The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029115	Escherichia coli strain AR435 chromosome, complete genome	4831922	197056	280529	4831922	portal,protease,plate,terminase,holin,tail,tRNA,integrase,head,lysis,transposase,capsid	Escherichia_phage(50.0%)	104	190264:190281	282141:282158
190264:190281	attL	CAGCGGCATCTCTTCGGG	NA	NA	NA	NA
AWF21157.1|197056_197494_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
AWF20724.1|197538_198480_+	putative thioesterase domain protein	NA	NA	NA	NA	NA
AWF20822.1|198839_198998_+	hypothetical protein	NA	NA	NA	NA	NA
AWF20722.1|199332_199551_+	ribbon-helix-helix, copG family protein	NA	NA	NA	NA	NA
AWF21716.1|199792_200011_+	copG-family DNA-binding protein	NA	NA	NA	NA	NA
AWF20251.1|200340_201270_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
AWF23417.1|201266_201902_-	formate dehydrogenase, gamma subunit	NA	NA	NA	NA	NA
AWF22091.1|201898_202801_-	formate dehydrogenase, beta subunit	NA	NA	NA	NA	NA
AWF20778.1|202813_205228_-	formate dehydrogenase, alpha subunit	NA	NA	NA	NA	NA
AWF19570.1|205276_205864_-	molybdopterin oxidoreductase Fe4S4 domain protein	NA	NA	NA	NA	NA
AWF20970.1|205972_206122_+	hypothetical protein	NA	NA	NA	NA	NA
AWF20779.1|206090_206891_+	formate dehydrogenase family accessory protein FdhD	NA	NA	NA	NA	NA
AWF20524.1|207043_208099_+	hypothetical protein	NA	NA	NA	NA	NA
AWF19491.1|208148_209897_-	phosphoenolpyruvate-dependent sugar phosphotransferase system, EIIA 2 family protein	NA	NA	NA	NA	NA
AWF21688.1|209896_210967_-	M42 glutamyl aminopeptidase family protein	NA	NA	NA	NA	NA
AWF19503.1|210956_212408_-	PTS system, Fru family, IIB component domain protein	NA	NA	NA	NA	NA
AWF20734.1|212418_212865_-	PTS system, fructose subfamily, IIA component domain protein	NA	NA	NA	NA	NA
AWF20206.1|213165_213480_-	L-rhamnose 1-epimerase	NA	NA	NA	NA	NA
AWF20129.1|213489_214314_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
AWF23102.1|214764_216024_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
AWF20647.1|216020_217490_-	rhamnulokinase	NA	NA	NA	NA	NA
AWF22950.1|217568_217718_+	hypothetical protein	NA	NA	NA	NA	NA
AWF20857.1|217825_218614_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
AWF23578.1|218687_219536_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
AWF21036.1|219532_220567_-	L-rhamnose-proton symporter	NA	NA	NA	NA	NA
AWF19615.1|220851_221472_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	59.3	8.4e-64
AWF19572.1|221512_221629_-	hypothetical protein	NA	NA	NA	NA	NA
AWF22761.1|221731_222715_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
AWF22720.1|222863_223538_+	protein YiiM	NA	NA	NA	NA	NA
AWF19280.1|223643_225017_-	sensor protein CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
AWF19815.1|225013_225646_-	response regulator	NA	NA	NA	NA	NA
AWF19333.1|225861_226362_+	periplasmic protein CpxP	NA	NA	NA	NA	NA
AWF19957.1|226548_227529_-|integrase	phage integrase family protein	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
AWF23464.1|228028_228301_+	regulatory phage cox family protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
AWF22287.1|228276_228474_+	putative orf78	NA	S4TNZ7	Salmonella_phage	100.0	7.3e-30
AWF21815.1|228470_228971_+	putative replication gene B protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
AWF22139.1|229034_229259_+	hypothetical protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
AWF19597.1|229258_229561_+	hypothetical protein	NA	A0A0F7LDT6	Escherichia_phage	96.0	2.5e-45
AWF20304.1|229560_229785_+	phage/conjugal plasmid C-4 type zinc finger, TraR family protein	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
AWF22569.1|229781_230057_+	phage/conjugal plasmid C-4 type zinc finger protein, TraR family	NA	A0A0F7LCM4	Escherichia_phage	100.0	2.3e-45
AWF20207.1|230046_231417_+	bacteriophage replication protein A	NA	A0A0F7LA09	Escherichia_phage	99.5	1.3e-255
AWF19692.1|231531_233073_+|integrase	integrase core domain protein	integrase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
AWF20789.1|233084_233834_+	istB-like ATP binding family protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
AWF23368.1|233884_234061_+	bacteriophage replication A domain protein	NA	NA	NA	NA	NA
AWF21912.1|234138_234912_+	putative bacteriophage replication A protein	NA	Q858T4	Yersinia_virus	93.0	2.1e-133
AWF23130.1|235151_237635_-	helicase C-terminal domain protein	NA	NA	NA	NA	NA
AWF22806.1|237806_237968_+	hypothetical protein	NA	M1TAP7	Escherichia_phage	83.0	4.6e-14
AWF20639.1|238006_239041_-|portal	phage portal protein, PBSX family	portal	U5N087	Enterobacteria_phage	99.1	1.6e-200
AWF19231.1|239040_240813_-|terminase	ATPase subunit of terminase family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
AWF22325.1|240986_241841_+|capsid	phage capsid scaffolding (GPO) serine peptidase family protein	capsid	Q778Z1	Enterobacteria_phage	99.6	1.7e-136
AWF23269.1|241899_242973_+|capsid	phage major capsid protein, P2 family	capsid	Q94MI3	Enterobacteria_phage	98.9	2.2e-200
AWF21362.1|243021_243720_+|terminase	phage small terminase subunit	terminase	Q94MJ2	Enterobacteria_phage	96.1	1.9e-117
AWF20356.1|243819_244329_+|head	phage head completion family protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
AWF23409.1|244328_244532_+	phage Tail Protein X family protein	NA	A0A0F7LCN2	Escherichia_phage	98.5	2.6e-30
AWF21957.1|244535_244817_+|holin	phage holin 2 family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
AWF20098.1|244816_245314_+	phage lysozyme family protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	1.5e-92
AWF21318.1|245328_245754_+	putative protein lysA	NA	A0A0F7LBP4	Escherichia_phage	92.9	3.7e-55
AWF21621.1|245741_246167_+|lysis	phage lysis regulatory, LysB family protein	lysis	A0A0F7L9Y0	Escherichia_phage	94.3	1.3e-63
AWF19477.1|246153_246312_+	putative protein lysB	NA	M1RZ27	Escherichia_phage	100.0	2.6e-22
AWF21189.1|246274_246742_+|tail	P2 phage tail completion R family protein	tail	A0A0F7LA33	Escherichia_phage	98.7	3.3e-81
AWF22998.1|246734_247187_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	97.3	4.5e-75
AWF21000.1|247253_247889_+|plate	baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.5e-111
AWF22633.1|247906_248233_+	lysozyme family protein	NA	A0A0F7LDQ1	Escherichia_phage	99.1	5.4e-54
AWF21206.1|248237_249146_+|plate	baseplate J-like family protein	plate	U5N3T9	Enterobacteria_phage	99.3	3.7e-161
AWF23123.1|249138_249750_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	1.4e-116
AWF22833.1|249746_251042_+|tail	phage tail-collar fiber family protein	tail	A0A0F7LBW5	Escherichia_phage	96.5	7.9e-141
AWF21548.1|251044_251461_+|tail	caudovirales tail fiber assembly family protein	tail	B6SCW7	Bacteriophage	46.0	3.4e-21
AWF22402.1|251432_251816_-|tail	caudovirales tail fiber assembly family protein	tail	Q9MCR5	Enterobacteria_phage	83.5	2.4e-53
AWF19048.1|251830_252016_-|tail	putative tail fiber assembly protein	tail	NA	NA	NA	NA
AWF23424.1|252049_252562_-	phage Tail Collar domain protein	NA	A0A0F7LCR3	Escherichia_phage	56.8	3.8e-46
AWF21808.1|252555_252678_+	hypothetical protein	NA	NA	NA	NA	NA
AWF19965.1|252706_253111_+|transposase	transposase family protein	transposase	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
AWF20420.1|253107_253455_+|transposase	putative transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
AWF20468.1|253503_255039_+|transposase	transposase C of IS166 homeodomain protein	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	3.5e-289
AWF22306.1|255103_255649_+	resolvase, N terminal domain protein	NA	A0A0F7LA37	Escherichia_phage	95.6	4.0e-94
AWF19903.1|255708_256899_+|tail	major tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	3.7e-225
AWF22207.1|256911_257430_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
AWF23081.1|257486_257762_+	mu-like prophage FluMu gp41 family protein	NA	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
AWF22715.1|257906_260354_+|tail	phage tail tape measure protein, TP901 family, core region	tail	M1T2S3	Escherichia_phage	95.2	0.0e+00
AWF20650.1|260368_260848_+	phage P2 GpU family protein	NA	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
AWF20800.1|260847_262011_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	4.8e-206
AWF20241.1|262092_262311_+	ogr/Delta-like zinc finger family protein	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
AWF21576.1|262383_262905_+	hypothetical protein	NA	A0A2I6AZV8	Macacine_betaherpesvirus	100.0	2.7e-92
AWF20328.1|262901_263753_+	DDE domain protein	NA	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	7.8e-113
AWF22665.1|263897_264539_+	hypothetical protein	NA	NA	NA	NA	NA
AWF21315.1|264609_264732_+	putative membrane protein	NA	NA	NA	NA	NA
AWF18950.1|264746_265649_+	cation diffusion facilitator transporter family protein	NA	NA	NA	NA	NA
AWF20044.1|265829_266792_+	6-phosphofructokinase	NA	NA	NA	NA	NA
AWF22066.1|267111_268101_+	sulfate-binding protein	NA	NA	NA	NA	NA
AWF22037.1|268207_268963_+	CDP-diacylglycerol pyrophosphatase	NA	NA	NA	NA	NA
AWF22228.1|269017_269767_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
AWF22842.1|269892_270492_-	hypothetical protein	NA	NA	NA	NA	NA
AWF23258.1|270592_271033_+	hypothetical protein	NA	NA	NA	NA	NA
AWF20522.1|271244_271544_+	hypothetical protein	NA	NA	NA	NA	NA
AWF19860.1|271570_271999_+	universal stress family protein	NA	NA	NA	NA	NA
AWF22938.1|272003_272750_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
AWF18951.1|272846_273857_-	fructose-1,6-bisphosphatase, class II	NA	NA	NA	NA	NA
AWF23595.1|273991_275500_-	glycerol kinase	NA	NA	NA	NA	NA
