The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029443	Klebsiella quasipneumoniae strain CAV1947 chromosome, complete genome	5418306	120740	130200	5418306	protease,tRNA	Brazilian_cedratvirus(16.67%)	8	NA	NA
AWL55242.1|120740_122462_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	33.0	6.4e-13
AWL55243.1|122501_123203_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AWL55244.1|123556_123775_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AWL55245.1|123896_126176_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	6.2e-165
AWL55246.1|126206_126524_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AWL55247.1|126849_127071_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AWL55248.1|127147_129088_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	40.5	1.4e-37
AWL55249.1|129084_130200_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 2
CP029443	Klebsiella quasipneumoniae strain CAV1947 chromosome, complete genome	5418306	2582075	2656611	5418306	holin,tail,integrase,plate,tRNA,terminase,head,capsid,portal,lysis	Salmonella_phage(56.63%)	96	2581945:2581989	2650421:2650465
2581945:2581989	attL	TGGTGGCCCCTGTTGGGTTTGAACCAACGACCAAGCGATTATGAG	NA	NA	NA	NA
AWL57425.1|2582075_2583113_-|integrase	integrase	integrase	F1BUS9	Erwinia_phage	64.7	2.7e-123
AWL57426.1|2583119_2583704_-	phage repressor protein CI	NA	F1BUS8	Erwinia_phage	38.7	1.0e-31
AWL57427.1|2583823_2584045_+	regulator	NA	NA	NA	NA	NA
AWL57428.1|2584075_2584585_+	hypothetical protein	NA	Q6K1F8	Salmonella_virus	93.5	4.6e-84
AWL57429.1|2584592_2584793_+	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	93.9	1.1e-30
AWL57430.1|2584756_2585095_+	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	92.0	8.0e-53
AWL57431.1|2585163_2585391_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	74.7	4.6e-20
AWL57432.1|2585390_2585612_+	hypothetical protein	NA	A0A0M4S5Q7	Salmonella_phage	86.3	2.0e-28
AWL57433.1|2585612_2585894_+	hypothetical protein	NA	A0A218M4I8	Erwinia_phage	91.4	3.7e-43
AWL57434.1|2585886_2587893_+	replication protein	NA	A0A218M4H2	Erwinia_phage	90.5	0.0e+00
AWL57435.1|2589526_2590252_+	hypothetical protein	NA	NA	NA	NA	NA
AWL57436.1|2590574_2591618_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	81.8	1.3e-165
AWL57437.1|2591617_2593387_-	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	87.9	6.3e-306
AWL57438.1|2593552_2594407_+|capsid	capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	81.0	2.1e-126
AWL57439.1|2594480_2595539_+|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.8	3.2e-164
AWL57440.1|2595542_2596286_+|terminase	terminase	terminase	Q94MJ2	Enterobacteria_phage	80.3	5.1e-100
AWL57441.1|2596382_2596889_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	84.3	2.1e-60
AWL57442.1|2596888_2597092_+|tail	phage tail protein	tail	S4TTA0	Salmonella_phage	79.1	9.5e-25
AWL57443.1|2597096_2597387_+|holin	holin	holin	A0A0M5M1H1	Salmonella_phage	79.6	5.0e-35
AWL57444.1|2597373_2597871_+	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	87.0	4.3e-79
AWL57445.1|2597867_2598299_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	66.9	6.2e-42
AWL57446.1|2598394_2598862_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	75.5	1.4e-63
AWL57447.1|2598854_2599313_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	66.0	2.0e-46
AWL57448.1|2599337_2600591_-	HNH endonuclease	NA	NA	NA	NA	NA
AWL57449.1|2600790_2601432_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	77.9	2.6e-92
AWL57450.1|2601428_2601776_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	74.8	2.0e-43
AWL57451.1|2601780_2602689_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	70.5	2.4e-112
AWL57452.1|2602681_2603278_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	49.1	1.2e-46
AWL57453.1|2603255_2605367_+|tail	phage tail protein	tail	S4TP40	Salmonella_phage	41.5	2.6e-08
AWL57454.1|2605374_2605614_+	hypothetical protein	NA	NA	NA	NA	NA
AWL57455.1|2605650_2606808_+|tail	phage tail protein	tail	S4TP62	Salmonella_phage	48.8	3.6e-44
AWL57456.1|2606918_2608100_+|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	86.4	1.8e-195
AWL57457.1|2608113_2608629_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.6	3.2e-69
AWL57458.1|2608689_2608965_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	78.4	2.4e-31
AWL57459.1|2608979_2609117_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	91.1	2.2e-17
AWL57460.1|2609109_2611548_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	69.9	4.6e-283
AWL57461.1|2611564_2612044_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	77.1	4.5e-65
AWL57462.1|2612043_2613204_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	80.2	2.4e-173
AWL57463.1|2613752_2613971_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	83.3	6.6e-32
AWL57464.1|2614317_2615790_-	hypothetical protein	NA	NA	NA	NA	NA
AWL57465.1|2615792_2616806_-|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	60.5	1.8e-116
AWL57466.1|2616808_2616991_-	hypothetical protein	NA	A0A0R6PIB1	Moraxella_phage	55.9	4.5e-10
AWL57467.1|2617032_2617647_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	44.6	1.6e-38
AWL57468.1|2617748_2617985_+	regulator	NA	NA	NA	NA	NA
AWL57469.1|2618091_2618355_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	89.7	1.0e-39
AWL57470.1|2618383_2618893_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	87.0	7.6e-79
AWL57471.1|2618900_2619125_+	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	74.3	3.6e-25
AWL57472.1|2619114_2619315_+	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	75.4	1.8e-23
AWL57473.1|2619384_2619618_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	59.7	1.4e-16
AWL57474.1|2619617_2619845_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	78.7	4.6e-28
AWL57475.1|2619841_2620699_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	70.5	4.8e-118
AWL57476.1|2620741_2623045_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	62.9	6.8e-268
AWL57477.1|2623196_2623892_+	DNA methylase	NA	A0A0M4S5U3	Salmonella_phage	73.7	3.3e-93
AWL57478.1|2624051_2624240_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.0	3.7e-23
AWL57479.1|2624250_2624484_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	88.3	5.4e-32
AWL57480.1|2624557_2624818_+	hypothetical protein	NA	J9Q7T5	Salmonella_phage	64.1	2.8e-21
AWL57481.1|2625082_2626057_+	hypothetical protein	NA	A4PE73	Ralstonia_virus	42.5	8.0e-53
AWL57482.1|2626056_2626395_+	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
AWL57483.1|2626440_2627472_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	86.9	1.5e-174
AWL57484.1|2627471_2629235_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	92.8	0.0e+00
AWL57485.1|2629375_2630209_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	76.2	5.2e-101
AWL57486.1|2630225_2631290_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	94.3	3.3e-185
AWL57487.1|2631293_2631944_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	86.6	9.6e-103
AWL57488.1|2632040_2632505_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	87.0	1.6e-75
AWL57489.1|2632504_2632708_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	88.1	1.7e-29
