The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028110	Escherichia coli O121 str. RM8352 chromosome, complete genome	5391064	520968	618637	5391064	tail,portal,terminase,head,capsid,integrase,transposase,tRNA,protease	Enterobacteria_phage(43.59%)	92	577763:577809	610111:610157
AWJ25609.1|520968_521448_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
AWJ25610.1|521463_521742_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ25611.1|521651_522446_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ25612.1|522583_522925_+	transcriptional regulator	NA	A0A222YWD7	Escherichia_phage	74.5	9.3e-41
AWJ25613.1|523139_525644_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.1	1.4e-114
AWJ25614.1|525905_526838_+	glutaminase	NA	NA	NA	NA	NA
AWJ25615.1|526840_528133_+	amino acid permease	NA	NA	NA	NA	NA
AWJ25616.1|528257_528665_+	transcriptional regulator	NA	NA	NA	NA	NA
AWJ25617.1|528665_529124_-	NfeD family protein	NA	NA	NA	NA	NA
AWJ25618.1|529120_530038_-	paraslipin	NA	NA	NA	NA	NA
AWJ25619.1|530183_530861_+	iron export ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
AWJ25620.1|530847_531627_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
AWJ25621.1|531689_532544_-	co-chaperone YbbN	NA	NA	NA	NA	NA
AWJ25622.1|532604_533414_-	short-chain dehydrogenase/reductase	NA	NA	NA	NA	NA
AWJ25623.1|533403_534030_-	arylesterase	NA	NA	NA	NA	NA
AWJ25624.1|533997_534684_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
AWJ25625.1|534680_537095_+	ABC transporter permease	NA	NA	NA	NA	NA
AWJ25626.1|537523_541714_+	RHS element protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	44.6	1.3e-22
AWJ25627.1|541694_542186_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ25628.1|543187_544282_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
AWJ25629.1|544350_545277_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
AWJ25630.1|545506_545989_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
AWJ25631.1|546066_546882_+	transcriptional regulator	NA	NA	NA	NA	NA
AWJ25632.1|546971_548753_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	26.8	6.0e-38
AWJ25633.1|548765_549542_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
AWJ25634.1|549641_550520_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
AWJ25635.1|550688_552143_+	putative allantoin permease	NA	NA	NA	NA	NA
AWJ25636.1|552202_553564_+	cyclic amidohydrolase	NA	NA	NA	NA	NA
AWJ25637.1|553620_554922_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
AWJ25638.1|554943_556089_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.9	4.1e-48
AWJ25639.1|556316_557102_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
AWJ25640.1|557112_558348_-	allantoate amidohydrolase	NA	NA	NA	NA	NA
AWJ25641.1|558369_559419_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
AWJ25642.1|559735_561403_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
AWJ25643.1|561412_562672_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
AWJ25644.1|562682_563498_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
AWJ25645.1|563494_564388_+	carbamate kinase	NA	NA	NA	NA	NA
AWJ25646.1|564526_565594_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AWJ25647.1|565590_566100_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
AWJ25648.1|566217_566940_-	UDP-2,3-diacylglucosamine hydrolase	NA	NA	NA	NA	NA
AWJ25649.1|566942_567437_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AWJ25650.1|567610_568996_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
AWJ25651.1|569031_569553_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AWJ25652.1|569660_569873_-	ribosome-associated protein	NA	NA	NA	NA	NA
AWJ25653.1|569874_570741_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
AWJ25654.1|571221_571764_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
AWJ25655.1|572705_575315_+	outer membrane usher protein	NA	NA	NA	NA	NA
AWJ25656.1|575327_576335_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
AWJ25657.1|576345_576861_+	fimbriae assembly protein	NA	NA	NA	NA	NA
AWJ25658.1|576863_577496_-	fimbriae biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
577763:577809	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
AWJ25659.1|577822_578986_-|integrase	phage integrase family protein	integrase	A0A088CD23	Shigella_phage	86.3	9.8e-199
AWJ25660.1|578841_579213_-	DNA-binding protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
AWJ25661.1|579184_579463_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
AWJ25662.1|579510_579729_-	conjugal transfer protein TraR	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
AWJ25663.1|579827_580109_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
AWJ25664.1|580165_581378_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
AWJ25665.1|581436_581961_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	97.7	2.2e-89
AWJ25666.1|581935_583861_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.3	0.0e+00
AWJ25667.1|583857_584070_+|tail	phage tail protein	tail	A0A2R9YJL2	Escherichia_phage	95.7	1.6e-27
AWJ25668.1|584066_585668_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.2e-308
AWJ25669.1|585648_586968_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	95.7	6.3e-226
AWJ25670.1|586977_587310_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	1.4e-54
AWJ25671.1|587364_588390_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	97.9	1.2e-189
AWJ25672.1|588431_588827_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	2.6e-55
AWJ25673.1|588838_589192_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	1.5e-62
AWJ25674.1|589203_589782_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	86.5	2.3e-79
AWJ25675.1|589778_590174_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	5.0e-70
AWJ30154.1|590181_590922_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.2	5.0e-132
AWJ25676.1|590937_591360_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	99.3	1.9e-72
AWJ25677.1|591341_591776_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AWJ25678.1|591768_594330_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.7	0.0e+00
AWJ25679.1|594326_594656_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	93.6	2.1e-53
AWJ25680.1|594655_595354_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	3.6e-132
AWJ25681.1|595359_596103_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
AWJ25682.1|596000_596672_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.6	3.1e-104
AWJ25683.1|600094_601307_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
AWJ25684.1|601476_602076_+	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	99.0	8.8e-111
AWJ30155.1|604239_605211_+	short-chain fatty acid transporter	NA	K7PHC9	Enterobacteria_phage	89.3	2.1e-37
AWJ25685.1|605210_605795_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	1.2e-101
AWJ25686.1|605767_605905_+|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AWJ30156.1|605849_606476_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWJ25687.1|606574_606880_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
AWJ25688.1|607063_608548_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWJ25689.1|608734_609688_-|protease	outer membrane protease	protease	NA	NA	NA	NA
AWJ25690.1|609713_609905_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ25691.1|610090_610207_-	hypothetical protein	NA	NA	NA	NA	NA
610111:610157	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
AWJ25692.1|610200_610962_-	porin thermoregulatory protein EnvY	NA	NA	NA	NA	NA
AWJ25693.1|611018_611231_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ25694.1|611144_612035_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ25695.1|612035_615008_-	phage receptor	NA	NA	NA	NA	NA
AWJ25696.1|614994_617232_-	bacteriophage N4 adsorption protein B	NA	NA	NA	NA	NA
AWJ25697.1|617500_618637_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP028110	Escherichia coli O121 str. RM8352 chromosome, complete genome	5391064	957360	971780	5391064	transposase,tRNA,protease	Stx2-converting_phage(30.0%)	12	NA	NA
AWJ26005.1|957360_959307_+	macrolide ABC transporter permease/ATP-binding protein MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
AWJ26006.1|959379_959604_-	cold-shock protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
AWJ26007.1|959926_960247_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
AWJ26008.1|960277_962554_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
AWJ26009.1|962679_964236_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.0	8.3e-161
AWJ26010.1|964255_964603_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
AWJ26011.1|964599_965274_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
AWJ26012.1|965954_966173_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AWJ26013.1|966457_967162_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AWJ26014.1|967203_968925_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	2.9e-21
AWJ26015.1|968925_970692_-	ATP-binding/permease CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
AWJ26016.1|970814_971780_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
>prophage 3
CP028110	Escherichia coli O121 str. RM8352 chromosome, complete genome	5391064	1056636	1164610	5391064	tail,portal,terminase,holin,head,capsid,integrase,lysis,protease	Escherichia_phage(34.41%)	132	1076307:1076325	1122129:1122147
AWJ26078.1|1056636_1058397_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AWJ26079.1|1058582_1059035_+	macrodomain Ter protein	NA	NA	NA	NA	NA
AWJ26080.1|1059109_1060162_-	porin OmpA	NA	NA	NA	NA	NA
AWJ26081.1|1060316_1060535_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ26082.1|1060518_1061028_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
AWJ26083.1|1061246_1061876_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AWJ30171.1|1061838_1063992_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
AWJ26084.1|1064010_1064457_-	YccF domain-containing protein	NA	NA	NA	NA	NA
AWJ26085.1|1064579_1066634_+	helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
AWJ26086.1|1066665_1067124_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AWJ26087.1|1067219_1067882_-	DUF2057 domain-containing protein	NA	NA	NA	NA	NA
AWJ26088.1|1068054_1068468_+	CoA-binding protein	NA	NA	NA	NA	NA
AWJ26089.1|1068512_1068830_-	heat-shock protein HspQ	NA	NA	NA	NA	NA
AWJ26090.1|1068887_1070078_-	ribosomal RNA large subunit methyltransferase I	NA	NA	NA	NA	NA
AWJ26091.1|1070172_1070451_+	acylphosphatase	NA	NA	NA	NA	NA
AWJ26092.1|1070447_1070777_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
AWJ26093.1|1070867_1071527_-	BAX inhibitor protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
AWJ26094.1|1071934_1072954_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	49.4	2.9e-85
AWJ26095.1|1072931_1073174_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AWJ26096.1|1073241_1075677_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.7	2.7e-57
AWJ26097.1|1075757_1075961_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWJ26098.1|1075963_1076146_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
1076307:1076325	attL	CACCGCATCACAAAATTCA	NA	NA	NA	NA
AWJ26099.1|1076891_1077281_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	39.3	1.9e-21
AWJ30172.1|1077292_1077445_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
AWJ26100.1|1077760_1078237_-	Rac prophage repressor	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
AWJ26101.1|1078360_1078657_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
AWJ26102.1|1078679_1079105_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AWJ26103.1|1079176_1080247_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	62.2	8.2e-59
AWJ26104.1|1080287_1080710_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	1.1e-64
AWJ26105.1|1080706_1081003_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	3.4e-47
AWJ26106.1|1080999_1081461_+	hypothetical protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
AWJ26107.1|1081438_1081795_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
AWJ26108.1|1081845_1082058_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
AWJ26109.1|1082143_1082308_+	O-polysaccharide acetyltransferase inhibitor	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
AWJ26110.1|1082309_1082573_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
AWJ26111.1|1082583_1083453_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
AWJ26112.1|1083568_1083673_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ26113.1|1083661_1083817_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	83.8	1.9e-09
AWJ26114.1|1083861_1084074_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	91.4	1.2e-25
AWJ26115.1|1084241_1084520_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
AWJ26116.1|1084521_1085571_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
AWJ26117.1|1085583_1085943_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.0	1.8e-34
AWJ26118.1|1085951_1086482_+	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
AWJ26119.1|1086600_1086921_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.6	1.6e-34
AWJ26120.1|1087072_1088149_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	87.1	3.8e-181
AWJ26121.1|1088744_1089071_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	62.9	5.1e-36
AWJ26122.1|1091452_1091632_+	DUF1378 domain-containing protein	NA	A0A2R2Z345	Escherichia_phage	96.6	1.4e-24
AWJ26123.1|1091672_1091918_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	90.1	2.2e-15
AWJ26124.1|1091994_1092210_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
AWJ26125.1|1092214_1092748_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	98.9	3.9e-102
