The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029242	Escherichia coli strain ECCRA-119 chromosome, complete genome	4893130	54108	129167	4893130	transposase,tRNA	Escherichia_phage(47.83%)	63	NA	NA
AWJ97252.1|54108_54813_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWJ97253.1|55198_55615_+	fosfomycin resistance glutathione transferase FosA3	NA	NA	NA	NA	NA
AWJ97254.1|55619_56138_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ97255.1|56137_56926_-	winged helix family transcriptional regulator	NA	NA	NA	NA	NA
AWJ97256.1|57425_58130_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWJ97257.1|58120_58249_+	replication initiator protein	NA	NA	NA	NA	NA
AWJ97258.1|58447_59008_+	DNA resolvase	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AWJ97259.1|59010_61962_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
AWK01696.1|61970_62372_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ97260.1|62456_63161_-|transposase	IS6 family transposase IS1006	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
AWJ97261.1|64085_64970_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
AWJ97262.1|65186_66401_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
AWJ97263.1|66428_66734_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWJ97264.1|66845_68339_+|transposase	IS91-like element ISVsa3 family transposase	transposase	NA	NA	NA	NA
AWJ97265.1|68369_68621_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ97266.1|68514_68817_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AWJ97267.1|68903_69719_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
AWJ97268.1|69808_70898_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
AWJ97269.1|71095_71581_-	phenol hydroxylase	NA	NA	NA	NA	NA
AWJ97270.1|73391_74144_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
AWJ97271.1|74565_75591_-	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
AWJ97272.1|75577_75799_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ97273.1|75819_76596_-	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
AWJ97274.1|76709_77414_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWJ97275.1|78060_78351_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
AWJ97276.1|78462_78960_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
AWJ97277.1|79364_80069_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWJ97278.1|80258_81074_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
AWJ97279.1|81224_81929_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWJ97280.1|83752_84721_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
AWJ97281.1|84755_85631_-	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
AWJ97282.1|86584_87289_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWJ97283.1|89168_89348_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ97284.1|89529_90402_-	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
AWJ97285.1|90500_91373_-	hypothetical protein	NA	NA	NA	NA	NA
AWK01697.1|93860_94058_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ97286.1|93960_94578_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ97287.1|94657_95059_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
AWJ97288.1|95571_95784_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
AWJ97289.1|96126_96324_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ97290.1|96527_97097_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AWJ97291.1|98347_99130_-|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	99.2	2.9e-138
AWJ97292.1|99126_100149_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.3e-199
AWJ97293.1|101206_101392_-	hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	100.0	8.1e-15
AWJ97294.1|101390_102407_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	1.1e-185
AWK01698.1|102444_102558_-	sugar kinase	NA	Q6QLL3	Human_immunodeficiency_virus	97.2	3.5e-13
AWJ97295.1|103281_103425_-	ABC transporter	NA	NA	NA	NA	NA
AWJ97296.1|103451_105482_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ97297.1|105487_106678_-	glycosyl transferase family 1	NA	NA	NA	NA	NA
AWJ97298.1|106698_108816_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ97299.1|108820_110230_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AWJ97300.1|110219_111032_-	ABC transporter permease	NA	NA	NA	NA	NA
AWJ97301.1|111037_112183_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AWK01699.1|112411_113216_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	38.9	6.4e-32
AWJ97302.1|115196_116381_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	69.9	3.4e-162
AWJ97303.1|117067_118450_+	inner membrane symporter YicJ	NA	NA	NA	NA	NA
AWJ97304.1|118459_120778_+	alpha-xylosidase	NA	NA	NA	NA	NA
AWJ97305.1|120830_122540_-	AsmA family protein	NA	NA	NA	NA	NA
AWJ97306.1|122660_124052_-	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
AWJ97307.1|124331_125537_+	sodium/glutamate symport carrier protein	NA	NA	NA	NA	NA
AWJ97308.1|125539_126406_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ97309.1|126390_128472_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
AWJ97310.1|128477_129167_-|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
>prophage 2
CP029242	Escherichia coli strain ECCRA-119 chromosome, complete genome	4893130	1135759	1142899	4893130		Escherichia_phage(83.33%)	6	NA	NA
AWJ98259.1|1135759_1136398_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AWJ98260.1|1136394_1137657_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.7	5.7e-136
AWJ98261.1|1137653_1138562_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AWJ98262.1|1138757_1139525_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
AWJ98263.1|1139575_1140232_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
AWJ98264.1|1140337_1142899_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	2.3e-30
>prophage 3
CP029242	Escherichia coli strain ECCRA-119 chromosome, complete genome	4893130	1724058	1733500	4893130		Enterobacteria_phage(85.71%)	10	NA	NA
AWJ98786.1|1724058_1724985_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
AWJ98787.1|1724989_1725721_+	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AWJ98788.1|1725701_1725809_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ98789.1|1725868_1726600_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
AWJ98790.1|1726821_1728507_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AWJ98791.1|1728503_1729223_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AWJ98792.1|1729269_1729740_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AWJ98793.1|1729780_1730242_-	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AWJ98794.1|1730366_1732367_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
AWJ98795.1|1732363_1733500_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.6e-161