AWL57490.1|2632711_2632927_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	87.3	2.3e-29
AWL57491.1|2632907_2633417_+	glycoside hydrolase	NA	E5G6N1	Salmonella_phage	84.0	2.8e-81
AWL57492.1|2633421_2633805_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	43.7	1.2e-17
AWL57493.1|2633801_2634230_+	hypothetical protein	NA	A0A1S6KZX8	Salmonella_phage	78.7	9.6e-51
AWL57494.1|2634325_2634757_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	5.8e-64
AWL57495.1|2634749_2635196_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.1	3.3e-54
AWL57496.1|2635192_2635846_-	hypothetical protein	NA	NA	NA	NA	NA
AWL57497.1|2636041_2636245_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.9	3.4e-22
AWL57498.1|2636207_2636639_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	81.8	6.4e-63
AWL57499.1|2637147_2637720_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	2.7e-77
AWL57500.1|2637716_2638079_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	9.9e-49
AWL57501.1|2638065_2638974_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	67.2	2.6e-106
AWL57502.1|2638966_2639563_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	55.8	1.3e-50
AWL57503.1|2639540_2641652_+|tail	phage tail protein	tail	S4TP40	Salmonella_phage	40.2	5.8e-08
AWL57504.1|2641659_2641899_+	hypothetical protein	NA	NA	NA	NA	NA
AWL57505.1|2641935_2643093_+|tail	phage tail protein	tail	S4TP62	Salmonella_phage	48.4	2.3e-43
AWL57506.1|2643231_2644404_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.5e-210
AWL57507.1|2644413_2644929_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
AWL57508.1|2644981_2645281_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	80.0	1.6e-33
AWL57509.1|2645295_2645415_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AWL57510.1|2645407_2648035_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	4.3e-117
AWL57511.1|2648031_2648517_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	77.6	4.1e-58
AWL57512.1|2648513_2649611_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	84.4	7.9e-174
AWL57513.1|2649681_2649900_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	72.2	8.3e-27
AWL57514.1|2649906_2650293_-	hypothetical protein	NA	NA	NA	NA	NA
AWL57515.1|2650620_2651127_+	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
2650421:2650465	attR	TGGTGGCCCCTGTTGGGTTTGAACCAACGACCAAGCGATTATGAG	NA	NA	NA	NA
AWL57516.1|2651226_2653068_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
AWL57517.1|2653287_2655033_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.5	3.5e-75
AWL57518.1|2655144_2655360_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AWL57519.1|2655358_2655589_+	hypothetical protein	NA	NA	NA	NA	NA
AWL57520.1|2655597_2656611_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
>prophage 3
CP029443	Klebsiella quasipneumoniae strain CAV1947 chromosome, complete genome	5418306	3172488	3181819	5418306	integrase	Enterobacteria_phage(83.33%)	9	3165457:3165471	3185022:3185036
3165457:3165471	attL	GCAGGTGGTCGAACA	NA	NA	NA	NA
AWL57997.1|3172488_3174822_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.4	0.0e+00
AWL57998.1|3174836_3175157_-	hypothetical protein	NA	NA	NA	NA	NA
AWL57999.1|3175153_3175381_-	hypothetical protein	NA	NA	NA	NA	NA
AWL58000.1|3175377_3175929_-	Ash-like/host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	72.2	6.6e-36
AWL58001.1|3176732_3177470_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	63.7	9.9e-80
AWL58002.1|3177466_3177727_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	67.9	6.4e-26
AWL58003.1|3177726_3178290_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	60.7	8.4e-55
AWL58004.1|3178661_3180557_+	hypothetical protein	NA	NA	NA	NA	NA
AWL58005.1|3180628_3181819_-|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	49.6	2.1e-103
3185022:3185036	attR	TGTTCGACCACCTGC	NA	NA	NA	NA
>prophage 4
CP029443	Klebsiella quasipneumoniae strain CAV1947 chromosome, complete genome	5418306	4672659	4683543	5418306		Escherichia_phage(87.5%)	9	NA	NA
AWL59312.1|4672659_4675767_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.5	0.0e+00
AWL59313.1|4675821_4677087_+	MFS transporter	NA	NA	NA	NA	NA
AWL59314.1|4677116_4678205_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	97.0	1.0e-205
AWL60219.1|4678289_4678550_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
AWL59315.1|4678846_4679707_+	OKP family class A broad-spectrum beta-lactamase	NA	A0A077SL40	Escherichia_phage	88.1	4.9e-139
AWL59316.1|4679727_4680489_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	99.2	2.1e-133
AWL59317.1|4680750_4681653_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	97.7	1.6e-156
AWL59318.1|4681664_4682930_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	91.7	1.9e-216
AWL59319.1|4682922_4683543_+	aldolase	NA	A0A077SK32	Escherichia_phage	94.2	2.2e-109
>prophage 5
CP029443	Klebsiella quasipneumoniae strain CAV1947 chromosome, complete genome	5418306	5105116	5155919	5418306	tail,integrase,plate,terminase,capsid,transposase,portal	Enterobacteria_phage(50.0%)	62	5114917:5114934	5152184:5152201
AWL59694.1|5105116_5106025_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	27.6	1.7e-17
AWL59695.1|5106984_5107290_+	DUF596 domain-containing protein	NA	NA	NA	NA	NA
AWL59696.1|5107900_5108143_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	73.4	1.1e-27
AWL59697.1|5108304_5109444_-	glycosyl transferase	NA	NA	NA	NA	NA
AWL59698.1|5109687_5110188_+	hypothetical protein	NA	NA	NA	NA	NA
AWL59699.1|5110305_5110752_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
AWL60240.1|5110735_5111527_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWL59700.1|5111628_5112813_+	MFS transporter	NA	NA	NA	NA	NA
AWL59701.1|5112844_5113537_-	hypothetical protein	NA	NA	NA	NA	NA
AWL59702.1|5113682_5114192_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
AWL60241.1|5114178_5114535_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AWL59703.1|5114524_5114764_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
5114917:5114934	attL	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
AWL59704.1|5115029_5115281_-	hypothetical protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
AWL59705.1|5115324_5116464_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	72.3	9.4e-146
AWL59706.1|5116618_5117791_+|tail	phage tail protein	tail	A0A0A7NV69	Enterobacteria_phage	70.7	2.9e-158
AWL59707.1|5117790_5118306_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	2.2e-57
AWL59708.1|5118351_5118669_+|tail	phage tail protein	tail	B9A7B2	Serratia_phage	54.8	1.0e-17
AWL60242.1|5118668_5118827_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	3.5e-11
AWL59709.1|5118813_5121789_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	47.1	1.3e-223
AWL59710.1|5121803_5122262_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	66.4	4.0e-55
AWL59711.1|5122620_5124606_+	DNA helicase	NA	NA	NA	NA	NA
AWL59712.1|5124602_5125241_+	hypothetical protein	NA	NA	NA	NA	NA
AWL59713.1|5125474_5126572_-|tail	phage tail protein	tail	G4KKN6	Yersinia_phage	73.3	1.4e-08
AWL59714.1|5126571_5126784_-	hypothetical protein	NA	NA	NA	NA	NA