AWF20559.1|275522_276368_-	MIP channel family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
AWF19021.1|276798_277038_+	cell division protein ZapB	NA	NA	NA	NA	NA
AWF20284.1|277122_277608_-	regulator of ribonuclease activity A	NA	NA	NA	NA	NA
AWF19858.1|277700_278627_-	1,4-dihydroxy-2-naphthoate octaprenyltransferase	NA	NA	NA	NA	NA
AWF22909.1|278693_280025_-|protease	ATP-dependent protease HslVU, ATPase subunit	protease	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
AWF21247.1|280034_280529_-|protease	ATP-dependent protease HslVU, peptidase subunit	protease	NA	NA	NA	NA
282141:282158	attR	CAGCGGCATCTCTTCGGG	NA	NA	NA	NA
>prophage 2
CP029115	Escherichia coli strain AR435 chromosome, complete genome	4831922	656701	739529	4831922	holin,tRNA,integrase,transposase	Enterobacteria_phage(20.0%)	98	680543:680585	709420:709462
AWF19046.1|656701_659557_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
AWF19341.1|659556_660000_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AWF21051.1|660353_661865_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
AWF20461.1|662089_662218_-	hypothetical protein	NA	NA	NA	NA	NA
AWF21714.1|662224_663232_+	lipopolysaccharide export system permease protein LptF	NA	NA	NA	NA	NA
AWF22025.1|663231_664314_+	lipopolysaccharide export system permease protein LptG	NA	NA	NA	NA	NA
AWF18993.1|664474_665977_-	AAA-like domain protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	1.4e-83
AWF22677.1|666104_667124_-	zinc-binding dehydrogenase family protein	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	8.4e-45
AWF20283.1|667625_668831_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	35.2	3.4e-61
AWF20298.1|668941_669499_+	hypothetical protein	NA	NA	NA	NA	NA
AWF23002.1|669876_670107_+	prophage CP4-57 regulatory family protein	NA	NA	NA	NA	NA
AWF22187.1|670203_670389_-	hypothetical protein	NA	NA	NA	NA	NA
AWF19094.1|670435_670753_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	55.6	7.7e-05
AWF23501.1|670745_671105_+	hypothetical protein	NA	NA	NA	NA	NA
AWF19347.1|671136_671421_+	hypothetical protein	NA	NA	NA	NA	NA
AWF20852.1|671417_671801_+	hypothetical protein	NA	NA	NA	NA	NA
AWF22937.1|671797_674470_+	hypothetical protein	NA	A0A1B0VP75	Pseudomonas_phage	34.6	4.1e-59
AWF22347.1|674870_675614_+	phage polarity suppression family protein	NA	NA	NA	NA	NA
AWF20671.1|675610_676162_+	phage polarity suppression family protein	NA	NA	NA	NA	NA
AWF23621.1|676317_676440_+	ogr family transcription activator	NA	NA	NA	NA	NA
AWF23042.1|676617_676767_+	hypothetical protein	NA	NA	NA	NA	NA
AWF18953.1|677085_678054_+	putative inner membrane protein	NA	NA	NA	NA	NA
AWF23034.1|678055_678988_+	reverse transcriptase family protein	NA	Q7M2A9	Enterobacteria_phage	29.4	1.8e-25
AWF20151.1|679442_679745_+	hypothetical protein	NA	Q7M297	Enterobacteria_phage	50.5	1.9e-21
AWF19150.1|679804_680356_+|integrase	phage integrase family protein	integrase	B7SYF8	Stenotrophomonas_phage	40.6	2.3e-28
680543:680585	attL	AGTGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAA	NA	NA	NA	NA
AWF22567.1|680586_680958_-|integrase	integrase core domain protein	integrase	Q6H9S3	Enterobacteria_phage	99.2	1.6e-65
AWF21256.1|681149_682496_-	group II intron, maturase-specific domain protein	NA	A0A0U4J920	Pseudomonas_phage	32.9	6.1e-43
AWF21160.1|682504_682672_-	putative reverse transcriptase-like from prophage/plasmid domain protein	NA	NA	NA	NA	NA
AWF21355.1|682853_682967_-	hypothetical protein	NA	NA	NA	NA	NA
AWF22417.1|683263_683689_-	HTH-like domain protein	NA	S5FNT8	Shigella_phage	96.7	1.0e-65
AWF21163.1|683744_684047_-|transposase	transposase family protein	transposase	Q716C1	Shigella_phage	96.5	1.2e-36
AWF18902.1|684283_685075_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AWF19018.1|685653_686166_+	glycosyl transferases group 1 family protein	NA	NA	NA	NA	NA
AWF19207.1|686170_687121_+	hypothetical protein	NA	NA	NA	NA	NA
AWF18916.1|687185_688130_+	lipid A biosynthesis (KDO)2-(lauroyl)-lipid IVA acyltransferase	NA	NA	NA	NA	NA
AWF19977.1|688631_689450_+	HTH-like domain protein	NA	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
AWF19758.1|689597_691601_+|holin	transporter, betaine/carnitine/choline transporter family protein	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.5e-21
AWF21658.1|691684_692941_+	hypothetical protein	NA	NA	NA	NA	NA
AWF21361.1|692997_693123_+	hypothetical protein	NA	NA	NA	NA	NA
AWF19140.1|693220_694087_-	DDE domain protein	NA	A0A0P0I4A4	Acinetobacter_phage	40.2	1.1e-50
AWF23604.1|694083_694383_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWF20874.1|694449_694668_+	bacterial regulatory, tetR family protein	NA	NA	NA	NA	NA
AWF19222.1|694718_695012_-	istB-like ATP binding family protein	NA	A0A2L1IVB6	Escherichia_phage	99.0	5.2e-48
AWF20663.1|695186_695513_+|transposase	putative transposase	transposase	Q6H9S4	Enterobacteria_phage	97.2	2.4e-54
AWF22803.1|695512_695992_+	HTH-like domain protein	NA	Q6H9S3	Enterobacteria_phage	100.0	1.4e-74
AWF21604.1|696288_696402_+	hypothetical protein	NA	NA	NA	NA	NA
AWF23253.1|696598_698107_+	group II intron, maturase-specific domain protein	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
AWF21613.1|698301_698436_+|transposase	putative transposase	transposase	NA	NA	NA	NA
AWF19385.1|698757_699015_+	hypothetical protein	NA	NA	NA	NA	NA
AWF20550.1|699458_699584_+	hypothetical protein	NA	NA	NA	NA	NA
AWF21415.1|699572_700184_-	ABC transporter family protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.5	6.6e-05
AWF21840.1|700143_700308_+	hypothetical protein	NA	NA	NA	NA	NA
AWF21156.1|700340_701297_-	fe(3+) dicitrate transport system permease protein FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
AWF23392.1|701293_702292_-	ABC 3 transport family protein	NA	NA	NA	NA	NA
AWF19790.1|702288_703191_-	periplasmic binding family protein	NA	NA	NA	NA	NA
AWF20640.1|703235_705560_-	fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
AWF19000.1|705646_706600_-	fecR family protein	NA	NA	NA	NA	NA
AWF19285.1|706596_707118_-	putative RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
AWF21269.1|707603_707897_+|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	87.9	4.7e-41
AWF22086.1|707897_708107_+|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	100.0	4.4e-33
AWF20750.1|708868_709126_+	biofilm development YmgB/AriR family protein	NA	NA	NA	NA	NA
AWF22868.1|709288_709498_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.0	5.9e-06
709420:709462	attR	AGTGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAA	NA	NA	NA	NA
AWF21290.1|709876_711235_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
AWF20203.1|711473_712859_-|transposase	transposase IS66 family protein	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.1	1.9e-257
AWF19470.1|712908_713256_-|transposase	putative transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	99.1	6.3e-61
AWF21900.1|713252_713414_-	hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	98.1	3.8e-21
AWF19992.1|713680_713848_-	hypothetical protein	NA	NA	NA	NA	NA
AWF22692.1|714160_714319_-	putative restriction endonuclease	NA	NA	NA	NA	NA
AWF21870.1|714550_714682_+	hypothetical protein	NA	NA	NA	NA	NA
AWF23221.1|714678_714801_+	putative hNH endonuclease domain protein	NA	NA	NA	NA	NA
AWF23058.1|714808_715789_-	hypothetical protein	NA	H6WZJ9	Escherichia_phage	56.3	1.6e-101
AWF20739.1|715853_716960_-	mutarotase, YjhT family protein	NA	NA	NA	NA	NA
AWF20196.1|716979_717528_-	putative N-acetylneuraminic acid outer membrane channel protein NanC	NA	NA	NA	NA	NA
AWF20348.1|718901_719405_-|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	98.8	8.2e-94
AWF19970.1|719659_719824_+	FimH domain protein	NA	NA	NA	NA	NA
AWF23605.1|719997_721341_-	H+ symporter family protein	NA	NA	NA	NA	NA
AWF21381.1|721680_722865_+	mannonate dehydratase	NA	NA	NA	NA	NA
AWF20323.1|722945_724406_+	mannitol dehydrogenase Rossmann domain protein	NA	H8ZJP8	Ostreococcus_tauri_virus	32.4	1.4e-48
AWF19710.1|724427_724622_-	hypothetical protein	NA	NA	NA	NA	NA
AWF22953.1|724620_725394_+	FCD domain protein	NA	NA	NA	NA	NA
AWF22671.1|725631_726210_-	hypothetical protein	NA	NA	NA	NA	NA
AWF23187.1|726534_726657_+	putative membrane protein	NA	NA	NA	NA	NA
AWF20512.1|726892_727027_+	hypothetical protein	NA	NA	NA	NA	NA
AWF21622.1|726992_727385_+	anti-adapter protein IraD	NA	NA	NA	NA	NA
AWF19562.1|727377_728289_-	HTH-type transcriptional regulator YjiE	NA	NA	NA	NA	NA
AWF21941.1|728353_729526_-	beta-aspartyl peptidase	NA	NA	NA	NA	NA
AWF21887.1|729538_730000_-	inner membrane protein YjiG	NA	NA	NA	NA	NA
AWF20116.1|729996_730680_-	nucleoside recognition family protein	NA	NA	NA	NA	NA
AWF23097.1|730928_731483_+	RNA 2'-phosphotransferase, Tpt1 / KptA family protein	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
AWF21539.1|731495_732674_-	hypothetical protein	NA	NA	NA	NA	NA
AWF21052.1|732741_733602_-	hypothetical protein	NA	NA	NA	NA	NA
AWF21582.1|733666_733924_-	hypothetical protein	NA	NA	NA	NA	NA
AWF21725.1|733920_734688_-	putative CoA-substrate-specific enzyme activase domain protein	NA	NA	NA	NA	NA
AWF22836.1|734697_735849_-	2-hydroxyglutaryl-CoA dehydratase, D-component family protein	NA	NA	NA	NA	NA
AWF19747.1|735964_737245_-	hypothetical protein	NA	NA	NA	NA	NA
AWF22799.1|737285_738518_-	multidrug resistance protein MdtM	NA	NA	NA	NA	NA
AWF22239.1|739026_739287_+|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	92.4	6.6e-31
AWF22056.1|739319_739529_+|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	100.0	4.4e-33
>prophage 3
CP029115	Escherichia coli strain AR435 chromosome, complete genome	4831922	805362	813301	4831922	transposase	Macacine_betaherpesvirus(33.33%)	7	NA	NA