>prophage 4
CP029242	Escherichia coli strain ECCRA-119 chromosome, complete genome	4893130	1825064	1833337	4893130		Enterobacteria_phage(28.57%)	10	NA	NA
AWJ98868.1|1825064_1826459_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.5	3.7e-19
AWJ98869.1|1826633_1827527_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
AWJ98870.1|1827563_1827827_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ98871.1|1827899_1828985_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	6.7e-101
AWJ98872.1|1828984_1829884_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	6.3e-28
AWJ98873.1|1829941_1830820_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	2.5e-106
AWJ98874.1|1830824_1831373_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	52.5	2.6e-48
AWJ98875.1|1831376_1831796_+	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
AWJ98876.1|1831770_1832241_+	N-acetyltransferase	NA	NA	NA	NA	NA
AWJ98877.1|1832230_1833337_+	aminotransferase class V-fold PLP-dependent enzyme	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	33.5	1.1e-45
>prophage 5
CP029242	Escherichia coli strain ECCRA-119 chromosome, complete genome	4893130	2296432	2363583	4893130	holin,terminase,lysis,capsid,tail,head,portal,protease	Enterobacteria_phage(46.0%)	80	NA	NA
AWJ99322.1|2296432_2297254_-|protease	serine protease	protease	NA	NA	NA	NA
AWJ99323.1|2297353_2297437_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ99324.1|2297529_2297865_-	acid shock protein	NA	NA	NA	NA	NA
AWJ99325.1|2298261_2299515_-	MFS transporter	NA	NA	NA	NA	NA
AWJ99326.1|2299621_2300515_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWJ99327.1|2300649_2301870_+	ROK family transcriptional regulator	NA	NA	NA	NA	NA
AWJ99328.1|2301994_2302690_+	dethiobiotin synthase	NA	NA	NA	NA	NA
AWJ99329.1|2302642_2303935_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
AWJ99330.1|2304093_2304708_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
AWJ99331.1|2304750_2305605_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AWJ99332.1|2305606_2306224_-	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
AWK01788.1|2306234_2308658_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
AWJ99333.1|2308718_2311145_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	2.9e-213
AWJ99334.1|2311343_2311649_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AWK01789.1|2311756_2312467_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
AWJ99335.1|2312469_2313030_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AWJ99336.1|2313064_2313406_-	DUF1283 domain-containing protein	NA	NA	NA	NA	NA
AWJ99337.1|2313540_2313867_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AWJ99338.1|2313903_2314092_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ99339.1|2314072_2315287_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AWJ99340.1|2315298_2316318_+	starvation-sensing protein RspB	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
AWJ99341.1|2316375_2316504_+	transporter	NA	NA	NA	NA	NA
AWJ99342.1|2316505_2317801_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.6	2.3e-156
AWJ99343.1|2317820_2318072_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
AWJ99344.1|2318144_2320616_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	1.5e-58
AWJ99345.1|2320709_2320901_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWJ99346.1|2320897_2321086_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AWK01790.1|2321435_2321639_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ99347.1|2321625_2321841_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ99348.1|2321870_2322041_-	hypothetical protein	NA	NA	NA	NA	NA
AWK01791.1|2322000_2322156_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
AWJ99349.1|2322421_2322841_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
AWJ99350.1|2322941_2323223_+	Cro/Cl family transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
AWJ99351.1|2323206_2323632_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AWJ99352.1|2323703_2324774_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	64.6	4.7e-62
AWJ99353.1|2324814_2325237_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
AWJ99354.1|2325571_2327575_+|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	26.2	3.4e-21
AWJ99355.1|2327638_2328916_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
AWJ99356.1|2329046_2329928_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWJ99357.1|2329924_2330617_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
AWJ99358.1|2330628_2331828_-	MFS transporter	NA	NA	NA	NA	NA
AWJ99359.1|2332189_2332333_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ99360.1|2332491_2332704_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	98.5	3.1e-26
AWJ99361.1|2332871_2333150_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
AWJ99362.1|2333151_2334201_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.1e-108
AWJ99363.1|2334213_2334588_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
AWJ99364.1|2334584_2335406_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	2.1e-78
AWJ99365.1|2335944_2336271_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ99366.1|2336306_2336438_+	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
AWJ99367.1|2336804_2337233_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
AWK01792.1|2337404_2337779_+	tolA family protein	NA	NA	NA	NA	NA
AWJ99368.1|2338030_2338246_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	95.8	5.9e-33
AWJ99369.1|2338245_2338743_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
AWJ99370.1|2338739_2339201_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	98.0	2.7e-75
AWJ99371.1|2339232_2339526_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
AWJ99372.1|2339888_2340083_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	93.8	2.2e-26
AWJ99373.1|2340230_2340332_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ99374.1|2340471_2341017_+	DNA-packaging protein NU1	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
AWJ99375.1|2340991_2342917_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
AWJ99376.1|2342913_2343120_+|tail	phage tail protein	tail	A0A2R9YJL2	Escherichia_phage	98.5	4.9e-29
AWJ99377.1|2343116_2344718_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	3.6e-308
AWJ99378.1|2344698_2346018_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.5	3.4e-232
AWJ99379.1|2346027_2346360_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
AWJ99380.1|2346415_2347441_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.4e-188
AWJ99381.1|2347482_2347878_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
AWJ99382.1|2347889_2348243_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
