The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029041	Salmonella enterica strain CFSAN051295 chromosome, complete genome	4914635	654734	669057	4914635	portal,capsid,protease,tail,head,terminase	uncultured_Caudovirales_phage(90.0%)	15	NA	NA
AWE44128.1|654734_656192_+	DNA primase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	67.3	8.7e-128
AWE44129.1|656592_657084_+	hypothetical protein	NA	NA	NA	NA	NA
AWE44130.1|657650_657911_+	hypothetical protein	NA	NA	NA	NA	NA
AWE44131.1|657947_658421_-	hypothetical protein	NA	NA	NA	NA	NA
AWE44132.1|658694_659849_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	67.3	1.0e-147
AWE44133.1|659893_660454_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	83.6	2.7e-85
AWE44134.1|660455_661685_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	86.2	4.8e-212
AWE44135.1|661681_662020_+|head,tail	head-tail adaptor	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	46.8	6.6e-23
AWE44136.1|662012_662303_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	57.7	6.9e-29
AWE44137.1|662303_662747_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	63.9	1.2e-51
AWE44138.1|662887_663244_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	93.2	3.3e-57
AWE44139.1|663227_664889_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	94.6	0.0e+00
AWE44140.1|664976_665825_+	hypothetical protein	NA	NA	NA	NA	NA
AWE44141.1|666444_666951_+	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
AWE44142.1|667074_669057_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	9.0e-35
>prophage 2
CP029041	Salmonella enterica strain CFSAN051295 chromosome, complete genome	4914635	1197624	1295739	4914635	portal,capsid,protease,tail,head,holin,terminase,tRNA	Salmonella_phage(51.52%)	114	NA	NA
AWE44633.1|1197624_1198662_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AWE44634.1|1198777_1199467_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
AWE44635.1|1199785_1200169_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
AWE44636.1|1200230_1200818_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
AWE48113.1|1200920_1201820_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWE44637.1|1201837_1203172_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
AWE44638.1|1203301_1204039_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase	tRNA	NA	NA	NA	NA
AWE44639.1|1204023_1205646_-	L-aspartate oxidase	NA	NA	NA	NA	NA
AWE44640.1|1205730_1205910_+	hypothetical protein	NA	NA	NA	NA	NA
AWE44641.1|1206070_1206646_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
AWE44642.1|1206677_1207328_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
AWE44643.1|1208281_1208761_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
AWE44644.1|1208790_1208907_+	transcriptional regulator	NA	NA	NA	NA	NA
AWE44645.1|1209258_1210488_+	DUF4102 domain-containing protein	NA	H6WRW7	Salmonella_phage	100.0	4.0e-243
AWE44646.1|1210465_1210750_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	100.0	4.5e-49
AWE48114.1|1210790_1211030_-	DUF4060 domain-containing protein	NA	H6WRW9	Salmonella_phage	97.5	1.3e-36
AWE44647.1|1211035_1211905_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	95.2	1.3e-158
AWE44648.1|1211901_1212582_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.2	5.1e-131
AWE44649.1|1212578_1213364_-	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	98.9	8.2e-149
AWE44650.1|1213369_1213666_-	host-nuclease inhibitor protein Gam	NA	A0A0M5M5Z9	Salmonella_phage	99.0	6.8e-48
AWE44651.1|1213749_1214022_-	hypothetical protein	NA	S4TU79	Salmonella_phage	61.1	8.0e-27
