The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029372	Listeria monocytogenes strain 2018TE5305-1-4 chromosome, complete genome	2894782	117463	123988	2894782	tail	Listeria_phage(33.33%)	10	NA	NA
AWL21963.1|117463_117916_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	47.9	4.0e-31
AWL21964.1|117921_118257_-	XRE family transcriptional regulator	NA	A0A2H4JAR9	uncultured_Caudovirales_phage	52.5	4.0e-20
AWL21965.1|118473_118902_+	hypothetical protein	NA	NA	NA	NA	NA
AWL21966.1|118913_119330_+	hypothetical protein	NA	A8ASQ1	Listeria_phage	39.3	1.3e-20
AWL21967.1|119607_119997_+	DUF5072 domain-containing protein	NA	NA	NA	NA	NA
AWL21968.1|120009_120522_+|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	62.7	1.2e-47
AWL21969.1|120569_120872_+	segregation and condensation protein B	NA	NA	NA	NA	NA
AWL21970.1|120913_121318_+	phenylalanine racemase	NA	NA	NA	NA	NA
AWL21971.1|121304_123173_+	hypothetical protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	45.8	3.5e-20
AWL21972.1|123169_123988_+|tail	phage tail family protein	tail	A0A060AFE1	Staphylococcus_phage	35.0	4.2e-39
>prophage 2
CP029372	Listeria monocytogenes strain 2018TE5305-1-4 chromosome, complete genome	2894782	658887	714227	2894782	terminase,holin,integrase,transposase,protease,tail,head,portal,capsid	Listeria_phage(51.61%)	64	690264:690287	693061:693084
AWL22459.1|658887_660039_-|integrase	site-specific integrase	integrase	A8ATX2	Listeria_phage	46.3	4.5e-87
AWL22460.1|660060_660774_-	hypothetical protein	NA	NA	NA	NA	NA
AWL22461.1|660828_661329_-	hypothetical protein	NA	A0A1S7FYX8	Listeria_phage	31.1	7.1e-13
AWL22462.1|661329_661680_-	helix-turn-helix domain-containing protein	NA	A0A059T669	Listeria_phage	47.6	7.9e-19
AWL22463.1|661833_662031_+	XRE family transcriptional regulator	NA	A0A059T7X5	Listeria_phage	52.3	7.5e-11
AWL22464.1|662053_662380_+	DUF771 domain-containing protein	NA	A0A2H4J474	uncultured_Caudovirales_phage	40.6	3.2e-14
AWL22465.1|663592_663949_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AWL22466.1|663945_664362_+	hypothetical protein	NA	NA	NA	NA	NA
AWL22467.1|664548_665073_+	sugar-phosphate nucleotidyltransferase	NA	A0A059T5F9	Listeria_phage	95.4	5.9e-95
AWL22468.1|665081_665546_+	class I SAM-dependent methyltransferase	NA	A0A059T693	Listeria_phage	96.8	6.9e-87
AWL22469.1|665542_666103_+	DUF1642 domain-containing protein	NA	A8ATY9	Listeria_phage	95.7	3.8e-100
AWL22470.1|666161_666563_+	hypothetical protein	NA	A8ATD9	Listeria_phage	100.0	2.6e-74
AWL22471.1|666559_666769_+	hypothetical protein	NA	A8ATE0	Listeria_phage	94.2	1.6e-30
AWL22472.1|666872_667052_+	hypothetical protein	NA	A0A076G7F4	Listeria_phage	85.5	1.4e-19
AWL22473.1|667048_667528_+	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	83.8	2.5e-68
AWL22474.1|667548_667788_+	hypothetical protein	NA	NA	NA	NA	NA
AWL22475.1|667778_667964_+	hypothetical protein	NA	NA	NA	NA	NA
AWL22476.1|668034_668553_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AWL22477.1|668549_669092_+|integrase	site-specific integrase	integrase	H0USV4	Bacillus_phage	53.3	2.5e-48
AWL22478.1|669107_669446_+	hypothetical protein	NA	NA	NA	NA	NA
AWL22479.1|669710_670037_+	hypothetical protein	NA	NA	NA	NA	NA
AWL22480.1|670033_670396_+	HNH endonuclease	NA	A0A075M5R4	Enterococcus_phage	45.2	1.2e-14
AWL22481.1|670490_671018_+|terminase	phage terminase small subunit P27 family	terminase	J7KC46	Streptococcus_phage	46.7	6.1e-31