AWJ99383.1|2348254_2348833_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	3.5e-80
AWJ99384.1|2348829_2349225_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
AWK01793.1|2349232_2349973_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.6	1.7e-132
AWJ99385.1|2349988_2350411_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
AWJ99386.1|2350392_2350827_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
AWJ99387.1|2350819_2353381_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.7	0.0e+00
AWJ99388.1|2353377_2353707_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
AWJ99389.1|2353706_2354405_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.1e-131
AWJ99390.1|2354410_2355154_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.3e-148
AWJ99391.1|2355051_2355723_+|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	87.9	1.3e-99
AWJ99392.1|2355783_2359197_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.8	0.0e+00
AWJ99393.1|2359266_2359866_+	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	95.5	3.5e-107
AWK01794.1|2359930_2363002_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	81.4	1.6e-67
AWJ99394.1|2363001_2363583_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	2.5e-102
>prophage 6
CP029242	Escherichia coli strain ECCRA-119 chromosome, complete genome	4893130	2657732	2722618	4893130	holin,terminase,integrase,capsid,tail,head,portal,protease	Enterobacteria_phage(63.33%)	84	2675491:2675507	2722805:2722821
AWJ99645.1|2657732_2658782_-|protease	protease	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
AWJ99646.1|2659001_2659760_+	NAD(P)-dependent oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	1.5e-06
AWJ99647.1|2659756_2660347_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
AWJ99648.1|2660386_2661259_-	23S rRNA pseudouridylate synthase B	NA	NA	NA	NA	NA
AWJ99649.1|2661359_2661980_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AWJ99650.1|2661976_2662858_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
AWK01809.1|2662995_2663040_+	trp operon leader peptide	NA	NA	NA	NA	NA
AWJ99651.1|2663131_2664694_+	anthranilate synthase component I	NA	NA	NA	NA	NA
AWJ99652.1|2664693_2666289_+	bifunctional glutamine amidotransferase/anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
AWK01810.1|2666292_2667651_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
AWJ99653.1|2667662_2668856_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AWJ99654.1|2668855_2669662_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AWJ99655.1|2670042_2670222_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ99656.1|2670307_2670808_+	YciE/YciF family protein	NA	NA	NA	NA	NA
AWJ99657.1|2670853_2671360_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AWJ99658.1|2671419_2672058_-	outer membrane protein W	NA	NA	NA	NA	NA
AWJ99659.1|2672414_2673158_+	UPF0259 family protein	NA	NA	NA	NA	NA
AWJ99660.1|2673187_2673727_+	intracellular septation protein A	NA	NA	NA	NA	NA
AWJ99661.1|2673831_2674230_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AWK01811.1|2674269_2674989_-	TonB system transport protein TonB	NA	NA	NA	NA	NA
AWJ99662.1|2675212_2675509_+	hypothetical protein	NA	NA	NA	NA	NA
2675491:2675507	attL	ATTTAAGAAAGTGTTCT	NA	NA	NA	NA
AWJ99663.1|2675627_2676176_-	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	100.0	2.7e-98
AWJ99664.1|2676634_2676874_+	DinI family protein	NA	K7P6H1	Enterobacteria_phage	100.0	2.0e-37
AWJ99665.1|2676931_2677345_-|tail	tail assembly chaperone	tail	K7P7H0	Enterobacteria_phage	98.5	7.3e-72
AWJ99666.1|2677346_2678207_-	hypothetical protein	NA	K7P7B1	Enterobacteria_phage	91.6	1.1e-146
AWJ99667.1|2678270_2678504_-	cor protein	NA	E4WL42	Enterobacteria_phage	100.0	2.3e-38
AWJ99668.1|2678615_2679290_-	hypothetical protein	NA	K7P7N1	Enterobacteria_phage	100.0	1.2e-124
AWJ99669.1|2679289_2679592_-	hypothetical protein	NA	K7PJT3	Enterobacteria_phage	100.0	5.7e-50
AWJ99670.1|2679593_2682776_-	host specificity protein	NA	K7P7G9	Enterobacteria_phage	98.5	0.0e+00
AWJ99671.1|2682829_2683417_-|tail	tail assembly protein	tail	K7P6V1	Enterobacteria_phage	99.5	2.2e-98
AWJ99672.1|2683404_2684136_-	peptidase P60	NA	K7P7M8	Enterobacteria_phage	100.0	8.1e-151
AWJ99673.1|2684137_2684893_-|tail	phage minor tail protein L	tail	K7P6G9	Enterobacteria_phage	99.6	6.7e-148
AWJ99674.1|2684889_2685237_-|tail	phage tail protein	tail	K7P7G7	Enterobacteria_phage	100.0	4.8e-61
AWJ99675.1|2685242_2687759_-|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	92.5	0.0e+00
AWJ99676.1|2687736_2688057_-|tail	phage tail assembly protein T	tail	K7P6V0	Enterobacteria_phage	94.3	7.6e-53
AWJ99677.1|2688065_2688488_-|tail	phage minor tail protein G	tail	K7PM17	Enterobacteria_phage	100.0	6.7e-57
AWJ99678.1|2688524_2689262_-|tail	phage tail protein	tail	O64327	Escherichia_phage	98.0	1.8e-129
AWJ99679.1|2689269_2689668_-|tail	phage tail protein	tail	K7PJT1	Enterobacteria_phage	100.0	1.0e-70
AWJ99680.1|2689664_2690219_-|tail	phage tail protein	tail	K7PKQ5	Enterobacteria_phage	100.0	1.8e-81
AWJ99681.1|2690228_2690582_-|tail	phage tail protein	tail	K7PHD8	Enterobacteria_phage	100.0	1.7e-61
AWJ99682.1|2690592_2691027_-	DNA-packaging protein	NA	K7PM13	Enterobacteria_phage	93.8	1.1e-41
AWJ99683.1|2691072_2692098_-|capsid	major capsid protein E	capsid	K7PGW9	Enterobacteria_phage	95.6	2.2e-186
AWJ99684.1|2692165_2692498_-|head	head decoration protein	head	E4WL24	Enterobacteria_phage	82.7	5.0e-47
AWJ99685.1|2692507_2693845_-	S49 family peptidase	NA	O64320	Escherichia_phage	84.1	1.2e-189
AWJ99686.1|2693825_2695418_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	92.1	9.7e-290
AWJ99687.1|2695414_2695621_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	95.5	3.2e-28
AWJ99688.1|2695620_2697543_-|terminase	phage terminase large subunit family protein	terminase	E4WL19	Enterobacteria_phage	98.4	0.0e+00
AWJ99689.1|2697517_2698063_-|terminase	terminase small subunit	terminase	E4WL18	Enterobacteria_phage	100.0	1.2e-95
AWJ99690.1|2698419_2698656_-	hypothetical protein	NA	G8C7W7	Escherichia_phage	66.7	1.8e-22
AWK01812.1|2698666_2698942_-	hypothetical protein	NA	G8C7W6	Escherichia_phage	98.9	6.3e-48
AWJ99691.1|2698950_2699574_-	hypothetical protein	NA	G8C7W5	Escherichia_phage	96.6	2.3e-106
AWJ99692.1|2699651_2700020_-	hypothetical protein	NA	G8C7W5	Escherichia_phage	99.2	2.2e-64
AWJ99693.1|2700074_2700332_-	hypothetical protein	NA	K7PMB3	Enterobacterial_phage	91.8	4.0e-36
AWJ99694.1|2700334_2701063_-	DNA-binding protein	NA	K7PH51	Enterobacterial_phage	100.0	2.4e-142
AWJ99695.1|2701257_2702160_-|protease	serine protease	protease	NA	NA	NA	NA
AWJ99696.1|2702163_2702364_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ99697.1|2702734_2703250_-	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	90.1	3.4e-79
