The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029550	Methylobacterium sp. 17SD2-17 chromosome, complete genome	6788375	638474	702875	6788375	transposase,protease,integrase	Erythrobacter_phage(33.33%)	52	636005:636055	699316:699366
636005:636055	attL	CAGCTTCCCAAGCTGAATGTCGTCGGTTCGATCCCGATCGCCCGCTCCACC	NA	NA	NA	NA
AWN39686.1|638474_639728_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AWN39687.1|640023_640644_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWN39688.1|640893_641958_+	hypothetical protein	NA	NA	NA	NA	NA
AWN44334.1|642189_642426_-	hypothetical protein	NA	NA	NA	NA	NA
AWN39689.1|642830_643397_-	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	46.7	5.5e-22
AWN39690.1|643805_644234_+	hypothetical protein	NA	NA	NA	NA	NA
AWN39691.1|644292_644538_-	hypothetical protein	NA	NA	NA	NA	NA
AWN44335.1|644589_645069_-	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	50.0	5.5e-23
AWN39692.1|645291_645996_-	chromosome partitioning protein	NA	NA	NA	NA	NA
AWN39693.1|646244_647474_-|integrase	integrase	integrase	NA	NA	NA	NA
AWN39694.1|647463_647715_-	hypothetical protein	NA	NA	NA	NA	NA
AWN39695.1|647788_648643_-	hypothetical protein	NA	NA	NA	NA	NA
AWN39696.1|648770_649831_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AWN39697.1|650329_651031_+	hypothetical protein	NA	NA	NA	NA	NA
AWN39698.1|651674_651968_+	hypothetical protein	NA	NA	NA	NA	NA
AWN39699.1|652572_654570_-	hypothetical protein	NA	NA	NA	NA	NA
AWN39700.1|654559_655777_-	hypothetical protein	NA	NA	NA	NA	NA
AWN39701.1|657326_657518_-	hypothetical protein	NA	NA	NA	NA	NA
AWN39702.1|657819_658239_+	hypothetical protein	NA	NA	NA	NA	NA
AWN39703.1|660167_661229_-	polysaccharide deacetylase	NA	NA	NA	NA	NA
AWN39704.1|661796_662537_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AWN39705.1|663430_663628_-	hypothetical protein	NA	NA	NA	NA	NA
AWN39706.1|663676_663817_-	hypothetical protein	NA	NA	NA	NA	NA
AWN39707.1|663813_664494_-	universal stress protein	NA	NA	NA	NA	NA
AWN39708.1|665031_672144_+	heme peroxidase	NA	NA	NA	NA	NA
AWN39709.1|672665_672950_+	hypothetical protein	NA	NA	NA	NA	NA
AWN39710.1|673623_675144_+	hypothetical protein	NA	NA	NA	NA	NA
AWN39711.1|675323_676112_+	hypothetical protein	NA	NA	NA	NA	NA
AWN39712.1|676976_677351_-	hypothetical protein	NA	NA	NA	NA	NA
AWN39713.1|677689_677875_-	hypothetical protein	NA	NA	NA	NA	NA
AWN39714.1|678012_678747_-	anti-sigma factor	NA	NA	NA	NA	NA
AWN39715.1|678736_679306_-	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AWN39716.1|679938_680133_+	hypothetical protein	NA	NA	NA	NA	NA
AWN44336.1|681032_682079_+	cystathionine gamma-synthase	NA	NA	NA	NA	NA
AWN39717.1|682564_683821_+	cupin	NA	NA	NA	NA	NA
AWN39718.1|684427_685180_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
AWN39719.1|685302_685536_-	hypothetical protein	NA	NA	NA	NA	NA
AWN39720.1|685760_685970_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	60.8	1.1e-12
AWN39721.1|686668_686974_+	hypothetical protein	NA	NA	NA	NA	NA
AWN39722.1|687147_687624_+	MucR family transcriptional regulator	NA	NA	NA	NA	NA
AWN39723.1|687630_687990_-	hypothetical protein	NA	NA	NA	NA	NA
AWN39724.1|688987_689224_-	hypothetical protein	NA	NA	NA	NA	NA
AWN39725.1|689726_690437_+	hypothetical protein	NA	NA	NA	NA	NA
AWN39726.1|692102_692921_+	hypothetical protein	NA	NA	NA	NA	NA
AWN44337.1|694150_695359_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	47.5	2.2e-92