AWF19376.1|805362_807279_+	chaperone protein DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
AWF19839.1|807367_808498_+	chaperone protein DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	3.6e-28
AWF20845.1|808760_809873_-|transposase	transposase DDE domain protein	transposase	NA	NA	NA	NA
AWF20765.1|809950_810103_-	protein HokC	NA	A0A0U2QV81	Escherichia_phage	78.0	1.6e-13
AWF22980.1|810202_811054_-	DDE domain protein	NA	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	7.8e-113
AWF22017.1|811050_811572_-	hypothetical protein	NA	A0A2I6AZV8	Macacine_betaherpesvirus	100.0	2.7e-92
AWF18922.1|812134_813301_+	na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	7.5e-90
>prophage 4
CP029115	Escherichia coli strain AR435 chromosome, complete genome	4831922	1086257	1157738	4831922	portal,terminase,tail,head,integrase,lysis,transposase	Enterobacteria_phage(41.07%)	81	1100495:1100511	1156006:1156022
AWF23388.1|1086257_1087313_-	outer membrane pore protein E	NA	Q1MVN1	Enterobacteria_phage	60.9	2.0e-118
AWF19913.1|1087600_1088704_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
AWF20858.1|1088715_1089969_+	gamma-glutamyl phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
AWF23558.1|1090173_1091337_-|integrase	phage integrase family protein	integrase	U5P434	Shigella_phage	99.2	1.7e-227
AWF19628.1|1091563_1091869_-	hypothetical protein	NA	U5P0J0	Shigella_phage	98.0	5.8e-50
AWF23430.1|1091868_1092210_-	putative phage protein	NA	U5P092	Shigella_phage	100.0	1.7e-63
AWF19091.1|1092221_1092758_-	hypothetical protein	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
AWF20103.1|1092885_1093710_-	hypothetical protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
AWF19567.1|1093775_1094138_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
AWF21241.1|1094840_1095488_-	helix-turn-helix domain protein	NA	K7PKK1	Enterobacteria_phage	99.5	2.3e-117
AWF22051.1|1095630_1095891_+	helix-turn-helix domain protein	NA	K7PJQ8	Enterobacteria_phage	98.8	7.1e-41
AWF19105.1|1095883_1096435_+	putative dNA-binding transcriptional regulator	NA	U5P4K1	Shigella_phage	98.9	3.8e-100
AWF22830.1|1096779_1097766_+	helix-turn-helix domain protein	NA	U5P0A0	Shigella_phage	87.8	1.4e-134
AWF22414.1|1098129_1098264_+	hypothetical protein	NA	NA	NA	NA	NA
AWF22523.1|1098256_1098910_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	8.1e-126
AWF19416.1|1098906_1099233_+	lexA DNA binding domain protein	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
AWF22638.1|1099229_1099619_+	endodeoxyribonuclease RusA family protein	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
AWF19873.1|1099638_1100448_+	kilA-N domain protein	NA	A0A291AWU7	Escherichia_phage	98.1	1.4e-148
AWF22987.1|1100455_1101445_+	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	98.5	7.5e-192
1100495:1100511	attL	GGGATCGTATTGTTCAG	NA	NA	NA	NA
AWF19296.1|1102334_1103276_-	hypothetical protein	NA	A5LH79	Enterobacteria_phage	44.2	5.0e-68
AWF22005.1|1103375_1103501_+	hypothetical protein	NA	NA	NA	NA	NA
AWF23285.1|1103544_1103748_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
AWF19953.1|1103898_1104951_+	DNA methylase family protein	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
AWF20290.1|1105018_1105234_+|lysis	lysis S family protein	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AWF20301.1|1105233_1105731_+	lysozyme RrrD	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
AWF22733.1|1105727_1106195_+|lysis	bacteriophage lysis family protein	lysis	A0A291AWW3	Escherichia_phage	100.0	7.7e-78
AWF23057.1|1106182_1106335_+	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	98.0	4.7e-21
AWF19027.1|1107010_1107502_+	hypothetical protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
AWF22663.1|1107501_1109604_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.1	0.0e+00
AWF22662.1|1109600_1109813_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
AWF20753.1|1109812_1111282_+|portal	phage portal protein, lambda family	portal	K7PJP3	Enterobacteria_phage	99.8	3.1e-282
AWF22661.1|1111334_1113293_+|head	mu-like prophage major head subunit gpT family protein	head	A0A291AWT6	Escherichia_phage	99.4	0.0e+00
AWF21224.1|1113379_1113703_+	hypothetical protein	NA	A0A291AWX2	Escherichia_phage	99.1	8.5e-52
AWF19686.1|1113695_1113971_+	ATP-binding sugar transporter from pro-phage family protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
AWF22450.1|1113982_1114561_+|tail	prophage minor tail Z family protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
AWF21782.1|1114557_1114959_+|tail	phage minor tail U family protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
AWF20787.1|1114969_1115713_+	bacterial Ig-like domain family protein	NA	A5LH35	Enterobacteria_phage	99.2	2.3e-132
AWF19908.1|1115773_1116160_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
AWF20513.1|1116180_1116498_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	1.5e-53
AWF22767.1|1116469_1119535_+|tail	phage tail tape measure protein, lambda family	tail	A0A291AWX1	Escherichia_phage	99.2	0.0e+00
AWF19457.1|1119534_1119864_+|tail	phage minor tail family protein	tail	A5LH39	Enterobacteria_phage	99.1	1.7e-60
AWF19557.1|1119873_1120572_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
AWF23132.1|1120577_1121321_+	nlpC/P60 family protein	NA	K7PLW1	Enterobacteria_phage	96.0	2.3e-148
AWF23069.1|1121365_1121866_+|tail	bacteriophage lambda tail assembly I family protein	tail	K7PH50	Enterobacteria_phage	97.0	7.7e-84
AWF19677.1|1121926_1125424_+	hypothetical protein	NA	A5LH43	Enterobacteria_phage	97.0	0.0e+00
AWF21018.1|1125493_1126093_+	ompA-like transmembrane domain protein	NA	A0A291AWV3	Escherichia_phage	98.5	5.7e-110
AWF21752.1|1126093_1126267_-	hypothetical protein	NA	Q6H9T0	Enterobacteria_phage	93.0	5.2e-24
AWF19546.1|1126654_1127143_-	hypothetical protein	NA	NA	NA	NA	NA
AWF22674.1|1129343_1129916_+	chaperone of endosialidase family protein	NA	A0A2D1UII2	Escherichia_phage	95.3	6.9e-97
AWF20300.1|1130071_1130221_+	hypothetical protein	NA	NA	NA	NA	NA
AWF22912.1|1130776_1131658_+	hypothetical protein	NA	NA	NA	NA	NA
AWF21002.1|1132016_1132217_+	hypothetical protein	NA	NA	NA	NA	NA
AWF23389.1|1132358_1132535_-|integrase	putative integrase	integrase	A0A2D1GN00	Marinobacter_phage	49.1	1.9e-05
AWF20856.1|1132927_1133110_+	hypothetical protein	NA	NA	NA	NA	NA
AWF19596.1|1133610_1134453_-	hypothetical protein	NA	NA	NA	NA	NA
AWF19909.1|1134664_1134817_+	hypothetical protein	NA	NA	NA	NA	NA
AWF22984.1|1135091_1136300_+|integrase	phage integrase family protein	integrase	Q7M297	Enterobacteria_phage	56.5	7.7e-130
AWF21980.1|1136556_1137750_+	eco57I restriction-modification methylase family protein	NA	NA	NA	NA	NA
AWF22041.1|1137742_1139449_+	archaeal ATPase family protein	NA	NA	NA	NA	NA
AWF21800.1|1139426_1140497_+	hypothetical protein	NA	NA	NA	NA	NA
AWF21283.1|1140897_1141620_-	putative membrane protein	NA	A0A2L1IVB6	Escherichia_phage	97.9	2.8e-18
AWF20952.1|1141591_1142050_-|transposase	putative transposase	transposase	A0A2L1IVA1	Escherichia_phage	84.0	1.3e-42
AWF20971.1|1142215_1142707_-|transposase	putative transposase	transposase	A0A2L1IVA1	Escherichia_phage	96.3	2.8e-86
AWF21317.1|1142703_1143111_-	phosphoethanolamine N-methyltransferase domain protein	NA	NA	NA	NA	NA
AWF18995.1|1143121_1143379_-	hypothetical protein	NA	NA	NA	NA	NA
AWF20066.1|1143491_1143644_-	hypothetical protein	NA	NA	NA	NA	NA
AWF23587.1|1143753_1144497_-	ribulose-phosphate 3 epimerase family protein	NA	NA	NA	NA	NA
AWF21773.1|1144507_1144798_-	autoinducer 2-degrading protein LsrG	NA	NA	NA	NA	NA
AWF21243.1|1144846_1145722_-	hypothetical protein	NA	NA	NA	NA	NA
AWF20088.1|1145750_1146773_-	autoinducer 2-binding protein LsrB	NA	NA	NA	NA	NA
AWF19712.1|1146799_1147798_-	branched-chain amino acid transport system / permease component family protein	NA	NA	NA	NA	NA
AWF21077.1|1147797_1148844_-	branched-chain amino acid transport system / permease component family protein	NA	NA	NA	NA	NA
AWF20056.1|1148837_1150391_-	heme ABC exporter, ATP-binding protein CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	29.5	1.9e-19
AWF19481.1|1150640_1151597_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
AWF22647.1|1151696_1153289_+	autoinducer 2 kinase LsrK	NA	NA	NA	NA	NA
AWF19778.1|1153301_1153652_+	hypothetical protein	NA	NA	NA	NA	NA
AWF20951.1|1154254_1154626_-|integrase	integrase core domain protein	integrase	A0A0N7C1X7	Escherichia_phage	96.7	1.0e-64
AWF23361.1|1154817_1156326_-	group II intron, maturase-specific domain protein	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
1156006:1156022	attR	CTGAACAATACGATCCC	NA	NA	NA	NA
AWF21408.1|1156522_1156636_-	hypothetical protein	NA	NA	NA	NA	NA
AWF23267.1|1156932_1157412_-	HTH-like domain protein	NA	Q6H9S3	Enterobacteria_phage	97.1	2.2e-72
AWF19777.1|1157411_1157738_-|transposase	putative transposase	transposase	Q6H9S4	Enterobacteria_phage	97.2	2.4e-54
>prophage 5
CP029115	Escherichia coli strain AR435 chromosome, complete genome	4831922	1442878	1494435	4831922	tRNA,transposase	Escherichia_phage(20.0%)	48	NA	NA
AWF22712.1|1442878_1444264_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
AWF20456.1|1444299_1444821_-	inner membrane protein YbcI	NA	NA	NA	NA	NA
AWF23139.1|1444928_1445141_-	hypothetical protein	NA	NA	NA	NA	NA
AWF23375.1|1445142_1446009_-	bifunctional protein FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
AWF21272.1|1446479_1447022_+	type-1 fimbrial protein, A chain	NA	NA	NA	NA	NA
AWF19369.1|1447241_1447934_+	gram-negative pili assembly chaperone, C-terminal domain protein	NA	NA	NA	NA	NA