AWE44652.1|1214032_1214230_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWE44653.1|1214229_1214430_-	hypothetical protein	NA	NA	NA	NA	NA
AWE44654.1|1214426_1214516_-	hypothetical protein	NA	NA	NA	NA	NA
AWE44655.1|1214795_1215002_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	67.6	7.4e-17
AWE44656.1|1215024_1215843_-	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
AWE44657.1|1215839_1216523_-	hypothetical protein	NA	NA	NA	NA	NA
AWE48115.1|1216729_1217116_-	transcriptional regulator	NA	A0A0M4R5D1	Salmonella_phage	92.1	2.1e-57
AWE44658.1|1217219_1217456_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	100.0	2.3e-38
AWE44659.1|1217421_1217796_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AWE44660.1|1218069_1219131_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	83.1	1.1e-36
AWE44661.1|1219133_1219883_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.6	1.6e-138
AWE44662.1|1219893_1220241_+	DUF977 domain-containing protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AWE44663.1|1220237_1220468_+	hypothetical protein	NA	Q286X0	Escherichia_phage	80.3	1.0e-27
AWE44664.1|1220464_1221070_+	hypothetical protein	NA	B9UDM4	Salmonella_phage	53.6	1.3e-37
AWE44665.1|1221071_1221542_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.5	3.2e-68
AWE48116.1|1221656_1222283_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	75.7	8.8e-53
AWE44666.1|1222376_1222643_+	hypothetical protein	NA	H6WRY4	Salmonella_phage	100.0	2.6e-46
AWE44667.1|1223128_1223308_+	hypothetical protein	NA	NA	NA	NA	NA
AWE44668.1|1223318_1223816_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
AWE44669.1|1224047_1224281_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
AWE44670.1|1224397_1224646_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
AWE44671.1|1224680_1225283_+	DUF1367 domain-containing protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AWE44672.1|1225282_1225489_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	98.5	3.9e-34
AWE44673.1|1225491_1226133_+	hypothetical protein	NA	S4TSR3	Salmonella_phage	98.6	1.8e-114
AWE44674.1|1226129_1226270_+	YlcG family protein	NA	H6WRZ0	Salmonella_phage	84.2	8.5e-09
AWE44675.1|1226266_1226944_+	antiterminator	NA	I6PDF8	Cronobacter_phage	52.2	1.6e-60
AWE44676.1|1227205_1227778_+	hypothetical protein	NA	A0A2R2Z302	Escherichia_phage	76.9	2.8e-45
AWE44677.1|1227989_1228337_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	80.4	9.8e-46
AWE44678.1|1228339_1228966_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	80.7	7.1e-95
AWE44679.1|1228962_1229502_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	47.9	3.7e-07
AWE44680.1|1229544_1229922_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	66.1	1.2e-41
AWE44681.1|1229989_1230334_+	HNH endonuclease	NA	K7P7P6	Enterobacteria_phage	73.9	3.9e-47
AWE44682.1|1230466_1230931_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.7	7.4e-49
AWE44683.1|1230884_1232627_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	44.4	5.9e-139
AWE44684.1|1232626_1233931_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	86.9	5.1e-220
AWE44685.1|1233944_1234793_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	87.9	1.3e-131
AWE44686.1|1234802_1236020_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	88.9	6.0e-199
AWE44687.1|1235924_1236299_-	hypothetical protein	NA	NA	NA	NA	NA
AWE44688.1|1236314_1236641_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	85.2	5.2e-49