AWL59715.1|5126780_5129807_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
AWL59716.1|5129796_5130720_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	43.9	3.4e-53
AWL59717.1|5130721_5131072_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	59.3	6.2e-24
AWL59718.1|5131068_5131656_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.0	9.1e-60
AWL59719.1|5131652_5132288_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.4	7.8e-57
AWL59720.1|5132284_5132752_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	58.8	1.6e-46
AWL59721.1|5132752_5132944_-	peptidase	NA	NA	NA	NA	NA
AWL60243.1|5132933_5133263_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
AWL59722.1|5133274_5133820_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	42.5	1.1e-30
AWL59723.1|5133816_5134101_-|tail	phage tail protein	tail	NA	NA	NA	NA
AWL59724.1|5134091_5134292_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
AWL59725.1|5134291_5134807_-|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	50.0	6.3e-41
AWL59726.1|5134919_5135777_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	58.5	4.9e-70
AWL59727.1|5135826_5136861_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	48.5	1.7e-93
AWL59728.1|5136870_5137710_-|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	66.3	5.6e-95
AWL59729.1|5137866_5139594_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	68.3	4.1e-233
AWL59730.1|5139587_5140649_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.4	4.8e-144
AWL59731.1|5140835_5141051_+	hypothetical protein	NA	NA	NA	NA	NA
AWL59732.1|5141214_5143437_-	peptidase S8 and S53, subtilisin, kexin, sedolisin	NA	NA	NA	NA	NA
AWL59733.1|5143448_5144588_-	ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	27.8	1.4e-16
AWL59734.1|5144715_5147289_-	endonuclease	NA	A0A1S6L028	Salmonella_phage	59.7	6.2e-246
AWL59735.1|5147326_5148262_-	adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	53.8	3.2e-83
AWL60244.1|5148258_5148486_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	41.0	1.9e-05
AWL59736.1|5148494_5149061_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.7	7.2e-14
AWL59737.1|5149057_5149282_-	hypothetical protein	NA	NA	NA	NA	NA
AWL59738.1|5149359_5149623_-	hypothetical protein	NA	NA	NA	NA	NA
AWL60245.1|5149638_5150016_-	hypothetical protein	NA	NA	NA	NA	NA
AWL59739.1|5150031_5150250_-	DUF4761 domain-containing protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
AWL59740.1|5150270_5150549_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
AWL59741.1|5150669_5150969_+	XRE family transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	74.7	2.7e-36
AWL59742.1|5151084_5152098_+|integrase	integrase	integrase	Q83VS6	Escherichia_phage	79.4	3.8e-154
AWL59743.1|5152332_5153346_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	33.1	5.5e-12
5152184:5152201	attR	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
AWL59744.1|5153403_5153505_+	hypothetical protein	NA	NA	NA	NA	NA
AWL60246.1|5153462_5153579_+	hypothetical protein	NA	NA	NA	NA	NA
AWL59745.1|5153697_5153823_+	hypothetical protein	NA	NA	NA	NA	NA
AWL59746.1|5153882_5154146_-	DUF2534 domain-containing protein	NA	NA	NA	NA	NA
AWL59747.1|5154276_5154915_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
AWL59748.1|5155004_5155919_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	49.6	1.2e-71
>prophage 6
CP029443	Klebsiella quasipneumoniae strain CAV1947 chromosome, complete genome	5418306	5183583	5222442	5418306	holin,tail,terminase,head,capsid,portal	Klebsiella_phage(64.71%)	36	NA	NA
AWL59778.1|5183583_5184642_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	30.3	7.0e-10
AWL59779.1|5185064_5186474_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	48.9	1.5e-84
AWL59780.1|5186535_5199123_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	49.9	0.0e+00
AWL59781.1|5199185_5199791_-|tail	tail assembly protein	tail	Q6UAW2	Klebsiella_phage	71.8	2.9e-77
AWL60247.1|5199842_5200178_-	hypothetical protein	NA	Q6UAW3	Klebsiella_phage	44.1	2.1e-21
AWL59782.1|5200213_5200924_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	89.8	1.4e-136
AWL59783.1|5200925_5201681_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.9	2.7e-125
AWL59784.1|5201677_5202016_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	89.3	6.4e-58
AWL59785.1|5202015_5205351_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	88.5	0.0e+00
AWL59786.1|5205350_5205563_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	88.9	3.7e-32
AWL59787.1|5205583_5205949_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
AWL59788.1|5206006_5206468_-|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
AWL59789.1|5206499_5206901_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	93.2	1.1e-61
AWL59790.1|5206897_5207287_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
AWL59791.1|5207267_5207606_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	91.1	5.6e-54
AWL59792.1|5207602_5207920_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
AWL59793.1|5207900_5208161_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	63.9	1.5e-22
AWL59794.1|5208219_5209506_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.5	2.0e-216
AWL59795.1|5209583_5210504_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	87.9	2.1e-148
AWL59796.1|5210540_5211800_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	90.2	2.8e-223
AWL59797.1|5211799_5211979_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	4.0e-11
AWL59798.1|5211972_5213694_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	1.1e-190
AWL59799.1|5213693_5214128_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
AWL59800.1|5214377_5214809_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	60.6	2.6e-40
AWL59801.1|5214805_5215123_-	hypothetical protein	NA	NA	NA	NA	NA
AWL59802.1|5215074_5215437_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
AWL60248.1|5215764_5215962_+	hypothetical protein	NA	H6WRV6	Salmonella_phage	73.8	1.1e-20
AWL59803.1|5217037_5217388_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	38.1	7.9e-11
AWL59804.1|5217384_5217882_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.6	6.2e-78
AWL59805.1|5217881_5218097_-|holin	holin	holin	A5LH82	Enterobacteria_phage	88.7	2.7e-30
AWL59806.1|5219623_5220226_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.6	1.4e-76
AWL59807.1|5220242_5221274_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.9	5.6e-97
AWL59808.1|5221273_5221477_-	hypothetical protein	NA	NA	NA	NA	NA
AWL59809.1|5221473_5221866_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	6.1e-12
AWL59810.1|5221906_5222197_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	6.1e-17
AWL59811.1|5222208_5222442_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	2.2e-25
>prophage 7
CP029443	Klebsiella quasipneumoniae strain CAV1947 chromosome, complete genome	5418306	5228982	5299054	5418306	protease,holin,tail,integrase,terminase,head,capsid,transposase,portal	Salmonella_phage(16.13%)	85	5271281:5271296	5306758:5306773
AWL59817.1|5228982_5229966_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	55.2	6.9e-44
AWL59818.1|5230017_5230572_-	hypothetical protein	NA	NA	NA	NA	NA