AWN44338.1|695256_695634_+	hypothetical protein	NA	NA	NA	NA	NA
AWN39727.1|695804_696734_+	acetoin utilization protein	NA	A0A2K9L0I3	Tupanvirus	37.3	9.4e-35
AWN39728.1|696981_697293_+	hypothetical protein	NA	NA	NA	NA	NA
AWN39729.1|698004_699065_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AWN39730.1|700537_700951_-	dioxygenase	NA	NA	NA	NA	NA
699316:699366	attR	CAGCTTCCCAAGCTGAATGTCGTCGGTTCGATCCCGATCGCCCGCTCCACC	NA	NA	NA	NA
AWN44339.1|701162_701903_+	oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.1	3.8e-15
AWN39731.1|701993_702875_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 2
CP029550	Methylobacterium sp. 17SD2-17 chromosome, complete genome	6788375	808057	869604	6788375	tRNA,transposase,integrase	uncultured_virus(22.22%)	60	802074:802091	856059:856076
802074:802091	attL	GCCGCCTCCCCGAGGGCG	NA	NA	NA	NA
AWN39812.1|808057_808519_+|tRNA	tRNA-specific adenosine deaminase	tRNA	NA	NA	NA	NA
AWN39813.1|808997_809891_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWN39814.1|810034_810742_+	thiol:disulfide oxidoreductase	NA	NA	NA	NA	NA
AWN44350.1|810975_811374_+	hypothetical protein	NA	NA	NA	NA	NA
AWN39815.1|811500_811956_+	4-aminobutyrate aminotransferase	NA	NA	NA	NA	NA
AWN39816.1|812187_814140_+	PrkA family serine protein kinase	NA	NA	NA	NA	NA
AWN39817.1|814253_815555_+	hypothetical protein	NA	NA	NA	NA	NA
AWN39818.1|815598_817173_+	SpoVR family protein	NA	NA	NA	NA	NA
AWN44351.1|817182_817479_-	hypothetical protein	NA	NA	NA	NA	NA
AWN44352.1|817735_817954_+	hypothetical protein	NA	NA	NA	NA	NA
AWN39819.1|818561_819236_+	dienelactone hydrolase	NA	NA	NA	NA	NA
AWN39820.1|819398_819818_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AWN39821.1|819897_821157_+	esterase	NA	NA	NA	NA	NA
AWN39822.1|821396_821684_+	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	59.6	3.3e-23
AWN39823.1|821775_823425_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	58.4	8.8e-169
AWN39824.1|825088_826204_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AWN39825.1|826922_827135_-	hypothetical protein	NA	NA	NA	NA	NA
AWN39826.1|827155_827791_-	hypothetical protein	NA	NA	NA	NA	NA
AWN39827.1|827911_828565_+	hypothetical protein	NA	NA	NA	NA	NA
AWN39828.1|828932_829229_+	hypothetical protein	NA	NA	NA	NA	NA
AWN39829.1|829697_830873_-	hypothetical protein	NA	NA	NA	NA	NA
AWN39830.1|831068_831374_+	hypothetical protein	NA	NA	NA	NA	NA
AWN39831.1|831379_831622_+	hypothetical protein	NA	NA	NA	NA	NA
AWN39832.1|831661_832393_+	hypothetical protein	NA	NA	NA	NA	NA
AWN44353.1|833966_834767_-	hypothetical protein	NA	NA	NA	NA	NA
AWN39833.1|835447_835696_+	hypothetical protein	NA	NA	NA	NA	NA
AWN44354.1|836018_836315_-	hypothetical protein	NA	NA	NA	NA	NA
AWN39834.1|836793_837036_-	hypothetical protein	NA	NA	NA	NA	NA
AWN39835.1|837314_838498_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	40.4	1.8e-46
AWN39836.1|839001_839963_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	25.6	6.8e-12
AWN39837.1|841153_842524_+	hypothetical protein	NA	NA	NA	NA	NA
AWN39838.1|842723_842933_+	hypothetical protein	NA	NA	NA	NA	NA
AWN39839.1|843144_843393_-	hypothetical protein	NA	NA	NA	NA	NA
AWN39840.1|843548_844250_+	RNA polymerase subunit sigma-70	NA	A0A076YQ50	Rhizobium_phage	30.3	1.1e-08
AWN39841.1|845259_845499_+	hypothetical protein	NA	NA	NA	NA	NA
AWN39842.1|845933_846146_-	hypothetical protein	NA	NA	NA	NA	NA