AWE44689.1|1236650_1236989_+|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	70.5	6.6e-39
AWE44690.1|1236985_1237435_+	hypothetical protein	NA	S4TR46	Salmonella_phage	96.6	2.5e-73
AWE44691.1|1237431_1237779_+	DUF3168 domain-containing protein	NA	S4TTG3	Salmonella_phage	77.9	2.4e-44
AWE44692.1|1237836_1238541_+|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	75.2	1.2e-93
AWE44693.1|1238568_1238940_+|tail	phage tail protein	tail	S4TSQ0	Salmonella_phage	92.6	3.4e-60
AWE44694.1|1238951_1239242_+	DUF4035 domain-containing protein	NA	S4TND7	Salmonella_phage	99.0	3.7e-46
AWE44695.1|1239767_1243058_+|tail	phage tail tape measure protein	tail	K7PKG1	Enterobacteria_phage	69.6	0.0e+00
AWE44696.1|1243103_1243415_+	hypothetical protein	NA	S4TNM6	Salmonella_phage	80.2	1.7e-36
AWE44697.1|1243453_1243666_-	hypothetical protein	NA	NA	NA	NA	NA
AWE44698.1|1243831_1244425_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	100.0	8.7e-111
AWE44699.1|1244424_1245009_+	hypothetical protein	NA	S4TND4	Salmonella_phage	100.0	1.5e-107
AWE44700.1|1245015_1245414_+	hypothetical protein	NA	S4TR39	Salmonella_phage	100.0	8.8e-75
AWE44701.1|1245413_1248134_+	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	98.3	0.0e+00
AWE44702.1|1248142_1249102_+	hypothetical protein	NA	H6WRW5	Salmonella_phage	99.1	1.8e-182
AWE44703.1|1249112_1250417_+|tail	phage tail protein	tail	A0A1V0E5M2	Salmonella_phage	59.7	1.6e-133
AWE44704.1|1250755_1252555_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
AWE44705.1|1252571_1253546_+	S26 family signal peptidase	NA	NA	NA	NA	NA
AWE44706.1|1253819_1254500_+	ribonuclease 3	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
AWE44707.1|1254496_1255402_+	GTPase Era	NA	NA	NA	NA	NA
AWE44708.1|1255413_1256142_+	DNA repair protein RecO	NA	NA	NA	NA	NA
AWE44709.1|1256153_1256885_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AWE44710.1|1256884_1257265_+	holo-ACP synthase	NA	NA	NA	NA	NA
AWE44711.1|1257376_1257637_-	4Fe-4S dicluster domain-containing protein	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	6.5e-18
AWE44712.1|1257674_1258601_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.8	3.0e-09
AWE44713.1|1258716_1259913_+	MFS transporter	NA	NA	NA	NA	NA
AWE44714.1|1259934_1260852_+	oxidoreductase	NA	NA	NA	NA	NA
AWE44715.1|1260890_1261739_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AWE44716.1|1261854_1262748_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
AWE44717.1|1262758_1264120_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
AWE44718.1|1264123_1264759_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
AWE44719.1|1264783_1265335_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
AWE44720.1|1265385_1266930_-	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
AWE44721.1|1266930_1267161_-	hypothetical protein	NA	NA	NA	NA	NA
AWE44722.1|1267185_1271073_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.3	5.2e-127
AWE44723.1|1271767_1273153_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	1.9e-15
AWE44724.1|1273154_1273919_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
AWE44725.1|1273915_1275253_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
AWE44726.1|1275329_1275668_+	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
AWE44727.1|1275716_1277177_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
AWE44728.1|1277232_1279377_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
AWE44729.1|1279459_1280791_-	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
AWE44730.1|1281151_1282693_-	transcriptional regulator CadC	NA	NA	NA	NA	NA