AWF20286.1|1447964_1450568_+	papC C-terminal domain protein	NA	NA	NA	NA	NA
AWF22048.1|1450618_1451587_+	fimbrial family protein	NA	NA	NA	NA	NA
AWF21907.1|1451915_1452113_+	putative fimbrial protein	NA	NA	NA	NA	NA
AWF21511.1|1452115_1452748_-	bacterial regulatory, luxR family protein	NA	NA	NA	NA	NA
AWF19190.1|1452802_1452958_+	hypothetical protein	NA	NA	NA	NA	NA
AWF23374.1|1453112_1453874_-	HTH-type transcriptional regulator AdiY	NA	NA	NA	NA	NA
AWF20835.1|1454056_1454947_-	putative n5-glutamine methyltransferase	NA	NA	NA	NA	NA
AWF21528.1|1454947_1457920_-	bacteriophage N adsorption A C-term family protein	NA	NA	NA	NA	NA
AWF19440.1|1457906_1460144_-	glycosyl transferase group 2 family protein	NA	NA	NA	NA	NA
AWF19881.1|1460293_1461736_-	sensor kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.2	3.0e-11
AWF20008.1|1461725_1462409_-	transcriptional regulatory protein CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
AWF20082.1|1462455_1462611_+	putative cu(I)/Ag(I) efflux system outer membrane protein CusC	NA	NA	NA	NA	NA
AWF21966.1|1462565_1463939_+	cation efflux system protein CusC	NA	NA	NA	NA	NA
AWF19193.1|1464096_1464429_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
AWF19359.1|1464444_1465668_+	cation efflux system protein CusB	NA	NA	NA	NA	NA
AWF19169.1|1465679_1468823_+	cation efflux system protein CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
AWF23588.1|1468924_1470301_+	phenylalanine-specific permease	NA	NA	NA	NA	NA
AWF19119.1|1470381_1471629_-	miniconductance mechanosensitive channel	NA	NA	NA	NA	NA
AWF19155.1|1471736_1472390_-	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
AWF20326.1|1472437_1472578_-|transposase	putative transposase domain protein	transposase	NA	NA	NA	NA
AWF22612.1|1472568_1473273_+|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWF19367.1|1473312_1474110_+	putative colanic acid biosynthesis protein	NA	A0A291LBB9	Klebsiella_phage	41.7	7.8e-14
AWF21812.1|1474274_1475168_+	regulatory protein GalF	NA	A0A127AW70	Bacillus_phage	40.3	3.3e-45
AWF21222.1|1475624_1476629_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	47.3	2.2e-82
AWF20632.1|1476662_1478879_+	glycosyl transferases group 1 family protein	NA	NA	NA	NA	NA
AWF22592.1|1478875_1479655_+	ABC-2 type transporter family protein	NA	NA	NA	NA	NA
AWF21529.1|1479661_1480414_+	ABC transporter family protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.4	1.1e-12
AWF19011.1|1480431_1481511_+	glycosyltransferase Family 4 family protein	NA	NA	NA	NA	NA
AWF19531.1|1481520_1482675_+	glycosyl transferases group 1 family protein	NA	NA	NA	NA	NA
AWF21075.1|1482722_1483913_+	methionine biosynthesis MetW family protein	NA	NA	NA	NA	NA
AWF22709.1|1483916_1485998_+	glycosyl transferases group 1 family protein	NA	A0A2K9L4U1	Tupanvirus	27.7	2.5e-19
AWF23262.1|1486215_1487139_-|transposase	transposase DDE domain protein	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
AWF18967.1|1487365_1487494_+	hypothetical protein	NA	NA	NA	NA	NA
AWF20651.1|1488210_1488702_+	acetyltransferase family protein	NA	NA	NA	NA	NA
AWF21801.1|1488787_1489150_-	hypothetical protein	NA	NA	NA	NA	NA
AWF20812.1|1489234_1489939_-|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWF21906.1|1489915_1490080_+|transposase	putative transposase	transposase	NA	NA	NA	NA
AWF22844.1|1490076_1491195_-	carboxylate-amine ligase YbdK	NA	NA	NA	NA	NA
AWF19795.1|1491626_1492148_+	hypothetical protein	NA	A0A2I6AZV8	Macacine_betaherpesvirus	100.0	2.7e-92
AWF21649.1|1492144_1492996_+	DDE domain protein	NA	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	7.8e-113
AWF21804.1|1493093_1493246_+	hok/gef family protein	NA	NA	NA	NA	NA
AWF20073.1|1493322_1494435_+|transposase	transposase DDE domain protein	transposase	NA	NA	NA	NA
>prophage 6
CP029115	Escherichia coli strain AR435 chromosome, complete genome	4831922	2067509	2123551	4831922	portal,protease,terminase,tail,head,integrase,tRNA,lysis,transposase,capsid	Escherichia_phage(40.82%)	69	2079795:2079810	2121793:2121808
AWF20630.1|2067509_2068628_-|integrase	phage integrase family protein	integrase	Q77Z04	Phage_21	44.4	1.6e-84
AWF20854.1|2068596_2068866_-	excisionase-like family protein	NA	NA	NA	NA	NA
AWF22721.1|2068927_2071369_-	enterobacterial exodeoxyribonuclease VIII family protein	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
AWF19715.1|2071462_2071654_-	hypothetical protein	NA	NA	NA	NA	NA
AWF20893.1|2071650_2071839_-	dicB family protein	NA	NA	NA	NA	NA
AWF21179.1|2071855_2071978_+	putative ybl82 protein	NA	NA	NA	NA	NA
AWF22097.1|2072239_2072443_+	hypothetical protein	NA	NA	NA	NA	NA
AWF21992.1|2072407_2072626_-	hypothetical protein	NA	NA	NA	NA	NA
AWF23535.1|2072697_2073054_-	hypothetical protein	NA	NA	NA	NA	NA
AWF19811.1|2073350_2073989_-	helix-turn-helix family protein	NA	H9C160	Pectobacterium_phage	26.7	8.7e-16
AWF19480.1|2074306_2074732_+	hypothetical protein	NA	NA	NA	NA	NA
AWF19544.1|2074803_2075874_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
AWF23255.1|2075914_2076337_+	hypothetical protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
AWF21554.1|2076394_2076751_+	putative bacteriophage protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
AWF19984.1|2076844_2077027_+	putative phage protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
AWF22452.1|2077019_2077196_+	putative yheA protein	NA	A0A2R2X2A8	Escherichia_phage	94.8	6.7e-27
AWF21543.1|2078844_2079780_+	hypothetical protein	NA	U5P0K4	Shigella_phage	48.7	6.9e-78
AWF22440.1|2079780_2080161_+	endodeoxyribonuclease RusA family protein	NA	V5URS4	Shigella_phage	63.6	1.3e-35
2079795:2079810	attL	AGAATTTGTTTTGCCT	NA	NA	NA	NA
AWF21667.1|2080157_2080979_+	antitermination family protein	NA	K7P7B9	Enterobacteria_phage	58.2	5.1e-77
AWF19339.1|2081343_2081460_+	hypothetical protein	NA	H6WZJ7	Escherichia_phage	93.5	3.6e-05
AWF19460.1|2081431_2081587_+	hypothetical protein	NA	NA	NA	NA	NA
AWF21962.1|2082231_2082417_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	75.4	1.7e-20
AWF19694.1|2082812_2083016_+	hypothetical protein	NA	H6WZJ9	Escherichia_phage	95.2	7.7e-27
AWF21221.1|2083012_2083174_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	87.0	5.9e-14
AWF22949.1|2083332_2083539_+|lysis	lysis S family protein	lysis	A0A2R2Z340	Escherichia_phage	100.0	8.1e-32
AWF23038.1|2083543_2083894_+	hypothetical protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
AWF22429.1|2083957_2084491_+	phage lysozyme family protein	NA	Q08J98	Stx2-converting_phage	93.2	1.5e-98
AWF23114.1|2084487_2084949_+|lysis	bacteriophage lysis family protein	lysis	A0A0K2FJD0	Enterobacteria_phage	87.6	9.6e-65
AWF18908.1|2084980_2085274_-	lipoprotein bor	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
AWF19072.1|2085712_2086066_-	hypothetical protein	NA	NA	NA	NA	NA
AWF22684.1|2086459_2086780_+|terminase	phage terminase, small subunit, P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	4.9e-52
AWF19983.1|2086779_2088537_+	phage Terminase family protein	NA	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
AWF20095.1|2088554_2088695_+	putative membrane protein	NA	NA	NA	NA	NA
AWF22177.1|2088684_2089911_+|portal	phage portal protein, HK97 family	portal	Q8SBI0	Shigella_phage	83.3	3.7e-204
AWF21628.1|2090142_2090502_+|head,protease	caudovirus prohead protease family protein	head,protease	Q8SBH9	Shigella_phage	82.4	5.2e-50
AWF22062.1|2090516_2091734_+|capsid	phage major capsid protein, HK97 family	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
AWF20927.1|2091810_2092128_+|head,tail	phage gp6-like head-tail connector family protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.5	5.3e-22
AWF22225.1|2092136_2092475_+|head,tail	putative head-tail adaptor	head,tail	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
AWF23347.1|2092474_2092921_+	hypothetical protein	NA	S4TR46	Salmonella_phage	81.1	2.3e-63
AWF23452.1|2092980_2093262_+	hypothetical protein	NA	A0A1B5FP84	Escherichia_phage	95.7	4.8e-43
AWF21684.1|2093322_2094027_+	immunoglobulin domain protein	NA	A0A1B5FP82	Escherichia_phage	92.7	1.4e-112
AWF19719.1|2094041_2094413_+|tail	phage tail assembly chaperone family protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.5e-64
AWF20239.1|2094424_2094715_+	hypothetical protein	NA	A0A1B5FP87	Escherichia_phage	95.7	7.2e-42
AWF19522.1|2094761_2097989_+|tail	phage tail tape measure protein, lambda family	tail	A0A1B5FPE2	Escherichia_phage	95.0	0.0e+00
AWF20347.1|2098023_2098323_+|tail	phage minor tail family protein	tail	A0A0P0ZDL9	Stx2-converting_phage	69.7	5.5e-37
AWF22353.1|2098322_2099021_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	3.4e-130
AWF19134.1|2099134_2099770_+	nlpC/P60 family protein	NA	K7PLW1	Enterobacteria_phage	97.2	5.5e-127
AWF23239.1|2099802_2100315_+|tail	bacteriophage lambda tail assembly I family protein	tail	K7PH50	Enterobacteria_phage	93.5	3.9e-83
AWF20972.1|2100375_2103855_+	fibronectin type III family protein	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
AWF22314.1|2103922_2104522_+	outer membrane beta-barrel domain protein	NA	H6WZM8	Escherichia_phage	95.0	1.6e-107
AWF20391.1|2104522_2104696_-	hypothetical protein	NA	Q6H9T0	Enterobacteria_phage	100.0	1.9e-26
AWF19524.1|2105083_2105572_-	hypothetical protein	NA	NA	NA	NA	NA
AWF22726.1|2105615_2107910_+	hypothetical protein	NA	A0A2D1UII2	Escherichia_phage	82.6	0.0e+00
AWF21918.1|2107912_2108284_-|integrase	integrase core domain protein	integrase	Q6H9S3	Enterobacteria_phage	99.2	1.6e-65
AWF20658.1|2108475_2109984_-	group II intron, maturase-specific domain protein	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
AWF19286.1|2110180_2110294_-	hypothetical protein	NA	NA	NA	NA	NA