AWN39843.1|846191_846434_-	hypothetical protein	NA	NA	NA	NA	NA
AWN39844.1|846572_846851_-	hypothetical protein	NA	NA	NA	NA	NA
AWN39845.1|847269_848166_+	hypothetical protein	NA	NA	NA	NA	NA
AWN44355.1|848529_848883_+	hypothetical protein	NA	NA	NA	NA	NA
AWN39846.1|848756_849905_+|integrase	site-specific integrase	integrase	A0A076G7B8	Sinorhizobium_phage	36.5	1.0e-51
AWN39847.1|850345_853441_+	hypothetical protein	NA	B0ZSI4	Halomonas_phage	22.5	4.0e-13
AWN39848.1|854228_854867_+	hypothetical protein	NA	NA	NA	NA	NA
AWN39849.1|854920_855664_+	hypothetical protein	NA	NA	NA	NA	NA
AWN39850.1|855762_856035_+	hypothetical protein	NA	NA	NA	NA	NA
AWN39851.1|856077_856413_-	hypothetical protein	NA	NA	NA	NA	NA
856059:856076	attR	GCCGCCTCCCCGAGGGCG	NA	NA	NA	NA
AWN39852.1|856760_858095_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
AWN39853.1|858258_858501_+	hypothetical protein	NA	NA	NA	NA	NA
AWN39854.1|858581_858809_+	hypothetical protein	NA	NA	NA	NA	NA
AWN39855.1|859001_859892_+	DNA polymerase III subunit epsilon	NA	A0A0F6R602	Sinorhizobium_phage	25.4	4.3e-13
AWN39856.1|860308_861343_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWN39857.1|861875_862355_-	hypothetical protein	NA	NA	NA	NA	NA
AWN39858.1|862805_863156_+	hypothetical protein	NA	NA	NA	NA	NA
AWN39859.1|863328_863847_-	ATPase	NA	NA	NA	NA	NA
AWN39860.1|863833_864190_-	transcriptional regulator	NA	NA	NA	NA	NA
AWN39861.1|864897_865137_-	hypothetical protein	NA	NA	NA	NA	NA
AWN39862.1|865812_866211_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AWN39863.1|866245_866992_-	oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.1	1.9e-17
AWN44356.1|867112_868027_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWN39864.1|868230_869604_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029550	Methylobacterium sp. 17SD2-17 chromosome, complete genome	6788375	1108393	1165252	6788375	transposase	Corynebacterium_phage(16.67%)	49	NA	NA
AWN44373.1|1108393_1109602_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	47.5	2.2e-92
AWN40048.1|1110200_1110410_+	hypothetical protein	NA	NA	NA	NA	NA
AWN40049.1|1110490_1110757_+	hypothetical protein	NA	NA	NA	NA	NA
AWN40050.1|1110763_1111501_-	hypothetical protein	NA	NA	NA	NA	NA
AWN40051.1|1111634_1111907_+	DUF2312 domain-containing protein	NA	B0VK10	Azospirillum_phage	53.8	1.0e-13
AWN44374.1|1112077_1112980_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AWN40052.1|1112976_1114404_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AWN40053.1|1114791_1114974_-	hypothetical protein	NA	NA	NA	NA	NA
AWN44375.1|1115326_1116526_-	hypothetical protein	NA	NA	NA	NA	NA
AWN40054.1|1116639_1117053_-	glyoxalase	NA	NA	NA	NA	NA
AWN40055.1|1117217_1118726_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AWN40056.1|1118774_1120280_+	glycerol kinase	NA	NA	NA	NA	NA
AWN40057.1|1120284_1121193_-	EamA family transporter	NA	NA	NA	NA	NA
AWN44376.1|1121296_1122367_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y3R2	Acanthamoeba_polyphaga_mimivirus	55.3	5.0e-16
AWN40058.1|1122455_1123373_-	3-methyladenine DNA glycosylase 2	NA	NA	NA	NA	NA
AWN40059.1|1123489_1123900_+	hypothetical protein	NA	NA	NA	NA	NA
AWN40060.1|1123854_1124337_-	hypothetical protein	NA	NA	NA	NA	NA
AWN40061.1|1124388_1125036_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AWN44377.1|1125639_1127499_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	28.1	1.4e-16