AWE44731.1|1282874_1284065_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
AWE44732.1|1284389_1285643_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
AWE44733.1|1285838_1286978_+	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
AWE44734.1|1286972_1288250_-	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
AWE44735.1|1288375_1289014_+	DUF1007 domain-containing protein	NA	NA	NA	NA	NA
AWE44736.1|1289004_1289991_+	nickel transporter	NA	NA	NA	NA	NA
AWE44737.1|1289991_1291005_-	anaerobic sulfite reductase subunit AsrC	NA	NA	NA	NA	NA
AWE44738.1|1291015_1291834_-	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
AWE44739.1|1291837_1292881_-	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
AWE44740.1|1293062_1293941_-	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
AWE44741.1|1294085_1294889_-	inositol monophosphatase	NA	NA	NA	NA	NA
AWE44742.1|1295007_1295739_+|tRNA	tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
>prophage 3
CP029041	Salmonella enterica strain CFSAN051295 chromosome, complete genome	4914635	1481549	1530951	4914635	tail,lysis,head	Salmonella_phage(62.32%)	79	NA	NA
AWE48124.1|1481549_1481753_-	hypothetical protein	NA	I6RSG8	Salmonella_phage	56.7	7.3e-17
AWE44902.1|1481866_1482112_-	hypothetical protein	NA	NA	NA	NA	NA
AWE44903.1|1482221_1482464_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AWE44904.1|1482426_1483500_-	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	67.9	3.5e-142
AWE44905.1|1484011_1484563_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	60.0	1.8e-57
AWE44906.1|1484726_1485011_-	hypothetical protein	NA	NA	NA	NA	NA
AWE44907.1|1485024_1485504_-	hypothetical protein	NA	Q716E9	Shigella_phage	91.8	4.2e-87
AWE44908.1|1485512_1485971_-	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	89.0	2.6e-70
AWE44909.1|1485971_1486679_-	recombinase	NA	E7C9Q0	Salmonella_phage	96.2	7.9e-135
AWE44910.1|1486686_1486875_-	hypothetical protein	NA	C6ZR38	Salmonella_phage	82.3	1.7e-23
AWE44911.1|1486962_1487157_-	hypothetical protein	NA	NA	NA	NA	NA
AWE44912.1|1487141_1487276_-	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	78.0	2.1e-09
AWE44913.1|1487361_1487616_-	hypothetical protein	NA	NA	NA	NA	NA
AWE44914.1|1487770_1489051_-	hypothetical protein	NA	Q5G8T6	Enterobacteria_phage	92.0	3.6e-61
AWE44915.1|1489134_1489329_-	restriction endonuclease	NA	E7C9Q6	Salmonella_phage	98.4	4.2e-30
AWE44916.1|1489407_1489743_-	hypothetical protein	NA	Q5G8T5	Enterobacteria_phage	86.9	5.0e-47
AWE44917.1|1490322_1490526_+	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	100.0	2.0e-27
AWE44918.1|1490666_1491425_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
AWE44919.1|1491421_1491958_-	hypothetical protein	NA	NA	NA	NA	NA
AWE48125.1|1492079_1492766_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	76.4	4.7e-92
AWE44920.1|1492875_1493103_+	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	78.7	1.1e-26
AWE44921.1|1493211_1493502_+	hypothetical protein	NA	I6RSP4	Salmonella_phage	100.0	2.4e-45
AWE44922.1|1493523_1493784_+	hypothetical protein	NA	G9L679	Escherichia_phage	74.1	3.4e-27
AWE48126.1|1493846_1494707_+	replication protein	NA	G9L680	Escherichia_phage	65.4	5.5e-90
AWE44923.1|1494703_1496080_+	replicative DNA helicase	NA	Q76H51	Enterobacteria_phage	99.6	6.3e-253
AWE44924.1|1496076_1496346_+	hypothetical protein	NA	I6S1N5	Salmonella_phage	96.6	2.1e-43
AWE44925.1|1496419_1496602_+	hypothetical protein	NA	NA	NA	NA	NA
AWE44926.1|1496616_1496832_+	hypothetical protein	NA	A0A0P0ZC82	Stx2-converting_phage	98.6	9.0e-34