AWF22737.1|2110590_2111070_-	HTH-like domain protein	NA	Q6H9S3	Enterobacteria_phage	100.0	1.4e-74
AWF21513.1|2111069_2111396_-|transposase	putative transposase	transposase	Q6H9S4	Enterobacteria_phage	97.2	2.4e-54
AWF21057.1|2111676_2111928_+	hypothetical protein	NA	A0A2D1UII2	Escherichia_phage	96.4	2.3e-36
AWF23540.1|2112165_2112597_-	putative 3-demethylubiquinone-9 3-methyltransferase 3,4-dihydroxy-5-hexaprenylbenzoate methyltransferase DHHB methyltransferase	NA	NA	NA	NA	NA
AWF19179.1|2113388_2114222_-	binding-protein-dependent transport system inner membrane component family protein	NA	Q6GZ02	Mycoplasma_phage	28.7	6.5e-11
AWF22482.1|2114235_2115372_-	spermidine/putrescine import ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
AWF23470.1|2115621_2116848_+	peptidase T	NA	NA	NA	NA	NA
AWF20622.1|2116896_2118018_-	50S ribosomal protein L16 arginine hydroxylase	NA	NA	NA	NA	NA
AWF23462.1|2118093_2119554_-	sensor protein PhoQ	NA	NA	NA	NA	NA
AWF20110.1|2119553_2120225_-	transcriptional regulatory protein PhoP	NA	NA	NA	NA	NA
AWF21662.1|2120393_2121764_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
AWF19835.1|2121767_2122409_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
2121793:2121808	attR	AGAATTTGTTTTGCCT	NA	NA	NA	NA
AWF22533.1|2122444_2123551_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 7
CP029115	Escherichia coli strain AR435 chromosome, complete genome	4831922	2929117	3012248	4831922	integrase,transposase	Shigella_phage(19.05%)	95	2945138:2945153	2955426:2955441
AWF20853.1|2929117_2929621_-|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	99.4	3.7e-94
AWF20736.1|2929965_2930103_+	hypothetical protein	NA	NA	NA	NA	NA
AWF21262.1|2930275_2930440_-	mATE family multidrug exporter	NA	NA	NA	NA	NA
AWF19907.1|2930783_2931773_-	MATE efflux family protein	NA	NA	NA	NA	NA
AWF21641.1|2932079_2933030_-	HTH-type transcriptional regulator cbl	NA	NA	NA	NA	NA
AWF20638.1|2933131_2934049_-	lysR substrate binding domain protein	NA	NA	NA	NA	NA
AWF22127.1|2934506_2935439_-	putative L,D-transpeptidase ErfK/SrfK	NA	NA	NA	NA	NA
AWF19756.1|2935503_2936583_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
AWF21286.1|2936594_2937338_-	cobalamin 5'-phosphate synthase	NA	NA	NA	NA	NA
AWF21213.1|2937334_2937880_-	bifunctional adenosylcobalamin biosynthesis protein CobU	NA	NA	NA	NA	NA
AWF19131.1|2938031_2938154_-	cobalamin biosynthesis family protein	NA	NA	NA	NA	NA
AWF22617.1|2938344_2938509_-	hypothetical protein	NA	NA	NA	NA	NA
AWF22475.1|2938932_2939289_+|transposase	transposase family protein	transposase	U5P4I9	Shigella_phage	92.5	4.4e-33
AWF23461.1|2939245_2940397_+	bacterial regulatory, luxR family protein	NA	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
AWF23023.1|2941683_2942088_-	hypothetical protein	NA	NA	NA	NA	NA
AWF21968.1|2942272_2942752_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWF19936.1|2942818_2943241_+|transposase	transposase IS116/IS110/IS902 family protein	transposase	NA	NA	NA	NA
AWF22911.1|2943250_2943643_-	hypothetical protein	NA	NA	NA	NA	NA
AWF20467.1|2943808_2944378_-	hypothetical protein	NA	NA	NA	NA	NA
AWF19425.1|2945122_2945263_-	hemolysin expression modulating family protein	NA	NA	NA	NA	NA
2945138:2945153	attL	CCAGACGGAAGCCGGC	NA	NA	NA	NA
AWF20146.1|2946006_2946213_+	helix-turn-helix domain protein	NA	NA	NA	NA	NA
AWF20563.1|2946307_2946910_+	hypothetical protein	NA	NA	NA	NA	NA
AWF20315.1|2947080_2947278_+	hypothetical protein	NA	NA	NA	NA	NA
AWF21282.1|2947424_2947553_-	hypothetical protein	NA	NA	NA	NA	NA
AWF21738.1|2947988_2948135_+	hypothetical protein	NA	NA	NA	NA	NA
AWF21948.1|2948313_2949027_+	hypothetical protein	NA	NA	NA	NA	NA
AWF21296.1|2949111_2949984_+	miro-like family protein	NA	NA	NA	NA	NA
AWF21971.1|2950475_2951225_-	istB-like ATP binding family protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
AWF22813.1|2951236_2952778_-|integrase	integrase core domain protein	integrase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
AWF22237.1|2953004_2955788_+	autotransporter beta-domain protein	NA	NA	NA	NA	NA
2955426:2955441	attR	GCCGGCTTCCGTCTGG	NA	NA	NA	NA
AWF20587.1|2955822_2956017_+	hypothetical protein	NA	NA	NA	NA	NA
AWF22336.1|2956171_2956990_+	hypothetical protein	NA	A0A2C9CX26	Yersinia_phage	40.1	4.2e-47
AWF20994.1|2957331_2957805_+	intergenic-region protein	NA	A9J566	Pseudomonas_phage	30.3	1.5e-12
AWF19352.1|2957820_2958297_+	DNA repair RadC family protein	NA	NA	NA	NA	NA
AWF20931.1|2958365_2958587_+	hypothetical protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
AWF20902.1|2958586_2958700_+	putative intergenic-region protein	NA	NA	NA	NA	NA
AWF23617.1|2958749_2959118_+	yagB/YeeU/YfjZ family protein	NA	NA	NA	NA	NA
AWF21799.1|2959207_2959585_+	hypothetical protein	NA	NA	NA	NA	NA
AWF20794.1|2960344_2961880_-|transposase	transposase C of IS166 homeodomain protein	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	3.5e-289
AWF19508.1|2961928_2962276_-|transposase	putative transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
AWF20369.1|2962272_2962677_-|transposase	transposase family protein	transposase	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
AWF21040.1|2962705_2962858_-	hypothetical protein	NA	NA	NA	NA	NA
AWF22997.1|2963088_2963229_+	hypothetical protein	NA	NA	NA	NA	NA
AWF21702.1|2963377_2963560_+|transposase	transposase IS116/IS110/IS902 family protein	transposase	NA	NA	NA	NA
AWF23266.1|2963941_2964196_+	ethanolamine utilization - propanediol utilization family protein	NA	NA	NA	NA	NA
AWF22331.1|2964296_2964626_-	hypothetical protein	NA	NA	NA	NA	NA
AWF22160.1|2964710_2964833_+	hypothetical protein	NA	NA	NA	NA	NA
AWF19171.1|2964797_2965856_-	inner membrane protein YeeA	NA	NA	NA	NA	NA
AWF23489.1|2966053_2966527_-	DNA gyrase inhibitor	NA	NA	NA	NA	NA
AWF23312.1|2966622_2967135_+|transposase	helix-turn-helix domain of transposase ISL3 family protein	transposase	NA	NA	NA	NA
AWF23301.1|2967137_2967842_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWF23185.1|2967968_2969135_-	D-alanyl-D-alanine carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.0	1.5e-226
AWF21951.1|2969343_2970771_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
AWF21523.1|2970813_2971041_-	sirA-like family protein	NA	NA	NA	NA	NA
AWF21593.1|2971054_2972113_-	hypothetical protein	NA	NA	NA	NA	NA
AWF19516.1|2972291_2973650_-	low-affinity putrescine importer PlaP	NA	NA	NA	NA	NA
AWF20546.1|2973916_2974846_-	lysR substrate binding domain protein	NA	NA	NA	NA	NA
AWF22679.1|2974891_2975716_-	NADH(P)-binding family protein	NA	NA	NA	NA	NA
AWF19912.1|2975798_2976053_-	addiction module toxin, Txe/YoeB family	NA	NA	NA	NA	NA
AWF23079.1|2976049_2976301_-	antitoxin YefM	NA	NA	NA	NA	NA
AWF22351.1|2976780_2977680_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
AWF19946.1|2977685_2978990_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
AWF21473.1|2978986_2980057_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
AWF21629.1|2980056_2981124_+	histidine biosynthesis bifunctional protein HisB	NA	NA	NA	NA	NA
AWF20934.1|2981123_2981714_+	imidazole glycerol phosphate synthase, glutamine amidotransferase subunit	NA	NA	NA	NA	NA
AWF21969.1|2981713_2982451_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
AWF22330.1|2982432_2983209_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
AWF20965.1|2983202_2983811_+	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
AWF20354.1|2983849_2984674_-	glycosyl transferases group 1 family protein	NA	NA	NA	NA	NA
AWF19126.1|2984801_2985305_-|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	99.4	1.7e-94
AWF22649.1|2985600_2986767_-	nucleotide sugar dehydrogenase family protein	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	53.7	1.8e-112
AWF23234.1|2986930_2988301_-	phosphoglucomutase/phosphomannomutase, alpha/beta/alpha domain III family protein	NA	A0A127AWJ1	Bacillus_phage	25.6	9.3e-31
AWF20156.1|2988323_2989739_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.6	5.8e-52
AWF22823.1|2989966_2991373_-	6-phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	8.0e-38
AWF21019.1|2991539_2992295_-	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
AWF21148.1|2992375_2992879_-|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AWF21466.1|2992914_2993040_+	hypothetical protein	NA	NA	NA	NA	NA
AWF19902.1|2993932_2994886_-	acyltransferase family protein	NA	NA	NA	NA	NA
AWF22383.1|2994893_2996627_-	pectate lyase superfamily protein	NA	A0A0A8J9B0	Klebsiella_phage	33.0	7.6e-54
AWF23299.1|2996662_2997430_-	glycosyl transferase WecB/TagA/CpsF family protein	NA	NA	NA	NA	NA
AWF20474.1|2997439_2998609_-	glycosyl transferases group 1 family protein	NA	NA	NA	NA	NA
AWF21861.1|2998620_2999709_-	glycosyl transferases group 1 family protein	NA	NA	NA	NA	NA
AWF19857.1|2999708_3001001_-	O-antigen ligase like membrane family protein	NA	NA	NA	NA	NA
AWF20004.1|3000957_3002112_-	glycosyltransferase Family 4 family protein	NA	NA	NA	NA	NA
AWF22276.1|3002122_3003289_-	polysaccharide biosynthesis family protein	NA	NA	NA	NA	NA
AWF22178.1|3003292_3004243_-	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
AWF22479.1|3004584_3005088_+|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	99.4	3.7e-94
AWF22006.1|3005102_3007274_-	tyrosine-protein kinase etk	NA	NA	NA	NA	NA
AWF20557.1|3007292_3007481_-	putative acid phosphatase Wzb	NA	NA	NA	NA	NA
AWF22714.1|3007730_3008864_-	putative outer membrane lipoprotein Wza	NA	NA	NA	NA	NA
AWF20770.1|3009009_3010443_-	capsule assembly Wzi family protein	NA	NA	NA	NA	NA
AWF22517.1|3010732_3010855_+	hypothetical protein	NA	NA	NA	NA	NA