AWN40062.1|1127602_1128952_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
AWN44378.1|1129029_1130124_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AWN44379.1|1130137_1132372_-	adenylate/guanylate cyclase domain-containing protein	NA	A0A2H4N7Z5	Lake_Baikal_phage	35.5	4.9e-98
AWN40063.1|1132392_1136664_-	hypothetical protein	NA	NA	NA	NA	NA
AWN40064.1|1136997_1137714_-	hypothetical protein	NA	NA	NA	NA	NA
AWN40065.1|1138148_1138628_-	Tellurite resistance protein TerB	NA	NA	NA	NA	NA
AWN40066.1|1139305_1140656_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWN44380.1|1141187_1142207_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWN40067.1|1143880_1145200_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AWN40068.1|1145336_1146401_-	hypothetical protein	NA	NA	NA	NA	NA
AWN40069.1|1146627_1147650_-	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
AWN40070.1|1148126_1148522_-	hypothetical protein	NA	NA	NA	NA	NA
AWN40071.1|1149007_1150012_-	histidine kinase	NA	NA	NA	NA	NA
AWN40072.1|1150572_1150662_+	pyrroloquinoline quinone precursor peptide PqqA	NA	NA	NA	NA	NA
AWN40073.1|1150994_1152135_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.0	3.6e-36
AWN40074.1|1152122_1152239_-	pyrroloquinoline quinone precursor peptide PqqA	NA	NA	NA	NA	NA
AWN40075.1|1152758_1153016_+	hypothetical protein	NA	NA	NA	NA	NA
AWN40076.1|1154102_1154486_-	hypothetical protein	NA	NA	NA	NA	NA
AWN40077.1|1154785_1155334_+	hypothetical protein	NA	NA	NA	NA	NA
AWN40078.1|1156223_1156988_+	hypothetical protein	NA	NA	NA	NA	NA
AWN40079.1|1157305_1157554_+	hypothetical protein	NA	NA	NA	NA	NA
AWN44381.1|1158291_1158936_-	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
AWN40080.1|1160201_1160585_+	exopolysaccharide production protein YjbE	NA	NA	NA	NA	NA
AWN40081.1|1160944_1161304_+	hypothetical protein	NA	NA	NA	NA	NA
AWN40082.1|1161485_1161974_+	hypothetical protein	NA	NA	NA	NA	NA
AWN40083.1|1162184_1162376_+	hypothetical protein	NA	NA	NA	NA	NA
AWN44382.1|1162614_1162824_+	hypothetical protein	NA	NA	NA	NA	NA
AWN44383.1|1162904_1163150_+	hypothetical protein	NA	NA	NA	NA	NA
AWN40084.1|1163791_1164223_+	inosine-5-monophosphate dehydrogenase	NA	NA	NA	NA	NA
AWN40085.1|1164304_1165252_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 4
CP029550	Methylobacterium sp. 17SD2-17 chromosome, complete genome	6788375	1651014	1724554	6788375	transposase,integrase	Rhizobium_phage(28.57%)	60	1677209:1677228	1723620:1723639
AWN40433.1|1651014_1652388_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AWN40434.1|1652544_1653102_+	deaminase	NA	NA	NA	NA	NA
AWN44422.1|1653301_1653481_+	hypothetical protein	NA	NA	NA	NA	NA
AWN40435.1|1653529_1653913_-	hypothetical protein	NA	NA	NA	NA	NA
AWN40436.1|1657514_1658141_-	hypothetical protein	NA	NA	NA	NA	NA
AWN40437.1|1658281_1658572_-	hypothetical protein	NA	NA	NA	NA	NA
AWN40438.1|1658949_1659477_+	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AWN44423.1|1659523_1661365_+	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
AWN40439.1|1661561_1662356_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
AWN40440.1|1662576_1663815_+	hypothetical protein	NA	NA	NA	NA	NA
AWN40441.1|1663958_1665395_-	cardiolipin synthase	NA	NA	NA	NA	NA
AWN40442.1|1665903_1666908_-	NTE family protein rssA	NA	NA	NA	NA	NA
AWN40443.1|1667279_1668008_-	RNA polymerase subunit sigma-70	NA	A0A076YQ50	Rhizobium_phage	30.1	6.3e-10