AWL59819.1|5230574_5230790_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	57.5	2.0e-17
AWL59820.1|5230891_5231281_+	transcriptional regulator	NA	A0A0M4R5D1	Salmonella_phage	60.2	6.7e-35
AWL59821.1|5231895_5232114_+	hypothetical protein	NA	NA	NA	NA	NA
AWL59822.1|5232123_5232318_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWL59823.1|5232360_5232705_+	transcriptional regulator	NA	NA	NA	NA	NA
AWL59824.1|5232846_5234985_+	exonuclease	NA	S4TNL0	Salmonella_phage	42.5	5.6e-99
AWL59825.1|5235037_5235283_+	excisionase	NA	NA	NA	NA	NA
AWL59826.1|5235263_5236391_+|integrase	integrase	integrase	O21925	Phage_21	58.4	3.3e-119
AWL59827.1|5236508_5236661_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
AWL59828.1|5236852_5237437_+	hypothetical protein	NA	NA	NA	NA	NA
AWL59829.1|5238189_5239167_+	hypothetical protein	NA	NA	NA	NA	NA
AWL59830.1|5239356_5239884_+	DUF159 family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	65.7	1.7e-65
AWL59831.1|5243095_5244361_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	83.6	1.1e-208
AWL59832.1|5244362_5244782_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	58.3	6.5e-36
AWL59833.1|5245442_5245865_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	2.8e-26
AWL59834.1|5245915_5246494_-	DNA-invertase	NA	A0A286S1P7	Klebsiella_phage	92.9	1.4e-89
AWL59835.1|5246572_5248549_+	hypothetical protein	NA	A0A1I9SEI8	Klebsiella_phage	26.8	3.0e-46
AWL59836.1|5248559_5248763_+	hypothetical protein	NA	NA	NA	NA	NA
AWL60249.1|5248810_5249008_-	hypothetical protein	NA	NA	NA	NA	NA
AWL59837.1|5251248_5254332_-	kinase	NA	A0A286S259	Klebsiella_phage	70.7	0.0e+00
AWL59838.1|5254328_5254709_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	80.2	1.6e-57
AWL59839.1|5254718_5255204_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	66.2	3.0e-53
AWL59840.1|5255190_5255664_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	60.1	1.0e-53
AWL59841.1|5255684_5259278_-|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	59.3	2.3e-222
AWL59842.1|5259652_5259958_-|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	64.6	3.6e-28
AWL59843.1|5259960_5260365_-|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	53.1	1.5e-29
AWL59844.1|5260395_5261100_-|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	66.5	1.0e-78
AWL59845.1|5261156_5261504_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	61.9	1.8e-31
AWL59846.1|5261500_5261950_-	hypothetical protein	NA	Q9MCS9	Enterobacteria_phage	81.9	1.1e-62
AWL59847.1|5261946_5262285_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	66.1	3.6e-37
AWL60250.1|5262297_5262630_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6JIM5	Burkholderia_virus	30.7	3.4e-11
AWL59848.1|5262635_5262890_-	hypothetical protein	NA	NA	NA	NA	NA
AWL59849.1|5262935_5264156_-|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	64.0	3.7e-140
AWL59850.1|5264165_5264873_-|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	63.5	2.2e-68
AWL59851.1|5264848_5266168_-|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	58.9	7.6e-139
AWL59852.1|5266174_5267911_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.3	1.3e-138
AWL59853.1|5267864_5268329_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.7	4.8e-48
AWL59854.1|5268511_5268853_-	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	74.8	6.0e-48
AWL59855.1|5268908_5269154_-	DUF2560 domain-containing protein	NA	A0A286N2R1	Klebsiella_phage	64.2	1.9e-19
AWL59856.1|5269220_5269610_-	hypothetical protein	NA	Q1MVJ1	Enterobacteria_phage	48.4	6.7e-27
AWL59857.1|5269694_5270183_-	hypothetical protein	NA	NA	NA	NA	NA
AWL59858.1|5270253_5270451_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	80.3	5.6e-22
AWL59859.1|5270401_5270677_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	42.7	6.8e-10
AWL59860.1|5271233_5271416_+	hypothetical protein	NA	NA	NA	NA	NA
5271281:5271296	attL	CTGCATCACCGCCAGC	NA	NA	NA	NA
AWL59861.1|5271428_5271614_-	hypothetical protein	NA	NA	NA	NA	NA
AWL59862.1|5271629_5272109_-	lysozyme	NA	A5VW81	Enterobacteria_phage	83.6	1.2e-70
AWL59863.1|5272092_5272416_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	80.4	8.0e-42
AWL60251.1|5273129_5273897_-	hypothetical protein	NA	A0A1B2I9V6	Erwinia_phage	74.7	2.9e-106
AWL60252.1|5274168_5274426_-	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	77.3	9.2e-25
AWL59864.1|5274428_5274689_-	hypothetical protein	NA	NA	NA	NA	NA
AWL59865.1|5274830_5275880_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	77.6	6.2e-168
AWL59866.1|5276029_5276221_-	TrmB family transcriptional regulator	NA	Q8SBE3	Shigella_phage	82.5	1.9e-22
AWL59867.1|5276915_5277965_-	hypothetical protein	NA	NA	NA	NA	NA
AWL59868.1|5278059_5278443_-	DUF1133 domain-containing protein	NA	U5P0A5	Shigella_phage	80.8	3.8e-51
AWL60253.1|5278460_5279447_-	hypothetical protein	NA	Q8SBE5	Shigella_phage	48.0	8.3e-90
AWL59869.1|5279528_5280350_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	65.8	4.0e-90
AWL59870.1|5280439_5280838_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	70.6	1.2e-44
AWL59871.1|5280834_5281311_-|protease	SOS-response repressor and protease LexA	protease	K7PHB4	Enterobacterial_phage	56.3	9.4e-15
AWL59872.1|5281307_5283158_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	52.3	6.3e-200
AWL59873.1|5283150_5284533_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	48.4	1.5e-105
AWL59874.1|5284520_5284979_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AWL59875.1|5284975_5285887_-	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	73.8	9.8e-53
AWL59876.1|5285876_5286056_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	67.3	5.6e-13
AWL59877.1|5286228_5286777_-	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	68.5	2.7e-66
AWL59878.1|5286856_5287327_+	hypothetical protein	NA	NA	NA	NA	NA
AWL59879.1|5287695_5288073_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	92.1	7.1e-58
AWL59880.1|5288069_5288417_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	96.5	4.1e-60
AWL59881.1|5288466_5290005_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	91.8	6.1e-273
AWL59882.1|5289911_5290226_-	hypothetical protein	NA	NA	NA	NA	NA
AWL59883.1|5290320_5290965_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	41.2	1.7e-38
AWL59884.1|5291151_5291241_+	hypothetical protein	NA	NA	NA	NA	NA
AWL59885.1|5291237_5291465_-	hypothetical protein	NA	NA	NA	NA	NA
AWL59886.1|5292162_5292534_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	80.0	2.7e-49
AWL59887.1|5292586_5293417_+	DUF2303 domain-containing protein	NA	Q8HAA2	Salmonella_phage	82.1	5.5e-127
AWL59888.1|5293552_5294080_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	69.7	1.8e-62
AWL59889.1|5294079_5294280_+	hypothetical protein	NA	NA	NA	NA	NA
AWL59890.1|5294272_5295058_+	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.2	3.8e-61
AWL59891.1|5295185_5295650_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	39.1	1.0e-10
AWL59892.1|5295646_5295916_+	antitoxin	NA	NA	NA	NA	NA
AWL59893.1|5296018_5296294_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	40.4	1.5e-09
AWL59894.1|5296322_5296559_+	excisionase	NA	NA	NA	NA	NA