AWL22482.1|670986_672738_+|terminase	terminase large subunit	terminase	A0A2H4JCI4	uncultured_Caudovirales_phage	50.7	4.1e-156
AWL22483.1|672744_672945_+	DUF1056 domain-containing protein	NA	NA	NA	NA	NA
AWL22484.1|672947_674183_+|portal	phage portal protein	portal	A0A2H4JAR2	uncultured_Caudovirales_phage	42.1	3.6e-82
AWL22485.1|674179_674746_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1D6Z2A7	Staphylococcus_phage	52.2	1.0e-44
AWL22486.1|674803_675979_+|capsid	phage major capsid protein	capsid	A0A060AI54	Enterococcus_phage	38.1	2.2e-44
AWL22487.1|676027_676366_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JB77	uncultured_Caudovirales_phage	37.8	8.1e-13
AWL22488.1|676335_676656_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
AWL22489.1|676649_677015_+	hypothetical protein	NA	NA	NA	NA	NA
AWL22490.1|677017_677416_+	hypothetical protein	NA	NA	NA	NA	NA
AWL24640.1|677436_678012_+|tail	phage tail protein	tail	M1PRQ7	Streptococcus_phage	42.4	1.2e-32
AWL22491.1|678101_678449_+	hypothetical protein	NA	NA	NA	NA	NA
AWL22492.1|678645_682845_+|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	33.0	1.2e-12
AWL22493.1|682837_685081_+|tail	phage tail protein	tail	A0A059T682	Listeria_phage	29.4	1.2e-56
AWL22494.1|685086_687378_+	hypothetical protein	NA	A0A059T7Y6	Listeria_phage	37.9	4.4e-134
AWL22495.1|687370_688432_+	hypothetical protein	NA	A0A059T7R4	Listeria_phage	51.0	1.2e-94
AWL22496.1|688470_688836_+	hypothetical protein	NA	Q9T1A0	Listeria_phage	100.0	7.4e-12
AWL22497.1|688848_689133_+|holin	holin	holin	A8ASL4	Listeria_phage	94.6	3.5e-41
690264:690287	attL	CCTTCAGCCGGACTTGGGTATTTC	NA	NA	NA	NA
AWL22498.1|690734_691016_-|integrase	integrase	integrase	NA	NA	NA	NA
AWL22499.1|692279_692639_+	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
AWL22500.1|693170_693704_+	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
693061:693084	attR	CCTTCAGCCGGACTTGGGTATTTC	NA	NA	NA	NA
AWL22501.1|693767_694685_+	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
AWL22502.1|694950_696831_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	38.2	8.3e-107
AWL22503.1|696926_697655_+	hypothetical protein	NA	NA	NA	NA	NA
AWL22504.1|697797_698448_+	transaldolase	NA	A0A0E3HJ81	Synechococcus_phage	27.6	3.4e-15
AWL22505.1|698487_700308_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	28.4	2.2e-48
AWL22506.1|700542_701934_+	amino acid permease	NA	NA	NA	NA	NA
AWL22507.1|702023_702863_+	VOC family protein	NA	NA	NA	NA	NA
AWL22508.1|702945_703230_-	hypothetical protein	NA	NA	NA	NA	NA
AWL22509.1|703327_704278_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
AWL22510.1|704301_704943_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWL22511.1|704985_707676_+	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
AWL22512.1|707721_708369_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWL22513.1|708377_708914_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWL24641.1|708900_709821_-	DUF975 domain-containing protein	NA	NA	NA	NA	NA
AWL22514.1|710011_710221_+	hypothetical protein	NA	NA	NA	NA	NA
AWL22515.1|710288_710996_+	serine/threonine protein phosphatase	NA	A0A249Y183	Enterococcus_phage	27.8	2.5e-19
AWL22516.1|711039_711603_-	DUF420 domain-containing protein	NA	NA	NA	NA	NA
AWL22517.1|711722_712139_+	hypothetical protein	NA	NA	NA	NA	NA
AWL22518.1|712190_712826_+	endonuclease III domain-containing protein	NA	NA	NA	NA	NA