AWE44927.1|1496833_1497097_+	hypothetical protein	NA	A0A192Y6R5	Salmonella_phage	97.7	2.6e-43
AWE44928.1|1497099_1497381_+	DUF3850 domain-containing protein	NA	R9TML3	Aeromonas_phage	66.2	1.7e-24
AWE44929.1|1497328_1497778_+	DUF1367 domain-containing protein	NA	A0A0P0ZFW0	Escherichia_phage	69.8	1.9e-57
AWE44930.1|1497784_1497961_+	NinE family protein	NA	C6ZR57	Salmonella_phage	74.1	5.1e-19
AWE44931.1|1497963_1498326_+	DUF2591 domain-containing protein	NA	A0A192Y677	Salmonella_phage	47.6	2.1e-22
AWE44932.1|1498318_1498501_+	NinF family protein	NA	A0A0M4S6T3	Salmonella_phage	65.0	3.8e-17
AWE44933.1|1498463_1498760_+	hypothetical protein	NA	A0A0M3ULJ7	Salmonella_phage	82.8	2.0e-39
AWE44934.1|1498756_1499152_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M4REJ2	Salmonella_phage	94.7	2.1e-68
AWE44935.1|1499148_1499352_+	protein ninH	NA	A0A075B8J4	Enterobacteria_phage	100.0	7.2e-33
AWE44936.1|1499332_1499512_+	hypothetical protein	NA	A0A0M4QWY9	Salmonella_phage	96.6	1.3e-22
AWE44937.1|1499508_1500273_+	antitermination protein	NA	Q5G8R6	Enterobacteria_phage	98.8	2.5e-142
AWE44938.1|1500308_1500635_+	hypothetical protein	NA	M1E3N9	Enterobacteria_phage	85.2	1.2e-21
AWE44939.1|1500719_1500923_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	98.5	1.5e-33
AWE48127.1|1500900_1501398_+	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	95.8	1.8e-88
AWE44940.1|1501498_1501960_+|lysis	lysis protein	lysis	A0A2H4FNE5	Salmonella_phage	85.6	1.6e-64
AWE44941.1|1502147_1502840_+	hypothetical protein	NA	Q5MBW0	Stx1-converting_phage	70.1	9.9e-82
AWE44942.1|1503186_1503396_+	hypothetical protein	NA	NA	NA	NA	NA
AWE44943.1|1503399_1504038_+	hypothetical protein	NA	I6S676	Salmonella_phage	90.6	1.3e-112
AWE44944.1|1504069_1504549_+	DUF2280 domain-containing protein	NA	F1C5D6	Cronobacter_phage	75.5	2.1e-62
AWE44945.1|1504535_1506020_+	DNA-packaging protein	NA	G0ZND4	Cronobacter_phage	86.6	2.2e-256
AWE44946.1|1506348_1507698_+	DUF1073 domain-containing protein	NA	A0A1V0E5Q5	Salmonella_phage	98.9	3.5e-256
AWE44947.1|1507657_1508584_+|head	phage head morphogenesis protein	head	Q5G8Y3	Enterobacteria_phage	97.7	2.2e-169
AWE44948.1|1508586_1509852_+	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	96.4	3.8e-228
AWE44949.1|1509864_1510314_+	hypothetical protein	NA	I6S1Q2	Salmonella_phage	100.0	9.6e-78
AWE44950.1|1510331_1511408_+	hypothetical protein	NA	I6RSK5	Salmonella_phage	99.7	5.3e-207
AWE44951.1|1511417_1511606_+	glycoprotein	NA	Q5G8X9	Enterobacteria_phage	100.0	2.9e-28
AWE44952.1|1511657_1512059_+	hypothetical protein	NA	Q5G8X8	Enterobacteria_phage	100.0	1.4e-72
AWE44953.1|1512058_1512238_+	DUF551 domain-containing protein	NA	Q5G8X7	Enterobacteria_phage	100.0	8.6e-30
AWE44954.1|1512230_1512593_+	hypothetical protein	NA	H6WRT8	Salmonella_phage	96.7	5.2e-66
AWE44955.1|1512600_1513038_+	hypothetical protein	NA	H6WRT9	Salmonella_phage	99.3	1.0e-76
AWE44956.1|1513034_1513421_+	hypothetical protein	NA	H6WRU0	Salmonella_phage	96.1	4.3e-66
AWE44957.1|1513436_1514168_+	hypothetical protein	NA	A0A1V0E5P2	Salmonella_phage	89.3	5.9e-117
AWE44958.1|1514211_1514724_+	DUF1983 domain-containing protein	NA	M9NZE9	Enterobacteria_phage	57.1	5.9e-07
AWE44959.1|1514728_1515382_+	hypothetical protein	NA	I6R0Q2	Salmonella_phage	95.9	1.7e-115
AWE44960.1|1515565_1516096_+	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	100.0	1.9e-93
AWE44961.1|1516210_1516585_+	hypothetical protein	NA	A0A1V0E5N7	Salmonella_phage	100.0	3.2e-66