AWJ26126.1|1093018_1093588_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
AWJ26127.1|1093741_1094209_+|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	100.0	6.9e-79
AWJ26128.1|1094623_1095100_+	DUF1441 domain-containing protein	NA	Q8VNN8	Enterobacteria_phage	99.4	9.5e-84
AWJ26129.1|1095096_1097220_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
AWJ26130.1|1097192_1097429_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	100.0	4.5e-34
AWJ26131.1|1097428_1098931_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
AWJ26132.1|1098934_1100899_+	peptidase S14	NA	S5M7Q8	Escherichia_phage	99.8	0.0e+00
AWJ26133.1|1100986_1101313_+	DUF2190 domain-containing protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
AWJ26134.1|1101305_1101587_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	100.0	2.1e-46
AWJ26135.1|1101589_1102213_+|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	100.0	8.9e-106
AWJ26136.1|1102630_1103383_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
AWJ26137.1|1103396_1103819_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
AWJ26138.1|1103845_1104154_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
AWJ26139.1|1106838_1107168_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
AWJ26140.1|1107167_1107866_+|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	98.7	1.8e-131
AWJ26141.1|1107876_1108620_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	96.7	8.0e-146
AWJ26142.1|1108517_1109198_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	96.0	2.6e-111
AWJ26143.1|1109446_1112923_+|tail	phage tail protein	tail	Q687E8	Enterobacteria_phage	95.1	0.0e+00
AWJ26144.1|1114965_1115235_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
AWJ26145.1|1115351_1115627_-	secretion protein EspO	NA	NA	NA	NA	NA
AWJ26146.1|1115689_1117051_-	type III secretion protein GogB	NA	Q9MBM1	Phage_Gifsy-1	40.2	1.5e-49
AWJ26147.1|1117427_1117580_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.4	4.3e-14
AWJ26148.1|1117862_1118882_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
AWJ26149.1|1118859_1119102_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AWJ26150.1|1119169_1121641_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	8.5e-59
AWJ26151.1|1121734_1121926_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWJ26152.1|1121922_1122111_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AWJ30173.1|1122377_1122683_+	hypothetical protein	NA	NA	NA	NA	NA
1122129:1122147	attR	TGAATTTTGTGATGCGGTG	NA	NA	NA	NA
AWJ26153.1|1122684_1122870_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ26154.1|1123056_1123446_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ26155.1|1123457_1123586_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ26156.1|1123587_1123743_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
AWJ26157.1|1124019_1124307_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AWJ26158.1|1124306_1124498_-	antitoxin	NA	NA	NA	NA	NA
AWJ26159.1|1124525_1124927_-	XRE family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
AWJ26160.1|1125035_1125308_+	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
AWJ26161.1|1125291_1125717_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AWJ26162.1|1125923_1126379_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ26163.1|1126457_1127582_+	DNA-binding protein	NA	V5URT9	Shigella_phage	67.9	1.6e-129
AWJ26164.1|1127578_1128319_+	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	85.0	2.0e-117
AWJ26165.1|1128344_1129115_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.6	3.7e-85
AWJ26166.1|1129130_1129544_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
AWJ26167.1|1129895_1130669_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWJ26168.1|1131216_1131429_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
AWJ26169.1|1131596_1131875_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
AWJ26170.1|1132937_1133309_+	hypothetical protein	NA	V5URS4	Shigella_phage	63.7	1.3e-35
AWJ26171.1|1133298_1133670_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
AWJ26172.1|1133821_1134640_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWJ26173.1|1134926_1135124_+	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	95.4	5.7e-27
AWJ26174.1|1135576_1135975_+	envelope protein	NA	NA	NA	NA	NA
AWJ26175.1|1136422_1136854_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
AWJ26176.1|1136744_1137011_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ26177.1|1137155_1137284_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ26178.1|1139404_1139584_+	DUF1378 domain-containing protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
AWJ26179.1|1139624_1139897_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
AWJ26180.1|1139973_1140189_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
AWJ26181.1|1140193_1140538_+	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	1.4e-57
AWJ26182.1|1140588_1141122_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	96.0	6.2e-100
AWJ26183.1|1141420_1141888_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	94.8	6.7e-74
AWJ26184.1|1142310_1142625_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AWJ26185.1|1142706_1142931_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
AWJ26186.1|1143333_1143843_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
AWJ26187.1|1143814_1145743_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	1.8e-261
AWJ26188.1|1145726_1145933_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
AWJ26189.1|1145929_1147522_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.7	2.1e-183
AWJ26190.1|1147511_1149017_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.8e-99
AWJ26191.1|1149053_1149380_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.1	2.1e-21
AWJ26192.1|1149457_1150486_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
AWJ26193.1|1150537_1150921_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
AWJ26194.1|1150913_1151267_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	67.5	3.3e-41
AWJ26195.1|1151281_1151815_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	5.0e-57
AWJ26196.1|1151811_1152207_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	6.7e-59
AWJ26197.1|1152214_1152967_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.2	1.4e-126
AWJ26198.1|1152980_1153412_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.3	2.8e-42
AWJ26199.1|1153438_1153852_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	81.2	7.8e-42
AWJ26200.1|1156407_1156737_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AWJ26201.1|1156736_1157435_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.8	5.8e-130
AWJ26202.1|1157440_1158184_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	1.4e-142
AWJ26203.1|1158081_1158753_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	8.1e-105
AWJ26204.1|1162361_1162961_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.0	1.1e-108
AWJ26205.1|1163025_1164339_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.9	8.2e-77
AWJ26206.1|1164340_1164610_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
>prophage 4
CP028110	Escherichia coli O121 str. RM8352 chromosome, complete genome	5391064	1285164	1375154	5391064	tail,portal,holin,head,integrase,transposase,lysis,protease	Stx2-converting_phage(28.75%)	120	1343298:1343315	1374927:1374944
AWJ26334.1|1285164_1286283_-|integrase	integrase	integrase	Q77Z04	Phage_21	44.4	2.6e-84
AWJ26335.1|1286251_1286521_-	excisionase	NA	NA	NA	NA	NA
AWJ26336.1|1286582_1289054_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
AWJ26337.1|1289177_1289399_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	82.2	4.3e-31
AWJ30178.1|1289753_1289969_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ26338.1|1290111_1290411_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ26339.1|1290394_1290559_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ26340.1|1290763_1291042_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AWJ26341.1|1291043_1291271_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ26342.1|1291255_1291690_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ26343.1|1291724_1292027_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
AWJ26344.1|1292023_1292449_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AWJ30179.1|1292471_1293434_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
AWJ26345.1|1293474_1293897_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	3.9e-65
AWJ26346.1|1294002_1294215_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	97.1	5.6e-36
AWJ26347.1|1294247_1294466_+	sugar acetyltransferase inhibitor	NA	A0A1I9LJM2	Stx_converting_phage	91.7	5.2e-29
AWJ26348.1|1294629_1296186_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.0	8.3e-161
AWJ26349.1|1296205_1296553_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
AWJ26350.1|1296549_1297224_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
AWJ30180.1|1297241_1297448_+	hypothetical protein	NA	S4TNB5	Salmonella_phage	70.8	7.1e-12
AWJ26351.1|1297458_1298328_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	79.2	8.5e-123
AWJ26352.1|1298443_1298548_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ26353.1|1298536_1298692_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	81.1	2.7e-08
AWJ26354.1|1298736_1298949_+	Hok/Gef family protein	NA	A0A0P0ZAX5	Stx2-converting_phage	97.1	2.5e-28
AWJ26355.1|1299066_1299414_+	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	81.7	9.2e-44
AWJ26356.1|1299534_1299807_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.1	1.9e-12
AWJ26357.1|1299808_1300858_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.1e-108
AWJ26358.1|1300870_1301245_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.1	6.4e-35
AWJ26359.1|1301241_1302063_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.9	8.2e-83
AWJ26360.1|1302288_1302486_+	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
AWJ26361.1|1302636_1303695_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	90.1	3.8e-189
AWJ26362.1|1304476_1304743_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ26363.1|1305156_1307007_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	97.1	0.0e+00
AWJ26364.1|1307444_1307660_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.7e-32
AWJ26365.1|1307704_1308918_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
AWJ26366.1|1309145_1310359_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.6	1.0e-166
AWJ26367.1|1310541_1310778_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ26368.1|1310746_1310941_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ26369.1|1310973_1311507_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	95.5	2.1e-100
AWJ26370.1|1311584_1311776_+	hypothetical protein	NA	A0A0M4S639	Salmonella_phage	63.9	7.8e-05
AWJ30181.1|1311933_1312401_+|lysis	lysis protein	lysis	A0A0H4IT10	Shigella_phage	87.1	7.2e-68
AWJ26371.1|1312424_1312649_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ26372.1|1312766_1313923_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
AWJ26373.1|1314272_1314413_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ30182.1|1314542_1314656_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	85.7	2.9e-07
AWJ26374.1|1314723_1315026_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ26375.1|1315123_1316279_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.8e-68
AWJ30183.1|1316272_1317016_+|portal	phage portal protein	portal	A0A0P0ZCZ4	Stx2-converting_phage	99.3	7.2e-78
AWJ26376.1|1317012_1317339_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
AWJ26377.1|1317349_1317700_+|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
AWJ26378.1|1317696_1318143_+	hypothetical protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
AWJ26379.1|1318139_1318484_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
AWJ26380.1|1318549_1319266_+|tail	phage tail protein	tail	B6DZA6	Enterobacteria_phage	99.6	2.1e-127
AWJ26381.1|1319280_1319655_+|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
AWJ26382.1|1319678_1319960_+|tail	phage tail protein	tail	A0A0P0ZDE6	Stx2-converting_phage	100.0	1.3e-45
AWJ26383.1|1320011_1323254_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.6	0.0e+00
AWJ26384.1|1323246_1323588_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
AWJ26385.1|1323587_1324286_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
AWJ30184.1|1329397_1329973_+	hypothetical protein	NA	A0A1U8QHD6	Enterobacteria_phage	55.6	1.2e-59
AWJ26386.1|1330037_1331351_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.5	1.4e-79
AWJ26387.1|1331352_1331622_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	97.8	7.1e-44
AWJ26388.1|1331747_1332500_-	type III effector	NA	NA	NA	NA	NA
AWJ26389.1|1332815_1332998_-	hypothetical protein	NA	H6WZN3	Escherichia_phage	87.9	2.2e-20
AWJ26390.1|1334730_1336524_+	hydrogenase-1 large chain	NA	NA	NA	NA	NA
AWJ26391.1|1336542_1337250_+	Ni/Fe-hydrogenase B-type cytochrome subunit	NA	NA	NA	NA	NA
AWJ26392.1|1337246_1337834_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
AWJ26393.1|1337830_1338229_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
AWJ26394.1|1338225_1339083_+	hydrogenase-1 operon protein HyaF	NA	NA	NA	NA	NA
AWJ26395.1|1339216_1340761_+	cytochrome bd-II ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AWJ26396.1|1340772_1341909_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AWJ26397.1|1341921_1342014_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
AWJ30185.1|1342093_1343392_+	phytase AppA	NA	NA	NA	NA	NA
1343298:1343315	attL	CAGGATGTGAAGAGCGAA	NA	NA	NA	NA
AWJ26398.1|1343506_1345687_-	tyrosine-protein kinase etk	NA	NA	NA	NA	NA