AWK01813.1|2703246_2703789_-	lysozyme	NA	K7PM52	Enterobacteria_phage	100.0	2.1e-103
AWJ99698.1|2703766_2704045_-|holin	holin	holin	K7PGZ9	Enterobacteria_phage	100.0	6.0e-46
AWJ99699.1|2704480_2704978_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ99700.1|2705148_2705838_-	antiterminator	NA	I6PDF8	Cronobacter_phage	53.2	2.0e-58
AWJ99701.1|2705834_2705975_-	YlcG family protein	NA	NA	NA	NA	NA
AWJ99702.1|2705971_2706334_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	82.4	4.3e-52
AWJ99703.1|2706330_2706621_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	88.5	3.1e-45
AWJ99704.1|2706623_2706830_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	64.7	8.4e-21
AWJ99705.1|2706829_2707426_-	DUF1367 domain-containing protein	NA	A0A0U2RT94	Escherichia_phage	53.8	1.2e-56
AWJ99706.1|2707814_2708072_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	74.0	3.2e-25
AWJ99707.1|2708074_2708323_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ99708.1|2708521_2708989_-	DUF551 domain-containing protein	NA	A0A193GYX5	Enterobacter_phage	35.5	1.6e-19
AWJ99709.1|2710177_2710471_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	2.5e-26
AWJ99710.1|2710470_2711061_-	phosphohydrolase	NA	I3PUZ9	Vibrio_phage	40.5	4.1e-36
AWK01814.1|2711060_2712017_-	phage replication protein	NA	H6WRX7	Salmonella_phage	64.0	4.3e-59
AWJ99711.1|2712165_2712387_-	transcriptional regulator	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
AWJ99712.1|2712466_2712658_-	hypothetical protein	NA	A0A2R2Z333	Escherichia_phage	55.4	2.4e-09
AWJ99713.1|2712762_2713473_+	XRE family transcriptional regulator	NA	K7P7K3	Enterobacteria_phage	72.3	1.5e-93
AWJ99714.1|2713574_2714339_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ99715.1|2714325_2715207_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ99716.1|2715243_2715447_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	74.6	5.4e-20
AWJ99717.1|2715875_2716082_+	cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	92.5	2.6e-30
AWJ99718.1|2716394_2719784_+	exodeoxyribonuclease	NA	K7P6V4	Enterobacteria_phage	93.9	0.0e+00
AWK01815.1|2719795_2720908_+	enterohemolysin	NA	K7PKR8	Enterobacteria_phage	100.0	3.9e-205
AWJ99719.1|2720946_2721189_+	DUF4060 domain-containing protein	NA	K7PHF4	Enterobacteria_phage	100.0	4.0e-38
AWJ99720.1|2721230_2721428_+	excisionase	NA	K7PM28	Enterobacteria_phage	100.0	8.3e-34
AWK01816.1|2721424_2722618_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	100.0	1.3e-235
2722805:2722821	attR	ATTTAAGAAAGTGTTCT	NA	NA	NA	NA
>prophage 7
CP029242	Escherichia coli strain ECCRA-119 chromosome, complete genome	4893130	3075167	3162945	4893130	integrase,capsid,tail,portal,transposase,head,plate,protease,tRNA	Salmonella_phage(60.0%)	96	3068128:3068143	3165516:3165531
3068128:3068143	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
AWK00049.1|3075167_3076460_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
AWK00050.1|3076550_3077894_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
AWK00051.1|3077904_3078516_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AWK00052.1|3078670_3082738_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
AWK00053.1|3082872_3083367_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AWK00054.1|3083911_3084877_+	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
AWK00055.1|3084999_3086766_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
AWK00056.1|3086766_3088488_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
AWK00057.1|3088529_3089234_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AWK00058.1|3089518_3089737_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AWK00059.1|3090420_3092697_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
AWK00060.1|3092727_3093048_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
AWK00061.1|3093370_3093595_+	cold-shock protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
AWK00062.1|3093667_3095614_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	5.0e-38
AWK00063.1|3095610_3096726_-	MacA family efflux pump subunit	NA	NA	NA	NA	NA
AWK00064.1|3096840_3097833_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
AWK00065.1|3097829_3099488_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AWK00066.1|3099913_3100609_+	aquaporin	NA	NA	NA	NA	NA
AWK00067.1|3101103_3102003_+	hypothetical protein	NA	NA	NA	NA	NA
AWK00068.1|3102146_3103799_+	hydroxylamine reductase	NA	NA	NA	NA	NA
AWK00069.1|3103810_3104779_+	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AWK00070.1|3104911_3106630_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
AWK00071.1|3106666_3107668_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AWK00072.1|3107678_3109109_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AWK01838.1|3109207_3110221_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AWK00073.1|3110217_3111048_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
AWK00074.1|3111044_3111368_-	hypothetical protein	NA	NA	NA	NA	NA
AWK00075.1|3111493_3112009_+	lipoprotein	NA	NA	NA	NA	NA
AWK00076.1|3112226_3112955_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
AWK00077.1|3112972_3113704_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWK00078.1|3113710_3114427_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
AWK00079.1|3114426_3115095_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
AWK00080.1|3115386_3116118_+	arginine/ornithine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWK00081.1|3116292_3117420_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	4.6e-28
AWK00082.1|3117460_3117949_-	DUF2593 domain-containing protein	NA	NA	NA	NA	NA
AWK00083.1|3118008_3118854_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AWK00084.1|3118850_3119804_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
AWK00085.1|3119813_3120947_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.9e-29
AWK00086.1|3121041_3122154_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AWK00087.1|3122505_3122982_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
AWK00088.1|3123069_3123972_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
AWK00089.1|3124032_3124755_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
AWK00090.1|3124738_3125026_-	DUF1418 domain-containing protein	NA	NA	NA	NA	NA
AWK00091.1|3125185_3125443_+	glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
AWK00092.1|3125472_3125850_-	hypothetical protein	NA	NA	NA	NA	NA
AWK00093.1|3126119_3127805_+	transporter	NA	NA	NA	NA	NA
AWK00094.1|3128040_3128259_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AWK00095.1|3128349_3129450_-	late control protein D	NA	A0A1S6KZZ5	Salmonella_phage	87.7	1.1e-175
AWK00096.1|3129446_3129932_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
