600_2007242_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWD63475.1|2007227_2007761_-|transposase	transposase	transposase	NA	NA	NA	NA
AWD63476.1|2007806_2008181_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63477.1|2008349_2009339_+	asparaginase	NA	NA	NA	NA	NA
AWD63478.1|2009398_2010400_-	hypothetical protein	NA	NA	NA	NA	NA
AWD63479.1|2010848_2011142_+|transposase	transposase	transposase	NA	NA	NA	NA
2010759:2010787	attR	CTCGCCGTTTGTAAAATTAAGTTAGAAAA	NA	NA	NA	NA
AWD63480.1|2011129_2011270_+|transposase	transposase	transposase	NA	NA	NA	NA
AWD63481.1|2011270_2011804_+|transposase	transposase	transposase	NA	NA	NA	NA
AWD63482.1|2011800_2012253_-	histidine kinase	NA	NA	NA	NA	NA
AWD63483.1|2012249_2012915_-	PhoB family transcriptional regulator	NA	W8CYM9	Bacillus_phage	33.2	2.0e-26
AWD63484.1|2012919_2013330_+|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	54.1	2.9e-28
AWD63485.1|2013346_2013694_+|transposase	putative transposase for insertion sequence element IS6501	transposase	NA	NA	NA	NA
