The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029173	Methylobacterium sp. DM1 chromosome, complete genome	5664348	1245725	1296829	5664348	integrase,transposase	Enterobacteria_phage(12.5%)	34	1282435:1282450	1303226:1303241
AWI87850.1|1245725_1246909_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWI87851.1|1246960_1247143_+	hypothetical protein	NA	NA	NA	NA	NA
AWI87852.1|1247729_1248713_-	hypothetical protein	NA	NA	NA	NA	NA
AWI87853.1|1249194_1250196_+	hypothetical protein	NA	NA	NA	NA	NA
AWI87854.1|1250985_1252077_+	hypothetical protein	NA	NA	NA	NA	NA
AWI87855.1|1254204_1254768_+	resolvase	NA	Q1MVP4	Enterobacteria_phage	42.1	1.2e-29
AWI87856.1|1256788_1258189_+	hypothetical protein	NA	NA	NA	NA	NA
AWI87857.1|1260491_1260914_-	hypothetical protein	NA	NA	NA	NA	NA
AWI87858.1|1262747_1263758_-|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	39.4	4.1e-52
AWI87859.1|1264268_1266536_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
AWI87860.1|1266710_1267136_+	hypothetical protein	NA	NA	NA	NA	NA
AWI87861.1|1268996_1269998_+	hypothetical protein	NA	L7TM14	Rhizobium_phage	30.3	1.2e-14
AWI87862.1|1270443_1271370_-|integrase	integrase	integrase	A0A0A1I5U0	Burkholderia_phage	42.3	1.4e-59
AWI91564.1|1273444_1273630_-	hypothetical protein	NA	NA	NA	NA	NA
AWI91565.1|1273792_1274629_+	HNH endonuclease	NA	NA	NA	NA	NA
AWI87863.1|1275186_1275393_-	hypothetical protein	NA	NA	NA	NA	NA
AWI87864.1|1275660_1276149_-	hypothetical protein	NA	NA	NA	NA	NA
AWI91566.1|1276343_1276562_+	hypothetical protein	NA	NA	NA	NA	NA
AWI87865.1|1276987_1277419_+	hypothetical protein	NA	NA	NA	NA	NA
AWI87866.1|1277532_1278297_+	3-oxoacyl-ACP reductase	NA	A0A2P0VP75	Tetraselmis_virus	26.1	4.4e-06
AWI87867.1|1278382_1278562_+	hypothetical protein	NA	NA	NA	NA	NA
AWI87868.1|1278619_1278862_+	hypothetical protein	NA	NA	NA	NA	NA
AWI87869.1|1279173_1280709_+|transposase	ISL3-like element ISMdi2 family transposase	transposase	NA	NA	NA	NA
AWI87870.1|1280936_1281668_-	ATPase	NA	A0A059NT77	Lactococcus_phage	34.8	9.0e-33
AWI87871.1|1281667_1283173_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
1282435:1282450	attL	GCACCTGGTTCTCGAC	NA	NA	NA	NA
AWI91567.1|1283978_1285700_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.4	2.6e-14
AWI87872.1|1285725_1286661_+	blue light sensor protein	NA	NA	NA	NA	NA
AWI87873.1|1286887_1287976_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AWI87874.1|1288583_1288856_-	hypothetical protein	NA	NA	NA	NA	NA
AWI87875.1|1288960_1289455_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWI87876.1|1289571_1291269_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
AWI87877.1|1292450_1292948_+	hypothetical protein	NA	NA	NA	NA	NA
AWI87878.1|1293170_1293944_-	pilus assembly protein	NA	NA	NA	NA	NA
AWI87879.1|1295725_1296829_-|integrase	integrase	integrase	A0A291AUF0	Sinorhizobium_phage	43.2	1.4e-69
1303226:1303241	attR	GTCGAGAACCAGGTGC	NA	NA	NA	NA
>prophage 2
CP029173	Methylobacterium sp. DM1 chromosome, complete genome	5664348	1369754	1438383	5664348	integrase,transposase	uncultured_Caudovirales_phage(30.0%)	57	1403271:1403288	1442564:1442581
AWI87944.1|1369754_1371023_-|transposase	IS256-like element ISMex3 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.7	2.5e-91
AWI87945.1|1374707_1375148_-	hypothetical protein	NA	NA	NA	NA	NA
AWI87946.1|1375152_1375734_-	DNA invertase	NA	E5FFF9	Burkholderia_phage	47.9	2.5e-41
AWI87947.1|1375927_1377586_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
AWI87948.1|1377729_1377987_-	hypothetical protein	NA	NA	NA	NA	NA
AWI91573.1|1379754_1380528_-	class III cytochrome C family protein	NA	NA	NA	NA	NA
AWI87949.1|1380524_1381274_-	hypothetical protein	NA	NA	NA	NA	NA
AWI87950.1|1381279_1383259_-	flavodoxin	NA	NA	NA	NA	NA
AWI87951.1|1383298_1383982_-	hypothetical protein	NA	NA	NA	NA	NA