AWK00097.1|3129928_3133006_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AWK00098.1|3132998_3133118_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AWK00099.1|3133132_3133435_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
AWK00100.1|3133489_3134005_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
AWK00101.1|3134014_3135187_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	2.1e-204
AWK00102.1|3135329_3135896_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
AWK00103.1|3135926_3136433_+	hypothetical protein	NA	NA	NA	NA	NA
AWK00104.1|3136435_3136846_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	43.3	2.2e-20
AWK00105.1|3136826_3137060_-	hypothetical protein	NA	NA	NA	NA	NA
AWK00106.1|3137062_3138547_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	78.1	5.1e-152
AWK00107.1|3138543_3139149_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	5.2e-111
AWK00108.1|3139141_3140050_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.1	2.3e-142
AWK00109.1|3140036_3140396_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	87.4	3.2e-52
AWK00110.1|3140392_3140971_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	4.7e-93
AWK00111.1|3141039_3141486_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	3.0e-63
AWK00112.1|3141478_3141910_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	7.6e-72
AWK00113.1|3141872_3142076_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	74.6	5.2e-23
AWK00114.1|3142005_3142434_-	hypothetical protein	NA	E5G6N2	Salmonella_phage	77.1	6.4e-47
AWK00115.1|3142430_3142808_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AWK01839.1|3142809_3143283_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AWK00116.1|3143302_3143518_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AWK00117.1|3143521_3143725_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AWK00118.1|3143724_3144189_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
AWK00119.1|3144284_3144935_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	95.8	2.5e-111
AWK00120.1|3144938_3145997_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	3.8e-181
AWK00121.1|3146013_3146847_-|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	89.9	1.2e-121
AWK00122.1|3146989_3148756_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.3	0.0e+00
AWK00123.1|3148755_3149790_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	88.9	6.3e-173
AWK00124.1|3149834_3150380_-	hypothetical protein	NA	NA	NA	NA	NA
AWK00125.1|3150605_3151448_-	hypothetical protein	NA	A0A0M4R2T6	Salmonella_phage	48.1	1.1e-58
AWK00126.1|3151447_3151663_-	multidrug ABC transporter ATPase	NA	NA	NA	NA	NA
AWK00127.1|3151933_3152167_-	DNA damage-inducible protein DinI	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AWK00128.1|3152178_3152367_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
AWK00129.1|3152519_3154934_-	endonuclease	NA	E5G6L9	Salmonella_phage	98.0	0.0e+00
AWK00130.1|3154930_3155788_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.0e-160
AWK00131.1|3155784_3156012_-	hypothetical protein	NA	E5G6L7	Salmonella_phage	98.7	4.6e-36
AWK00132.1|3156011_3156245_-	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	97.4	3.2e-32
AWK00133.1|3156312_3156654_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	96.5	4.3e-54
AWK00134.1|3156617_3156818_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	2.1e-32
AWK00135.1|3156825_3157335_-	hypothetical protein	NA	E5G6L3	Salmonella_phage	97.6	2.9e-86
AWK00136.1|3157367_3157589_-	regulator	NA	NA	NA	NA	NA
AWK00137.1|3157677_3158613_+	Repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.0	2.7e-34
AWK00138.1|3158632_3160105_+	hypothetical protein	NA	NA	NA	NA	NA
AWK00139.1|3160114_3161131_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
AWK00140.1|3161168_3161312_-	sugar kinase	NA	Q6QLL3	Human_immunodeficiency_virus	97.2	4.5e-13
AWK00141.1|3161379_3161814_+	hypothetical protein	NA	NA	NA	NA	NA
AWK00142.1|3161892_3162945_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
3165516:3165531	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 8
CP029242	Escherichia coli strain ECCRA-119 chromosome, complete genome	4893130	3744504	3759345	4893130	integrase	Enterobacteria_phage(88.89%)	17	NA	NA
AWK00674.1|3744504_3746703_+	xanthine dehydrogenase	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
AWK00675.1|3746712_3747669_+	XdhC family protein	NA	NA	NA	NA	NA
AWK00676.1|3747647_3748058_+	transcriptional regulator	NA	NA	NA	NA	NA
AWK00677.1|3748308_3748461_-|integrase	attP region and P4int integrase	integrase	NA	NA	NA	NA
AWK00678.1|3748676_3751010_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.6	0.0e+00
AWK00679.1|3751024_3751345_-	hypothetical protein	NA	NA	NA	NA	NA
AWK00680.1|3751480_3751936_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
AWK00681.1|3751928_3752216_-	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
AWK00682.1|3752208_3752808_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	80.3	1.9e-49
AWK00683.1|3752804_3753071_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
AWK00684.1|3753083_3753275_-	hypothetical protein	NA	NA	NA	NA	NA
AWK00685.1|3753622_3754357_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.4	1.4e-129
AWK00686.1|3754353_3754854_+	transactivation protein	NA	NA	NA	NA	NA
AWK00687.1|3754927_3755500_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	6.5e-95
AWK00688.1|3755802_3756543_-	hypothetical protein	NA	NA	NA	NA	NA
AWK00689.1|3756539_3758168_-	RNA-dependent DNA polymerase	NA	NA	NA	NA	NA
AWK00690.1|3758160_3759345_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	61.4	3.2e-144
>prophage 9
CP029242	Escherichia coli strain ECCRA-119 chromosome, complete genome	4893130	3770202	3827977	4893130	plate,integrase	Enterobacteria_phage(18.18%)	54	3759508:3759551	3785440:3785483
3759508:3759551	attL	GATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTAC	NA	NA	NA	NA
AWK00696.1|3770202_3772140_-|integrase	integrase	integrase	NA	NA	NA	NA
AWK01858.1|3772331_3773666_+|integrase	integrase	integrase	NA	NA	NA	NA
AWK00697.1|3773746_3774424_-	hypothetical protein	NA	A0A1D7XFF4	Escherichia_phage	51.8	1.7e-46
AWK00698.1|3774471_3776313_-	hypothetical protein	NA	A0A140G5Z0	Enterobacteria_phage	27.5	4.2e-18
AWK00699.1|3776347_3776545_-	hypothetical protein	NA	NA	NA	NA	NA
AWK00700.1|3776700_3777732_-	hypothetical protein	NA	NA	NA	NA	NA
AWK00701.1|3777746_3778130_-	hypothetical protein	NA	NA	NA	NA	NA
AWK00702.1|3778134_3778332_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
AWK00703.1|3779313_3779616_-	transporter	NA	NA	NA	NA	NA
AWK00704.1|3779615_3779819_-	ABC transporter ATPase	NA	NA	NA	NA	NA
AWK00705.1|3779876_3780257_-	hypothetical protein	NA	NA	NA	NA	NA