AWE48128.1|1516658_1516955_+	hypothetical protein	NA	A0A1V0E5P0	Salmonella_phage	100.0	8.6e-43
AWE44962.1|1517037_1517391_+	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	97.4	7.9e-59
AWE44963.1|1517482_1517869_+	hypothetical protein	NA	I6R0Q4	Salmonella_phage	99.2	2.7e-68
AWE44964.1|1517908_1520152_+	hypothetical protein	NA	A0A1V0E5N4	Salmonella_phage	81.1	5.4e-254
AWE44965.1|1520151_1520499_+|tail	phage tail protein	tail	H6WRV8	Salmonella_phage	96.5	8.2e-61
AWE44966.1|1520495_1520783_+	hypothetical protein	NA	NA	NA	NA	NA
AWE44967.1|1520825_1521530_+|tail	phage minor tail protein L	tail	A0A1V0E5N2	Salmonella_phage	97.0	3.0e-134
AWE44968.1|1521529_1522249_+|tail	phage tail protein	tail	A0A1V0E5M9	Salmonella_phage	89.1	4.4e-133
AWE44969.1|1522191_1522719_+|tail	tail assembly protein	tail	I6RSM0	Salmonella_phage	93.8	4.2e-64
AWE44970.1|1522728_1525908_+	DUF1983 domain-containing protein	NA	H6WRW4	Salmonella_phage	94.4	0.0e+00
AWE44971.1|1525916_1526876_+	hypothetical protein	NA	H6WRW5	Salmonella_phage	99.4	1.4e-182
AWE44972.1|1526885_1528250_+|tail	phage tail protein	tail	A0A1V0E5M2	Salmonella_phage	49.1	3.9e-106
AWE44973.1|1528384_1528498_-	virulence protein	NA	S4TND2	Salmonella_phage	83.8	2.1e-10
AWE44974.1|1528525_1529695_-	DUF4102 domain-containing protein	NA	C6ZR22	Salmonella_phage	90.0	2.3e-211
AWE44975.1|1530009_1530951_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.6e-146
>prophage 4
CP029041	Salmonella enterica strain CFSAN051295 chromosome, complete genome	4914635	1770467	1779638	4914635	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AWE45197.1|1770467_1771415_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
AWE45198.1|1771398_1772130_+	ABC transporter permease	NA	NA	NA	NA	NA
AWE45199.1|1772110_1772218_-	hypothetical protein	NA	NA	NA	NA	NA
AWE45200.1|1772277_1773009_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AWE45201.1|1773231_1774917_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
AWE45202.1|1774913_1775633_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AWE45203.1|1775679_1776147_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AWE45204.1|1776203_1776734_-	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
AWE45205.1|1776905_1777364_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AWE45206.1|1777604_1779638_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 5
CP029041	Salmonella enterica strain CFSAN051295 chromosome, complete genome	4914635	1855479	1864340	4914635		Bacillus_phage(33.33%)	8	NA	NA
AWE45268.1|1855479_1856373_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AWE45269.1|1856704_1857724_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.8	9.2e-84
AWE45270.1|1857760_1858885_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AWE45271.1|1858932_1860051_+	GDP-mannose 4,6-dehydratase	NA	M1HXY1	Acanthocystis_turfacea_Chlorella_virus	65.3	5.3e-133
AWE48136.1|1860053_1861019_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.2	7.9e-85
AWE45272.1|1861021_1861522_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
AWE45273.1|1861514_1862963_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	32.5	5.5e-58
AWE45274.1|1862966_1864340_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.5	5.8e-33
>prophage 6
CP029041	Salmonella enterica strain CFSAN051295 chromosome, complete genome	4914635	1955283	1962536	4914635		Morganella_phage(33.33%)	8	NA	NA
AWE45363.1|1955283_1955703_+	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
AWE45364.1|1955705_1956974_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.7	3.8e-228