AWF19218.1|3011023_3011344_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWF20388.1|3011517_3011652_-	hypothetical protein	NA	NA	NA	NA	NA
AWF21389.1|3011879_3012248_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
>prophage 8
CP029115	Escherichia coli strain AR435 chromosome, complete genome	4831922	3090607	3100050	4831922		Enterobacteria_phage(85.71%)	9	NA	NA
AWF22166.1|3090607_3091744_+	VWA domain containing CoxE-like family protein	NA	Q9EYF7	Enterobacteria_phage	97.4	5.0e-163
AWF22555.1|3091740_3093741_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
AWF20408.1|3093865_3094327_+	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AWF22817.1|3094368_3094839_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	99.4	5.2e-82
AWF22839.1|3094885_3095605_-	response regulator	NA	NA	NA	NA	NA
AWF20620.1|3095601_3097287_-	putative sensor-like histidine kinase YehU	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AWF21661.1|3097508_3098240_+	merR regulatory family protein	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
AWF21270.1|3098387_3099119_-	putative osmoprotectant uptake system permease protein YehW	NA	NA	NA	NA	NA
AWF23342.1|3099123_3100050_-	ABC transporter family protein	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 9
CP029115	Escherichia coli strain AR435 chromosome, complete genome	4831922	3702930	3716113	4831922		Escherichia_phage(50.0%)	12	NA	NA
AWF22453.1|3702930_3705492_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
AWF20728.1|3705597_3706254_+	serine/threonine-protein phosphatase 2	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
AWF19407.1|3706304_3707072_-	HTH domain protein	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
AWF23151.1|3707267_3708176_+	3-hydroxyacyl-CoA dehydrogenase, NAD binding domain protein	NA	A0A077SLF7	Escherichia_phage	76.5	5.1e-118
AWF22651.1|3708172_3709435_+	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
AWF18992.1|3709473_3710070_+	class II Aldolase and Adducin N-terminal domain protein	NA	A0A077SK32	Escherichia_phage	74.6	2.3e-79
AWF23601.1|3710074_3710851_+	putative hydroxypyruvate isomerase YgbM	NA	NA	NA	NA	NA
AWF19111.1|3710939_3712304_+	inner membrane permease YgbN	NA	NA	NA	NA	NA
AWF21647.1|3712397_3713390_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
AWF21659.1|3713452_3714592_-	peptidase M23 family protein	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
AWF20219.1|3714731_3715358_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
AWF22981.1|3715351_3716113_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 10
CP029115	Escherichia coli strain AR435 chromosome, complete genome	4831922	3850458	3865524	4831922	head,integrase,transposase	Streptococcus_phage(25.0%)	14	3852923:3852939	3861905:3861921
AWF21266.1|3850458_3850899_+|transposase	putative transposase DDE domain protein	transposase	NA	NA	NA	NA
AWF21911.1|3850853_3851570_+|transposase	transposase DDE domain protein	transposase	NA	NA	NA	NA
AWF19350.1|3851972_3852767_-	hypothetical protein	NA	NA	NA	NA	NA
3852923:3852939	attL	TGGAGCGGGCGAAGGGA	NA	NA	NA	NA
AWF20442.1|3853361_3854489_-	hypothetical protein	NA	NA	NA	NA	NA
AWF19178.1|3854583_3854994_-	hypothetical protein	NA	NA	NA	NA	NA
AWF18999.1|3855350_3855842_-	hypothetical protein	NA	NA	NA	NA	NA
AWF21073.1|3856081_3856213_+	hypothetical protein	NA	NA	NA	NA	NA
AWF20119.1|3856941_3857238_-	hypothetical protein	NA	M1PSB6	Streptococcus_phage	43.0	4.8e-17
AWF23543.1|3857574_3858384_-|integrase	phage integrase family protein	integrase	NA	NA	NA	NA
AWF21066.1|3858564_3860106_+|integrase	integrase core domain protein	integrase	K4I413	Acidithiobacillus_phage	46.4	7.5e-130
AWF20594.1|3860117_3860867_+	istB-like ATP binding family protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
AWF21923.1|3860937_3861624_-|integrase	putative integrase domain protein	integrase	NA	NA	NA	NA
AWF22223.1|3862056_3862812_-	peptidase M23 family protein	NA	A0A7K9	Microcystis_virus	40.6	3.8e-10
3861905:3861921	attR	TGGAGCGGGCGAAGGGA	NA	NA	NA	NA
AWF21520.1|3863226_3865524_+|head	aldehyde oxidase and xanthine dehydrogenase, a/b hammerhead domain protein	head	NA	NA	NA	NA
>prophage 1
CP029113	Escherichia coli strain AR435 plasmid unnamed1, complete sequence	114412	42670	75594	114412	tRNA,integrase,transposase,protease	Salmonella_phage(33.33%)	34	35523:35536	58269:58282
35523:35536	attL	ATGGAAGGCGGCAC	NA	NA	NA	NA
AWF18820.1|42670_43069_-|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
AWF18768.1|43068_43296_-	antitoxin VapB	NA	NA	NA	NA	NA
AWF18888.1|43581_48648_+	conjugative transfer relaxase protein TraI	NA	NA	NA	NA	NA
AWF18764.1|48923_50465_+|integrase	integrase core domain protein	integrase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
AWF18890.1|50476_51226_+	istB-like ATP binding family protein	NA	K4HZD4	Acidithiobacillus_phage	48.3	3.9e-55
AWF18881.1|51325_52000_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.5	2.4e-08
AWF18870.1|52054_52615_+	fertility inhibition protein	NA	NA	NA	NA	NA
AWF18802.1|52927_53065_+	hypothetical protein	NA	NA	NA	NA	NA
AWF18858.1|53366_53993_+	NYN domain protein	NA	NA	NA	NA	NA
AWF18772.1|54144_54714_+	hypothetical protein	NA	NA	NA	NA	NA
AWF18796.1|55088_55355_+	hypothetical protein	NA	NA	NA	NA	NA
AWF18825.1|55897_56065_-	hypothetical protein	NA	NA	NA	NA	NA
AWF18850.1|56031_56289_+	replication regulatory RepB family protein	NA	NA	NA	NA	NA
AWF18824.1|56591_57449_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
AWF18827.1|58149_58290_+	hypothetical protein	NA	NA	NA	NA	NA
58269:58282	attR	GTGCCGCCTTCCAT	NA	NA	NA	NA
AWF18867.1|58268_58391_+	hypothetical protein	NA	NA	NA	NA	NA
AWF18859.1|58387_59041_+|protease	CAAX protease self-immunity family protein	protease	NA	NA	NA	NA
AWF18829.1|59133_59391_+	antitoxin PemI	NA	NA	NA	NA	NA
AWF18769.1|59392_59725_+	mRNA interferase PemK	NA	NA	NA	NA	NA
AWF18854.1|59861_62759_-	hypothetical protein	NA	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
AWF18804.1|62853_63459_+	resolvase, N terminal domain protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
AWF18856.1|63455_64217_-|transposase	tn3 transposase DDE domain protein	transposase	A0A1B0V7H9	Salmonella_phage	98.4	1.9e-134
AWF18797.1|64220_64628_+	isochorismatase family protein	NA	NA	NA	NA	NA
AWF18857.1|64765_65650_+	multidrug resistance efflux transporter family protein	NA	NA	NA	NA	NA
AWF18851.1|65681_66881_-	tetracycline resistance protein, class C	NA	NA	NA	NA	NA
AWF18834.1|66986_67637_+	tetracycline repressor protein class B from transposon Tn10	NA	NA	NA	NA	NA
AWF18837.1|67952_69542_-|transposase	tn3 transposase DDE domain protein	transposase	A0A1B0V7H9	Salmonella_phage	100.0	1.4e-293
AWF18767.1|69532_70237_+|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWF18771.1|70438_71227_+	nucleotidyltransferase domain protein	NA	NA	NA	NA	NA
AWF18847.1|71773_72613_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AWF18826.1|73099_74305_+	chromate transporter, chromate ion transporter family protein	NA	NA	NA	NA	NA
AWF18864.1|74315_74621_+	winged helix DNA-binding domain protein	NA	NA	NA	NA	NA
AWF18853.1|74646_74760_-	hypothetical protein	NA	NA	NA	NA	NA
AWF18765.1|74772_75594_-|transposase	putative transposase	transposase	NA	NA	NA	NA
>prophage 1
CP029117	Escherichia coli strain AR435 plasmid unnamed4	120846	0	116920	120846	terminase,plate,transposase,head,tail	Escherichia_phage(59.26%)	153	NA	NA
AWF23829.1|0_115_-	ddrB domain protein	NA	A0A077SK08	Escherichia_phage	100.0	2.1e-13
AWF23701.1|296_890_+	helix-turn-helix domain protein	NA	A0A077SL42	Escherichia_phage	98.4	1.6e-104
AWF23780.1|1021_1444_+|transposase	transposase, IS605 OrfB family	transposase	A0A077SL42	Escherichia_phage	100.0	4.5e-69
AWF23699.1|1482_1767_-	putative upf26.7	NA	A0A1B0V846	Salmonella_phage	73.3	1.2e-38
AWF23747.1|1871_2000_-|head	putative internal head protein	head	A0A077SLK4	Escherichia_phage	100.0	9.5e-07
AWF23711.1|2019_2145_-|head	putative internal head protein	head	A0A077SLK4	Escherichia_phage	82.5	3.4e-09
AWF23788.1|2113_2341_-|head	putative internal head protein	head	A0A077SLK4	Escherichia_phage	94.6	2.4e-24
AWF23722.1|2360_2498_-|head	putative internal head protein	head	NA	NA	NA	NA
AWF23765.1|2521_2809_-|head	putative internal head protein	head	A0A077SLK4	Escherichia_phage	94.4	1.3e-30
AWF23685.1|3043_3241_+	hypothetical protein	NA	NA	NA	NA	NA
AWF23739.1|3265_3481_-	putative darA domain protein	NA	A0A077SLK4	Escherichia_phage	98.5	9.7e-28
AWF23827.1|3437_3647_-	putative darA domain protein	NA	Q1MVM7	Enterobacteria_phage	100.0	1.4e-07
AWF23751.1|3737_4328_-	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	47.3	9.8e-30
AWF23787.1|4314_4467_-	hypothetical protein	NA	NA	NA	NA	NA
AWF23815.1|4517_4631_-	putative lydB	NA	Q37877	Escherichia_phage	97.3	6.4e-15
AWF23708.1|4831_4948_+	hypothetical protein	NA	NA	NA	NA	NA
AWF23784.1|5834_5948_-	helix-turn-helix domain of resolvase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	77.8	4.6e-05
AWF23720.1|5977_6394_-	resolvase, N terminal domain protein	NA	A0A1S6L009	Salmonella_phage	91.1	5.1e-65
AWF23731.1|6433_6577_+	hypothetical protein	NA	NA	NA	NA	NA
AWF23828.1|6651_6843_+	hypothetical protein	NA	NA	NA	NA	NA
AWF23737.1|6995_7145_-	hypothetical protein	NA	NA	NA	NA	NA
AWF23810.1|7185_7353_+|tail	caudovirales tail fiber assembly family protein	tail	E5G6P1	Salmonella_phage	57.7	3.0e-08
AWF23805.1|7324_7498_-|tail	caudovirales tail fiber assembly family protein	tail	U5P0S4	Shigella_phage	82.2	1.6e-12
AWF23745.1|7464_7632_+	hypothetical protein	NA	NA	NA	NA	NA
AWF23762.1|7597_7729_-|tail	putative tail fiber chaperone (Assembly protein) e14 prophage	tail	A0A0F7LDQ5	Escherichia_phage	80.8	1.3e-06