AWN40444.1|1668269_1668530_+	hypothetical protein	NA	NA	NA	NA	NA
AWN40445.1|1669022_1670654_+	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	NA	NA	NA	NA
AWN40446.1|1670907_1671804_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
AWN44424.1|1671872_1673048_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
AWN40447.1|1673392_1674319_-	blue light sensor protein	NA	NA	NA	NA	NA
AWN40448.1|1674357_1676076_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.0	1.1e-15
AWN40449.1|1676251_1676653_-	hypothetical protein	NA	NA	NA	NA	NA
AWN40450.1|1676818_1677895_+	hypothetical protein	NA	NA	NA	NA	NA
1677209:1677228	attL	CTGGCCGAGCGCGTCACCGA	NA	NA	NA	NA
AWN40451.1|1678013_1678373_+	phasin	NA	NA	NA	NA	NA
AWN40452.1|1678448_1679273_+	hypothetical protein	NA	NA	NA	NA	NA
AWN40453.1|1679522_1681088_-	amidase	NA	NA	NA	NA	NA
AWN44425.1|1681389_1682649_-	esterase	NA	NA	NA	NA	NA
AWN40454.1|1682723_1683143_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AWN40455.1|1683583_1683856_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AWN40456.1|1684146_1684461_+	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	56.5	2.6e-21
AWN40457.1|1684507_1686154_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	60.3	1.4e-169
AWN40458.1|1687689_1688688_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWN40459.1|1688915_1690943_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
AWN44426.1|1690935_1691130_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
AWN40460.1|1691479_1692355_+	hypothetical protein	NA	NA	NA	NA	NA
AWN40461.1|1692577_1693705_-	alkene reductase	NA	NA	NA	NA	NA
AWN40462.1|1694050_1694425_+	hypothetical protein	NA	NA	NA	NA	NA
AWN40463.1|1694531_1695026_+	hypothetical protein	NA	NA	NA	NA	NA
AWN40464.1|1695456_1695660_+	hypothetical protein	NA	NA	NA	NA	NA
AWN40465.1|1695880_1696873_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AWN44427.1|1697076_1697892_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
AWN40466.1|1697888_1698158_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
AWN40467.1|1698510_1699239_-	hypothetical protein	NA	NA	NA	NA	NA
AWN40468.1|1700056_1701113_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AWN40469.1|1702633_1703359_+	RNA polymerase subunit sigma-70	NA	A0A076YQ50	Rhizobium_phage	28.3	2.6e-08
AWN40470.1|1703378_1704095_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AWN40471.1|1704476_1704713_+	hypothetical protein	NA	NA	NA	NA	NA
AWN40472.1|1704725_1704926_+	hypothetical protein	NA	NA	NA	NA	NA
AWN40473.1|1705232_1705649_-	hypothetical protein	NA	NA	NA	NA	NA
AWN40474.1|1705713_1706553_-	HNH endonuclease	NA	NA	NA	NA	NA
AWN44428.1|1708819_1709746_+|integrase	integrase	integrase	A0A0A1I5U0	Burkholderia_phage	43.2	4.2e-59
AWN40475.1|1710782_1711706_+	hypothetical protein	NA	NA	NA	NA	NA
AWN40476.1|1712268_1712481_+	hypothetical protein	NA	NA	NA	NA	NA
AWN40477.1|1712914_1713574_+	hypothetical protein	NA	NA	NA	NA	NA
AWN44429.1|1713986_1714658_+	hypothetical protein	NA	NA	NA	NA	NA
AWN40478.1|1714854_1715502_+	hypothetical protein	NA	NA	NA	NA	NA
AWN44430.1|1715417_1716626_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	47.2	6.4e-92
AWN40479.1|1716682_1717063_+	hypothetical protein	NA	NA	NA	NA	NA
AWN40480.1|1717206_1719597_+	peptidase C14	NA	NA	NA	NA	NA
AWN40481.1|1721291_1721510_+	hypothetical protein	NA	NA	NA	NA	NA
AWN40482.1|1721567_1722413_+	universal stress protein	NA	NA	NA	NA	NA