AWI87952.1|1384172_1384973_+	hypothetical protein	NA	NA	NA	NA	NA
AWI87953.1|1384948_1385383_-	hypothetical protein	NA	NA	NA	NA	NA
AWI87954.1|1385413_1385797_-	hypothetical protein	NA	NA	NA	NA	NA
AWI87955.1|1386018_1386282_-	RND transporter	NA	NA	NA	NA	NA
AWI87956.1|1386915_1388955_+	copper oxidase	NA	NA	NA	NA	NA
AWI87957.1|1388964_1389753_+	copper resistance protein CopB	NA	NA	NA	NA	NA
AWI87958.1|1390056_1390353_+	hypothetical protein	NA	NA	NA	NA	NA
AWI87959.1|1391436_1392411_-	hypothetical protein	NA	NA	NA	NA	NA
AWI87960.1|1392851_1393448_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWI87961.1|1395594_1396311_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWI87962.1|1396461_1397760_+	MFS transporter	NA	NA	NA	NA	NA
AWI87963.1|1397801_1398878_+	tartrate dehydrogenase	NA	NA	NA	NA	NA
AWI87964.1|1398882_1400142_+	glycerate kinase	NA	NA	NA	NA	NA
AWI91574.1|1400181_1401594_+	pyruvate kinase	NA	NA	NA	NA	NA
AWI87965.1|1402045_1402258_+	hypothetical protein	NA	NA	NA	NA	NA
AWI87966.1|1402305_1403052_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	66.1	2.2e-82
AWI87967.1|1403102_1403981_+	ArsR family transcriptional regulator	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	43.9	5.8e-26
1403271:1403288	attL	GCGCATGCCGGGCTGATC	NA	NA	NA	NA
AWI87968.1|1403980_1404406_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	61.3	1.9e-43
AWI87969.1|1404414_1405482_+	arsenical-resistance protein	NA	NA	NA	NA	NA
AWI87970.1|1405471_1406647_+	MFS transporter	NA	NA	NA	NA	NA
AWI87971.1|1406834_1407107_+	hypothetical protein	NA	NA	NA	NA	NA
AWI91575.1|1409027_1410677_-|transposase	ISL3 family transposase ISMex10	transposase	NA	NA	NA	NA
AWI87972.1|1410811_1411994_+|transposase	IS3-like element ISMex5 family transposase	transposase	S5WIU1	Leptospira_phage	32.4	7.3e-32
AWI87973.1|1412003_1412252_+	hypothetical protein	NA	NA	NA	NA	NA
AWI87974.1|1412151_1412832_-	RNA polymerase subunit sigma-70	NA	A0A0F6TH34	Sinorhizobium_phage	38.7	1.9e-13
AWI87975.1|1413312_1414902_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
AWI87976.1|1415073_1415289_-	hypothetical protein	NA	NA	NA	NA	NA
AWI87977.1|1415346_1415829_-	hypothetical protein	NA	NA	NA	NA	NA
AWI87978.1|1416130_1416439_+	cytochrome C biogenesis protein	NA	NA	NA	NA	NA
AWI87979.1|1417996_1419232_-	carbohydrate porin	NA	NA	NA	NA	NA
AWI87980.1|1420576_1420999_-	hypothetical protein	NA	NA	NA	NA	NA
AWI87981.1|1421947_1422682_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.8	2.5e-27
AWI87982.1|1422678_1424013_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	33.7	4.5e-06
AWI87983.1|1424109_1424364_+	hypothetical protein	NA	NA	NA	NA	NA
AWI87984.1|1424926_1425118_+	hypothetical protein	NA	NA	NA	NA	NA
AWI87985.1|1425462_1425834_+	hypothetical protein	NA	NA	NA	NA	NA
AWI87986.1|1425958_1427323_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AWI87987.1|1427334_1430583_+	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
AWI87988.1|1430588_1431143_+	threonyl-trna synthetase	NA	NA	NA	NA	NA
AWI87989.1|1431188_1432106_+	cation transporter	NA	A0A1V0SED0	Indivirus	39.3	6.7e-09
AWI87990.1|1432611_1432866_+	hypothetical protein	NA	NA	NA	NA	NA
AWI87991.1|1433241_1434786_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
AWI87992.1|1434988_1435729_-	hypothetical protein	NA	NA	NA	NA	NA
AWI87993.1|1435916_1436183_+	hypothetical protein	NA	NA	NA	NA	NA
AWI87994.1|1436298_1436505_-	hypothetical protein	NA	NA	NA	NA	NA
AWI87995.1|1436580_1436829_-	hypothetical protein	NA	NA	NA	NA	NA
AWI87996.1|1437656_1437893_+	hypothetical protein	NA	NA	NA	NA	NA
AWI87997.1|1438092_1438383_+|integrase	integrase	integrase	NA	NA	NA	NA
1442564:1442581	attR	GCGCATGCCGGGCTGATC	NA	NA	NA	NA
>prophage 3
CP029173	Methylobacterium sp. DM1 chromosome, complete genome	5664348	1686022	1723699	5664348	tail,head,protease,capsid	Tupanvirus(14.29%)	35	NA	NA