AWL59895.1|5296548_5297691_+|integrase	integrase	integrase	Q77Z02	Phage_21	81.4	1.1e-170
AWL59896.1|5297803_5299054_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
5306758:5306773	attR	GCTGGCGGTGATGCAG	NA	NA	NA	NA
>prophage 1
CP029441	Klebsiella quasipneumoniae strain CAV1947 plasmid pCAV1947-173, complete sequence	172839	0	10639	172839		Leptospira_phage(33.33%)	8	NA	NA
AWL54494.1|198_1584_+	hypothetical protein	NA	NA	NA	NA	NA
AWL54495.1|1612_1966_+	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWL54496.1|2079_3372_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AWL54497.1|3382_6529_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.6	6.1e-62
AWL54498.1|6615_7056_+	hypothetical protein	NA	NA	NA	NA	NA
AWL54499.1|7182_9630_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.8	4.4e-84
AWL54500.1|9670_9868_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AWL54501.1|9901_10639_-	peptidase	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	31.9	1.3e-10
>prophage 2
CP029441	Klebsiella quasipneumoniae strain CAV1947 plasmid pCAV1947-173, complete sequence	172839	15718	48662	172839	integrase,transposase	Escherichia_phage(28.57%)	45	20588:20647	45715:46535
AWL54507.1|15718_16399_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.8	1.3e-30
AWL54508.1|16395_17796_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	6.4e-19
AWL54509.1|18002_18437_+	copper-binding protein	NA	NA	NA	NA	NA
AWL54510.1|18691_19045_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	51.9	2.8e-24
AWL54511.1|19092_19455_+	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
20588:20647	attL	GGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
AWL54512.1|20651_21356_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWL54513.1|21246_21624_-	hypothetical protein	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.2	1.6e-17
AWL54514.1|22224_22929_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWL54515.1|22940_23861_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	42.2	5.6e-56
AWL54516.1|24016_24490_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
AWL54517.1|24710_24977_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
AWL54518.1|25119_25884_+|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AWL54519.1|25925_26147_+	resolvase	NA	NA	NA	NA	NA
AWL54520.1|26179_26485_+	hypothetical protein	NA	NA	NA	NA	NA
AWL54521.1|26534_26828_+	hypothetical protein	NA	NA	NA	NA	NA
AWL54668.1|27126_27771_+	resolvase	NA	NA	NA	NA	NA
AWL54522.1|28886_29891_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWL54523.1|29969_32936_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.8	0.0e+00
AWL54524.1|32938_33499_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	88.6	2.1e-50
AWL54525.1|33629_33842_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AWL54669.1|33804_33924_+	mercury resistance protein	NA	NA	NA	NA	NA
AWL54526.1|33907_34144_-	mercury resistance protein	NA	NA	NA	NA	NA
AWL54527.1|34140_34506_-	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
AWL54528.1|34523_36206_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	1.9e-38
AWL54529.1|36244_36652_-	mercury transport protein MerC	NA	NA	NA	NA	NA
AWL54530.1|36679_36955_-	mercuric transporter periplasmic component	NA	NA	NA	NA	NA
AWL54531.1|36970_37321_-	mercuric transporter	NA	NA	NA	NA	NA
AWL54532.1|37392_37848_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AWL54533.1|37844_38054_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	75.9	6.8e-18
AWL54534.1|38212_38503_+	nucleotidyltransferase	NA	NA	NA	NA	NA
AWL54535.1|38906_39263_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AWL54536.1|39517_39832_+	hypothetical protein	NA	NA	NA	NA	NA
AWL54537.1|40004_40538_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	5.8e-21
AWL54538.1|41299_42067_-	DUF1883 domain-containing protein	NA	S6BFN8	Thermus_phage	46.4	9.8e-30
AWL54539.1|42235_42850_+	hypothetical protein	NA	NA	NA	NA	NA
AWL54540.1|42890_43598_-	hypothetical protein	NA	NA	NA	NA	NA
AWL54541.1|43625_44171_-	resolvase/recombinase	NA	Q1MVP4	Enterobacteria_phage	81.4	3.1e-70
AWL54542.1|44210_44915_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWL54543.1|45005_45722_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	2.4e-139
AWL54544.1|45700_45922_+	hypothetical protein	NA	NA	NA	NA	NA
AWL54545.1|46002_46323_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	6.8e-09
AWL54546.1|46312_46591_+	XRE family transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
45715:46535	attR	AGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCACTTGGACACGCCGATGCTGCAGCGCTTAATCAGTTTGATATCGATATCAGCAAAGCTCAGGCACCCGAAGCACGCACCTGGTTGCTTCAGAACAAAGCAGAATTCATCGCTCTGATCCTGGGCATTGAAGTCGTAAAGGTCGGGTAGTGAGAAGCCAGCTAACTTAGCTCTTGAGCTAAGTTAGCTTTTGAGCTAATGTGTGCACATACGGACCAGAGATTACATTCATGTTCACAGTCATCTTTCATGATGAGGCTGAAAAAGAGTTTACGGCTCTGCCTGCTGCCATTCGTGCAAAAATGGCCAGGCTACTCATGAAGCTGGAAGCAAACCCTCGCCAGCTACGCGAGCCAGATACCAAGCCGCTTGGAAACGGCCTTTTCGAAATACGTACAATGGGGGCAGATATCGCCCGCGGAATCTGGGTATATCAGAGTGGTGAACGTATTTTTCTACTTCGGATCTTTATCAAAAAATCGCCAAAAACGCCCCCGGCAGAAATAGATCAGGCACTTCGCAGACTGGAGGAAATGCAGAATGAAATATAAAACCCTTAGCCAGGTTCATACCGAAGCAATGAACGATCATGAGTACAGCGCGGCATTCGAGGCAGAAGAAGCCTCGGAGCTACTTCGGGAAACCTTAGCAACATGGAGAAAAGAAGCGGGTTTGACGTCGGCACAGGTTGCAGAACGTATGGGCATCAAAGCGCCTACTATCTCACGTATGGAGAAGAACGCTTCGCGAATGAGTATTCAGA	NA	NA	NA	NA
AWL54547.1|46591_47005_+	transcriptional regulator	NA	NA	NA	NA	NA
AWL54548.1|47518_47737_-	hypothetical protein	NA	NA	NA	NA	NA
AWL54549.1|47834_48662_+	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.1	1.2e-44
>prophage 3
CP029441	Klebsiella quasipneumoniae strain CAV1947 plasmid pCAV1947-173, complete sequence	172839	53384	103662	172839	transposase	Escherichia_phage(28.57%)	55	NA	NA
AWL54555.1|53384_54389_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AWL54556.1|57510_57801_+	nucleotidyltransferase	NA	NA	NA	NA	NA
AWL54557.1|57797_58199_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
AWL54558.1|58344_59049_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWL54559.1|59739_60027_+	hypothetical protein	NA	NA	NA	NA	NA
AWL54560.1|60010_60856_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWL54561.1|60885_61404_-	DUF417 domain-containing protein	NA	NA	NA	NA	NA
AWL54562.1|62134_62509_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
AWL54563.1|63044_63290_+	hypothetical protein	NA	NA	NA	NA	NA
AWL54564.1|63369_63636_-	hypothetical protein	NA	NA	NA	NA	NA
AWL54565.1|63805_64087_-	DUF427 domain-containing protein	NA	NA	NA	NA	NA
AWL54566.1|64154_64427_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	41.9	7.5e-09
AWL54567.1|64880_65627_-	oxidoreductase	NA	NA	NA	NA	NA
AWL54568.1|65619_66222_-	sulfite oxidase-like oxidoreductase	NA	NA	NA	NA	NA
AWL54569.1|66689_67160_+	thiol-disulfide isomerase	NA	NA	NA	NA	NA
AWL54570.1|67291_67489_-	hypothetical protein	NA	NA	NA	NA	NA
AWL54571.1|67485_67779_-	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
AWL54572.1|67837_68269_-	heme-binding protein	NA	NA	NA	NA	NA
AWL54573.1|68341_69355_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
AWL54574.1|69802_70771_-	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