AWN40483.1|1723276_1724554_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
1723620:1723639	attR	TCGGTGACGCGCTCGGCCAG	NA	NA	NA	NA
>prophage 5
CP029550	Methylobacterium sp. 17SD2-17 chromosome, complete genome	6788375	1844610	1884967	6788375	transposase	Shigella_phage(16.67%)	37	NA	NA
AWN40572.1|1844610_1845415_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AWN40573.1|1845530_1846714_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	40.4	1.8e-46
AWN40574.1|1846788_1848015_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AWN40575.1|1848325_1848688_+	hypothetical protein	NA	NA	NA	NA	NA
AWN40576.1|1848731_1848947_-	hypothetical protein	NA	NA	NA	NA	NA
AWN40577.1|1848988_1849309_+	hypothetical protein	NA	NA	NA	NA	NA
AWN40578.1|1849970_1850252_+	hypothetical protein	NA	NA	NA	NA	NA
AWN40579.1|1850654_1850873_+	hypothetical protein	NA	NA	NA	NA	NA
AWN40580.1|1850954_1851266_+	hypothetical protein	NA	NA	NA	NA	NA
AWN40581.1|1851725_1852202_+	MucR family transcriptional regulator	NA	NA	NA	NA	NA
AWN40582.1|1852317_1852569_+	hypothetical protein	NA	NA	NA	NA	NA
AWN40583.1|1852710_1853301_+	hypothetical protein	NA	NA	NA	NA	NA
AWN40584.1|1853589_1854432_-	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	38.0	6.7e-40
AWN40585.1|1854428_1855928_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
AWN44443.1|1858511_1859441_+	2-hydroxyacid dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	27.2	3.3e-16
AWN40586.1|1859377_1860226_+	hypothetical protein	NA	NA	NA	NA	NA
AWN40587.1|1860254_1860815_-	cytochrome B	NA	NA	NA	NA	NA
AWN44444.1|1860843_1861536_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWN40588.1|1861710_1862532_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	31.0	3.4e-12
AWN40589.1|1862544_1863054_-	hypothetical protein	NA	NA	NA	NA	NA
AWN40590.1|1863377_1863656_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
AWN40591.1|1863936_1864659_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	37.3	3.4e-32
AWN40592.1|1864655_1866065_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AWN40593.1|1866116_1866773_-	glutathione S-transferase	NA	NA	NA	NA	NA
AWN40594.1|1867137_1868352_+	polyhydroxyalkanoate depolymerase	NA	NA	NA	NA	NA
AWN40595.1|1868603_1868921_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AWN40596.1|1869041_1869434_-	response regulator	NA	NA	NA	NA	NA
AWN44445.1|1869811_1870591_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
AWN40597.1|1870707_1872147_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AWN40598.1|1872671_1872884_-	SlyX protein	NA	NA	NA	NA	NA
AWN40599.1|1872880_1873633_-	hypothetical protein	NA	NA	NA	NA	NA
AWN40600.1|1874658_1875462_-	hypothetical protein	NA	NA	NA	NA	NA
AWN40601.1|1875711_1878852_-	DNA polymerase I	NA	A0A0C5K9B9	Enterococcus_phage	27.3	1.3e-48
AWN40602.1|1879491_1881753_+	hypothetical protein	NA	NA	NA	NA	NA
AWN40603.1|1881879_1883230_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWN40604.1|1883462_1883840_+	hypothetical protein	NA	NA	NA	NA	NA
AWN40605.1|1883907_1884967_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 6
CP029550	Methylobacterium sp. 17SD2-17 chromosome, complete genome	6788375	2060075	2092676	6788375	transposase,protease	Pseudomonas_phage(16.67%)	33	NA	NA
AWN40698.1|2060075_2060930_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AWN40699.1|2060928_2061201_+	hypothetical protein	NA	NA	NA	NA	NA