AWL22519.1|712815_713712_-	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
AWL22520.1|713942_714227_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029372	Listeria monocytogenes strain 2018TE5305-1-4 chromosome, complete genome	2894782	1136954	1144377	2894782		Hokovirus(33.33%)	8	NA	NA
AWL22946.1|1136954_1137338_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.7	1.4e-16
AWL22947.1|1137359_1138343_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	35.3	3.1e-12
AWL22948.1|1138357_1139371_+	glycosyl transferase	NA	A0A1V0SAH6	Catovirus	32.0	6.0e-11
AWL22949.1|1139579_1141070_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	49.7	9.5e-114
AWL22950.1|1141081_1141906_+	NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.6	9.7e-68
AWL22951.1|1141918_1142227_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AWL22952.1|1142287_1142692_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
AWL22953.1|1142820_1144377_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.1	2.3e-17
>prophage 4
CP029372	Listeria monocytogenes strain 2018TE5305-1-4 chromosome, complete genome	2894782	1825742	1834028	2894782		Prochlorococcus_phage(33.33%)	8	NA	NA
AWL23597.1|1825742_1826309_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	39.1	1.3e-26
AWL23598.1|1826305_1827355_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.4	8.3e-64
AWL23599.1|1827373_1828801_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	1.1e-53
AWL23600.1|1828785_1831005_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.2	1.0e-159
AWL23601.1|1830997_1831681_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AWL23602.1|1831684_1831930_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AWL23603.1|1831941_1832655_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	38.7	2.7e-42
AWL23604.1|1832735_1834028_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.6	5.5e-17
>prophage 5
CP029372	Listeria monocytogenes strain 2018TE5305-1-4 chromosome, complete genome	2894782	2492688	2500532	2894782		Streptococcus_phage(50.0%)	7	NA	NA
AWL24229.1|2492688_2493660_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	5.2e-52
AWL24230.1|2493667_2494636_-	gluconeogenesis factor	NA	A1IMD5	Streptococcus_phage	43.3	6.7e-68
AWL24231.1|2494637_2495513_-	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	3.2e-08
AWL24232.1|2495620_2497351_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.3	4.3e-174
AWL24233.1|2497392_2498454_-	galactose mutarotase	NA	NA	NA	NA	NA
AWL24234.1|2498470_2499454_-	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	37.2	1.6e-48
AWL24235.1|2499572_2500532_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.7	2.0e-88
>prophage 6
CP029372	Listeria monocytogenes strain 2018TE5305-1-4 chromosome, complete genome	2894782	2787926	2797958	2894782		Tupanvirus(33.33%)	7	NA	NA
AWL24517.1|2787926_2790080_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	34.1	6.7e-44
AWL24518.1|2790103_2791876_-	DNA helicase RecQ	NA	A0A2K9L3P7	Tupanvirus	37.1	1.1e-79
AWL24519.1|2792036_2793503_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.0	8.0e-97
AWL24687.1|2793524_2793659_+	restriction endonuclease	NA	NA	NA	NA	NA
AWL24520.1|2793788_2794319_-	ADP-ribose-binding protein	NA	A0A0K1L687	Scale_drop_disease_virus	49.3	2.6e-29
AWL24521.1|2794376_2795987_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.9	7.5e-48
AWL24522.1|2796503_2797958_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	30.3	1.9e-50