AWI88190.1|1686022_1687486_-|protease	serine protease	protease	NA	NA	NA	NA
AWI88191.1|1687709_1693016_+	alpha-2-macroglobulin	NA	NA	NA	NA	NA
AWI91593.1|1693071_1695135_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
AWI88192.1|1695285_1695606_+	quaternary ammonium compound-resistance protein SugE	NA	NA	NA	NA	NA
AWI88193.1|1695615_1696407_-	transcriptional regulator	NA	NA	NA	NA	NA
AWI88194.1|1696457_1697105_-	class GN sortase	NA	NA	NA	NA	NA
AWI88195.1|1697101_1699285_-	marine proteobacterial sortase target protein	NA	A0A2K9L4P5	Tupanvirus	21.4	2.4e-12
AWI88196.1|1699518_1700127_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
AWI88197.1|1700117_1700837_-	hypothetical protein	NA	NA	NA	NA	NA
AWI88198.1|1700901_1701915_-	nickel transporter	NA	NA	NA	NA	NA
AWI88199.1|1701905_1702571_-	DUF1007 domain-containing protein	NA	NA	NA	NA	NA
AWI88200.1|1702801_1703260_-	cytochrome C biogenesis protein	NA	NA	NA	NA	NA
AWI88201.1|1703256_1705257_-	heme lyase NrfEFG subunit NrfE	NA	NA	NA	NA	NA
AWI88202.1|1705315_1705837_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
AWI91594.1|1705997_1707548_-	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
AWI88203.1|1707695_1709111_-	ATP-binding protein	NA	NA	NA	NA	NA
AWI88204.1|1709203_1709440_+	transcription factor	NA	NA	NA	NA	NA
AWI88205.1|1709439_1709838_+	VapC toxin family PIN domain ribonuclease	NA	NA	NA	NA	NA
AWI88206.1|1709842_1710520_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AWI88207.1|1710569_1711124_-	hypothetical protein	NA	NA	NA	NA	NA
AWI88208.1|1711137_1711365_-	hypothetical protein	NA	NA	NA	NA	NA
AWI88209.1|1711385_1711739_-	hypothetical protein	NA	NA	NA	NA	NA
AWI88210.1|1711801_1712374_-	hypothetical protein	NA	NA	NA	NA	NA
AWI88211.1|1712424_1712985_-	glycoside hydrolase	NA	W6E9Q2	Rhizobium_phage	43.4	2.8e-26
AWI88212.1|1713031_1714114_-	hypothetical protein	NA	A0A0K1LM54	Rhodobacter_phage	38.8	3.4e-36
AWI88213.1|1717162_1717789_-|tail	phage tail protein	tail	K7YBG2	uncultured_Mediterranean_phage	44.4	2.8e-06
AWI88214.1|1717788_1718019_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
AWI88215.1|1718015_1718342_-	gene transfer agent family protein	NA	NA	NA	NA	NA
AWI88216.1|1718344_1718755_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
AWI88217.1|1718785_1719205_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
AWI88218.1|1719564_1720140_-	hypothetical protein	NA	NA	NA	NA	NA
AWI88219.1|1720173_1720929_+	peptidase S1	NA	NA	NA	NA	NA
AWI88220.1|1721074_1721923_+	peptidase S1	NA	I6WTR7	Cotesia_sesamiae_Mombasa_bracovirus	22.9	5.4e-05
AWI88221.1|1721934_1723200_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	44.5	2.2e-79
AWI88222.1|1723228_1723699_-|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	50.7	5.6e-28
>prophage 4
CP029173	Methylobacterium sp. DM1 chromosome, complete genome	5664348	2870247	2925860	5664348	portal,terminase,protease,transposase,capsid	Rhizobium_phage(20.0%)	54	NA	NA
AWI89185.1|2870247_2870874_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	63.5	2.6e-65
AWI89186.1|2871120_2872392_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.8	3.5e-133
AWI89187.1|2872660_2875084_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	47.4	4.4e-193
AWI89188.1|2875381_2875648_+	hypothetical protein	NA	NA	NA	NA	NA
AWI89189.1|2875656_2875866_+	hypothetical protein	NA	NA	NA	NA	NA
AWI89190.1|2877466_2878216_-	hypothetical protein	NA	A0A2N9QVU4	Dishui_lake_phycodnavirus	23.4	1.9e-17
AWI89191.1|2878300_2878867_+	hypothetical protein	NA	A0A1V0SAW9	Catovirus	50.0	1.5e-35
AWI89192.1|2879015_2879471_-	hypothetical protein	NA	NA	NA	NA	NA
AWI89193.1|2879467_2879923_-	hypothetical protein	NA	NA	NA	NA	NA
AWI89194.1|2879931_2880138_-	hypothetical protein	NA	NA	NA	NA	NA
AWI89195.1|2880141_2880369_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
AWI89196.1|2880365_2880662_-	hypothetical protein	NA	NA	NA	NA	NA