AWJ26399.1|1345706_1346153_-	protein tyrosine phosphatase	NA	NA	NA	NA	NA
AWJ26400.1|1346140_1347280_-	polysaccharide export protein Wza	NA	NA	NA	NA	NA
AWJ26401.1|1347325_1349422_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
AWJ26402.1|1349421_1350168_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ26403.1|1350164_1350809_-	lipoprotein GfcB	NA	NA	NA	NA	NA
AWJ26404.1|1350915_1351221_-	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
AWJ26405.1|1351662_1351875_-	cold-shock protein CspH	NA	NA	NA	NA	NA
AWJ26406.1|1352160_1352373_+	cold-shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
AWJ30186.1|1352383_1352572_+	cold-shock protein	NA	NA	NA	NA	NA
AWJ26407.1|1352546_1352777_+	cold-shock protein	NA	NA	NA	NA	NA
AWJ26408.1|1352766_1352940_+	protein GnsA	NA	NA	NA	NA	NA
AWJ26409.1|1352988_1354062_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
AWJ26410.1|1354133_1356878_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.2	4.6e-37
AWJ26411.1|1356972_1358046_-|integrase	integrase	integrase	Q9G075	Enterobacteria_phage	99.7	1.3e-200
AWJ26412.1|1358023_1358242_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
AWJ26413.1|1358281_1358449_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
AWJ26414.1|1358537_1358819_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ26415.1|1358933_1359731_-	DUF550 domain-containing protein	NA	A0A075B8H2	Enterobacteria_phage	41.1	5.7e-49
AWJ26416.1|1359741_1360497_-	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	92.8	4.2e-142
AWJ26417.1|1360498_1360906_-	hypothetical protein	NA	A0A125RPT9	Escherichia_phage	97.8	2.8e-68
AWJ26418.1|1360902_1361124_-	conjugal transfer protein TraR	NA	A0A1I9LJM6	Stx_converting_phage	98.6	6.4e-35
AWJ26419.1|1361222_1361504_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
AWJ26420.1|1361514_1361706_-	DUF1382 domain-containing protein	NA	A0A0P0ZC49	Stx2-converting_phage	100.0	4.3e-27
AWJ30187.1|1361678_1361861_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	98.3	2.2e-28
AWJ26421.1|1361860_1362538_-	exonuclease	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
AWJ26422.1|1362534_1363320_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
AWJ26423.1|1363325_1363622_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
AWJ26424.1|1363590_1363743_-	host-nuclease inhibitor protein Gam	NA	Q08J51	Stx2-converting_phage	96.0	1.8e-20
AWJ30188.1|1363676_1363967_-	host cell division inhibitory peptide Kil	NA	M1FN78	Enterobacteria_phage	94.4	3.9e-40
AWJ26425.1|1364046_1364415_-	DUF2528 domain-containing protein	NA	A0A0N7C1W2	Escherichia_phage	96.7	1.1e-63
AWJ26426.1|1364600_1364801_-	restriction endonuclease	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
AWJ26427.1|1365549_1366005_-	antitermination protein	NA	J3JZZ6	Escherichia_phage	96.1	6.8e-63
AWJ30189.1|1366353_1367172_-	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	46.2	3.3e-36
AWJ26428.1|1367338_1368052_-	LexA family transcriptional repressor	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
AWJ26429.1|1368152_1368353_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
AWJ26430.1|1368471_1368765_+	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
AWJ26431.1|1368797_1369697_+	Replication protein O	NA	K7P7F0	Enterobacteria_phage	99.0	6.0e-172
AWJ26432.1|1369693_1370395_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
AWJ26433.1|1370391_1370682_+	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
AWJ26434.1|1370737_1371196_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.3e-81
AWJ30190.1|1371192_1371375_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	100.0	1.9e-29
AWJ26435.1|1371371_1371542_+	protein ninF	NA	Q8H9Z5	Enterobacteria_phage	96.4	3.5e-25
AWJ26436.1|1371534_1372155_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	2.0e-94
AWJ26437.1|1372151_1372817_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.1	3.2e-130
AWJ26438.1|1373028_1373988_-	DUF2219 domain-containing protein	NA	NA	NA	NA	NA
AWJ26439.1|1374327_1374450_+	YlcG family protein	NA	NA	NA	NA	NA
AWJ26440.1|1374464_1375154_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
1374927:1374944	attR	CAGGATGTGAAGAGCGAA	NA	NA	NA	NA
>prophage 5
CP028110	Escherichia coli O121 str. RM8352 chromosome, complete genome	5391064	1378820	1414242	5391064	tail,portal,holin,head,capsid,transposase,lysis	Enterobacteria_phage(40.74%)	32	NA	NA
AWJ26443.1|1378820_1379495_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
AWJ26444.1|1379491_1379839_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
AWJ26445.1|1379858_1381415_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.2	1.3e-161
AWJ26446.1|1381468_1381630_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ26447.1|1381628_1381844_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
AWJ26448.1|1381843_1382341_+	lysozyme	NA	A0A1B5FP97	Escherichia_phage	97.6	1.4e-90
AWJ26449.1|1382337_1382775_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	96.6	4.2e-70
AWJ26450.1|1383508_1383649_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ26451.1|1383728_1383923_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
AWJ30191.1|1384350_1384857_+	DNA-packaging protein	NA	O64316	Escherichia_phage	47.9	1.5e-34
AWJ26452.1|1386738_1386945_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
AWJ26453.1|1386941_1388534_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.7	2.1e-183
AWJ26454.1|1390064_1390412_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.0	4.4e-22
AWJ26455.1|1390469_1391498_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
AWJ26456.1|1391549_1391933_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
AWJ26457.1|1393223_1393976_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.2	1.4e-126
AWJ26458.1|1393989_1394421_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.3	2.8e-42
AWJ26459.1|1394447_1394861_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	81.2	7.8e-42
AWJ26460.1|1397416_1397746_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AWJ26461.1|1397745_1398444_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.8	5.8e-130
AWJ26462.1|1398449_1399193_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.8	5.6e-147
AWJ30192.1|1403549_1404125_+	hypothetical protein	NA	A0A1U8QHD6	Enterobacteria_phage	55.6	1.2e-59
AWJ26463.1|1405521_1405770_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	98.8	1.2e-40
AWJ26464.1|1405822_1406979_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
AWJ30193.1|1407216_1407726_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.7	3.3e-50
AWJ26465.1|1408016_1408598_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
AWJ26466.1|1408665_1409301_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
AWJ26467.1|1409428_1410487_-	type III effector	NA	NA	NA	NA	NA
AWJ26468.1|1410561_1411212_-	DUF1076 domain-containing protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
AWJ26469.1|1411394_1411985_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
AWJ26470.1|1412258_1413122_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
AWJ26471.1|1413105_1414242_-	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.2	2.1e-28
>prophage 6
CP028110	Escherichia coli O121 str. RM8352 chromosome, complete genome	5391064	1648145	1718811	5391064	tail,portal,terminase,holin,integrase,transposase,tRNA,lysis	Escherichia_phage(46.55%)	80	1644831:1644846	1652741:1652756
1644831:1644846	attL	TGCTGGATAAGCTGCG	NA	NA	NA	NA
AWJ26695.1|1648145_1649519_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
AWJ26696.1|1649647_1650583_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	2.2e-145
AWJ26697.1|1650634_1651879_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.5	8.5e-233
AWJ26698.1|1651875_1653089_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
1652741:1652756	attR	CGCAGCTTATCCAGCA	NA	NA	NA	NA
AWJ26699.1|1653184_1653400_-	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
AWJ30212.1|1653478_1653688_-	double-strand break reduction protein	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
AWJ30211.1|1653680_1653875_-	restriction alleviation and modification enhancement protein	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
AWJ26700.1|1653931_1654741_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	69.9	2.2e-104
AWJ26701.1|1654733_1657403_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	59.6	2.0e-194
AWJ30213.1|1657483_1657654_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.3	3.3e-23
AWJ26702.1|1657653_1657875_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
AWJ26703.1|1658299_1658452_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	57.4	2.1e-08
AWJ26704.1|1658462_1658597_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ26705.1|1658832_1659297_-	transcriptional regulator	NA	A0A0U2QW76	Escherichia_phage	69.5	1.2e-54
AWJ26706.1|1659401_1659677_+	transcriptional regulator	NA	A0A0U2S629	Escherichia_phage	65.9	1.4e-23
AWJ26707.1|1659660_1660083_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	5.3e-70
AWJ26708.1|1660095_1660953_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	94.4	4.0e-80
AWJ26709.1|1660959_1661706_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	80.9	2.8e-114
AWJ26710.1|1661727_1662489_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	2.0e-120
AWJ26711.1|1662504_1662921_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	86.2	1.6e-58
AWJ26712.1|1662917_1663391_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	74.8	2.9e-64
AWJ26713.1|1663713_1664292_+	hypothetical protein	NA	A0A0U2RXY7	Escherichia_phage	100.0	2.6e-104
AWJ26714.1|1664251_1665349_-	beta family protein	NA	A0A0U2S621	Escherichia_phage	99.7	9.5e-212
AWJ26715.1|1665902_1667065_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
AWJ26716.1|1667167_1667323_+	type I toxin-antitoxin system hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.1	4.2e-17
AWJ26717.1|1667534_1667714_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ26718.1|1667732_1668218_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
AWJ26719.1|1668679_1669279_+	DUF1367 domain-containing protein	NA	A0A0U2RT94	Escherichia_phage	93.5	1.2e-107
AWJ26720.1|1669278_1669569_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	90.6	1.5e-47
AWJ26721.1|1669565_1670120_+	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	70.5	1.8e-70
AWJ26722.1|1670116_1670341_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ26723.1|1670867_1671053_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ26724.1|1671661_1673608_+	sialate O-acetylesterase	NA	Q9EYC8	Enterobacteria_phage	97.1	0.0e+00
AWJ26725.1|1673744_1673924_+	DUF1378 domain-containing protein	NA	A0A2R2Z345	Escherichia_phage	96.6	1.4e-24
AWJ26726.1|1673964_1674210_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	90.1	2.2e-15
AWJ26727.1|1674286_1674502_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
AWJ26728.1|1674506_1675040_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	98.9	3.9e-102
AWJ26729.1|1675310_1675880_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
AWJ26730.1|1676033_1676501_+|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	99.4	1.2e-78
AWJ26731.1|1676954_1677431_+	DUF1441 domain-containing protein	NA	Q9EYD0	Enterobacteria_phage	96.2	2.2e-80
AWJ26732.1|1677427_1679551_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.9	0.0e+00
AWJ26733.1|1679523_1679760_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	100.0	4.5e-34
AWJ26734.1|1679759_1681262_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	99.2	1.0e-288
AWJ30214.1|1681275_1683231_+	peptidase S14	NA	S5M7Q8	Escherichia_phage	99.8	0.0e+00
AWJ26735.1|1683645_1683927_+	DNA breaking-rejoining protein	NA	S5MDP9	Escherichia_phage	98.9	2.7e-46
AWJ26736.1|1683929_1684553_+|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	99.5	2.6e-105
AWJ26737.1|1684565_1684964_+|tail	phage tail protein	tail	Q9EYD7	Enterobacteria_phage	98.5	2.9e-70
AWJ26738.1|1684971_1685724_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
AWJ26739.1|1685737_1686160_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
AWJ26740.1|1686186_1686600_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
AWJ26741.1|1686580_1689193_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	87.8	0.0e+00
AWJ26742.1|1689189_1689519_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	92.7	6.0e-53
AWJ26743.1|1689518_1690217_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	2.1e-132
AWJ26744.1|1690222_1690966_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	5.0e-148
AWJ26745.1|1690863_1691547_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	89.8	1.8e-107
AWJ26746.1|1691782_1695259_+|tail	phage tail protein	tail	B6DZB5	Enterobacteria_phage	95.0	0.0e+00
AWJ26747.1|1695325_1695925_+	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	1.3e-109
AWJ26748.1|1695989_1697303_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.2	5.3e-76
AWJ26749.1|1697304_1697574_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	95.5	6.0e-43
AWJ26750.1|1697783_1697975_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ26751.1|1698003_1698990_+	peptidase M85	NA	NA	NA	NA	NA
AWJ30215.1|1699360_1699675_-	DinI family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
AWJ26752.1|1699734_1701018_+	MFS transporter	NA	NA	NA	NA	NA
AWJ26753.1|1702603_1702807_-	protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
AWJ26754.1|1702984_1703671_-	transcriptional regulator	NA	NA	NA	NA	NA
AWJ26755.1|1703759_1704506_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AWJ26756.1|1704517_1704736_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ30216.1|1704642_1706688_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