AWL54575.1|70767_71472_-	glutathione S-transferase	NA	NA	NA	NA	NA
AWL54576.1|71612_72152_-	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
AWL54577.1|72153_72597_-	peptide-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
AWL54578.1|74915_76184_-|transposase	IS4 family transposase ISApu1	transposase	NA	NA	NA	NA
AWL54579.1|76501_76873_-	hypothetical protein	NA	NA	NA	NA	NA
AWL54580.1|77512_80410_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
AWL54581.1|80504_81110_+	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
AWL54582.1|81790_82225_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
AWL54583.1|82271_82820_-	thioredoxin-like domain protein	NA	NA	NA	NA	NA
AWL54584.1|82951_83188_-	hypothetical protein	NA	NA	NA	NA	NA
AWL54585.1|83313_83622_+	hypothetical protein	NA	NA	NA	NA	NA
AWL54586.1|83511_83811_-	hypothetical protein	NA	NA	NA	NA	NA
AWL54587.1|83854_84349_-	DNA-binding protein	NA	NA	NA	NA	NA
AWL54588.1|84379_84952_-	hypothetical protein	NA	NA	NA	NA	NA
AWL54589.1|84948_85197_-	hypothetical protein	NA	NA	NA	NA	NA
AWL54590.1|85642_87370_+	hypothetical protein	NA	NA	NA	NA	NA
AWL54591.1|87366_88782_+	hypothetical protein	NA	NA	NA	NA	NA
AWL54670.1|88778_88973_-	hypothetical protein	NA	NA	NA	NA	NA
AWL54592.1|89381_92186_+	hypothetical protein	NA	NA	NA	NA	NA
AWL54593.1|92330_93359_-	hypothetical protein	NA	NA	NA	NA	NA
AWL54594.1|93499_94102_-	hypothetical protein	NA	NA	NA	NA	NA
AWL54595.1|94370_94598_-	hypothetical protein	NA	NA	NA	NA	NA
AWL54596.1|94649_94868_+	plasmid maintenance protein CcdA	NA	NA	NA	NA	NA
AWL54597.1|94869_95175_+	plasmid maintenance protein CcdB	NA	NA	NA	NA	NA
AWL54671.1|95379_95739_+	hypothetical protein	NA	NA	NA	NA	NA
AWL54598.1|95765_96089_+	hypothetical protein	NA	NA	NA	NA	NA
AWL54599.1|96085_97102_+	hypothetical protein	NA	NA	NA	NA	NA
AWL54600.1|97436_98705_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	34.4	1.1e-59
AWL54601.1|98919_99624_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWL54602.1|99770_99983_-	hypothetical protein	NA	NA	NA	NA	NA
AWL54603.1|100043_100400_-	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.1	2.6e-25
AWL54604.1|101036_101387_-	hypothetical protein	NA	NA	NA	NA	NA
AWL54605.1|101383_101656_-	hypothetical protein	NA	NA	NA	NA	NA
AWL54606.1|102351_102513_-	Hok/Gef family protein	NA	NA	NA	NA	NA
AWL54607.1|102582_103662_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 4
CP029441	Klebsiella quasipneumoniae strain CAV1947 plasmid pCAV1947-173, complete sequence	172839	112945	120829	172839	transposase	Macacine_betaherpesvirus(25.0%)	10	NA	NA
AWL54620.1|112945_114315_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	69.2	1.9e-76
AWL54621.1|114514_114889_-	hypothetical protein	NA	NA	NA	NA	NA
AWL54622.1|114944_115271_-	theronine dehydrogenase	NA	NA	NA	NA	NA
AWL54623.1|115267_115996_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
AWL54624.1|115992_116424_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
AWL54625.1|116468_118526_-	hypothetical protein	NA	G8DH78	Emiliania_huxleyi_virus	25.4	6.9e-22
AWL54626.1|118595_118844_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AWL54627.1|118892_119435_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	78.3	9.3e-51
AWL54628.1|120041_120371_+	hypothetical protein	NA	NA	NA	NA	NA
AWL54629.1|120265_120829_-	SAM-dependent methyltransferase	NA	M4M9L8	Vibrio_phage	42.0	1.7e-18
>prophage 5
CP029441	Klebsiella quasipneumoniae strain CAV1947 plasmid pCAV1947-173, complete sequence	172839	123909	135742	172839		Macacine_betaherpesvirus(42.86%)	10	NA	NA
AWL54632.1|123909_124164_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.0	1.2e-11
AWL54633.1|124852_125074_+	hypothetical protein	NA	NA	NA	NA	NA
AWL54672.1|125335_125566_-	hypothetical protein	NA	NA	NA	NA	NA
AWL54634.1|125779_126205_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	50.4	2.9e-31
AWL54635.1|126204_127476_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.0	3.3e-155
AWL54636.1|130385_131357_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.6	4.1e-150
AWL54637.1|131356_132523_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.2	1.2e-223
AWL54638.1|133274_134285_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	54.3	8.8e-87
AWL54639.1|134621_134819_-	hypothetical protein	NA	NA	NA	NA	NA
AWL54640.1|135001_135742_-	recombinase	NA	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
>prophage 6
CP029441	Klebsiella quasipneumoniae strain CAV1947 plasmid pCAV1947-173, complete sequence	172839	139928	144207	172839		Herpes_simplex_virus(50.0%)	2	NA	NA
AWL54642.1|139928_143003_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
AWL54643.1|143124_144207_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	97.8	1.9e-188
>prophage 7
CP029441	Klebsiella quasipneumoniae strain CAV1947 plasmid pCAV1947-173, complete sequence	172839	147847	149007	172839		Stx2-converting_phage(50.0%)	2	NA	NA
AWL54646.1|147847_148141_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	95.9	1.4e-48
AWL54647.1|148239_149007_-	iron-dicitrate ABC transporter ATP-binding subunit	NA	G3M9Y6	Bacillus_virus	25.2	5.8e-14
>prophage 8
CP029441	Klebsiella quasipneumoniae strain CAV1947 plasmid pCAV1947-173, complete sequence	172839	157722	172175	172839	integrase,transposase	Burkholderia_virus(16.67%)	15	163408:163421	164938:164951
AWL54655.1|157722_158676_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	26.3	4.3e-11
AWL54656.1|158831_159680_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWL54657.1|159703_160375_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWL54658.1|160371_161034_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWL54659.1|161038_161857_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.6	1.4e-29
AWL54660.1|161853_162819_+	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AWL54674.1|163074_163389_-	hypothetical protein	NA	NA	NA	NA	NA
163408:163421	attL	GCCGCTTTCATCCT	NA	NA	NA	NA
AWL54661.1|163669_164470_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.4	2.1e-51
AWL54675.1|164508_164856_-	hypothetical protein	NA	NA	NA	NA	NA
AWL54662.1|165217_166027_-	hypothetical protein	NA	NA	NA	NA	NA
164938:164951	attR	GCCGCTTTCATCCT	NA	NA	NA	NA
AWL54663.1|166352_167515_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	43.8	6.8e-51
AWL54676.1|168227_169136_+	HNH endonuclease	NA	NA	NA	NA	NA
AWL54664.1|169523_169874_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	53.3	1.2e-19
AWL54665.1|170017_170449_-	silver-binding protein SilE	NA	NA	NA	NA	NA
AWL54666.1|170699_172175_-	Cu(+)/Ag(+) sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	7.9e-28
>prophage 1
CP029440	Klebsiella quasipneumoniae strain CAV1947 plasmid pCAV1947-61, complete sequence	60653	11799	40479	60653	transposase	uncultured_Caudovirales_phage(25.0%)	32	NA	NA
AWL54436.1|11799_12822_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWL54437.1|13107_13476_-	hypothetical protein	NA	NA	NA	NA	NA
AWL54438.1|13663_14413_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	28.9	2.0e-19
AWL54439.1|14413_14641_+	hypothetical protein	NA	NA	NA	NA	NA
AWL54440.1|15454_15808_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	4.1e-23