AWI91680.1|2880742_2881417_-	TIGR02594 family protein	NA	R9TRQ2	Rhizobium_phage	69.5	9.0e-88
AWI89197.1|2881912_2882209_-	hypothetical protein	NA	NA	NA	NA	NA
AWI89198.1|2882205_2882712_-	hypothetical protein	NA	NA	NA	NA	NA
AWI89199.1|2882711_2883902_-	hypothetical protein	NA	NA	NA	NA	NA
AWI89200.1|2889001_2889307_+	hypothetical protein	NA	NA	NA	NA	NA
AWI89201.1|2889343_2889736_-	hypothetical protein	NA	NA	NA	NA	NA
AWI89202.1|2889848_2890700_-	hypothetical protein	NA	A0A141GEX9	Brucella_phage	36.7	2.1e-25
AWI89203.1|2890713_2890947_-	hypothetical protein	NA	NA	NA	NA	NA
AWI89204.1|2891025_2891421_+	hypothetical protein	NA	NA	NA	NA	NA
AWI89205.1|2891737_2891992_+	hypothetical protein	NA	NA	NA	NA	NA
AWI89206.1|2892179_2892617_-	hypothetical protein	NA	NA	NA	NA	NA
AWI89207.1|2892627_2892921_-	hypothetical protein	NA	NA	NA	NA	NA
AWI89208.1|2892929_2893472_-	hypothetical protein	NA	NA	NA	NA	NA
AWI89209.1|2893606_2893864_+	hypothetical protein	NA	NA	NA	NA	NA
AWI89210.1|2893868_2894249_-	hypothetical protein	NA	NA	NA	NA	NA
AWI89211.1|2894252_2897753_-	hypothetical protein	NA	A0A1V1FCQ8	Vibrio_phage	50.7	2.1e-10
AWI89212.1|2897742_2899008_-|capsid	major capsid protein	capsid	A0A068CC75	Rhizobium_phage	72.7	3.4e-144
AWI89213.1|2899035_2899446_-	hypothetical protein	NA	A0A068CDC3	Rhizobium_phage	76.9	1.8e-51
AWI89214.1|2899485_2900655_-	peptidase S14	NA	A0A0A8IKZ4	Aurantimonas_phage	46.8	4.2e-48
AWI89215.1|2900667_2901660_-|portal	phage portal protein	portal	Q75QM9	Wolbachia_phage	45.1	5.6e-70
AWI89216.1|2901738_2902947_-	hypothetical protein	NA	NA	NA	NA	NA
AWI89217.1|2902949_2903525_-	phage P22, antirepressor protein	NA	A0A0M3LR56	Mannheimia_phage	40.3	6.0e-24
AWI89218.1|2903840_2904056_-	hypothetical protein	NA	NA	NA	NA	NA
AWI89219.1|2904052_2904391_-	hypothetical protein	NA	NA	NA	NA	NA
AWI89220.1|2904984_2905782_+	hypothetical protein	NA	NA	NA	NA	NA
AWI89221.1|2906516_2910689_+	hypothetical protein	NA	NA	NA	NA	NA
AWI89222.1|2910838_2911474_-	hypothetical protein	NA	NA	NA	NA	NA
AWI89223.1|2911591_2911993_-	hypothetical protein	NA	NA	NA	NA	NA
AWI89224.1|2912107_2913163_-	hypothetical protein	NA	NA	NA	NA	NA
AWI89225.1|2913209_2914070_-	hypothetical protein	NA	NA	NA	NA	NA
AWI89226.1|2914081_2914300_-	hypothetical protein	NA	NA	NA	NA	NA
AWI89227.1|2914435_2916139_+	hypothetical protein	NA	NA	NA	NA	NA
AWI89228.1|2917100_2918177_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AWI89229.1|2918447_2919203_-	hypothetical protein	NA	NA	NA	NA	NA
AWI89230.1|2919831_2920098_-	hypothetical protein	NA	NA	NA	NA	NA
AWI89231.1|2920123_2920375_-	hypothetical protein	NA	NA	NA	NA	NA
AWI89232.1|2920371_2920647_-	hypothetical protein	NA	NA	NA	NA	NA
AWI89233.1|2920639_2920855_-	DNA-binding protein	NA	NA	NA	NA	NA
AWI89234.1|2921604_2921829_-	hypothetical protein	NA	NA	NA	NA	NA
AWI89235.1|2921831_2923913_-|terminase	terminase	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	40.7	1.3e-116
AWI89236.1|2923857_2924496_-	hypothetical protein	NA	NA	NA	NA	NA
AWI89237.1|2924591_2925860_-|transposase	IS256-like element ISMex3 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.7	2.5e-91
>prophage 5
CP029173	Methylobacterium sp. DM1 chromosome, complete genome	5664348	4181838	4250718	5664348	integrase,transposase	Paenibacillus_phage(11.11%)	54	4216454:4216472	4249149:4249167
AWI90313.1|4181838_4182605_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AWI90314.1|4182738_4183513_+|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	36.4	2.1e-11
AWI90315.1|4183615_4184416_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AWI90316.1|4186261_4186678_-	hypothetical protein	NA	NA	NA	NA	NA
AWI90317.1|4187944_4189741_+	hypothetical protein	NA	NA	NA	NA	NA
AWI90318.1|4190036_4191497_-	hypothetical protein	NA	NA	NA	NA	NA
AWI90319.1|4192584_4192839_-	hypothetical protein	NA	NA	NA	NA	NA