AWJ26757.1|1706731_1707250_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ26758.1|1707525_1707918_+	TIGR00156 family protein	NA	NA	NA	NA	NA
AWJ26759.1|1708172_1709063_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.7	1.8e-19
AWJ26760.1|1709281_1709377_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ26761.1|1709503_1710691_-	transporter	NA	NA	NA	NA	NA
AWJ26762.1|1710885_1711785_+	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
AWJ26763.1|1711829_1712528_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWJ26764.1|1712726_1713038_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
AWJ26765.1|1713152_1714475_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
AWJ26766.1|1714502_1714814_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
AWJ26767.1|1714869_1716543_+	carbohydrate porin	NA	NA	NA	NA	NA
AWJ26768.1|1717655_1718811_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
>prophage 7
CP028110	Escherichia coli O121 str. RM8352 chromosome, complete genome	5391064	1810722	1876623	5391064	transposase,protease	Escherichia_phage(27.27%)	52	NA	NA
AWJ26838.1|1810722_1811859_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
AWJ26839.1|1811998_1813135_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
AWJ26840.1|1813664_1813883_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ26841.1|1821139_1821352_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ26842.1|1821427_1822045_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
AWJ26843.1|1823923_1824985_-	YncE family protein	NA	NA	NA	NA	NA
AWJ30220.1|1825132_1825312_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ26844.1|1825226_1827329_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.3	1.8e-134
AWJ26845.1|1827364_1828030_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWJ26846.1|1829441_1829960_+	L-methionine sulfoximine/L-methionine sulfone acetyltransferase	NA	NA	NA	NA	NA
AWJ26847.1|1829956_1830406_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ26848.1|1830406_1830640_-	DUF2526 domain-containing protein	NA	NA	NA	NA	NA
AWJ30221.1|1830725_1830947_-	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
AWJ30222.1|1830881_1831097_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ26849.1|1831093_1831189_+	stress response membrane protein YncL	NA	NA	NA	NA	NA
AWJ26850.1|1832607_1834032_-	aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
AWJ26851.1|1834053_1834848_-	ABC transporter permease	NA	NA	NA	NA	NA
AWJ26852.1|1834837_1835779_-	ABC transporter permease	NA	NA	NA	NA	NA
AWJ26853.1|1835779_1836793_-	polyamine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
AWJ26854.1|1836810_1837956_-	spermidine/putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWJ26855.1|1838200_1839607_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWJ30223.1|1839685_1840102_-	antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
AWJ26856.1|1840147_1840324_-	mRNA interferase HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
AWJ26857.1|1840545_1840776_+	DUF2554 domain-containing protein	NA	NA	NA	NA	NA
AWJ26858.1|1840867_1842829_-|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	28.3	2.7e-23
AWJ26859.1|1842901_1843438_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWJ26860.1|1843490_1844705_+	BenE family transporter YdcO	NA	NA	NA	NA	NA
AWJ26861.1|1844744_1845953_-|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	92.3	9.5e-205
AWJ26862.1|1846601_1847814_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
AWJ26863.1|1847854_1848466_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
AWJ26864.1|1848768_1849362_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
AWJ26865.1|1849358_1850351_-	TDT family transporter	NA	NA	NA	NA	NA
AWJ26866.1|1850474_1851455_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ26867.1|1851449_1851986_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
AWJ26868.1|1852048_1852273_-	DUF465 domain-containing protein	NA	NA	NA	NA	NA
AWJ26869.1|1852288_1852492_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ26870.1|1852412_1854068_-	glucan biosynthesis protein D	NA	NA	NA	NA	NA
AWJ26871.1|1854292_1855636_-	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
AWJ26872.1|1855852_1856776_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWJ26873.1|1856813_1858454_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
AWJ26874.1|1858852_1859002_+	protein HokB	NA	NA	NA	NA	NA
AWJ26875.1|1859073_1859247_-	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
AWJ26876.1|1859491_1860022_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	2.4e-19
AWJ26877.1|1860210_1861212_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AWJ26878.1|1861253_1862693_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AWJ26879.1|1862889_1863690_-	DUF218 domain-containing protein	NA	NA	NA	NA	NA
AWJ26880.1|1863961_1867864_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
AWJ26881.1|1868064_1868670_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
AWJ30224.1|1868720_1870013_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ26882.1|1871465_1872362_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ26883.1|1872361_1872967_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
AWJ26884.1|1875467_1876623_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
>prophage 8
CP028110	Escherichia coli O121 str. RM8352 chromosome, complete genome	5391064	1908595	1956453	5391064	tail,terminase,holin,head,transposase,lysis	Enterobacteria_phage(34.0%)	56	NA	NA
AWJ26912.1|1908595_1909751_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
AWJ26913.1|1909800_1910787_-	peptidase M85	NA	NA	NA	NA	NA
AWJ26914.1|1910815_1911007_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ26915.1|1911216_1911486_-|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
AWJ26916.1|1911487_1912801_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	3.3e-78
AWJ26917.1|1912865_1913465_-	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	9.7e-110
AWJ26918.1|1913532_1917006_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	98.0	0.0e+00
AWJ26919.1|1917245_1917923_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	96.0	5.1e-115
AWJ26920.1|1918331_1918562_-	hydrolase	NA	A0A0P0ZE89	Stx2-converting_phage	96.8	6.5e-30
AWJ26921.1|1918572_1919271_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
AWJ26922.1|1919270_1919600_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AWJ30225.1|1919596_1921123_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	94.1	1.8e-253
AWJ26923.1|1921134_1921467_-	hypothetical protein	NA	Q687F3	Enterobacteria_phage	100.0	1.1e-51
AWJ26924.1|1922625_1923048_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
AWJ26925.1|1923820_1924216_-|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
AWJ26926.1|1924801_1925155_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
AWJ26927.1|1925166_1925562_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	2.0e-55
AWJ26928.1|1926682_1927015_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
AWJ26929.1|1929918_1930125_-|tail	phage tail protein	tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
AWJ26930.1|1930078_1932046_-|terminase	terminase	terminase	A0A0K2FJ14	Enterobacteria_phage	97.2	0.0e+00
AWJ26931.1|1932020_1932566_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
AWJ26932.1|1932679_1932937_+	hypothetical protein	NA	A0A0K2FJC5	Escherichia_phage	91.4	1.3e-10
AWJ26933.1|1932952_1933177_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
AWJ26934.1|1933258_1933573_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AWJ26935.1|1933813_1933954_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ30226.1|1934036_1934504_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	83.8	3.7e-64
AWJ26936.1|1934652_1935222_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
AWJ26937.1|1935492_1936026_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.3	5.6e-101
AWJ26938.1|1936076_1936421_-	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
AWJ26939.1|1936425_1936641_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
AWJ26940.1|1936790_1938653_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	95.5	0.0e+00
AWJ26941.1|1939475_1939628_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	98.0	3.4e-19
AWJ26942.1|1939642_1939852_+	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	100.0	2.0e-25
AWJ26943.1|1941963_1942953_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	2.3e-193
AWJ26944.1|1943004_1943262_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	71.1	9.5e-22
AWJ26945.1|1943258_1944659_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	92.2	6.4e-245
AWJ26946.1|1944655_1945555_-	AAA family ATPase	NA	Q8W641	Enterobacteria_phage	94.8	8.8e-139
AWJ26947.1|1945565_1946390_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	78.4	1.2e-89
AWJ26948.1|1946386_1946611_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ26949.1|1946607_1946802_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ26950.1|1946798_1947965_-	peptidase	NA	A0A1C9IHV9	Salmonella_phage	61.1	3.6e-116
AWJ26951.1|1947961_1948546_-	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	60.3	2.1e-56
AWJ26952.1|1948573_1948771_-	hypothetical protein	NA	K7PHB1	Enterobacterial_phage	56.9	1.1e-14
AWJ26953.1|1948866_1949520_+	LexA family transcriptional repressor	NA	K7PLZ5	Enterobacterial_phage	60.8	5.7e-71
AWJ26954.1|1949977_1950340_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
AWJ26955.1|1950405_1951230_+	DUF2303 domain-containing protein	NA	Q8SBF9	Shigella_phage	100.0	3.5e-150
AWJ26956.1|1951357_1951543_+	hypothetical protein	NA	U5P0T3	Shigella_phage	100.0	5.6e-24
AWJ26957.1|1951568_1952781_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
AWJ26958.1|1952872_1953208_+	hypothetical protein	NA	U5P0T3	Shigella_phage	97.3	5.7e-59
AWJ26959.1|1953198_1953549_+	Eae protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
AWJ26960.1|1953545_1954019_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	75.5	4.0e-66
AWJ26961.1|1954165_1954633_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	72.1	1.1e-36
AWJ26962.1|1954634_1954826_+	hypothetical protein	NA	G9L660	Escherichia_phage	100.0	9.5e-27
AWJ26963.1|1954828_1955563_+	DUF551 domain-containing protein	NA	S5MC19	Escherichia_phage	98.8	1.4e-139
AWJ26964.1|1955562_1956135_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	97.9	6.7e-108
AWJ26965.1|1956171_1956453_+	pyocin activator protein PrtN	NA	K7PGU0	Enterobacteria_phage	95.7	4.1e-42
>prophage 9
CP028110	Escherichia coli O121 str. RM8352 chromosome, complete genome	5391064	2995742	3057596	5391064	integrase,transposase,tRNA	Stx2-converting_phage(36.0%)	63	2986557:2986572	3040383:3040398
2986557:2986572	attL	CGACCTGTGCCGGAAT	NA	NA	NA	NA
AWJ27898.1|2995742_2996075_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
AWJ30272.1|2996116_2997496_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	2.0e-33
AWJ30273.1|2997431_2997638_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ27899.1|2997913_2999434_+	hypothetical protein	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
AWJ27900.1|2999587_3000211_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AWJ27901.1|3000281_3000464_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ27902.1|3000487_3001252_+	siderophore-interacting protein	NA	NA	NA	NA	NA
AWJ27903.1|3001548_3002865_+|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	28.8	6.6e-34
AWJ27904.1|3002994_3003591_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	89.4	2.0e-99
AWJ27905.1|3003683_3005297_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ27906.1|3006026_3006254_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AWJ27907.1|3006349_3007783_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
AWJ27908.1|3008795_3009359_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AWJ27909.1|3009513_3011874_+	DEAD/DEAH box helicase	NA	Q84473	Paramecium_bursaria_Chlorella_virus	31.8	2.6e-33
AWJ27910.1|3011891_3012080_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ27911.1|3012146_3013685_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.0	3.9e-296
AWJ27912.1|3013734_3014082_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AWJ27913.1|3014340_3015897_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.2	1.3e-161
AWJ27914.1|3015916_3016264_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
AWJ27915.1|3016260_3016935_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
AWJ27916.1|3016948_3017197_-	hypothetical protein	NA	B6DZU5	Stx2-converting_phage	80.2	1.3e-28
AWJ27917.1|3017366_3017564_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ27918.1|3017650_3021640_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	45.1	4.0e-308
AWJ27919.1|3024396_3025014_-	urease accessory protein UreG	NA	NA	NA	NA	NA
AWJ27920.1|3025025_3025700_-	urease accessory protein UreF	NA	NA	NA	NA	NA
AWJ27921.1|3025700_3026165_-	urease accessory protein UreE	NA	NA	NA	NA	NA
AWJ27922.1|3026174_3027881_-	urease subunit alpha	NA	NA	NA	NA	NA
AWJ27923.1|3027870_3028191_-	urease subunit beta	NA	NA	NA	NA	NA
AWJ27924.1|3028199_3028502_-	urease subunit gamma	NA	NA	NA	NA	NA
AWJ27925.1|3029417_3029648_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ27926.1|3029644_3030801_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
AWJ27927.1|3030939_3031215_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ27928.1|3031439_3033059_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
AWJ27929.1|3033151_3033511_-	diacylglycerol kinase	NA	NA	NA	NA	NA