AWK00706.1|3780391_3780961_-	transcriptional regulator	NA	NA	NA	NA	NA
AWK00707.1|3781204_3781405_-	hypothetical protein	NA	NA	NA	NA	NA
AWK00708.1|3782819_3783056_-	hypothetical protein	NA	NA	NA	NA	NA
AWK00709.1|3783511_3784063_-	hypothetical protein	NA	A0A1L5C2A2	Pseudoalteromonas_phage	60.0	1.2e-05
AWK00710.1|3785068_3785383_+	hypothetical protein	NA	NA	NA	NA	NA
AWK00711.1|3785631_3786885_-	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
3785440:3785483	attR	GATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTAC	NA	NA	NA	NA
AWK00712.1|3786896_3788000_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
AWK00713.1|3788287_3789343_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	2.0e-118
AWK00714.1|3789381_3789783_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
AWK00715.1|3789840_3791085_-	esterase	NA	NA	NA	NA	NA
AWK00716.1|3791176_3791635_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
AWK00717.1|3791895_3793353_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
AWK00718.1|3793409_3794024_-	peptide chain release factor H	NA	NA	NA	NA	NA
AWK00719.1|3794020_3795187_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	32.0	5.5e-32
AWK00720.1|3795107_3795371_-	hypothetical protein	NA	NA	NA	NA	NA
AWK00721.1|3795405_3795858_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWK00722.1|3795854_3796910_-	DNA polymerase IV	NA	NA	NA	NA	NA
AWK01859.1|3796980_3797751_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
AWK00723.1|3797710_3799450_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
AWK00724.1|3799554_3799833_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
AWK00725.1|3799825_3800182_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
AWK00726.1|3800238_3800988_-	peptidoglycan endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
AWK00727.1|3801197_3801458_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
AWK00728.1|3801460_3801739_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
AWK00729.1|3801894_3802635_+	transpeptidase	NA	NA	NA	NA	NA
AWK00730.1|3802605_3803373_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
AWK00731.1|3803578_3804157_-	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
AWK00732.1|3804396_3806841_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AWK00733.1|3806883_3807357_-	inhibitor of vertebrate lysozyme	NA	NA	NA	NA	NA
AWK00734.1|3807510_3808281_+	amidohydrolase	NA	NA	NA	NA	NA
AWK00735.1|3810868_3811351_-	hypothetical protein	NA	NA	NA	NA	NA
AWK00736.1|3811334_3815570_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	1.5e-23
AWK00737.1|3815645_3817787_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	8.2e-26
AWK00738.1|3817996_3818515_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AWK00739.1|3819211_3819712_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AWK00740.1|3819746_3819971_+	hypothetical protein	NA	NA	NA	NA	NA
AWK00741.1|3820021_3821497_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AWK00742.1|3821503_3821917_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AWK00743.1|3821920_3823771_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AWK00744.1|3823734_3824817_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AWK00745.1|3824841_3826122_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AWK00746.1|3826118_3826643_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AWK00747.1|3826645_3827977_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 10
CP029242	Escherichia coli strain ECCRA-119 chromosome, complete genome	4893130	4189071	4230604	4893130	transposase	uncultured_marine_virus(30.77%)	45	NA	NA
AWK01065.1|4189071_4190280_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
AWK01066.1|4191978_4192719_-	hypothetical protein	NA	NA	NA	NA	NA
AWK01067.1|4193243_4194405_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AWK01068.1|4194542_4195334_-	hypothetical protein	NA	NA	NA	NA	NA
AWK01069.1|4195404_4196226_-	hypothetical protein	NA	NA	NA	NA	NA
AWK01872.1|4196263_4196713_-	hypothetical protein	NA	NA	NA	NA	NA
AWK01070.1|4196961_4197513_-	hypothetical protein	NA	NA	NA	NA	NA
AWK01071.1|4197517_4197718_-	hypothetical protein	NA	NA	NA	NA	NA
AWK01072.1|4197698_4198502_-	chaperonin	NA	A0A0F7L9X0	Escherichia_phage	51.3	4.1e-79
AWK01073.1|4199152_4199500_+	hypothetical protein	NA	NA	NA	NA	NA
AWK01074.1|4199778_4200555_-	nucleotidyltransferase	NA	NA	NA	NA	NA
AWK01075.1|4200557_4201061_-	hypothetical protein	NA	NA	NA	NA	NA
AWK01873.1|4201264_4201747_+	hypothetical protein	NA	NA	NA	NA	NA
AWK01076.1|4201664_4202186_+	hypothetical protein	NA	NA	NA	NA	NA
AWK01077.1|4203218_4204001_+|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	99.2	1.7e-138
AWK01078.1|4204216_4204948_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AWK01079.1|4205289_4205478_-	hypothetical protein	NA	NA	NA	NA	NA
AWK01080.1|4205617_4206148_+	DNA-binding protein	NA	NA	NA	NA	NA
AWK01081.1|4206897_4207077_-	hypothetical protein	NA	NA	NA	NA	NA
AWK01082.1|4207752_4208622_+	replication regulatory RepB family protein	NA	NA	NA	NA	NA
AWK01083.1|4208618_4209581_-	hypothetical protein	NA	NA	NA	NA	NA
AWK01084.1|4209686_4210571_+	GTPase	NA	NA	NA	NA	NA
AWK01085.1|4210773_4211454_+	WYL domain-containing protein	NA	NA	NA	NA	NA
AWK01086.1|4211601_4212279_+	hypothetical protein	NA	NA	NA	NA	NA
AWK01087.1|4212284_4212518_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AWK01088.1|4212715_4213924_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
AWK01089.1|4213945_4214764_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.1	1.9e-47
AWK01090.1|4214855_4215341_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.7	1.2e-12
AWK01874.1|4215385_4215832_+	DNA repair protein RadC	NA	NA	NA	NA	NA
AWK01091.1|4215918_4216140_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
AWK01092.1|4216219_4216588_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
AWK01093.1|4216677_4217055_+	toxin	NA	NA	NA	NA	NA
AWK01094.1|4217051_4217540_+	hypothetical protein	NA	NA	NA	NA	NA
AWK01095.1|4217559_4217757_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
AWK01096.1|4218449_4219715_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	43.1	1.1e-81
AWK01097.1|4219915_4221385_-	serine/threonine protein kinase	NA	A0A2K9L5Y0	Tupanvirus	26.5	1.4e-11
AWK01098.1|4221671_4222880_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
AWK01099.1|4223245_4224451_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
AWK01100.1|4224894_4225215_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AWK01101.1|4225207_4225594_+	amino acid-binding protein	NA	NA	NA	NA	NA
AWK01102.1|4225601_4226288_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AWK01103.1|4226265_4226892_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWK01104.1|4226970_4228176_+	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