AWI90320.1|4192956_4193343_-	MucR family transcriptional regulator	NA	NA	NA	NA	NA
AWI90321.1|4193442_4194030_+	hypothetical protein	NA	NA	NA	NA	NA
AWI90322.1|4194031_4194520_+	hypothetical protein	NA	NA	NA	NA	NA
AWI90323.1|4194513_4194861_+	hypothetical protein	NA	NA	NA	NA	NA
AWI90324.1|4194857_4195310_+	hypothetical protein	NA	NA	NA	NA	NA
AWI90325.1|4195403_4195670_-	hypothetical protein	NA	NA	NA	NA	NA
AWI90326.1|4195850_4196045_+	hypothetical protein	NA	A0A2H4IB20	Erwinia_phage	52.2	2.1e-05
AWI90327.1|4197690_4197960_+	hypothetical protein	NA	NA	NA	NA	NA
AWI90328.1|4197962_4199906_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
AWI90329.1|4199902_4200691_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWI90330.1|4200771_4202145_-	histidine kinase	NA	NA	NA	NA	NA
AWI90331.1|4202452_4202815_+	hypothetical protein	NA	Q06VL0	Trichoplusia_ni_ascovirus	45.7	2.5e-20
AWI90332.1|4202936_4205354_+	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
AWI90333.1|4206408_4207549_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	35.9	4.0e-35
AWI90334.1|4207995_4208784_+	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AWI90335.1|4208968_4209154_+	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
AWI91774.1|4209221_4209695_-	histidine kinase	NA	NA	NA	NA	NA
AWI90336.1|4209921_4210374_+	blue light sensor protein	NA	NA	NA	NA	NA
AWI90337.1|4211429_4211792_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
AWI90338.1|4214016_4214424_-	transcriptional regulator	NA	Q8W6G2	Sinorhizobium_phage	43.9	2.3e-14
AWI90339.1|4214649_4215387_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AWI90340.1|4215418_4215655_-	hypothetical protein	NA	NA	NA	NA	NA
AWI90341.1|4216315_4216513_-	hypothetical protein	NA	NA	NA	NA	NA
4216454:4216472	attL	CAGGCACTCGTCGCGCAGC	NA	NA	NA	NA
AWI90342.1|4216655_4216940_-	hypothetical protein	NA	NA	NA	NA	NA
AWI90343.1|4217249_4217750_+	hypothetical protein	NA	NA	NA	NA	NA
AWI90344.1|4218092_4218569_-	hypothetical protein	NA	NA	NA	NA	NA
AWI90345.1|4219459_4221697_-	histidine kinase	NA	NA	NA	NA	NA
AWI90346.1|4221772_4222207_-	hypothetical protein	NA	NA	NA	NA	NA
AWI90347.1|4222406_4223927_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AWI90348.1|4224155_4224368_-	hypothetical protein	NA	NA	NA	NA	NA
AWI90349.1|4224508_4224844_+	hypothetical protein	NA	NA	NA	NA	NA
AWI90350.1|4225320_4225665_-	hypothetical protein	NA	NA	NA	NA	NA
AWI90351.1|4225664_4227362_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
AWI90352.1|4227653_4227962_+	hypothetical protein	NA	NA	NA	NA	NA
AWI90353.1|4228089_4229631_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	28.4	8.3e-12
AWI90354.1|4231032_4233420_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	NA	NA	NA	NA
AWI91775.1|4233952_4234582_-|integrase	integrase	integrase	A0A0A8WF93	Clostridium_phage	24.2	6.2e-06
AWI90355.1|4234979_4235396_+	response regulator	NA	NA	NA	NA	NA
AWI90356.1|4235499_4238049_+	two-component system sensor histidine kinase/response regulator	NA	B5LWN8	Feldmannia_species_virus	28.6	2.7e-23
AWI90357.1|4238489_4239584_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
AWI90358.1|4239855_4242018_-	molybdopterin oxidoreductase	NA	A0A077SK27	Escherichia_phage	25.7	1.4e-52
AWI90359.1|4242247_4243714_+	transcriptional regulator	NA	NA	NA	NA	NA
AWI91776.1|4244105_4245113_+	endonuclease	NA	NA	NA	NA	NA
AWI90360.1|4245698_4245959_+	hypothetical protein	NA	NA	NA	NA	NA
AWI90361.1|4246029_4246491_+	hypothetical protein	NA	NA	NA	NA	NA
AWI90362.1|4246493_4247729_+	secretion protein HlyD	NA	NA	NA	NA	NA
AWI90363.1|4249908_4250718_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
4249149:4249167	attR	CAGGCACTCGTCGCGCAGC	NA	NA	NA	NA
>prophage 1
CP029174	Methylobacterium sp. DM1 plasmid pLVM1, complete sequence	240873	0	15363	240873		Pseudomonas_phage(50.0%)	8	NA	NA