AWL54441.1|15855_16218_+	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AWL54442.1|16235_17987_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AWL54443.1|18034_19324_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.3	3.3e-171
AWL54444.1|19336_19762_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.2e-50
AWL54445.1|19792_20197_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AWL54446.1|20205_20778_-	recombinase	NA	Q1MVP4	Enterobacteria_phage	89.0	2.0e-83
AWL54447.1|20941_23950_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.5	0.0e+00
AWL54448.1|24081_24393_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AWL54449.1|24380_24659_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
AWL54450.1|25333_25828_-	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
AWL54451.1|25817_26279_-	peptide-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
AWL54452.1|26513_27020_-	DUF417 domain-containing protein	NA	NA	NA	NA	NA
AWL54453.1|27050_27311_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AWL54454.1|27523_28081_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AWL54455.1|28177_28444_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AWL54456.1|28601_29207_-	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
AWL54457.1|29301_32199_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
AWL54492.1|32399_33020_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AWL54458.1|33160_33427_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AWL54459.1|33519_33996_+	hypothetical protein	NA	NA	NA	NA	NA
AWL54460.1|34334_34895_+	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	41.8	1.9e-30
AWL54461.1|34878_36540_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AWL54462.1|36529_37498_+	AAA family ATPase	NA	NA	NA	NA	NA
AWL54463.1|37735_38017_+	XRE family transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
AWL54464.1|38294_39275_+|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	2.0e-184
AWL54465.1|39313_39439_-	ABC transporter	NA	NA	NA	NA	NA
AWL54466.1|39774_40479_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 1
CP029438	Klebsiella quasipneumoniae strain CAV1947 plasmid pKPC_CAV1947-14, complete sequence	14106	77	7175	14106	transposase	Cellulophaga_phage(33.33%)	7	NA	NA
AWL54362.1|77_422_+	plasmid mobilization relaxosome protein MobC	NA	M1PXS8	Cellulophaga_phage	92.5	1.3e-50
AWL54353.1|411_1914_+	nuclease	NA	M1Q738	Cellulophaga_phage	70.9	1.7e-179
AWL54354.1|1993_2260_+	hypothetical protein	NA	NA	NA	NA	NA
AWL54355.1|2536_3856_+|transposase	IS1182 family transposase ISKpn6	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
AWL54356.1|4105_4987_-	carbapenem-hydrolyzing class A beta-lactamase KPC-3	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
AWL54357.1|5373_6153_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
AWL54358.1|6149_7175_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
>prophage 1
CP029442	Klebsiella quasipneumoniae strain CAV1947 plasmid pKPC_CAV1947-412, complete sequence	412382	9269	61820	412382	transposase,integrase	Escherichia_phage(33.33%)	46	30990:31049	61821:62022
AWL54689.1|9269_10292_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWL54690.1|10288_13354_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.5	5.1e-295
AWL54691.1|13521_14163_+	resolvase	NA	NA	NA	NA	NA
AWL54692.1|14426_16085_-	CoA-disulfide reductase	NA	NA	NA	NA	NA
AWL54693.1|16246_16597_+	transcriptional regulator	NA	NA	NA	NA	NA
AWL54694.1|16901_17378_-	DNA starvation/stationary phase protection protein	NA	G0X506	Salmonella_phage	28.7	6.7e-05
AWL54695.1|17492_17930_-	PaaI family thioesterase	NA	NA	NA	NA	NA
AWL54696.1|18090_18552_-	dinitrogenase iron-molybdenum cofactor	NA	NA	NA	NA	NA
AWL54697.1|18526_18847_-	DUF134 domain-containing protein	NA	NA	NA	NA	NA
AWL54698.1|19140_19368_-	hypothetical protein	NA	NA	NA	NA	NA
AWL54699.1|19546_20527_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	1.5e-184
AWL55113.1|20565_20682_-	ABC transporter	NA	NA	NA	NA	NA
AWL55114.1|21205_21349_+	sugar kinase	NA	Q6QLL3	Human_immunodeficiency_virus	78.3	1.2e-13
AWL54700.1|23141_24371_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
AWL54701.1|24480_26379_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	56.0	8.7e-11
AWL54702.1|28226_29102_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWL54703.1|29202_29493_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AWL54704.1|30079_30784_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWL55115.1|30927_31242_+|transposase	transposase	transposase	NA	NA	NA	NA
30990:31049	attL	GGCAGCGCAAGTCAATCCTGGCGGATTCACTACCCCTGCGCGAAGGCCATCGGTGCCGCA	NA	NA	NA	NA
AWL54705.1|31381_31951_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
AWL54706.1|32372_33263_-	hypothetical protein	NA	NA	NA	NA	NA
AWL54707.1|36341_37661_+|transposase	IS1182 family transposase ISKpn6	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
AWL54708.1|37910_38792_-	carbapenem-hydrolyzing class A beta-lactamase KPC-3	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
AWL54709.1|39178_39958_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
AWL54710.1|39954_40980_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
AWL54711.1|41086_44116_-|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
AWL54712.1|44225_45941_+|integrase	integrase	integrase	NA	NA	NA	NA
AWL54713.1|47293_47998_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWL55116.1|48033_48339_+	IncN plasmid KikA protein	NA	NA	NA	NA	NA
AWL54714.1|48374_48686_+	hypothetical protein	NA	NA	NA	NA	NA
AWL55117.1|48894_49383_+	restriction endonuclease	NA	NA	NA	NA	NA
AWL54715.1|49387_49594_+	hypothetical protein	NA	NA	NA	NA	NA
AWL54716.1|49975_51409_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
AWL54717.1|51442_52651_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
AWL54718.1|52663_52876_-	resolvase	NA	NA	NA	NA	NA
AWL54719.1|52917_53682_-|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AWL54720.1|53769_53883_+	NTP-binding protein	NA	NA	NA	NA	NA
AWL54721.1|54188_54689_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWL54722.1|54707_54887_+	hypothetical protein	NA	NA	NA	NA	NA
AWL54723.1|54816_55656_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AWL54724.1|55855_56512_-	quinolone resistance pentapeptide repeat protein QnrA1	NA	NA	NA	NA	NA
AWL54725.1|56844_58386_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AWL54726.1|58790_59630_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AWL54727.1|59623_59971_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AWL55118.1|60127_60661_-	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
AWL54728.1|60806_61820_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
61821:62022	attR	GGCAGCGCAAGTCAATCCTGGCGGATTCACTACCCCTGCGCGAAGGCCATCGGTGCCGCATCGAACGGCCGGTTGCGGAAAGTCCTCCCTGCGTCCGCTGATGGCCGGCAGCAGCCCGTCGTTGCCTGATGGATCCAACCCCTCCGCTGCTATAGTGCAGTCGGCTTCTGACGTTCAGTGCAGCCGTCTTCTGAAAACGACA	NA	NA	NA	NA
>prophage 2
CP029442	Klebsiella quasipneumoniae strain CAV1947 plasmid pKPC_CAV1947-412, complete sequence	412382	165417	221710	412382	transposase,protease	uncultured_Caudovirales_phage(30.0%)	48	NA	NA