AWK01105.1|4228288_4228957_-	putative tetracyline resistance transcriptional regulator TetC	NA	NA	NA	NA	NA
AWK01106.1|4229395_4230604_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
>prophage 1
CP029243	Escherichia coli strain ECCRA-119 plasmid pTB201, complete sequence	146268	66073	104674	146268	protease,transposase	Macacine_betaherpesvirus(27.27%)	30	NA	NA
AWK01982.1|66073_67045_+|transposase	IS110 family transposase ISEc32	transposase	Q75QL1	Wolbachia_phage	32.1	1.1e-25
AWK01983.1|69399_70371_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	96.6	8.8e-169
AWK01984.1|70370_71537_-	protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	99.7	1.6e-228
AWK01985.1|72689_74192_-	hypothetical protein	NA	NA	NA	NA	NA
AWK01986.1|74809_75259_-	hypothetical protein	NA	A0A222YWI5	Escherichia_phage	67.1	8.5e-42
AWK01987.1|75376_75856_+	peptidase M14	NA	NA	NA	NA	NA
AWK01988.1|75931_76126_-	hypothetical protein	NA	NA	NA	NA	NA
AWK01989.1|77139_77997_-	metal ABC transporter permease	NA	NA	NA	NA	NA
AWK01990.1|77993_78851_-	metal ABC transporter permease	NA	NA	NA	NA	NA
AWK01991.1|78847_79675_-	manganese/iron ABC transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	27.0	3.6e-14
AWK01992.1|79674_80589_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWK01993.1|80711_80903_-	prephenate dehydratase	NA	NA	NA	NA	NA
AWK02050.1|84042_85234_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.2e-100
AWK01994.1|85779_86757_+	repFIB replication protein A	NA	J9Q7H0	Salmonella_phage	63.9	4.6e-101
AWK01995.1|87041_87782_-	recombinase	NA	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
AWK01996.1|87902_88091_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
AWK01997.1|88464_89373_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
AWK01998.1|89435_90545_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
AWK01999.1|90603_90888_+	hypothetical protein	NA	NA	NA	NA	NA
AWK02000.1|90977_91931_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
AWK02001.1|92034_92424_+|protease	outer membrane protease	protease	NA	NA	NA	NA
AWK02002.1|92790_93054_-	hypothetical protein	NA	NA	NA	NA	NA
AWK02003.1|93203_93386_-	hypothetical protein	NA	NA	NA	NA	NA
AWK02004.1|93545_94758_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.6	6.0e-167
AWK02005.1|98032_99226_-	cobalamin biosynthesis protein CobW	NA	NA	NA	NA	NA
AWK02051.1|99640_99865_-	hypothetical protein	NA	NA	NA	NA	NA
AWK02006.1|101695_101938_+	hypothetical protein	NA	NA	NA	NA	NA
AWK02007.1|102311_102605_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
AWK02008.1|103120_103303_-	hypothetical protein	NA	NA	NA	NA	NA
AWK02009.1|103460_104674_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.3	1.6e-167
>prophage 1
CP029244	Escherichia coli strain ECCRA-119 plasmid pTB202, complete sequence	139629	14337	65324	139629	integrase,transposase,holin	Escherichia_phage(58.97%)	51	NA	NA
AWK02063.1|14337_15610_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	6.8e-169
AWK02064.1|15913_16648_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWK02065.1|17683_17875_+	hypothetical protein	NA	Q71TJ0	Escherichia_phage	98.3	2.5e-27
AWK02066.1|17956_18175_+	hypothetical protein	NA	Q71TI9	Escherichia_phage	100.0	3.4e-36
AWK02067.1|18176_18404_+	hypothetical protein	NA	A0A077SL55	Escherichia_phage	100.0	6.2e-17
AWK02068.1|18340_19438_+	hypothetical protein	NA	Q71TI8	Escherichia_phage	97.5	4.9e-200
AWK02069.1|19510_20017_+	3'-phosphatase	NA	A0A1B0VAK0	Salmonella_phage	98.8	2.7e-92
AWK02070.1|20283_23400_-	DEAD/DEAH box helicase	NA	A0A220A398	Liberibacter_phage	24.0	1.3e-27
AWK02071.1|23521_24754_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AWK02175.1|24750_26307_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.9	3.8e-105
AWK02072.1|26489_26711_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	A0A222YXU1	Escherichia_phage	98.6	3.3e-31
AWK02073.1|26710_27091_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	99.2	2.5e-63
AWK02074.1|27095_27275_+	PdcA protein	NA	Q71TH5	Escherichia_phage	98.3	1.2e-23
AWK02075.1|29183_29303_+	hypothetical protein	NA	NA	NA	NA	NA
AWK02076.1|29321_29543_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	79.7	1.8e-24
AWK02077.1|29539_30655_+	phage antirepressor Ant	NA	A0A077SLR9	Escherichia_phage	92.7	3.6e-190
AWK02078.1|30687_31539_-	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	100.0	1.2e-158
AWK02079.1|31649_31859_-	c1 repressor inactivator	NA	A0A077SK26	Escherichia_phage	100.0	1.8e-31
AWK02080.1|31824_31920_-	peptidase	NA	Q38402	Escherichia_phage	100.0	2.8e-11
AWK02081.1|32046_33027_+|transposase	IS5 family transposase ISKpn26	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
AWK02082.1|33065_33176_-	ABC transporter	NA	NA	NA	NA	NA
AWK02083.1|33159_33252_-	peptidase	NA	Q38401	Escherichia_phage	100.0	2.3e-07
AWK02084.1|33663_33885_+	creatininase	NA	Q5QBN7	Enterobacteria_phage	97.3	4.2e-34
AWK02085.1|33892_34924_+	recombinase	NA	A0A077SLE7	Escherichia_phage	99.1	1.9e-193
AWK02086.1|34974_35286_+	lysogeny establishment protein	NA	A0A077SK03	Escherichia_phage	97.1	8.8e-46
AWK02087.1|35531_36092_+	recombinase	NA	Q5QBN4	Enterobacteria_phage	95.7	2.8e-95
AWK02088.1|36178_36928_+	DUF4145 domain-containing protein	NA	A0A1S6L018	Salmonella_phage	48.6	8.3e-66
AWK02089.1|37083_37725_+	maturation control protein	NA	A0A077SK30	Escherichia_phage	95.3	2.0e-108
AWK02090.1|37827_38955_+	GTP pyrophosphokinase	NA	A0A1B0VBT5	Salmonella_phage	74.4	2.0e-156
AWK02091.1|38991_39240_-	modulator protein	NA	Q71TG0	Escherichia_phage	98.8	4.0e-41
AWK02092.1|39236_39677_-	peptide-binding protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
AWK02093.1|39796_40958_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
AWK02094.1|40972_41221_-|holin	holin	holin	Q71TF4	Escherichia_phage	100.0	2.5e-35
AWK02176.1|41213_41771_-	lysozyme	NA	Q71TF3	Escherichia_phage	98.9	6.1e-106
AWK02095.1|41940_42429_+	single-stranded DNA-binding protein	NA	Q1MVN2	Enterobacteria_phage	98.8	2.5e-87
AWK02096.1|42662_43775_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	98.4	3.4e-201
AWK02097.1|44516_44828_-	hypothetical protein	NA	A0A077SLG5	Escherichia_phage	100.0	1.8e-46
AWK02177.1|44817_46095_-	ddrB domain protein	NA	Q1MVM9	Enterobacteria_phage	98.6	1.1e-235
AWK02098.1|47540_51056_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	36.1	2.7e-98
AWK02099.1|51425_51626_+	DUF839 domain-containing protein	NA	NA	NA	NA	NA
AWK02100.1|51915_52203_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	4.5e-20
AWK02101.1|52199_52451_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AWK02102.1|52703_52835_+	replication protein RepA4	NA	NA	NA	NA	NA