AWI91895.1|2968_3247_+	conjugal transfer protein TraC	NA	NA	NA	NA	NA
AWI91896.1|3230_3428_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
AWI91897.1|3424_5449_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AWI91898.1|6646_7114_+	hypothetical protein	NA	NA	NA	NA	NA
AWI91899.1|7110_8040_-	DUF2493 domain-containing protein	NA	A0A1B0V0Z8	Roseobacter_phage	32.1	4.0e-09
AWI91900.1|8374_9433_-	DNA primase	NA	A0A0U4B0G9	Pseudomonas_phage	34.9	1.1e-10
AWI91901.1|9458_13832_-	methylase	NA	A0A1Y0T2N3	Pseudomonas_phage	28.7	2.4e-08
AWI91902.1|15048_15363_-	DUF4326 domain-containing protein	NA	Q6UYH1	Burkholderia_phage	50.6	4.6e-18
>prophage 2
CP029174	Methylobacterium sp. DM1 plasmid pLVM1, complete sequence	240873	20846	70409	240873	transposase	Enterobacteria_phage(36.36%)	36	NA	NA
AWI91909.1|20846_21863_-	antirestriction protein ArdC	NA	A0A1V0EEV1	Caulobacter_phage	38.3	1.1e-49
AWI91910.1|22560_23379_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AWI91911.1|23988_25197_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AWI91912.1|27120_27878_-|transposase	IS5-like element ISMpo7 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	35.0	1.2e-08
AWI91913.1|28056_28665_+	hypothetical protein	NA	NA	NA	NA	NA
AWI91914.1|28710_30360_+|transposase	ISL3-like element ISMex10 family transposase	transposase	NA	NA	NA	NA
AWI92069.1|30908_31265_-	DUF736 domain-containing protein	NA	NA	NA	NA	NA
AWI91915.1|31676_32078_-	PIN domain nuclease	NA	NA	NA	NA	NA
AWI91916.1|32081_32324_-	hypothetical protein	NA	NA	NA	NA	NA
AWI91917.1|32700_33252_-	hypothetical protein	NA	NA	NA	NA	NA
AWI92070.1|33235_33490_-	prevent-host-death family protein	NA	NA	NA	NA	NA
AWI91918.1|33556_33943_-	hypothetical protein	NA	NA	NA	NA	NA
AWI91919.1|33939_34254_-	hypothetical protein	NA	NA	NA	NA	NA
AWI91920.1|34269_34482_-	hypothetical protein	NA	NA	NA	NA	NA
AWI91921.1|34689_35121_+	hypothetical protein	NA	A0A142UM78	Mycobacterium_phage	31.8	2.8e-10
AWI92071.1|35165_35597_+	hypothetical protein	NA	NA	NA	NA	NA
AWI92072.1|38919_39786_-	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	46.7	1.3e-51
AWI91922.1|39782_41174_-|transposase	IS21-like element ISMex13 family transposase	transposase	U5N3F9	Enterobacteria_phage	34.1	1.1e-44
AWI91923.1|43853_44969_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AWI91924.1|44961_45360_+	hypothetical protein	NA	NA	NA	NA	NA
AWI91925.1|45395_47699_+	hypothetical protein	NA	NA	NA	NA	NA
AWI91926.1|48299_49091_+	hypothetical protein	NA	NA	NA	NA	NA
AWI91927.1|49111_50509_+	hypothetical protein	NA	NA	NA	NA	NA
AWI91928.1|50505_50706_+	hypothetical protein	NA	NA	NA	NA	NA
AWI91929.1|50942_51815_+	hypothetical protein	NA	NA	NA	NA	NA
AWI91930.1|52665_52896_+	hypothetical protein	NA	NA	NA	NA	NA
AWI91931.1|54625_55081_+	IS66 family insertion sequence hypothetical protein	NA	A0A1B0YZU7	Pseudomonas_phage	39.7	8.4e-05
AWI91932.1|55077_55434_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AWI91933.1|56409_57801_+|transposase	IS21-like element ISMex13 family transposase	transposase	U5N3F9	Enterobacteria_phage	34.1	1.1e-44
AWI91934.1|57797_58664_+	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	46.7	1.3e-51
AWI91935.1|59635_61882_+	hypothetical protein	NA	NA	NA	NA	NA
AWI91936.1|62111_63125_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	27.1	4.6e-11
AWI92073.1|65901_67200_-|transposase	ISNCY-like element ISMex6 family transposase	transposase	NA	NA	NA	NA
AWI91937.1|67392_68744_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	27.1	1.1e-10
AWI91938.1|68880_69750_-	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
AWI91939.1|69746_70409_-	ferredoxin-type protein NapG	NA	A0A077SLP0	Escherichia_phage	29.3	2.5e-05
>prophage 3
CP029174	Methylobacterium sp. DM1 plasmid pLVM1, complete sequence	240873	86045	209080	240873	transposase,integrase	Paenibacillus_phage(20.69%)	88	106743:106802	135063:135354