AWL54857.1|165417_168426_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.6	0.0e+00
AWL54858.1|168589_169162_+	recombinase	NA	Q1MVP4	Enterobacteria_phage	89.0	2.0e-83
AWL54859.1|169170_169575_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AWL54860.1|169605_170031_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.2e-50
AWL54861.1|170043_171333_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.3	1.6e-170
AWL54862.1|171381_173133_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AWL54863.1|173150_173513_-	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AWL54864.1|173560_173914_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	4.1e-23
AWL54865.1|175124_175466_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	51.9	3.6e-24
AWL54866.1|175593_176550_-	ABC transporter permease	NA	NA	NA	NA	NA
AWL54867.1|176546_177518_-	ABC transporter permease	NA	NA	NA	NA	NA
AWL54868.1|177510_179010_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.7	1.6e-12
AWL54869.1|179042_180029_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AWL54870.1|180154_180343_-	hypothetical protein	NA	NA	NA	NA	NA
AWL54871.1|180454_181252_-	hypothetical protein	NA	NA	NA	NA	NA
AWL54872.1|181390_182290_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.9	6.3e-12
AWL54873.1|182252_185630_-	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	30.2	4.6e-39
AWL54874.1|185830_187069_+	urea ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWL54875.1|187122_188049_+	urea ABC transporter permease subunit UrtB	NA	NA	NA	NA	NA
AWL54876.1|188062_189235_+	urea ABC transporter permease subunit UrtC	NA	NA	NA	NA	NA
AWL55125.1|189218_189968_+	urea ABC transporter ATP-binding protein UrtD	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	2.1e-16
AWL54877.1|189978_190668_+	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	4.1e-19
AWL54878.1|190700_191711_+	formamidase	NA	NA	NA	NA	NA
AWL54879.1|191811_192855_+	aliphatic amidase	NA	NA	NA	NA	NA
AWL55126.1|192900_193953_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	31.0	3.8e-32
AWL54880.1|193924_194221_-	hypothetical protein	NA	NA	NA	NA	NA
AWL55127.1|194743_196855_+	hypothetical protein	NA	A0A2L1IV38	Escherichia_phage	45.6	6.9e-17
AWL54881.1|196859_199757_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
AWL54882.1|199851_200457_+	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
AWL54883.1|201905_202142_-	hypothetical protein	NA	NA	NA	NA	NA
AWL54884.1|202402_202621_-	hypothetical protein	NA	NA	NA	NA	NA
AWL54885.1|202903_203227_+	hypothetical protein	NA	NA	NA	NA	NA
AWL54886.1|203262_204186_-	hypothetical protein	NA	NA	NA	NA	NA
AWL54887.1|204366_204594_-	hypothetical protein	NA	NA	NA	NA	NA
AWL54888.1|204912_205311_-	hypothetical protein	NA	NA	NA	NA	NA
AWL54889.1|205332_205650_-	hypothetical protein	NA	NA	NA	NA	NA
AWL54890.1|205737_206223_-	hypothetical protein	NA	NA	NA	NA	NA
AWL54891.1|206633_207500_-	repA protein	NA	J9Q7H0	Salmonella_phage	37.2	8.4e-46
AWL54892.1|208072_208321_-	hypothetical protein	NA	NA	NA	NA	NA
AWL55128.1|209282_210365_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	56.5	1.1e-79
AWL54893.1|210419_210689_-	hypothetical protein	NA	NA	NA	NA	NA
AWL54894.1|211805_212810_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWL54895.1|213158_214154_-	glycosyl transferase	NA	NA	NA	NA	NA
AWL54896.1|214214_215042_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	42.0	3.0e-53
AWL54897.1|215060_216539_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.6	8.6e-200
AWL54898.1|216964_217588_+	serine recombinase	NA	NA	NA	NA	NA
AWL54899.1|217642_220627_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	54.2	3.5e-301
AWL54900.1|220705_221710_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 1
CP029439	Klebsiella quasipneumoniae strain CAV1947 plasmid pKPC_CAV1947-56, complete sequence	55890	4803	41739	55890	tRNA,coat,integrase,transposase	Enterobacteria_phage(16.67%)	40	15686:15702	41026:41042
AWL54367.1|4803_5964_-|coat	spore coat protein CotH	coat	NA	NA	NA	NA
AWL54368.1|5966_6515_-	DNA distortion polypeptide 1	NA	NA	NA	NA	NA
AWL54369.1|6842_7100_-	hypothetical protein	NA	NA	NA	NA	NA
AWL54370.1|7342_7684_-	hypothetical protein	NA	NA	NA	NA	NA
AWL54371.1|7780_8020_-	hypothetical protein	NA	NA	NA	NA	NA
AWL54418.1|8012_8279_-	hypothetical protein	NA	NA	NA	NA	NA
AWL54372.1|8290_8833_-	hypothetical protein	NA	NA	NA	NA	NA
AWL54373.1|8876_9392_-	molecular chaperone DnaJ	NA	A0A219YC37	Aeromonas_phage	36.9	5.6e-05
AWL54374.1|10016_10253_-	hypothetical protein	NA	NA	NA	NA	NA
AWL54375.1|10776_11682_+	RepB family plasmid replication initiator protein	NA	NA	NA	NA	NA
AWL54376.1|11690_12128_+	hypothetical protein	NA	NA	NA	NA	NA
AWL54377.1|12310_12667_+	DNA distortion polypeptide 3	NA	NA	NA	NA	NA
AWL54378.1|12663_13641_-	hypothetical protein	NA	NA	NA	NA	NA
AWL54379.1|13665_13947_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AWL54380.1|14044_14707_-	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	26.1	4.5e-07
AWL54381.1|15040_15688_+	resolvase	NA	M9Q1K0	Clostridium_phage	25.0	1.3e-06
15686:15702	attL	TAGTTACAACATTCAAC	NA	NA	NA	NA
AWL54382.1|15952_16813_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AWL54383.1|17512_18337_-	oxacillin-hydrolyzing class D beta-lactamase OXA-9	NA	NA	NA	NA	NA
AWL54384.1|18396_19185_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AWL54419.1|19254_19809_-	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
AWL54385.1|20559_21384_-	oxacillin-hydrolyzing class D beta-lactamase OXA-9	NA	NA	NA	NA	NA
AWL54386.1|21443_22232_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AWL54420.1|22301_22856_-	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
AWL54387.1|23089_23647_-	recombinase	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
AWL54388.1|25942_27658_-|integrase	integrase	integrase	NA	NA	NA	NA
AWL54389.1|27767_30797_+|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
AWL54390.1|30903_31929_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
AWL54391.1|31925_32705_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
AWL54392.1|33091_33973_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
AWL54393.1|34222_35542_-|transposase	IS1182 family transposase ISKpn6	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
AWL54394.1|35938_36052_+	NTP-binding protein	NA	NA	NA	NA	NA
AWL54395.1|36357_36858_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWL54396.1|36876_37056_+	hypothetical protein	NA	NA	NA	NA	NA
AWL54397.1|36985_37825_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AWL54398.1|37818_38166_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AWL54399.1|38270_38561_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
AWL54400.1|38669_39143_-	trimethoprim-resistant dihydrofolate reductase DfrA5	NA	G3MBI7	Bacillus_virus	27.7	1.0e-13
AWL54401.1|39735_40749_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AWL54402.1|40687_40957_+|transposase	transposase	transposase	NA	NA	NA	NA
AWL54403.1|41469_41739_-|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
41026:41042	attR	GTTGAATGTTGTAACTA	NA	NA	NA	NA