AWK02178.1|58988_59381_+	cysteine hydrolase	NA	NA	NA	NA	NA
AWK02103.1|59518_60403_+	EamA family transporter	NA	NA	NA	NA	NA
AWK02104.1|60434_61634_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AWK02105.1|61712_62390_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWK02106.1|62418_63018_-	hypothetical protein	NA	A0A1B0V7H9	Salmonella_phage	85.1	4.7e-64
AWK02107.1|63021_63582_-|transposase	transposase	transposase	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
AWK02108.1|63757_64372_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AWK02109.1|64310_65324_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
>prophage 2
CP029244	Escherichia coli strain ECCRA-119 plasmid pTB202, complete sequence	139629	69723	128940	139629	integrase,transposase	Escherichia_phage(53.85%)	59	69690:69749	105129:106465
69690:69749	attL	CGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGCAACGTTTTCTGCCTCTGACG	NA	NA	NA	NA
AWK02117.1|69723_72729_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
AWK02118.1|72892_73450_+	recombinase	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
AWK02119.1|73632_74493_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AWK02120.1|75166_75472_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AWK02121.1|75487_75670_-	resolvase	NA	NA	NA	NA	NA
AWK02179.1|75698_76463_+|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AWK02122.1|76653_77010_-	hypothetical protein	NA	NA	NA	NA	NA
AWK02123.1|76955_77540_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AWK02124.1|77539_78778_-	MFS transporter	NA	NA	NA	NA	NA
AWK02125.1|78774_79680_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AWK02126.1|79801_80506_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWK02127.1|80496_80685_+	hypothetical protein	NA	NA	NA	NA	NA
AWK02128.1|80772_82209_+	glutathione synthase	NA	NA	NA	NA	NA
AWK02180.1|83024_83729_-	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	28.7	6.4e-20
AWK02129.1|83758_84463_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AWK02130.1|84661_84985_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AWK02131.1|85089_86127_+	permease	NA	NA	NA	NA	NA
AWK02132.1|86419_87037_-	proQ/FINO family protein	NA	NA	NA	NA	NA
AWK02133.1|87228_88785_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
AWK02134.1|89047_89638_-	hypothetical protein	NA	NA	NA	NA	NA
AWK02135.1|89637_89895_-	hypothetical protein	NA	NA	NA	NA	NA
AWK02136.1|90248_92387_+	AAA family ATPase	NA	NA	NA	NA	NA
AWK02137.1|92548_92965_-	PIN domain-containing protein	NA	NA	NA	NA	NA
AWK02138.1|92961_93192_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AWK02181.1|93133_93307_-	toxin-antitoxin system, antitoxin component, AbrB family protein	NA	NA	NA	NA	NA
AWK02139.1|93487_93778_+	hypothetical protein	NA	NA	NA	NA	NA
AWK02140.1|93767_94667_+	hypothetical protein	NA	NA	NA	NA	NA
AWK02141.1|94716_96942_-	phage T7 exclusion protein	NA	NA	NA	NA	NA
AWK02142.1|96943_98032_-	transcriptional regulator	NA	NA	NA	NA	NA
AWK02143.1|98583_98934_+	hypothetical protein	NA	NA	NA	NA	NA
AWK02144.1|98984_99728_+	hypothetical protein	NA	NA	NA	NA	NA
AWK02145.1|99724_100501_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
AWK02146.1|100752_101457_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AWK02147.1|101791_102184_+	NimC/NimA family protein	NA	NA	NA	NA	NA
AWK02148.1|102503_102890_-	bleomycin binding protein	NA	NA	NA	NA	NA
AWK02149.1|102958_103138_+	hypothetical protein	NA	Q1MVP5	Enterobacteria_phage	85.7	7.3e-05
AWK02150.1|103083_103788_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	98.7	8.4e-137
AWK02151.1|105899_106091_-	hypothetical protein	NA	NA	NA	NA	NA
AWK02152.1|106888_107338_-	hypothetical protein	NA	NA	NA	NA	NA
105129:106465	attR	CGTCAGAGGCAGAAAACGTTGCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTCTACAAGTGTGGCTATATGAGAGTTTTTTGTACCTGAGACTAAATCGCCCTCCCAATGCCCCAGAGAGCGTCTGTTATCGATATTTCGGGAACGTTCGTGAATTGGTGTTCCGTTCACTATGTTAATCGTACCTCTTTCGCCTTTGCGGGTATGACGCCTGCCATGGCGAAGGCTATGCGACCGTCGCAGATGCTGTATATTCAGGTGGTGTAGCGCTTCACGGCTACGAAAGTACAGCGTTTTATAAATTGTCTCAGGTGATATTCGCAGCGTTTTTTGACGTGATTTTGTTCGCCTTAACCATCCTGATATTTGCTCTGGAGACCATTTCATCTCCAGCTTTTCCAGAACAAGCTTTCGCAATGGTAAATTTTGATCCAGTAAGCACGGTTTTGGCCTTTTCGCCATTCTGTTGGCTCGGTTATTAGCATCAACAGCTTTGTAATAGCGTCTGCCCCGATTACGCTGAACTTCACGTGAGATCGTCGAAGGACTGCGATTCAGCGCAGTAGCTATCGCACGAATGCTCATTTTGGCTGACAAACCAGCTCGTATCTCCTCGCGCTCAGACAGTGTCAGGTGAGCTACAGCCCGCTTACGCTCATGGGGTTTTATGCCGCCAGTATCCCTTAACATAGTGAAGATCGTTCCGGGTTTTGAACCCAGGATATTCGCTATTTCACTGAAGCCTGTTCCGTTCTTCCATAGTTCAAAAACAGAGGCTTTTTCCTCTGCTGTAAATGTTCGTCTCATTCAAAAAACCTCCGCAACCCCATGTTTTCACATAACTGTTGCGTTGACCAATTGAATCTACAACCGCGCTCTTGATGTCAGACTCCCTGAACAGTTCTCGATAATCGGGAAACTCAGGGCGCGTTATCCTGTGGCCACTCTCTGCCATGTGTTCGGGGTCCATCGCAGCAGCTACAAATACTGGAAAAACCGTCCTGAAAAGCCAGACGGCAGACGGGCTGTATTACGCAGCCAGGTACTTGAACTGCATGGCATCAGCCACGGCTCTGCCGGAGCAAGAAGCATCGCCACAATGGCAACCCAGAGAGGCTACCAGATGGGGCGCTGGCTTGCTGGCAGACTCATGAAAGAGCTGGGGCTGGTCAACTGTCAGCAGCCGACTTACCGGTATAAACGTGGTGGTCATGAACATGTTGCTATCCCTAACTACCTTGAACGGCAGTTCGCCGTGACCGAGCCAAATCAGGTGTGGTGCGGTGATGTGACCTATATCTGGACGGGTAAGCGCTGGGCGTACCTCGC	NA	NA	NA	NA
AWK02153.1|107327_108374_-	thioredoxin family protein	NA	NA	NA	NA	NA
AWK02154.1|108565_109582_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
AWK02155.1|109619_109787_-	sugar kinase	NA	Q6QLL3	Human_immunodeficiency_virus	100.0	1.1e-13
AWK02156.1|110701_111232_-	hypothetical protein	NA	NA	NA	NA	NA
AWK02157.1|112257_112743_+	plasmid transfer protein	NA	NA	NA	NA	NA
AWK02158.1|112739_113462_+	hypothetical protein	NA	NA	NA	NA	NA
AWK02159.1|115201_115522_-	hypothetical protein	NA	Q71TB4	Escherichia_phage	99.0	4.6e-50
AWK02160.1|115469_115682_+	hypothetical protein	NA	NA	NA	NA	NA
AWK02161.1|115800_116616_-	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	98.5	5.4e-111
AWK02162.1|116625_117897_-	hypothetical protein	NA	A0A1B0V7E4	Salmonella_phage	97.9	3.0e-241
AWK02163.1|117921_119195_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	6.8e-169
AWK02164.1|119610_121317_-	hypothetical protein	NA	Q71TM1	Escherichia_phage	99.8	0.0e+00
AWK02165.1|121542_122544_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
AWK02166.1|122560_123757_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
AWK02167.1|123925_124735_-	helicase	NA	A0A077SK46	Escherichia_phage	97.8	7.1e-156
AWK02168.1|125027_125912_-	RepB family plasmid replication initiator protein	NA	A0A077SLP3	Escherichia_phage	100.0	2.1e-161
AWK02169.1|126247_126640_-	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	97.7	7.6e-71
AWK02170.1|126815_127238_-	ppfA	NA	A0A1B0VCB0	Salmonella_phage	100.0	2.7e-58
AWK02171.1|127277_127631_-	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	94.9	2.0e-38
AWK02172.1|127726_128940_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.3	1.6e-167