AWI91953.1|86045_87599_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AWI91954.1|87789_89325_+|transposase	ISL3-like element ISMdi2 family transposase	transposase	NA	NA	NA	NA
AWI91955.1|89684_90428_-	AAA family ATPase	NA	K4HZD4	Acidithiobacillus_phage	46.7	1.4e-57
AWI91956.1|90439_91954_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.6	2.5e-122
AWI91957.1|93931_95002_-	hypothetical protein	NA	NA	NA	NA	NA
AWI91958.1|95223_95787_-	hypothetical protein	NA	NA	NA	NA	NA
AWI91959.1|95783_96878_-	hypothetical protein	NA	NA	NA	NA	NA
AWI91960.1|97114_97597_-	hypothetical protein	NA	NA	NA	NA	NA
AWI91961.1|97598_104408_-	hypothetical protein	NA	NA	NA	NA	NA
AWI91962.1|104762_106454_+	hypothetical protein	NA	NA	NA	NA	NA
AWI91963.1|106598_107356_-|transposase	IS5-like element ISMpo7 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	35.0	1.2e-08
106743:106802	attL	CTTGTCGTGGCGGATCTTCCGCTTTCGGCCGCGCTTGCCCGGGATGACGGGCGTGATGCC	NA	NA	NA	NA
AWI91964.1|107496_107829_-	hypothetical protein	NA	NA	NA	NA	NA
AWI91965.1|107837_108392_-	hypothetical protein	NA	NA	NA	NA	NA
AWI91966.1|109096_109471_-	hypothetical protein	NA	NA	NA	NA	NA
AWI91967.1|109448_110051_-	hypothetical protein	NA	A0A2H4N7Y7	Lake_Baikal_phage	49.2	6.8e-10
AWI91968.1|110023_110281_-	hypothetical protein	NA	NA	NA	NA	NA
AWI91969.1|110277_111981_-	AAA family ATPase	NA	A0A1V0CP82	Kaumoebavirus	30.2	6.8e-07
AWI91970.1|112681_113125_+	hypothetical protein	NA	NA	NA	NA	NA
AWI91971.1|113121_113367_+	hypothetical protein	NA	NA	NA	NA	NA
AWI91972.1|113390_113849_-	hypothetical protein	NA	NA	NA	NA	NA
AWI91973.1|114492_115554_-|integrase	integrase	integrase	Q5QBN6	Enterobacteria_phage	26.3	1.7e-16
AWI91974.1|115840_116062_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
AWI91975.1|116058_116445_+	VapC toxin family PIN domain ribonuclease	NA	NA	NA	NA	NA
AWI91976.1|118923_120192_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.9	4.6e-93
AWI91977.1|120343_120862_-	hypothetical protein	NA	NA	NA	NA	NA
AWI91978.1|121419_122591_-|transposase	IS3-like element ISMch1 family transposase	transposase	S5WIU1	Leptospira_phage	27.9	4.0e-14
AWI91979.1|122663_122837_+	hypothetical protein	NA	NA	NA	NA	NA
AWI91980.1|122839_123421_+	TetR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	32.6	3.6e-16
AWI91981.1|124722_125976_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AWI91982.1|126031_126807_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	41.5	2.2e-21
AWI91983.1|126888_130053_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
AWI92076.1|131853_132306_-	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	40.2	6.4e-13
AWI91984.1|132809_133331_-	hypothetical protein	NA	NA	NA	NA	NA
AWI91985.1|133821_135034_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	44.1	6.9e-46
AWI91986.1|135429_136458_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
135063:135354	attR	CTTGTCGTGGCGGATCTTCCGCTTTCGGCCGCGCTTGCCCGGGATGACGGGCGTGATGCCTGCCTCCCGCAGATCGGTGCGCAGCCAGTCGGCGTCGTAGCCTTTGTCGGCGGCCAGACGGCGGATGCGGCCGGGCGCCTCGGCCAGTACGGCTGGCGCGGTCGTCACGTCGCTGGCGTTGCCTGGCGTCAGCAGAAGGACGCCGGGGCGACCGAGGACGTCGGTGAGCGCGTGGACCTTGGTCGTCTGGCCGCCGCGCGACGGGCCGATGGCCTGCGTGCGAGCCCCCCTT	NA	NA	NA	NA
AWI91987.1|137090_137498_-	globin	NA	NA	NA	NA	NA
AWI91988.1|137582_138131_-	aldehyde-activating protein	NA	NA	NA	NA	NA
AWI91989.1|138424_139723_-	type III glutamate--ammonia ligase	NA	NA	NA	NA	NA
AWI91990.1|139812_141147_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
AWI91991.1|141146_141836_-	protein glxC	NA	NA	NA	NA	NA
AWI92077.1|141835_142729_-	glutamine amidotransferase	NA	F2Y1G4	Organic_Lake_phycodnavirus	25.7	3.6e-07
AWI91992.1|143032_144094_-	hypothetical protein	NA	NA	NA	NA	NA
AWI91993.1|144104_145046_-	oxidoreductase	NA	NA	NA	NA	NA
AWI91994.1|145048_145624_-	hypothetical protein	NA	NA	NA	NA	NA