AWF23697.1|7815_8280_-	hypothetical protein	NA	M1TAS6	Escherichia_phage	61.1	3.0e-26
AWF23817.1|8498_8846_-|tail	phage tail fiber repeat family protein	tail	U5N099	Enterobacteria_phage	75.6	6.9e-07
AWF23759.1|9005_9236_-|tail	phage tail fiber repeat family protein	tail	U5N099	Enterobacteria_phage	92.5	6.8e-11
AWF23798.1|9384_9702_-|tail	phage tail fiber repeat family protein	tail	U5N099	Enterobacteria_phage	93.2	2.2e-12
AWF23804.1|9969_10938_-|tail	phage tail fiber repeat family protein	tail	A0A1B0V7G4	Salmonella_phage	94.5	4.6e-77
AWF23794.1|11630_12467_-	putative pep42	NA	A0A1B0V7F2	Salmonella_phage	98.2	8.4e-152
AWF23820.1|12466_13900_-	putative bplA domain protein	NA	A0A1B0VAD6	Salmonella_phage	99.8	8.2e-272
AWF23686.1|13896_14253_-	putative pmgA	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
AWF23706.1|14252_17948_-	transglycosylase SLT domain protein	NA	A0A1B0VDM8	Salmonella_phage	85.9	0.0e+00
AWF23683.1|17959_18076_-	hypothetical protein	NA	NA	NA	NA	NA
AWF23729.1|18029_18911_-	putative pmgB	NA	Q71TC9	Escherichia_phage	98.6	2.7e-172
AWF23676.1|18925_19537_-	putative tubB	NA	Q71TN8	Escherichia_phage	99.5	2.9e-109
AWF23790.1|19547_20114_-	putative tubA	NA	Q1MVL0	Enterobacteria_phage	99.5	1.1e-99
AWF23749.1|20344_21238_+	hypothetical protein	NA	A0A1B5FPC5	Escherichia_phage	30.3	3.4e-26
AWF23764.1|21289_21601_-	hypothetical protein	NA	NA	NA	NA	NA
AWF23782.1|21788_21947_-	putative membrane protein	NA	NA	NA	NA	NA
AWF23735.1|22635_22857_+	putative cell division repressor	NA	Q38557	Escherichia_phage	80.3	9.3e-26
AWF23732.1|22853_23945_+	hypothetical protein	NA	A0A077SLR9	Escherichia_phage	79.8	7.1e-159
AWF23679.1|24109_24910_+	kilA-N domain protein	NA	Q1MVK4	Enterobacteria_phage	100.0	1.9e-148
AWF23713.1|24939_25785_+	putative replication protein repL	NA	Q1MVK3	Enterobacteria_phage	97.5	1.8e-149
AWF23770.1|26049_27105_+	cobQ/CobB/MinD/ParA nucleotide binding domain protein	NA	H2BD62	Pseudomonas_phage	70.8	9.0e-143
AWF23698.1|27751_28186_-	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	100.0	3.5e-77
AWF23753.1|28519_29029_-	putative upf52.7	NA	Q1MVJ9	Enterobacteria_phage	100.0	1.3e-91
AWF23724.1|29040_29280_-	putative pmgG	NA	Q71TB4	Escherichia_phage	98.7	1.3e-36
AWF23736.1|29344_29545_+	hypothetical protein	NA	NA	NA	NA	NA
AWF23824.1|29657_30389_-	putative upf54.2	NA	A0A1B0V835	Salmonella_phage	98.8	3.4e-96
AWF23808.1|30482_32072_-	putative gp22	NA	Q71TB2	Escherichia_phage	98.5	1.9e-301
AWF23819.1|32132_33839_-	putative upf57.5	NA	Q1MVJ5	Enterobacteria_phage	94.4	4.7e-311
AWF23826.1|34065_35067_-	parB	NA	Q38420	Escherichia_phage	99.7	4.8e-178
AWF23761.1|35083_36232_-	plasmid partition protein A	NA	A0A077SL49	Escherichia_phage	100.0	4.6e-217
AWF23756.1|36837_37596_-	replication protein RepA	NA	Q71TL8	Escherichia_phage	100.0	5.7e-139
AWF23719.1|38024_38426_-	putative upfA	NA	Q71TL7	Escherichia_phage	54.0	5.5e-32
AWF23755.1|38496_38856_-	phage family protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	69.1	4.6e-38
AWF23677.1|38867_38999_-	putative membrane lipoprotein	NA	Q71TL6	Escherichia_phage	97.7	6.1e-17
AWF23821.1|39033_39456_-	putative ppfA	NA	A0A1B0VCB0	Salmonella_phage	100.0	2.7e-58
AWF23778.1|39495_40284_-	putative upfB	NA	A0A1B0V830	Salmonella_phage	96.9	1.7e-117
AWF23802.1|41022_41928_+	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.7	1.6e-159
AWF23803.1|41996_44189_+	DNA adenine methylase family protein	NA	A0A077SL51	Escherichia_phage	98.1	1.8e-23
AWF23730.1|45317_45434_+	hypothetical protein	NA	A0A1B0VAL9	Salmonella_phage	97.4	1.1e-14
AWF23750.1|46163_46991_+	SPFH domain / Band 7 family protein	NA	A0A077SLJ6	Escherichia_phage	100.0	1.6e-131
AWF23710.1|47174_47315_-	hypothetical protein	NA	NA	NA	NA	NA
AWF23716.1|47449_48745_+	replicative DNA helicase	NA	O80281	Escherichia_phage	99.8	2.3e-241
AWF23777.1|48744_49743_+	glycosyl transferases group 1 family protein	NA	Q71TK3	Escherichia_phage	99.1	8.1e-194
AWF23796.1|49789_50197_-	putative upf76.8	NA	A0A077SK50	Escherichia_phage	98.9	3.5e-42
AWF23809.1|50414_51248_-	putative upf77.7	NA	A0A077SLQ1	Escherichia_phage	99.3	1.9e-156
AWF23703.1|51432_52218_-	putative gp24	NA	A0A1B0V7N6	Salmonella_phage	99.6	3.6e-144
AWF23831.1|52204_52933_-	putative upf79.2	NA	A0A077SK19	Escherichia_phage	100.0	9.3e-139
AWF23758.1|52936_54154_-	putative gp25	NA	A0A077SL53	Escherichia_phage	100.0	1.1e-224
AWF23675.1|54163_54424_-	putative 26 protein	NA	Q38620	Escherichia_phage	100.0	1.6e-45
AWF23691.1|54687_54933_+	putative pmgL	NA	Q71T86	Escherichia_phage	100.0	5.7e-40
AWF23741.1|54935_55514_+	VRR-NUC domain protein	NA	Q71T85	Escherichia_phage	99.5	5.7e-107
AWF23774.1|55619_55736_+	putative hdmA	NA	Q71TJ4	Escherichia_phage	100.0	2.8e-13
AWF23738.1|56237_56864_+	putative pmgP	NA	Q71T82	Escherichia_phage	100.0	6.1e-123
AWF23684.1|56860_57538_+	serine/threonine-protein phosphatase	NA	Q71TJ1	Escherichia_phage	99.6	1.1e-133
AWF23717.1|57534_58236_+	putative pmgQ	NA	Q71TJ0	Escherichia_phage	99.6	2.1e-143
AWF23779.1|58537_59800_+	putative pmgS	NA	Q71TI8	Escherichia_phage	99.8	9.2e-235
AWF23718.1|59872_60379_+	putative morphogenetic protein	NA	A0A1B0VAK0	Salmonella_phage	99.4	1.8e-93
AWF23723.1|60429_60564_+	putative membrane protein	NA	A0A1B0VBV0	Salmonella_phage	100.0	9.6e-18
AWF23702.1|60573_61302_+	hypothetical protein	NA	Q71T76	Escherichia_phage	99.1	1.7e-140
AWF23816.1|61385_61589_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	94.0	5.2e-31
AWF23789.1|61581_61821_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	97.5	1.3e-36
AWF23797.1|61817_62543_+	ead/Ea22-like family protein	NA	A0A0U2QW67	Escherichia_phage	49.8	7.5e-48
AWF23793.1|62638_62839_+	hypothetical protein	NA	Q716F3	Shigella_phage	100.0	2.4e-36
AWF23715.1|62840_63398_+	ead/Ea22-like family protein	NA	A0A0N7BYR8	Escherichia_phage	62.8	5.1e-36
AWF23746.1|63399_63663_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	73.6	6.7e-31
AWF23769.1|63673_64273_+	hypothetical protein	NA	A0A1B0V865	Salmonella_phage	92.6	7.5e-78
AWF23709.1|64355_64589_+	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	97.4	1.6e-36
AWF23694.1|64637_64760_+	putative membrane protein	NA	A0A1B0V7K1	Salmonella_phage	87.5	1.4e-12
AWF23757.1|64767_65061_+	putative gp44	NA	A0A077SK23	Escherichia_phage	91.8	9.1e-45
AWF23792.1|65067_65442_+	hypothetical protein	NA	A0A1B0VBU7	Salmonella_phage	97.6	1.1e-66
AWF23740.1|65438_66356_+	putative upf89.5	NA	A0A1B0VDS6	Salmonella_phage	97.7	9.2e-176
AWF23801.1|66352_66715_+	putative pmgV	NA	Q71TI4	Escherichia_phage	100.0	2.2e-56
AWF23680.1|66789_66927_-	hypothetical protein	NA	NA	NA	NA	NA
AWF23695.1|67227_67341_+	hypothetical protein	NA	Q71TI1	Escherichia_phage	94.6	4.7e-10
AWF23752.1|67376_67628_+	hot	NA	Q71T70	Escherichia_phage	94.0	4.6e-37
AWF23704.1|67841_68141_+	putative sOS mutagenesis and repair protein UmuD	NA	Q1MVE7	Enterobacteria_phage	100.0	1.3e-51
AWF23678.1|68213_68435_+	antitoxin phd	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
AWF23696.1|68434_68815_+	toxin doc	NA	Q71T66	Escherichia_phage	100.0	1.9e-63
AWF23771.1|68819_68999_+	putative pdcA	NA	Q71TH5	Escherichia_phage	98.3	2.7e-23
AWF23776.1|69026_70070_+	hypothetical protein	NA	A0A077SLM1	Escherichia_phage	98.8	2.2e-205
AWF23692.1|70236_70611_+	putative late promoter-activating protein	NA	A0A1B0VDS0	Salmonella_phage	99.2	1.6e-62
AWF23823.1|70697_71891_+	helix-turn-helix domain protein	NA	Q5QBP3	Enterobacteria_phage	99.0	4.1e-208
AWF23744.1|71890_73375_+|terminase	putative large terminase protein	terminase	Q5QBP2	Enterobacteria_phage	100.0	2.5e-292
AWF23748.1|73399_74251_-	repressor protein C1	NA	A0A077SLM8	Escherichia_phage	99.6	6.1e-158
AWF23760.1|75174_75396_+	putative cre-associated protein	NA	Q5QBN7	Enterobacteria_phage	100.0	4.5e-36
AWF23734.1|75403_76435_+	recombinase cre	NA	Q71TG5	Escherichia_phage	99.7	2.2e-194
AWF23806.1|77042_77603_+	recombination enhancement function protein	NA	Q5QBN4	Enterobacteria_phage	95.7	2.3e-97
AWF23775.1|77818_78433_+	putative maturation control protein	NA	A0A077SK30	Escherichia_phage	98.0	2.5e-108
AWF23785.1|78489_79797_+	SIR2-like domain protein	NA	NA	NA	NA	NA
AWF23727.1|79843_79981_-	modulator protein	NA	Q71TG0	Escherichia_phage	100.0	4.7e-20
AWF23693.1|80088_80463_-	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	99.2	2.9e-67
AWF23688.1|80562_87219_-	SNF2 family N-terminal domain protein	NA	Q1MVN7	Enterobacteria_phage	98.6	0.0e+00
AWF23783.1|87405_89115_+	putative proA	NA	Q1MVN6	Enterobacteria_phage	99.6	0.0e+00
AWF23714.1|89212_90127_+	putative proB	NA	Q71TR6	Escherichia_phage	88.5	6.6e-142
AWF23690.1|90418_90976_-	lysozyme	NA	Q71TF3	Escherichia_phage	100.0	4.2e-107
AWF23767.1|91144_91633_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	87.7	1.1e-74
AWF23721.1|91835_92624_+	putative isaA	NA	A0A077SK34	Escherichia_phage	99.2	8.0e-144
AWF23791.1|92616_93711_+	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	36.7	6.7e-40
AWF23813.1|93742_94051_-	putative odaA	NA	O21974	Escherichia_phage	97.1	5.4e-48
AWF23754.1|94040_97004_-	putative ddrB	NA	A0A1B0VFX4	Salmonella_phage	99.5	0.0e+00
AWF23830.1|97187_98336_+|transposase	transposase, IS605 OrfB family	transposase	A0A077SL42	Escherichia_phage	100.0	5.3e-213
AWF23733.1|98375_98717_-	putative upf26.7	NA	A0A1B0V846	Salmonella_phage	84.1	6.9e-44
AWF23812.1|98737_100657_-	putative darA protein	NA	A0A1B0V7H1	Salmonella_phage	98.4	0.0e+00
AWF23707.1|100658_101261_-	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	100.0	5.4e-100
AWF23814.1|101247_101691_-	putative lydB	NA	A0A077SK09	Escherichia_phage	100.0	1.3e-82
AWF23681.1|101687_101804_-	putative lydA	NA	Q37876	Escherichia_phage	100.0	8.0e-13