AWE45365.1|1957428_1957641_+	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
AWE48143.1|1957651_1957840_+	cold-shock protein	NA	NA	NA	NA	NA
AWE45366.1|1958099_1959296_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	55.8	3.9e-110
AWE45367.1|1959945_1960257_+	hypothetical protein	NA	NA	NA	NA	NA
AWE45368.1|1960336_1961032_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.2	3.6e-07
AWE45369.1|1961105_1962536_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 7
CP029041	Salmonella enterica strain CFSAN051295 chromosome, complete genome	4914635	2747280	2794694	4914635	portal,capsid,integrase,tail,head,holin,terminase,tRNA	Salmonella_phage(32.56%)	60	2741806:2741865	2790659:2790812
2741806:2741865	attL	CGATAATCGCGTCGCCAAACTCACTACATTTCAGCAGCTTAGCGCCTTCCATCAGGCGTT	NA	NA	NA	NA
AWE46150.1|2747280_2747397_+|tail	phage tail protein	tail	NA	NA	NA	NA
AWE46151.1|2747560_2747788_+	phage virulence factor	NA	NA	NA	NA	NA
AWE46152.1|2747884_2748469_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	81.2	2.4e-84
AWE46153.1|2748468_2750907_-|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	62.1	4.6e-89
AWE46154.1|2750960_2751203_-	hypothetical protein	NA	NA	NA	NA	NA
AWE46155.1|2751241_2754604_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	80.5	0.0e+00
AWE46156.1|2754666_2755314_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	78.6	5.4e-90
AWE46157.1|2755211_2755949_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	84.6	1.2e-128
AWE46158.1|2755955_2756654_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	75.4	7.9e-103
AWE46159.1|2756663_2756993_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	71.3	7.3e-43
AWE46160.1|2756995_2760037_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	64.8	1.9e-294
AWE46161.1|2760008_2760347_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
AWE46162.1|2760343_2760739_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
AWE46163.1|2760789_2761536_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
AWE46164.1|2761543_2761945_-|tail	phage tail protein	tail	Q9G0F3	Phage_Gifsy-1	99.0	1.5e-50
AWE46165.1|2761941_2762520_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
AWE46166.1|2762506_2762884_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	1.5e-28
AWE46167.1|2762894_2763260_-	DNA packaging protein	NA	NA	NA	NA	NA
AWE46168.1|2763317_2764346_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
AWE46169.1|2764400_2764748_-|head	head decoration protein	head	NA	NA	NA	NA
AWE46170.1|2766247_2767828_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.6	3.6e-188
AWE46171.1|2767824_2768028_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
AWE46172.1|2768011_2769943_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	1.7e-259
AWE46173.1|2769914_2770460_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
AWE46174.1|2770867_2771317_-	hypothetical protein	NA	NA	NA	NA	NA
AWE46175.1|2771384_2771888_-	hypothetical protein	NA	NA	NA	NA	NA
AWE46176.1|2771990_2772533_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
AWE46177.1|2772529_2773144_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	92.2	1.6e-107
AWE46178.1|2773143_2773425_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AWE46179.1|2773411_2773801_-	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	72.5	4.8e-41
AWE46180.1|2773892_2774081_-	hypothetical protein	NA	NA	NA	NA	NA
AWE46181.1|2774135_2774327_+	hypothetical protein	NA	NA	NA	NA	NA
AWE46182.1|2774607_2775033_-	subtilase cytotoxin subunit B-like protein	NA	A0A0U2KD34	Escherichia_phage	36.8	2.9e-07