AWJ27930.1|3033920_3034121_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ27931.1|3035506_3035770_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
AWJ27932.1|3035723_3036080_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ27933.1|3036071_3036212_+	hok/gef family protein	NA	G9L6L7	Escherichia_phage	66.7	3.1e-11
AWJ27934.1|3036143_3036422_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ27935.1|3036483_3036663_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ27936.1|3036966_3037158_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ30274.1|3037078_3037750_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ27937.1|3037952_3038108_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ27938.1|3039282_3040824_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	36.8	3.9e-78
3040383:3040398	attR	CGACCTGTGCCGGAAT	NA	NA	NA	NA
AWJ27939.1|3040866_3041247_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AWJ27940.1|3041233_3041563_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AWJ27941.1|3041823_3042291_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
AWJ27942.1|3042308_3043517_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
AWJ27943.1|3043527_3044484_-	citrate lyase subunit beta	NA	NA	NA	NA	NA
AWJ27944.1|3044483_3045563_-	hypothetical protein	NA	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
AWJ27945.1|3045564_3046338_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ27946.1|3046330_3047473_-	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
AWJ27947.1|3047482_3048541_-	carbamoyl-phosphate synthase large chain	NA	NA	NA	NA	NA
AWJ27948.1|3048863_3049445_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
AWJ27949.1|3049444_3050602_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
AWJ27950.1|3050624_3051080_+	Tellurium resistance protein TerB	NA	NA	NA	NA	NA
AWJ27951.1|3051102_3052143_+	tellurium resistance protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
AWJ27952.1|3052191_3052770_+	tellurium resistance protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
AWJ27953.1|3052838_3053414_+	tellurium resistance protein TerE	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
AWJ27954.1|3053683_3054896_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
AWJ27955.1|3055001_3055676_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
AWJ27956.1|3055672_3056020_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
AWJ27957.1|3056039_3057596_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.2	1.3e-161
>prophage 10
CP028110	Escherichia coli O121 str. RM8352 chromosome, complete genome	5391064	3239070	3289168	5391064	transposase,tRNA,protease	Stx2-converting_phage(60.0%)	57	NA	NA
AWJ28142.1|3239070_3240284_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
AWJ28143.1|3240572_3241265_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AWJ28144.1|3241361_3242036_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
AWJ28145.1|3242032_3242380_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
AWJ28146.1|3242399_3243956_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.2	1.3e-161
AWJ28147.1|3244216_3244414_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
AWJ28148.1|3244425_3244914_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ28149.1|3244910_3245288_-	toxin	NA	NA	NA	NA	NA
AWJ28150.1|3245334_3245709_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
AWJ28151.1|3245871_3246093_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
AWJ30283.1|3246161_3246329_-	DNA repair protein RadC	NA	NA	NA	NA	NA
AWJ28152.1|3247611_3247962_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	1.8e-39
AWJ28153.1|3247958_3248384_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	97.9	2.9e-47
AWJ28154.1|3248987_3249620_-	hypothetical protein	NA	A0A2L1IVA1	Escherichia_phage	96.5	5.7e-44
AWJ28155.1|3249888_3250131_+	hypothetical protein	NA	B6DZU5	Stx2-converting_phage	100.0	8.6e-41
AWJ28156.1|3250159_3251716_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.0	8.3e-161
AWJ28157.1|3251735_3252083_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
AWJ28158.1|3252079_3252754_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
AWJ28159.1|3252862_3254401_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.0	8.7e-296
AWJ28160.1|3254517_3255783_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	38.3	2.7e-77
AWJ28161.1|3256161_3256869_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
AWJ28162.1|3256983_3257187_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ28163.1|3257266_3259402_+	ornithine decarboxylase	NA	NA	NA	NA	NA
AWJ28164.1|3259450_3260707_-	nucleoside permease NupG	NA	NA	NA	NA	NA
AWJ28165.1|3260908_3261988_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
AWJ28166.1|3262052_3262328_-	Fe(2+)-trafficking protein	NA	NA	NA	NA	NA
AWJ28167.1|3262355_3263408_-	adenine DNA glycosylase	NA	NA	NA	NA	NA
AWJ28168.1|3263361_3263499_-	adenine glycosylase	NA	NA	NA	NA	NA
AWJ28169.1|3263568_3264288_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AWJ28170.1|3264287_3264614_+	DUF469 domain-containing protein	NA	NA	NA	NA	NA
AWJ28171.1|3264797_3265517_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
AWJ28172.1|3265692_3266739_+	L-asparaginase 2	NA	NA	NA	NA	NA
AWJ28173.1|3266855_3267863_+	DUF1202 domain-containing protein	NA	NA	NA	NA	NA
AWJ28174.1|3267918_3269220_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ28175.1|3269219_3269732_-	TRAP transporter small permease	NA	NA	NA	NA	NA
AWJ28176.1|3269767_3270754_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
AWJ28177.1|3271069_3272206_-	YggW family oxidoreductase	NA	NA	NA	NA	NA
AWJ28178.1|3272198_3272792_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
AWJ28179.1|3272799_3273090_-	YggU family protein	NA	NA	NA	NA	NA
AWJ28180.1|3273086_3273653_-	YggT family protein	NA	NA	NA	NA	NA
AWJ30284.1|3273670_3274375_-	YggS family pyridoxal phosphate enzyme	NA	NA	NA	NA	NA
AWJ28181.1|3274347_3275322_+	type IV pili twitching motility protein PilT	NA	NA	NA	NA	NA
AWJ28182.1|3275530_3275977_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
AWJ28183.1|3275976_3276540_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
AWJ28184.1|3276648_3277599_-	glutathione synthetase	NA	NA	NA	NA	NA
AWJ28185.1|3277611_3278343_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AWJ28186.1|3278422_3279130_-	endonuclease-1	NA	NA	NA	NA	NA
AWJ28187.1|3279224_3279722_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
AWJ28188.1|3279798_3281193_-	galactose-proton symporter	NA	NA	NA	NA	NA
AWJ28189.1|3281628_3282783_-	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
AWJ28190.1|3282838_3283090_+	DUF2684 domain-containing protein	NA	NA	NA	NA	NA
AWJ28191.1|3283086_3283302_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ30285.1|3283437_3283569_+	virulence promoting factor	NA	NA	NA	NA	NA
AWJ28192.1|3283577_3285554_+	arginine decarboxylase	NA	NA	NA	NA	NA
AWJ28193.1|3285690_3286611_+	agmatinase	NA	NA	NA	NA	NA
AWJ28194.1|3286761_3288324_+	DUF1266 domain-containing protein	NA	NA	NA	NA	NA
AWJ28195.1|3288409_3289168_-|protease	metalloprotease	protease	NA	NA	NA	NA
>prophage 11
CP028110	Escherichia coli O121 str. RM8352 chromosome, complete genome	5391064	3503685	3510825	5391064		Escherichia_phage(83.33%)	6	NA	NA
AWJ28380.1|3503685_3504324_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AWJ28381.1|3504320_3505583_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.7	4.4e-136
AWJ28382.1|3505579_3506488_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AWJ28383.1|3506683_3507451_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
AWJ28384.1|3507501_3508158_-	serine/threonine protein phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.8	4.3e-50
AWJ28385.1|3508263_3510825_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 12
CP028110	Escherichia coli O121 str. RM8352 chromosome, complete genome	5391064	3592398	3659784	5391064	tail,terminase,holin,head,capsid,integrase,transposase,tRNA,lysis	Stx2-converting_phage(46.15%)	63	3584985:3585001	3608694:3608710
3584985:3585001	attL	TTGAAACTTTACAAAAA	NA	NA	NA	NA
AWJ28460.1|3592398_3593610_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AWJ28461.1|3593602_3593824_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ28462.1|3593832_3594966_+|integrase	integrase	integrase	NA	NA	NA	NA
AWJ28463.1|3595906_3597063_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
AWJ28464.1|3598146_3598542_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ28465.1|3598656_3599070_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ28466.1|3601105_3601258_-	PapI protein	NA	A0A0N7BTS3	Escherichia_phage	96.0	5.6e-06
AWJ28467.1|3601223_3602437_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
AWJ28468.1|3602563_3602857_+	hypothetical protein	NA	A0A1B5FPB9	Escherichia_phage	96.9	2.8e-46
AWJ28469.1|3603286_3604945_+	helicase	NA	A0A1B5FPA4	Escherichia_phage	98.7	0.0e+00
AWJ28470.1|3604946_3605915_+	DNA primase	NA	A0A1B5FPA8	Escherichia_phage	98.8	2.3e-185
AWJ28471.1|3605914_3606775_+	helix-turn-helix domain containing protein	NA	A0A1B5FPA6	Escherichia_phage	97.2	8.6e-160
AWJ28472.1|3607016_3607259_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	97.5	2.1e-34
AWJ28473.1|3607258_3607609_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	89.1	6.8e-55
AWJ28474.1|3607660_3608551_+	DNA methyltransferase	NA	A0A0P0YLW3	Yellowstone_lake_mimivirus	29.0	4.9e-17
AWJ28475.1|3608597_3610001_-	hypothetical protein	NA	NA	NA	NA	NA
3608694:3608710	attR	TTTTTGTAAAGTTTCAA	NA	NA	NA	NA
AWJ28476.1|3609974_3610166_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ28477.1|3610525_3610792_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ28478.1|3611205_3613059_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.9	0.0e+00
AWJ28479.1|3613342_3613558_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	6.5e-32
AWJ28480.1|3613562_3613907_+	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
AWJ28481.1|3613957_3614491_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
AWJ28482.1|3614568_3614787_+	hypothetical protein	NA	Q687G2	Enterobacteria_phage	93.3	1.0e-16
AWJ28483.1|3614788_3615283_+|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	93.2	9.0e-77
AWJ28484.1|3615279_3615504_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ28485.1|3615872_3616100_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
AWJ28486.1|3616785_3617349_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	98.4	4.0e-89
AWJ28487.1|3617345_3619007_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.3	0.0e+00
AWJ28488.1|3619070_3621008_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.5	0.0e+00
AWJ30295.1|3621052_3621274_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
AWJ28489.1|3623800_3624127_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
AWJ28490.1|3624137_3624488_+|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
AWJ28491.1|3624484_3624931_+	hypothetical protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
AWJ28492.1|3624927_3625272_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
AWJ28493.1|3625336_3626053_+|tail	phage tail protein	tail	B6DZA6	Enterobacteria_phage	99.2	6.2e-127
AWJ28494.1|3626067_3626442_+|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
AWJ28495.1|3626465_3626747_+|tail	phage tail protein	tail	A0A0P0ZDE6	Stx2-converting_phage	100.0	1.3e-45
AWJ28496.1|3626798_3630041_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.6	0.0e+00
AWJ28497.1|3630033_3630375_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
AWJ28498.1|3630374_3631073_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
AWJ28499.1|3631083_3631827_+|tail	phage tail protein	tail	H6WZM4	Escherichia_phage	98.0	2.3e-148
AWJ28500.1|3631724_3632405_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	92.5	8.8e-107
AWJ28501.1|3632358_3632562_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ28502.1|3632592_3633120_-	superoxide dismutase	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
AWJ28503.1|3633253_3636727_+|tail	phage tail protein	tail	A0A0P0ZCI5	Stx2-converting_phage	98.2	0.0e+00
AWJ28504.1|3638769_3639039_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	95.5	6.0e-43
AWJ28505.1|3639254_3641603_+	type III secretion system effector HECT-type E3 ubiquitin transferase	NA	NA	NA	NA	NA
AWJ28506.1|3642194_3645596_+	DUF4765 domain-containing protein	NA	A0A0N7KZG3	Stx2-converting_phage	39.3	1.3e-219
AWJ28507.1|3645972_3647334_-	type III secretion protein GogB	NA	Q9MBM1	Phage_Gifsy-1	29.6	4.3e-52
AWJ28508.1|3649088_3649571_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
AWJ28509.1|3649702_3650179_+	ubiquinone-binding protein	NA	NA	NA	NA	NA
AWJ28510.1|3650168_3650459_+	RnfH family protein	NA	NA	NA	NA	NA
AWJ28511.1|3650520_3650862_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AWJ28512.1|3651010_3652672_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AWJ28513.1|3652757_3653636_-	NAD(+) kinase	NA	NA	NA	NA	NA
AWJ28514.1|3653567_3653762_+	molecular chaperone GrpE	NA	NA	NA	NA	NA
AWJ28515.1|3653758_3654352_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AWJ30296.1|3654406_3655648_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AWJ30297.1|3655713_3656505_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AWJ28516.1|3656671_3658033_+	signal recognition particle protein	NA	NA	NA	NA	NA
AWJ28517.1|3658170_3658419_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AWJ28518.1|3658437_3658986_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AWJ28519.1|3659016_3659784_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 13
CP028110	Escherichia coli O121 str. RM8352 chromosome, complete genome	5391064	3914461	3980289	5391064	tail,portal,terminase,holin,capsid,bacteriocin,transposase,lysis	Escherichia_phage(58.54%)	83	NA	NA