AWF23743.1|102790_103363_-	resolvase, N terminal domain protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.6	1.5e-83
AWF23768.1|103393_103882_+	phage Tail Collar domain protein	NA	M1TAS6	Escherichia_phage	72.2	1.7e-59
AWF23728.1|103881_104484_+|tail	caudovirales tail fiber assembly family protein	tail	M1SV83	Escherichia_phage	87.5	2.3e-95
AWF23781.1|104455_104872_-|tail	caudovirales tail fiber assembly family protein	tail	B6SCW7	Bacteriophage	47.6	4.1e-22
AWF23700.1|104874_106983_-	hypothetical protein	NA	A0A0F7LDR4	Escherichia_phage	50.5	1.3e-28
AWF23726.1|107089_107395_-|tail	phage tail fiber repeat family protein	tail	Q71TP5	Escherichia_phage	61.6	1.2e-07
AWF23682.1|107417_108092_-|tail	putative major tail fiber protein S	tail	A0A077SK37	Escherichia_phage	92.4	8.4e-102
AWF23795.1|108103_108538_-|tail	putative tail fiber protein R	tail	A0A077SLL3	Escherichia_phage	100.0	3.3e-75
AWF23725.1|108616_109453_-	putative pep42	NA	A0A1B0V7F2	Salmonella_phage	98.2	8.4e-152
AWF23800.1|109433_109829_-	bplA domain protein	NA	Q71TP2	Escherichia_phage	100.0	1.4e-59
AWF23825.1|109968_110367_-	putative pep43	NA	Q71TP2	Escherichia_phage	96.2	2.8e-65
AWF23705.1|110380_110776_-|plate	putative baseplate structural protein	plate	Q71TP2	Escherichia_phage	92.4	9.4e-53
AWF23822.1|110919_111066_+	hypothetical protein	NA	NA	NA	NA	NA
AWF23811.1|111230_111548_-	hypothetical protein	NA	A0A1B0VDM8	Salmonella_phage	100.0	6.4e-52
AWF23687.1|111800_111947_-	sit domain protein	NA	Q71TP0	Escherichia_phage	94.3	1.7e-12
AWF23742.1|112686_113019_-	putative structural lytic transglycosylase domain protein	NA	NA	NA	NA	NA
AWF23772.1|113987_114176_-	hypothetical protein	NA	Q71TP0	Escherichia_phage	78.0	1.9e-11
AWF23766.1|115176_115524_-	putative pmgB	NA	Q71TC9	Escherichia_phage	100.0	1.8e-31
AWF23763.1|115520_115682_-	hypothetical protein	NA	A0A077SLL9	Escherichia_phage	88.2	9.5e-12
AWF23807.1|115835_115991_-|tail	putative major tail tube protein	tail	Q71TN8	Escherichia_phage	100.0	1.6e-19
AWF23799.1|116208_116331_-	hypothetical protein	NA	NA	NA	NA	NA
AWF23773.1|116506_116920_-	putative tubA	NA	Q1MVL0	Enterobacteria_phage	99.2	1.5e-61
>prophage 1
CP029118	Escherichia coli strain AR435 plasmid unnamed5, complete sequence	187909	45205	89268	187909	integrase,transposase	Acidithiobacillus_phage(18.18%)	40	61441:61454	96704:96717
AWF23855.1|45205_46726_+|integrase	integrase core domain protein	integrase	K4I413	Acidithiobacillus_phage	46.7	1.4e-125
AWF23955.1|46740_47496_+	phoH-like family protein	NA	K4HZD4	Acidithiobacillus_phage	51.5	3.4e-59
AWF23848.1|47533_47764_-	hypothetical protein	NA	NA	NA	NA	NA
AWF23872.1|47766_48288_-	hypothetical protein	NA	NA	NA	NA	NA
AWF24017.1|48292_48901_-	hypothetical protein	NA	NA	NA	NA	NA
AWF23927.1|49168_50284_+	phosphoadenosine phosphosulfate reductase family protein	NA	H7BVI4	unidentified_phage	28.9	8.3e-46
AWF23906.1|50301_50736_+	putative membrane protein	NA	NA	NA	NA	NA
AWF23948.1|51772_52873_-	putative repAC protein	NA	NA	NA	NA	NA
AWF23885.1|52857_53145_-	hypothetical protein	NA	NA	NA	NA	NA
AWF23961.1|54187_55171_+	putative stbA plasmid stability protein	NA	A7KUY1	Bacillus_phage	24.4	2.1e-08
AWF24022.1|55623_55902_+	H-NS histone family protein	NA	NA	NA	NA	NA
AWF23972.1|56509_57118_-	flagellar transcriptional activator family protein	NA	NA	NA	NA	NA
AWF24021.1|59049_62664_-	putative traG protein	NA	NA	NA	NA	NA
61441:61454	attL	ACCAGCACTGAGGC	NA	NA	NA	NA
AWF23973.1|62676_64110_-	conjugative relaxosome accessory transposon family protein	NA	NA	NA	NA	NA
AWF23997.1|64111_65152_-	F plasmid transfer operon family protein	NA	NA	NA	NA	NA
AWF23934.1|65262_66774_-	description family protein	NA	A0A2D1GN12	Pseudoalteromonas_phage	30.7	3.6e-44
AWF23935.1|67060_68101_-	plasmid replication region DNA-binding N-term family protein	NA	NA	NA	NA	NA
AWF23834.1|68253_69129_-	DNA replication terminus site-binding family protein	NA	NA	NA	NA	NA
AWF23959.1|69445_69937_-	hypothetical protein	NA	NA	NA	NA	NA
AWF23857.1|69933_70803_-	exonuclease family protein	NA	A0A1S6L012	Salmonella_phage	35.1	3.5e-23
AWF23853.1|70807_71818_-|integrase	phage integrase family protein	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
AWF23871.1|71820_72357_-	hypothetical protein	NA	NA	NA	NA	NA
AWF23932.1|72655_72937_-	hypothetical protein	NA	NA	NA	NA	NA
AWF23905.1|73206_73809_+	hypothetical protein	NA	NA	NA	NA	NA
AWF24002.1|73824_74169_-	hypothetical protein	NA	NA	NA	NA	NA
AWF23942.1|74447_74813_-	hypothetical protein	NA	NA	NA	NA	NA
AWF23856.1|74859_79113_-	RHS repeat-associated core domain protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	47.6	1.1e-18
AWF23983.1|79245_79971_-	hypothetical protein	NA	NA	NA	NA	NA
AWF23849.1|80864_81368_+|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AWF24000.1|81718_82723_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWF23903.1|82801_83236_-	hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AWF24003.1|83307_83658_+	merT mercuric transport family protein	NA	NA	NA	NA	NA
AWF23838.1|83671_83947_+	mercuric transport protein periplasmic component	NA	NA	NA	NA	NA
AWF23883.1|83982_84405_+	merC mercury resistance family protein	NA	NA	NA	NA	NA
AWF24006.1|84456_86151_+	mercuric reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AWF24005.1|86168_86531_+	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
AWF23930.1|86527_86764_+	merE family protein	NA	NA	NA	NA	NA
AWF23946.1|86799_87354_+	EAL domain protein	NA	NA	NA	NA	NA
AWF23994.1|87542_88811_+|integrase	integrase core domain protein	integrase	NA	NA	NA	NA
AWF23945.1|88857_89268_+|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.9e-72
96704:96717	attR	GCCTCAGTGCTGGT	NA	NA	NA	NA
>prophage 2
CP029118	Escherichia coli strain AR435 plasmid unnamed5, complete sequence	187909	93468	136105	187909	integrase,transposase	Escherichia_phage(40.91%)	41	87339:87353	140152:140166
87339:87353	attL	TGATGCCCGTGACTA	NA	NA	NA	NA
AWF23956.1|93468_94026_-	transposon Tn3 resolvase	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
AWF23914.1|94189_97195_+	hypothetical protein	NA	Q1MVP5	Enterobacteria_phage	99.5	0.0e+00
AWF23879.1|97234_97564_+	DDE domain protein	NA	A0A077SL39	Escherichia_phage	99.1	2.4e-57
AWF23928.1|97933_98461_-	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	98.9	1.4e-91
AWF23960.1|98553_99186_-	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	98.9	8.5e-96
AWF23967.1|99197_100100_-	3-hydroxyacyl-CoA dehydrogenase, NAD binding domain protein	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AWF23979.1|100361_101123_+	HTH domain protein	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AWF23962.1|101143_102004_-	beta-lactamase SHV-2	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AWF23929.1|102140_102845_+|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWF23937.1|102995_103361_-|transposase	transposase domain protein	transposase	NA	NA	NA	NA
AWF23947.1|103360_104527_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWF23918.1|104500_104776_+	hypothetical protein	NA	NA	NA	NA	NA
AWF23869.1|105078_106719_-	chaperonin GroL	NA	A0A219YK78	uncultured_virus	62.1	8.2e-175
AWF23915.1|106774_107065_-	10 kDa chaperonin	NA	A0A221S322	uncultured_virus	47.8	2.1e-17
AWF23975.1|107092_107596_+	divalent-cation tolerance CutA domain protein	NA	NA	NA	NA	NA
AWF23902.1|107592_108624_+	disulfide bond corrector DsbC family protein	NA	NA	NA	NA	NA
AWF23882.1|108634_109105_-	N-(5'phosphoribosyl)anthranilate (PRA) isomerase family protein	NA	NA	NA	NA	NA
AWF23936.1|109277_109643_-	bleomycin resistance protein	NA	NA	NA	NA	NA
AWF23953.1|109646_110459_-	beta-lactamase NDM-1	NA	NA	NA	NA	NA
AWF23865.1|110839_111343_+|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AWF23860.1|111693_112698_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWF23878.1|112776_113211_-	hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AWF23923.1|113405_115421_-|transposase	tn3 transposase DDE domain protein	transposase	Q1MVP5	Enterobacteria_phage	99.9	0.0e+00
AWF23861.1|115665_116370_-|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AWF24009.1|116360_117188_+	initiator Replication family protein	NA	A0A218MNI2	uncultured_virus	42.5	3.9e-48
AWF23847.1|117575_117797_+	hypothetical protein	NA	NA	NA	NA	NA
AWF23978.1|118155_119040_-	phosphotransferase enzyme family protein	NA	NA	NA	NA	NA
AWF23944.1|119095_120571_-	miro-like family protein	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
AWF23891.1|120969_122145_-|transposase	transposase DDE domain protein	transposase	A0A0F7LAS3	uncultured_marine_virus	35.4	4.5e-50
AWF24008.1|122202_122388_+	hypothetical protein	NA	NA	NA	NA	NA
AWF23896.1|122869_123685_-	16S rRNA methylase	NA	NA	NA	NA	NA
AWF23963.1|123968_124535_-|transposase	transposase DDE domain protein	transposase	A0A1V0E8E1	Vibrio_phage	64.2	1.6e-61
AWF24020.1|125041_125287_-	hypothetical protein	NA	NA	NA	NA	NA
AWF23845.1|125618_126581_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWF23920.1|126985_127825_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AWF23863.1|128329_129109_-	nucleotidyltransferase domain protein	NA	NA	NA	NA	NA
AWF23992.1|129166_129280_+	hypothetical protein	NA	NA	NA	NA	NA
AWF24013.1|130170_131184_+|integrase	integron integrase family protein	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AWF23995.1|131489_132047_+	resolvase, N terminal domain protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
AWF24023.1|132400_135022_+	hypothetical protein	NA	A0A1B0V7H9	Salmonella_phage	74.9	0.0e+00
AWF23911.1|135100_136105_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
140152:140166	attR	TGATGCCCGTGACTA	NA	NA	NA	NA