AWI91995.1|146191_146836_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWI91996.1|146900_147675_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	41.5	2.2e-21
AWI91997.1|148505_149840_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
AWI91998.1|150057_151143_-	type VI secretion protein	NA	NA	NA	NA	NA
AWI91999.1|151139_151658_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
AWI92000.1|151954_152746_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	41.3	4.0e-34
AWI92001.1|153184_153454_-	hypothetical protein	NA	NA	NA	NA	NA
AWI92002.1|153864_154875_-	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
AWI92003.1|154887_155646_-	ParA family protein	NA	V5UP47	Mycobacterium_phage	28.2	8.0e-08
AWI92004.1|156667_157696_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWI92005.1|159653_159923_-	hypothetical protein	NA	NA	NA	NA	NA
AWI92006.1|160201_161149_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWI92007.1|161343_161727_-	DUF736 domain-containing protein	NA	NA	NA	NA	NA
AWI92008.1|162243_163594_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	27.1	1.1e-10
AWI92009.1|164056_165148_-	plasmid partitioning protein RepB	NA	A0A240F4U0	Ochrobactrum_phage	42.7	6.6e-48
AWI92078.1|165152_166328_-	plasmid partitioning protein RepA	NA	A0A240F4U1	Ochrobactrum_phage	61.1	9.4e-133
AWI92010.1|166539_167766_-	replication initiation protein RepC	NA	L7TKN6	Rhizobium_phage	31.2	3.5e-21
AWI92011.1|168046_169129_-	hypothetical protein	NA	NA	NA	NA	NA
AWI92012.1|172144_172399_+	transcriptional regulator	NA	NA	NA	NA	NA
AWI92013.1|172398_173394_+	toxin HipA	NA	NA	NA	NA	NA
AWI92014.1|173407_174165_-|transposase	IS5-like element ISMpo7 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	35.0	1.2e-08
AWI92015.1|174297_174570_+	hypothetical protein	NA	NA	NA	NA	NA
AWI92016.1|174861_175791_-	hypothetical protein	NA	A0A1B0V0Z8	Roseobacter_phage	31.1	2.6e-08
AWI92017.1|176122_177181_-	DNA primase	NA	A0A0U4B0G9	Pseudomonas_phage	32.9	1.2e-09
AWI92018.1|181594_182369_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	41.5	2.2e-21
AWI92019.1|185265_186023_-|transposase	IS5-like element ISMpo7 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	35.0	1.2e-08
AWI92020.1|186547_187898_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	27.1	1.1e-10
AWI92021.1|188407_189856_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
AWI92022.1|191219_192263_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWI92023.1|193290_194157_+	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	46.7	1.3e-51
AWI92024.1|194639_194990_+	hypothetical protein	NA	NA	NA	NA	NA
AWI92025.1|195606_195819_+	hypothetical protein	NA	NA	NA	NA	NA
AWI92026.1|195927_196107_-	hypothetical protein	NA	NA	NA	NA	NA
AWI92027.1|196267_196903_-	transcriptional regulator	NA	NA	NA	NA	NA
AWI92028.1|197285_197555_-	hypothetical protein	NA	NA	NA	NA	NA
AWI92029.1|197837_198080_-	hypothetical protein	NA	NA	NA	NA	NA
AWI92079.1|198725_200150_+	ammonia channel protein	NA	H8ZJB2	Ostreococcus_tauri_virus	29.5	8.4e-27
AWI92030.1|200235_201234_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWI92031.1|201339_202590_+	sarcosine oxidase subunit beta	NA	NA	NA	NA	NA
AWI92032.1|202602_202890_+	sarcosine oxidase subunit delta	NA	NA	NA	NA	NA
AWI92033.1|202886_205928_+	sarcosine oxidase subunit alpha	NA	NA	NA	NA	NA
AWI92034.1|205920_206541_+	sarcosine oxidase subunit gamma	NA	NA	NA	NA	NA
AWI92035.1|206734_207451_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWI92036.1|207745_209080_+|transposase	IS1182 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	20.0	3.6e-11
>prophage 4
CP029174	Methylobacterium sp. DM1 plasmid pLVM1, complete sequence	240873	218858	219497	240873		Human_gut_gokushovirus(100.0%)	1	NA	NA
AWI92080.1|218858_219497_-	hypothetical protein	NA	A0A1X9Q111	Human_gut_gokushovirus	34.3	2.8e-06