AWJ28745.1|3914461_3915631_+	DUF4102 domain-containing protein	NA	A0A2R2Z2Y0	Escherichia_phage	100.0	1.7e-230
AWJ28746.1|3915614_3915797_-	DNA-binding protein	NA	A0A2R2Z2X2	Escherichia_phage	100.0	4.1e-27
AWJ28747.1|3915875_3916262_-	DUF1627 domain-containing protein	NA	A0A2L1IV77	Escherichia_phage	100.0	4.6e-52
AWJ28748.1|3916297_3916510_-	DUF1382 domain-containing protein	NA	A0A2R2X2A7	Escherichia_phage	100.0	7.1e-31
AWJ28749.1|3916750_3917419_-	hypothetical protein	NA	A0A0P0ZDC0	Stx2-converting_phage	95.2	1.1e-104
AWJ28750.1|3917467_3917752_-	ASCH domain-containing protein	NA	A0A0P0ZDM1	Stx2-converting_phage	97.9	7.7e-49
AWJ28751.1|3917751_3918012_-	eaa protein	NA	A0A077SLR0	Escherichia_phage	98.8	1.9e-41
AWJ28752.1|3918008_3918884_-	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	86.1	5.4e-141
AWJ30305.1|3918880_3919168_-	hypothetical protein	NA	G9L6B3	Escherichia_phage	100.0	9.5e-55
AWJ30306.1|3919397_3919595_-	hypothetical protein	NA	A0A222YWL3	Escherichia_phage	93.4	3.2e-25
AWJ28753.1|3919679_3920835_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
AWJ28754.1|3920876_3921326_-	hypothetical protein	NA	V5UT79	Shigella_phage	54.5	7.0e-20
AWJ28755.1|3921328_3921520_-	hypothetical protein	NA	A0A0P0ZG45	Escherichia_phage	100.0	3.3e-27
AWJ28756.1|3921521_3921929_-	hypothetical protein	NA	A0A125RPT9	Escherichia_phage	100.0	1.3e-70
AWJ28757.1|3921925_3922534_-	hypothetical protein	NA	A0A0P0ZFU9	Escherichia_phage	93.6	1.0e-82
AWJ30307.1|3922530_3922695_-	DUF2737 domain-containing protein	NA	K7P7R0	Enterobacteria_phage	98.1	9.3e-23
AWJ28758.1|3922705_3923002_-	RecBCD nuclease inhibitor	NA	G9L665	Escherichia_phage	100.0	9.5e-50
AWJ28759.1|3923025_3923613_-	DUF669 domain-containing protein	NA	G9L666	Escherichia_phage	100.0	9.9e-107
AWJ28760.1|3923609_3924290_-	ATP-binding protein	NA	G9L667	Escherichia_phage	100.0	3.4e-127
AWJ28761.1|3924298_3924487_-	hypothetical protein	NA	G9L668	Escherichia_phage	100.0	2.2e-28
AWJ28762.1|3924483_3924723_-	host cell division inhibitory peptide Kil	NA	G9L669	Escherichia_phage	100.0	4.4e-37
AWJ28763.1|3924802_3925171_-	DUF2528 domain-containing protein	NA	A0A1U9AJB3	Stx1_converting_phage	99.2	2.6e-65
AWJ28764.1|3925351_3925615_-	hypothetical protein	NA	A4KWT2	Enterobacteria_phage	100.0	3.2e-41
AWJ28765.1|3927298_3927724_-	regulator	NA	F1C5C1	Cronobacter_phage	66.9	7.3e-35
AWJ30308.1|3928088_3928907_-	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	46.2	3.3e-36
AWJ28766.1|3929093_3929435_-	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	99.1	2.5e-62
AWJ28767.1|3929495_3930203_-	phage repressor protein C	NA	G9L676	Escherichia_phage	99.6	1.5e-133
AWJ28768.1|3930281_3930509_+	DNA-binding protein	NA	G9L677	Escherichia_phage	100.0	7.8e-36
AWJ28769.1|3930615_3930915_+	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	100.0	1.3e-49
AWJ28770.1|3930937_3931210_+	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
AWJ28771.1|3931272_3932160_+	replication protein	NA	G9L680	Escherichia_phage	99.7	2.8e-145
AWJ28772.1|3932156_3934550_+	DNA helicase	NA	G9L681	Escherichia_phage	99.7	0.0e+00
AWJ28773.1|3934546_3934816_+	hypothetical protein	NA	G9L682	Escherichia_phage	100.0	2.9e-45
AWJ28774.1|3935239_3935455_+	hypothetical protein	NA	G9L684	Escherichia_phage	100.0	2.2e-32
AWJ28775.1|3935465_3935648_+	hypothetical protein	NA	G9L685	Escherichia_phage	100.0	1.6e-28
AWJ28776.1|3935628_3936045_+	NinB protein	NA	G9L686	Escherichia_phage	100.0	3.9e-73
AWJ28777.1|3936037_3936640_+	endonuclease	NA	G9L687	Escherichia_phage	100.0	1.7e-114
AWJ28778.1|3936636_3937164_+	phage N-6-adenine-methyltransferase	NA	G9L688	Escherichia_phage	100.0	9.5e-101
AWJ28779.1|3937160_3937355_+	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	100.0	2.9e-31
AWJ28780.1|3937611_3937977_+	hypothetical protein	NA	A0A0N7C203	Escherichia_phage	96.7	3.7e-43
AWJ28781.1|3938242_3938917_+	phage antirepressor Ant	NA	A0A0P0ZDQ5	Stx2-converting_phage	88.8	6.2e-113
AWJ28782.1|3938991_3939714_+	DNA-binding protein	NA	A0A0P0ZCB2	Stx2-converting_phage	99.6	3.9e-129
AWJ28783.1|3939713_3940319_+	recombination protein NinG	NA	Q8VNP2	Enterobacteria_phage	98.0	2.4e-95
AWJ28784.1|3940315_3940510_+	protein ninH	NA	A0A0P0ZGE1	Escherichia_phage	100.0	8.4e-31
AWJ28785.1|3940502_3940937_+	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
AWJ28786.1|3940925_3941171_-	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	100.0	5.0e-36
AWJ28787.1|3941185_3941338_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
AWJ28788.1|3941720_3942680_+	Shiga toxin Stx2 subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
AWJ28789.1|3942691_3942961_+	Shiga toxin Stx2 subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
AWJ28790.1|3943447_3945385_+	DUF1737 domain-containing protein	NA	G9L6J1	Escherichia_phage	99.7	0.0e+00
AWJ28791.1|3945520_3945700_+	DUF1378 domain-containing protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
AWJ28792.1|3945740_3946013_+	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	98.9	3.1e-23
AWJ28793.1|3946089_3946305_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
AWJ28794.1|3946309_3946843_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	99.4	3.0e-102
AWJ28795.1|3947117_3947687_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	98.9	2.6e-104
AWJ28796.1|3947843_3948311_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	95.5	7.4e-73
AWJ28797.1|3948476_3949028_+	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	100.0	4.5e-101
AWJ28798.1|3949320_3950127_+|terminase	terminase	terminase	A0A1U9AJA9	Stx1_converting_phage	99.3	1.1e-132
AWJ28799.1|3950107_3951814_+|terminase	terminase	terminase	A0A1U9AJA6	Stx1_converting_phage	99.1	0.0e+00
AWJ28800.1|3951813_3953958_+|portal	portal protein	portal	A0A2R2Z346	Escherichia_phage	99.9	0.0e+00
AWJ28801.1|3954115_3955123_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
AWJ28802.1|3955146_3956361_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	99.5	1.1e-232
AWJ28803.1|3956415_3956805_+	hypothetical protein	NA	V5UT93	Shigella_phage	100.0	9.9e-63
AWJ28804.1|3956855_3957317_+	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	94.8	3.3e-73
AWJ28805.1|3957300_3957864_+	hypothetical protein	NA	A0A0P0ZGG2	Escherichia_phage	99.5	7.0e-102
AWJ28806.1|3957863_3958514_+	hypothetical protein	NA	A0A0H4J3F2	Shigella_phage	99.5	3.9e-120
AWJ28807.1|3958510_3960349_+|tail	phage tail protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.0e-64
AWJ28808.1|3960350_3960620_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	98.9	6.4e-45
AWJ28809.1|3960703_3960937_+	hypothetical protein	NA	A0A0N7CHY0	Escherichia_phage	100.0	1.6e-39
AWJ28810.1|3960832_3961075_-	outer membrane protein	NA	NA	NA	NA	NA
AWJ30309.1|3961240_3962866_+	hypothetical protein	NA	A0A088CBK0	Shigella_phage	99.8	0.0e+00
AWJ28811.1|3962862_3964131_+	host specificity protein J	NA	Q08J79	Stx2-converting_phage	100.0	9.9e-221
AWJ28812.1|3964145_3964427_+	hypothetical protein	NA	Q08J78	Stx2-converting_phage	100.0	3.1e-50
AWJ28813.1|3964432_3964990_+	hypothetical protein	NA	Q08J77	Stx2-converting_phage	98.9	5.5e-107
AWJ28814.1|3965136_3965859_+	hypothetical protein	NA	A0A2L1IV31	Escherichia_phage	76.7	9.0e-102
AWJ28815.1|3966288_3966690_+	hypothetical protein	NA	A0A2L1IV61	Escherichia_phage	97.0	3.9e-70
AWJ28816.1|3966783_3967437_+	hypothetical protein	NA	Q08J74	Stx2-converting_phage	96.8	1.1e-109
AWJ28817.1|3967439_3967886_+	hypothetical protein	NA	A0A2L1IV89	Escherichia_phage	97.3	1.3e-74
AWJ28818.1|3967895_3968147_+|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	97.4	5.1e-12
AWJ28819.1|3968468_3969624_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
AWJ28820.1|3969697_3970690_+	hypothetical protein	NA	A0A2L1IV65	Escherichia_phage	90.0	3.3e-163
AWJ28821.1|3970758_3979134_+	hypothetical protein	NA	A0A0P0ZCC7	Stx2-converting_phage	97.0	0.0e+00
AWJ28822.1|3979356_3980289_-	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
>prophage 14
CP028110	Escherichia coli O121 str. RM8352 chromosome, complete genome	5391064	4221612	4231054	5391064		Enterobacteria_phage(85.71%)	10	NA	NA
AWJ29036.1|4221612_4222539_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
AWJ29037.1|4222543_4223275_+	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AWJ29038.1|4223255_4223363_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ29039.1|4223422_4224154_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AWJ29040.1|4224375_4226061_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AWJ29041.1|4226057_4226777_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AWJ29042.1|4226823_4227294_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	99.4	1.1e-81
AWJ29043.1|4227334_4227796_-	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AWJ29044.1|4227920_4229921_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
AWJ29045.1|4229917_4231054_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 15
CP028110	Escherichia coli O121 str. RM8352 chromosome, complete genome	5391064	4322525	4330815	5391064		Klebsiella_phage(14.29%)	7	NA	NA
AWJ29118.1|4322525_4323920_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
AWJ29119.1|4324094_4324988_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.9e-46
AWJ29120.1|4325409_4326690_+	Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB	NA	A0A218MKK1	uncultured_virus	24.7	2.1e-08
AWJ29121.1|4326726_4327755_+	Vi polysaccharide biosynthesis UDP-N-acetylglucosaminuronic acid C-4 epimerase TviC	NA	E3T4Y8	Cafeteria_roenbergensis_virus	45.1	4.5e-70
AWJ30321.1|4327757_4328846_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	50.3	2.5e-95
AWJ29122.1|4328812_4329712_+	glucose-1-phosphate thymidylyltransferase	NA	K7QKA7	Escherichia_phage	64.7	1.8e-107
AWJ29123.1|4329711_4330815_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2P1ELT3	Moumouvirus	32.1	2.7e-28
>prophage 16
CP028110	Escherichia coli O121 str. RM8352 chromosome, complete genome	5391064	4457011	4511586	5391064	tail,portal,terminase,holin,capsid,integrase,plate	Enterobacteria_phage(82.93%)	72	4476449:4476508	4511693:4511816
AWJ29238.1|4457011_4457206_-|integrase	integrase	integrase	NA	NA	NA	NA
AWJ29239.1|4457485_4458154_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	1.6e-81
AWJ29240.1|4458260_4458494_-	SirA-like protein	NA	NA	NA	NA	NA
AWJ29241.1|4458490_4459696_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
AWJ29242.1|4459882_4460296_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ29243.1|4460329_4461817_-	alpha-amylase	NA	NA	NA	NA	NA
AWJ29244.1|4461894_4462260_-	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
AWJ29245.1|4462259_4462670_-	flagella export chaperone FliS	NA	NA	NA	NA	NA
AWJ29246.1|4462694_4464101_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
AWJ29247.1|4464366_4466199_+	flagellin FliC	NA	NA	NA	NA	NA
AWJ29248.1|4466529_4467249_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
AWJ29249.1|4467294_4467846_+	flagella biosynthesis regulatory protein FliZ	NA	NA	NA	NA	NA
AWJ29250.1|4467933_4468734_+	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWJ29251.1|4468838_4469825_+	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
AWJ29252.1|4469839_4470508_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWJ29253.1|4470504_4471257_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
AWJ29254.1|4471486_4472209_+	transcriptional regulator SdiA	NA	NA	NA	NA	NA
AWJ29255.1|4472275_4472500_-	DUF2594 domain-containing protein	NA	NA	NA	NA	NA
AWJ29256.1|4472700_4472817_-	transcriptional regulator	NA	NA	NA	NA	NA
AWJ29257.1|4472958_4473615_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AWJ29258.1|4473611_4475444_+	excinuclease ABC subunit C	NA	NA	NA	NA	NA
AWJ29259.1|4475500_4476049_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
4476449:4476508	attL	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGA	NA	NA	NA	NA
AWJ30328.1|4476932_4477325_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ29260.1|4477514_4477655_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
AWJ29261.1|4477660_4477849_+	hypothetical protein	NA	Q7Y2U2	Escherichia_phage	61.9	5.3e-06
AWJ29262.1|4477845_4478106_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ29263.1|4478148_4479258_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
AWJ29264.1|4479415_4480600_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.0	4.4e-223
AWJ29265.1|4480599_4481112_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
AWJ29266.1|4481166_4481532_+|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
AWJ29267.1|4481459_4481696_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	8.7e-22
AWJ29268.1|4481682_4484490_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.7	0.0e+00
AWJ30329.1|4485168_4485714_+	transferase	NA	NA	NA	NA	NA
AWJ29269.1|4485677_4486295_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	80.9	1.0e-85
AWJ29270.1|4486294_4488295_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	97.6	4.6e-111
AWJ29271.1|4488297_4488828_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
AWJ29272.1|4488820_4489717_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	5.7e-154
AWJ29273.1|4489720_4490071_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
AWJ29274.1|4490067_4490649_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.9	1.4e-100
AWJ29275.1|4490645_4491281_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	1.5e-113
AWJ29276.1|4491273_4491741_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
AWJ30330.1|4491727_4491907_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ29277.1|4491878_4492286_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	99.3	9.0e-67