AWE46183.1|2775165_2775891_-	pertussis toxin-like subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	66.2	5.2e-81
AWE46184.1|2776089_2776668_-	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	57.8	3.2e-49
AWE48177.1|2776682_2777672_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.0	1.6e-189
AWE46185.1|2777679_2778585_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.7	1.1e-162
AWE46186.1|2778556_2778946_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	86.8	4.2e-61
AWE46187.1|2778942_2779263_-	LexA family transcriptional regulator	NA	S5FXP5	Shigella_phage	56.6	7.4e-24
AWE46188.1|2779259_2780990_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	58.2	5.1e-220
AWE46189.1|2780982_2781861_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	87.0	3.8e-147
AWE46190.1|2781860_2782385_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	98.3	1.3e-94
AWE46191.1|2782344_2783319_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	79.6	6.0e-117
AWE46192.1|2783315_2783540_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	98.6	2.2e-38
AWE46193.1|2783536_2784679_-	peptidase	NA	A0A1C9IHV9	Salmonella_phage	87.6	3.7e-182
AWE46194.1|2784675_2785230_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
AWE46195.1|2785258_2785483_-	XRE family transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
AWE46196.1|2785421_2785607_-	amino acid permease	NA	NA	NA	NA	NA
AWE46197.1|2785580_2786276_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	4.6e-127
AWE46198.1|2786806_2786992_-	hypothetical protein	NA	NA	NA	NA	NA
AWE46199.1|2787089_2787461_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
AWE46200.1|2787518_2788346_+	DUF2303 domain-containing protein	NA	Q8HAA2	Salmonella_phage	98.2	9.2e-151
AWE46201.1|2788482_2789022_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	99.4	2.2e-97
AWE46202.1|2789165_2789402_+	excisionase	NA	NA	NA	NA	NA
AWE46203.1|2789391_2790534_+|integrase	integrase	integrase	O21929	Phage_21	80.3	8.2e-174
AWE46204.1|2790647_2791898_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	6.7e-20
2790659:2790812	attR	CGATAATCGCGTCGCCAAACTCACTACATTTCAGCAGCTTAGCGCCTTCCATCAGGCGTTCAAAGTCATAGGTCACGGTCTTCGCGGCAATCGCGCCTTCCATACCTTTAACAATCAGGTCTGCGGCTTCGAACCACTGCATGTGGCGCAGCAT	NA	NA	NA	NA
AWE46205.1|2792069_2792735_+	23S rRNA pseudouridine synthase E	NA	NA	NA	NA	NA
AWE46206.1|2792731_2793061_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
AWE46207.1|2793072_2793534_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AWE46208.1|2793587_2794694_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 8
CP029041	Salmonella enterica strain CFSAN051295 chromosome, complete genome	4914635	3395730	3401248	4914635	integrase	Salmonella_phage(85.71%)	7	3393681:3393698	3406593:3406610
3393681:3393698	attL	CCGCATAGCCCCGCCAGT	NA	NA	NA	NA
AWE46749.1|3395730_3396093_+	GtrA family protein	NA	I1TED9	Salmonella_phage	100.0	3.9e-61
AWE46750.1|3396089_3397007_+	glycosyltransferase	NA	I1TED8	Salmonella_phage	92.8	4.9e-161
AWE46751.1|3397003_3398428_+	hypothetical protein	NA	F1C5A9	Cronobacter_phage	26.5	1.8e-29
AWE46752.1|3399801_3400173_+	DNA-binding protein	NA	B9UDM0	Salmonella_phage	97.6	4.7e-62
AWE46753.1|3400217_3400733_+	hypothetical protein	NA	B9UDL9	Salmonella_phage	91.8	2.7e-84
AWE46754.1|3400733_3401033_+	hypothetical protein	NA	A0A0M4R586	Salmonella_phage	98.0	8.4e-54
AWE48205.1|3401059_3401248_+|integrase	integrase	integrase	B9UDL9	Salmonella_phage	81.0	2.2e-12
3406593:3406610	attR	CCGCATAGCCCCGCCAGT	NA	NA	NA	NA