AWJ29278.1|4492282_4492675_-	M15 family peptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
AWJ29279.1|4492671_4492995_-|holin	phage holin, lambda family	holin	A0A0A7NRY9	Enterobacteria_phage	100.0	4.2e-51
AWJ29280.1|4492997_4493198_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
AWJ29281.1|4493197_4493692_-|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	98.2	2.3e-88
AWJ29282.1|4493794_4494595_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	97.4	3.3e-137
AWJ29283.1|4494640_4495693_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.4	2.9e-194
AWJ29284.1|4495716_4496553_-|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.6	1.5e-148
AWJ29285.1|4496707_4498459_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	97.9	0.0e+00
AWJ29286.1|4498458_4499505_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.4	6.3e-205
AWJ30331.1|4499705_4499996_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ29287.1|4499892_4500144_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ29288.1|4500034_4500565_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ29289.1|4500656_4501040_-	hypothetical protein	NA	Q8HAA6	Salmonella_phage	50.0	9.8e-31
AWJ29290.1|4501103_4501415_-	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	94.2	4.2e-48
AWJ29291.1|4501419_4502379_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	6.4e-180
AWJ29292.1|4505293_4505683_-	inositol monophosphatase	NA	NA	NA	NA	NA
AWJ29293.1|4505755_4505986_-	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	92.1	2.5e-29
AWJ29294.1|4506308_4506608_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	86.9	9.0e-40
AWJ29295.1|4506604_4506871_-	MarR family transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	3.4e-30
AWJ29296.1|4506867_4507071_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	80.6	5.5e-25
AWJ29297.1|4507094_4507490_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ29298.1|4507714_4507957_-	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	6.8e-38
AWJ29299.1|4507968_4508247_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	5.3e-34
AWJ29300.1|4508257_4508608_-	DUF4761 domain-containing protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
AWJ29301.1|4508629_4508833_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
AWJ29302.1|4508849_4509056_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ29303.1|4509131_4509536_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
AWJ29304.1|4510231_4510579_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AWJ29305.1|4510584_4511586_+|integrase	integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
4511693:4511816	attR	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTTTGT	NA	NA	NA	NA
>prophage 17
CP028110	Escherichia coli O121 str. RM8352 chromosome, complete genome	5391064	4540920	4547546	5391064	transposase,tRNA	Stx2-converting_phage(83.33%)	6	NA	NA
AWJ29335.1|4540920_4542459_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.0	3.0e-296
AWJ29336.1|4542508_4542856_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AWJ29337.1|4543037_4544594_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.0	8.3e-161
AWJ29338.1|4544613_4544961_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
AWJ29339.1|4544957_4545632_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
AWJ29340.1|4545812_4547546_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	5.7e-86
>prophage 18
CP028110	Escherichia coli O121 str. RM8352 chromosome, complete genome	5391064	4834423	4976506	5391064	tail,portal,terminase,holin,head,capsid,integrase,transposase,tRNA,lysis,protease	Escherichia_phage(33.93%)	163	4967703:4967717	4980448:4980462
AWJ29612.1|4834423_4835245_-|protease	serine protease	protease	NA	NA	NA	NA
AWJ29613.1|4835344_4835428_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ29614.1|4835520_4835856_-	acid shock protein	NA	NA	NA	NA	NA
AWJ29615.1|4836252_4837506_-	MFS transporter	NA	NA	NA	NA	NA
AWJ29616.1|4837612_4838506_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWJ29617.1|4838640_4839861_+	ROK family transcriptional regulator	NA	NA	NA	NA	NA
AWJ29618.1|4839985_4840681_+	dethiobiotin synthase	NA	NA	NA	NA	NA
AWJ30347.1|4840633_4841926_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
AWJ29619.1|4842084_4842699_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
AWJ29620.1|4842741_4843596_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AWJ29621.1|4843597_4844215_-	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
AWJ30348.1|4844225_4846649_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.3	2.9e-205
AWJ29622.1|4846709_4849136_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	2.0e-214
AWJ29623.1|4849334_4849640_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AWJ29624.1|4849747_4850458_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
AWJ29625.1|4850460_4851021_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AWJ29626.1|4851055_4851397_-	DUF1283 domain-containing protein	NA	NA	NA	NA	NA
AWJ29627.1|4851531_4851858_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	7.6e-24
AWJ29628.1|4851894_4852083_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ29629.1|4852063_4853278_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AWJ29630.1|4853289_4853856_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	30.2	1.5e-11
AWJ29631.1|4854097_4854772_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
AWJ29632.1|4854768_4855116_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
AWJ29633.1|4855135_4856692_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.0	8.3e-161
AWJ29634.1|4856873_4857221_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AWJ29635.1|4857270_4858809_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.0	3.0e-296
AWJ29636.1|4858966_4859218_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
AWJ29637.1|4860476_4861690_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
AWJ29638.1|4861962_4862241_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
AWJ29639.1|4862242_4863292_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.9	2.5e-113
AWJ29640.1|4863305_4864058_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	96.8	2.1e-133
AWJ29641.1|4865218_4865404_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ29642.1|4866174_4866387_-	cold-shock protein CspF	NA	NA	NA	NA	NA
AWJ29643.1|4866687_4866903_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	76.5	7.7e-25
AWJ29644.1|4867656_4867872_+|holin	holin	holin	A5LH82	Enterobacteria_phage	93.0	5.5e-31
AWJ29645.1|4868184_4868718_+	lysozyme from lambdoid prophage Qin	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
AWJ29646.1|4868714_4869212_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
AWJ29647.1|4869573_4869786_+	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AWJ29648.1|4869796_4869985_+	cold-shock protein	NA	NA	NA	NA	NA
AWJ29649.1|4870015_4870288_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ30349.1|4870459_4870633_+	protein GnsB	NA	NA	NA	NA	NA
AWJ29650.1|4870784_4871195_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.7	1.2e-63
AWJ29651.1|4871140_4871341_-	hypothetical protein	NA	C6ZCX4	Enterobacteria_phage	70.0	4.5e-11
AWJ29652.1|4871495_4871702_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
AWJ29653.1|4872254_4872794_+	DUF1441 domain-containing protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
AWJ29654.1|4872868_4873840_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.7	3.1e-182
AWJ29655.1|4873957_4875196_+	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	35.1	6.6e-60
AWJ29656.1|4875188_4875413_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ29657.1|4875472_4876051_+	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	65.4	4.9e-58
AWJ29658.1|4876171_4876369_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ29659.1|4876426_4876669_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ29660.1|4877125_4877446_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ29661.1|4877452_4877752_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AWJ29662.1|4877748_4879575_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	50.7	2.0e-129
AWJ29663.1|4879862_4880108_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ29664.1|4880104_4880527_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AWJ29665.1|4880994_4881189_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ29666.1|4881185_4883075_+	peptidase	NA	Q8VNN5	Enterobacteria_phage	51.5	9.4e-183
AWJ29667.1|4883332_4883614_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ29668.1|4885096_4885309_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
AWJ29669.1|4885308_4886817_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.6	7.8e-289
AWJ29670.1|4888830_4889199_+	DUF2190 domain-containing protein	NA	A5LH31	Enterobacteria_phage	100.0	9.7e-52
AWJ29671.1|4889191_4889467_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	1.1e-44
AWJ29672.1|4889478_4890057_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
AWJ29673.1|4890053_4890455_+|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
AWJ29674.1|4890466_4891210_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	96.8	4.0e-129
AWJ30350.1|4891270_4891657_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	96.1	4.9e-62
AWJ29675.1|4891665_4891995_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
AWJ29676.1|4891966_4895032_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.7	0.0e+00
AWJ29677.1|4895031_4895361_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	8.6e-60
AWJ29678.1|4895370_4896069_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	2.3e-134
AWJ29679.1|4896074_4896818_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.5e-147
AWJ29680.1|4896715_4897363_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	1.2e-110
AWJ29681.1|4897423_4900822_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	88.6	0.0e+00
AWJ29682.1|4900888_4901488_+	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.0	8.8e-111
AWJ30351.1|4901552_4904507_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	80.7	6.0e-67
AWJ29683.1|4904506_4905028_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.9	2.3e-91
AWJ29684.1|4905084_4906240_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
AWJ29685.1|4906446_4907034_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	6.1e-24
AWJ29686.1|4907350_4907584_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AWJ29687.1|4908416_4909712_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.3	2.5e-155
AWJ30352.1|4909731_4909926_-	DNA-binding protein	NA	Q859D3	Escherichia_coli_phage	53.7	6.3e-10
AWJ29688.1|4910023_4911237_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
AWJ29689.1|4911300_4912457_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
AWJ29690.1|4912635_4915098_-	exonuclease	NA	V5UQJ3	Shigella_phage	47.7	2.3e-125
AWJ29691.1|4915190_4915379_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWJ29692.1|4915375_4915564_-	cell division inhibitor	NA	NA	NA	NA	NA
AWJ29693.1|4915819_4916080_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ30353.1|4916128_4916338_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ30354.1|4916338_4916977_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
AWJ30355.1|4916988_4917141_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
AWJ30356.1|4917433_4917958_-	LexA family transcriptional repressor	NA	A0A1W6JP50	Morganella_phage	32.9	1.3e-12
AWJ29694.1|4918163_4918406_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
AWJ29695.1|4918389_4918815_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AWJ29696.1|4918825_4919026_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ29697.1|4919202_4919403_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ29698.1|4919742_4920405_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.4e-79
AWJ29699.1|4920438_4921155_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
AWJ30357.1|4921187_4921469_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
AWJ29700.1|4921465_4921693_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
AWJ29701.1|4921685_4921997_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
AWJ29702.1|4922124_4922343_+	sugar acetyltransferase inhibitor	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
AWJ29703.1|4922344_4922902_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.3	2.4e-33
AWJ29704.1|4923135_4923348_+	Hok/Gef family protein	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
AWJ29705.1|4923467_4923812_+	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
AWJ29706.1|4923933_4924206_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
AWJ29707.1|4924207_4925257_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
AWJ29708.1|4925269_4925629_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
AWJ29709.1|4925637_4926192_+	antiterminator	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
AWJ29710.1|4926416_4926614_+	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	95.4	1.5e-27
AWJ29711.1|4926749_4927463_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWJ29712.1|4927913_4928345_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
AWJ29713.1|4928235_4928502_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ29714.1|4928646_4928775_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ29715.1|4930950_4931112_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ29716.1|4931110_4931326_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
AWJ29717.1|4931330_4931675_+	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
AWJ29718.1|4931725_4932259_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	7.4e-101
AWJ29719.1|4932529_4933084_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	1.4e-102
AWJ30358.1|4933246_4933714_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	83.8	3.7e-64
AWJ29720.1|4933796_4933961_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ29721.1|4934176_4934491_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AWJ30359.1|4934572_4934797_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
AWJ29722.1|4934811_4935069_-	hypothetical protein	NA	A0A0K2FJC5	Escherichia_phage	91.4	1.3e-10
AWJ29723.1|4935182_4935728_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
AWJ29724.1|4935702_4937628_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
AWJ29725.1|4937624_4937831_+|tail	phage tail protein	tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
AWJ29726.1|4937827_4938235_+|portal	portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	90.7	1.4e-51
AWJ29727.1|4939713_4939863_+	peptidase, S49 family protein	NA	A0A2I6TC87	Escherichia_phage	96.9	3.7e-10
AWJ29728.1|4940731_4941064_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
AWJ29729.1|4941119_4942145_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	96.8	9.9e-187
AWJ29730.1|4942186_4942582_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	2.0e-55
AWJ29731.1|4942593_4942947_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
AWJ29732.1|4942958_4943537_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	6.6e-79
AWJ29733.1|4943935_4944688_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
AWJ29734.1|4944701_4945124_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
AWJ29735.1|4945150_4945564_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
AWJ29736.1|4948147_4948477_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	92.7	6.0e-53
AWJ29737.1|4949179_4949923_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	5.0e-148
AWJ29738.1|4949820_4950504_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	89.8	1.8e-107
AWJ29739.1|4950738_4954131_+|tail	phage tail protein	tail	B6DZB5	Enterobacteria_phage	87.7	0.0e+00
AWJ29740.1|4954197_4954797_+	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.6e-110
AWJ29741.1|4956445_4957658_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
AWJ29742.1|4957624_4957759_+|tail	phage tail protein	tail	A0A0N7BTS3	Escherichia_phage	100.0	2.6e-07
AWJ29743.1|4958170_4958776_+	secretion protein EspS	NA	A0A0P0ZCT1	Stx2-converting_phage	99.5	1.8e-111
AWJ30360.1|4959000_4959372_-	DUF1076 domain-containing protein	NA	A0A0P0ZBX1	Stx2-converting_phage	99.2	1.7e-67
AWJ29744.1|4959907_4961064_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.8e-68
AWJ29745.1|4961511_4961760_-	damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
AWJ29746.1|4961821_4962919_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.7	9.5e-212
AWJ29747.1|4963007_4964045_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AWJ29748.1|4964178_4964421_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
AWJ29749.1|4965652_4967068_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
AWJ29750.1|4967120_4968200_+	alanine racemase biosynthetic	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
4967703:4967717	attL	GGTGGCATTCTGCTG	NA	NA	NA	NA
AWJ29751.1|4968452_4969646_+	aromatic amino acid transaminase	NA	NA	NA	NA	NA
AWJ29752.1|4969867_4970410_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ29753.1|4970772_4971486_+	class B acid phosphatase	NA	NA	NA	NA	NA
AWJ29754.1|4971596_4972013_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
AWJ29755.1|4972016_4972373_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
AWJ29756.1|4972407_4975230_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.0	0.0e+00
AWJ29757.1|4975180_4975363_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ29758.1|4975484_4976021_+	ssDNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
AWJ29759.1|4976119_4976401_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ29760.1|4976359_4976506_+|integrase	integrase	integrase	NA	NA	NA	NA
4980448:4980462	attR	GGTGGCATTCTGCTG	NA	NA	NA	NA
>prophage 19
CP028110	Escherichia coli O121 str. RM8352 chromosome, complete genome	5391064	5325883	5363026	5391064	tail,terminase,holin,integrase,transposase,lysis	Enterobacteria_phage(42.86%)	50	5322851:5322864	5332747:5332760
5322851:5322864	attL	TTCTTCGCCTGGCG	NA	NA	NA	NA
AWJ30066.1|5325883_5327101_+|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	99.5	1.7e-238
AWJ30067.1|5329473_5329668_-	DNA-binding protein	NA	A5LH59	Enterobacteria_phage	96.9	3.8e-31
AWJ30068.1|5329667_5330288_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	92.7	3.6e-115
AWJ30069.1|5330287_5330650_-	hypothetical protein	NA	K7PH61	Enterobacteria_phage	98.3	5.8e-65
AWJ30070.1|5330640_5331177_-	HD family hydrolase	NA	A0A0P0ZCH9	Stx2-converting_phage	98.9	4.8e-100
AWJ30071.1|5331467_5331662_+	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	95.3	1.4e-30
AWJ30072.1|5331763_5332018_-	hypothetical protein	NA	A0A291AWY6	Escherichia_phage	97.4	2.7e-13
AWJ30073.1|5332097_5332790_-	XRE family transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	2.9e-121
5332747:5332760	attR	TTCTTCGCCTGGCG	NA	NA	NA	NA
AWJ30375.1|5332763_5332916_+	amino acid permease	NA	NA	NA	NA	NA
AWJ30074.1|5332887_5333148_+	XRE family transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	98.8	1.2e-40
AWJ30075.1|5333140_5333692_+	hypothetical protein	NA	A0A0P0ZE62	Stx2-converting_phage	98.9	2.2e-100
AWJ30076.1|5333688_5334837_+	peptidase	NA	K7PLX4	Enterobacteria_phage	86.9	7.2e-178
AWJ30077.1|5334833_5335058_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	98.6	2.8e-38
AWJ30078.1|5335868_5336363_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	98.8	4.3e-87
AWJ30079.1|5336362_5337016_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
AWJ30080.1|5337012_5337339_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
AWJ30081.1|5337335_5337725_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
AWJ30082.1|5337744_5338554_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
AWJ30083.1|5338569_5339085_+	hypothetical protein	NA	V5URU3	Shigella_phage	28.7	4.6e-15
AWJ30084.1|5339094_5340084_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	1.2e-194
AWJ30085.1|5340101_5340443_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
AWJ30086.1|5340455_5341004_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ30087.1|5340990_5341917_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ30088.1|5342181_5342385_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
AWJ30089.1|5342535_5343594_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	86.7	2.9e-181
AWJ30090.1|5344036_5344468_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	99.3	3.5e-69
AWJ30091.1|5344358_5344625_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ30092.1|5345039_5346890_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	96.8	0.0e+00
AWJ30093.1|5347012_5348168_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
AWJ30094.1|5348434_5348596_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ30095.1|5348594_5348810_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
AWJ30096.1|5349296_5350510_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
AWJ30097.1|5350616_5351084_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	80.1	4.0e-58
AWJ30098.1|5351166_5351307_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ30099.1|5351549_5351864_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AWJ30100.1|5351945_5352170_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
AWJ30101.1|5352211_5352577_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
AWJ30102.1|5352867_5353269_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	97.7	5.6e-61
AWJ30103.1|5353261_5354475_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
AWJ30104.1|5354500_5355196_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	99.6	8.6e-126
AWJ30105.1|5355263_5355887_+	hypothetical protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	2.5e-68
AWJ30106.1|5355951_5357142_+|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	95.5	4.8e-76
AWJ30107.1|5357143_5357413_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	98.9	2.4e-44
AWJ30108.1|5357523_5358105_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
AWJ30109.1|5358172_5358802_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	8.7e-77
AWJ30110.1|5358883_5359525_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	98.6	1.4e-106
AWJ30111.1|5359685_5359934_-	damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
AWJ30112.1|5360153_5361740_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
AWJ30113.1|5362132_5362738_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
AWJ30114.1|5362846_5363026_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	2.0e-10
>prophage 1
CP028111	Escherichia coli O121 str. RM8352 plasmid pRM8352, complete sequence	83211	7074	71900	83211	bacteriocin,transposase,protease,integrase	Stx2-converting_phage(38.1%)	54	3791:3850	62616:62889
3791:3850	attL	AGTTGCAGAATTTCAGATTCCAGTTCAGCCACCGTGCGGGAACCAGGAGTACCGAGCCCT	NA	NA	NA	NA
AWJ30385.1|7074_8262_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AWJ30386.1|8261_8627_-|transposase	transposase	transposase	NA	NA	NA	NA
AWJ30387.1|8863_9211_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AWJ30388.1|9260_10799_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.8	4.3e-295
AWJ30389.1|11102_12101_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
AWJ30390.1|12174_13896_-	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
AWJ30391.1|13989_15096_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AWJ30392.1|15095_15917_-	carbohydrate transporter	NA	NA	NA	NA	NA
AWJ30393.1|18589_19081_+	toxin-activating lysine-acyltransferase	NA	NA	NA	NA	NA
AWJ30394.1|19082_22079_+	enterohemolysin	NA	NA	NA	NA	NA
AWJ30395.1|22128_24249_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	30.2	1.6e-45
AWJ30396.1|24252_25692_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
AWJ30397.1|25758_26097_+|bacteriocin	lipid II-degrading bacteriocin	bacteriocin	NA	NA	NA	NA
AWJ30398.1|26104_26485_-	colicin M immunity protein	NA	NA	NA	NA	NA
AWJ30399.1|26630_27413_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.3	1.2e-54
AWJ30400.1|27414_27828_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ30401.1|27941_28136_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ30436.1|28096_28300_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ30402.1|28272_28410_+	toxin-antitoxin system, antitoxin component, AbrB family protein	NA	NA	NA	NA	NA
AWJ30403.1|28387_28618_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AWJ30404.1|28614_29031_+	PIN domain-containing protein	NA	NA	NA	NA	NA
AWJ30437.1|29192_29525_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ30405.1|29484_29568_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.2e-07
AWJ30406.1|33068_33452_-	hydrogenase	NA	NA	NA	NA	NA
AWJ30407.1|36761_36992_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
AWJ30408.1|37136_38292_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
AWJ30409.1|38379_38766_+	recombinase	NA	NA	NA	NA	NA
AWJ30410.1|38819_39494_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
AWJ30411.1|39490_39838_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
AWJ30412.1|39857_41414_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.0	8.3e-161
AWJ30413.1|42877_43243_-|transposase	transposase	transposase	NA	NA	NA	NA
AWJ30414.1|43170_43554_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ30415.1|44066_45623_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.0	8.3e-161
AWJ30416.1|45642_45990_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
AWJ30417.1|45986_46661_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
AWJ30418.1|46666_46906_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ30419.1|46959_47937_-	repFIB replication protein A	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
AWJ30420.1|50539_50935_-	plasmid stabilization protein	NA	NA	NA	NA	NA
AWJ30421.1|50934_51894_-	plasmid stabilization protein	NA	A0A222YXF2	Escherichia_phage	40.6	1.6e-61
AWJ30438.1|52166_53069_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
AWJ30422.1|53452_54136_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	5.6e-29
AWJ30439.1|54135_54354_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ30423.1|54365_54800_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AWJ30424.1|54844_55327_+	recombinase	NA	NA	NA	NA	NA
AWJ30425.1|55833_56989_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
AWJ30426.1|57399_57582_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ30427.1|57886_61789_-|protease	serine protease EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
AWJ30428.1|62726_63263_-	hypothetical protein	NA	NA	NA	NA	NA
62616:62889	attR	AGGGCTCGGTACTCCTGGTTCCCGCACGGTGGCTGAACTGGAATCTGAAATTCTGCAACTACAACCATCCCGGAAGATTAAACATAGTGAGAACCTCTGTATATGTCGGGATTAAAGAACATCCGGCCAGGGATTCAGTTCGCCCAGCCAGCGGGAACCGGAAAGACGGCAGACAATAATCACTTTGTCTCCTCGTCTGAATTCTTTCCCGGCCTCCGGCTCCAGCAACAGGTAATGAACCTGCCCAAAGCGGTCTGTGAAGCGACCTTCACAG	NA	NA	NA	NA
AWJ30429.1|63330_64486_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
AWJ30430.1|65256_65442_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ30431.1|65492_65969_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	90.7	3.0e-45
AWJ30432.1|67015_68228_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
AWJ30433.1|69990_71152_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	1.4e-51
AWJ30434.1|71669_71900_+|transposase	transposase	transposase	NA	NA	NA	NA