AWN40700.1|2061171_2062430_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	53.2	3.0e-76
AWN44459.1|2062497_2062836_+	hypothetical protein	NA	NA	NA	NA	NA
AWN44460.1|2063193_2064402_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	47.2	6.4e-92
AWN40701.1|2064507_2065047_-	hypothetical protein	NA	NA	NA	NA	NA
AWN40702.1|2066408_2066627_+	hypothetical protein	NA	NA	NA	NA	NA
AWN40703.1|2066651_2066948_-	hypothetical protein	NA	NA	NA	NA	NA
AWN40704.1|2067658_2068048_-	hypothetical protein	NA	NA	NA	NA	NA
AWN44461.1|2068877_2069801_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWN40705.1|2070050_2070236_-	hypothetical protein	NA	NA	NA	NA	NA
AWN40706.1|2070412_2071558_+	hypothetical protein	NA	NA	NA	NA	NA
AWN40707.1|2071644_2071926_+	DUF2312 domain-containing protein	NA	B0VK10	Azospirillum_phage	44.2	8.3e-11
AWN40708.1|2071980_2072439_-	MucR family transcriptional regulator	NA	NA	NA	NA	NA
AWN40709.1|2072551_2072758_-	hypothetical protein	NA	A0A0A0YUA2	Escherichia_phage	56.7	5.1e-10
AWN40710.1|2072924_2073371_+	hypothetical protein	NA	NA	NA	NA	NA
AWN40711.1|2073379_2073775_+	hypothetical protein	NA	NA	NA	NA	NA
AWN40712.1|2073771_2074191_+	hypothetical protein	NA	NA	NA	NA	NA
AWN40713.1|2076639_2077404_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
AWN40714.1|2077400_2078297_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
AWN40715.1|2079143_2079455_-	hypothetical protein	NA	NA	NA	NA	NA
AWN40716.1|2079882_2081136_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AWN40717.1|2081238_2082044_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AWN40718.1|2082555_2083167_-	cysteine hydrolase	NA	NA	NA	NA	NA
AWN40719.1|2083377_2084241_-	alpha/beta hydrolase	NA	R4JP33	Mycobacterium_phage	29.2	1.7e-06
AWN40720.1|2084470_2085037_+	hypothetical protein	NA	NA	NA	NA	NA
AWN40721.1|2085033_2085528_+	hypothetical protein	NA	NA	NA	NA	NA
AWN40722.1|2085530_2086553_+	inositol monophosphatase	NA	NA	NA	NA	NA
AWN44462.1|2086632_2087625_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2I2L5E1	Orpheovirus	26.8	6.7e-15
AWN40723.1|2088258_2089410_-	hypothetical protein	NA	NA	NA	NA	NA
AWN44463.1|2089894_2090752_-	hypothetical protein	NA	NA	NA	NA	NA
AWN40724.1|2090791_2091235_-	hypothetical protein	NA	NA	NA	NA	NA
AWN40725.1|2091557_2092676_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
>prophage 7
CP029550	Methylobacterium sp. 17SD2-17 chromosome, complete genome	6788375	2654669	2693467	6788375	transposase	Enterobacteria_phage(22.22%)	26	NA	NA
AWN41143.1|2654669_2655782_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWN41144.1|2657590_2658703_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWN41145.1|2659804_2661241_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	27.8	1.6e-49
AWN41146.1|2662425_2663403_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	53.5	2.3e-92
AWN41147.1|2663517_2664387_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	56.2	7.8e-92
AWN41148.1|2664383_2665298_-	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
AWN41149.1|2665304_2666369_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	46.8	1.5e-84
AWN41150.1|2666440_2666995_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	H9NC63	Sphingomonas_phage	42.0	9.2e-22
AWN41151.1|2667874_2668408_-	hypothetical protein	NA	NA	NA	NA	NA
AWN41152.1|2668404_2669625_-	hypothetical protein	NA	NA	NA	NA	NA
AWN41153.1|2669605_2669839_-	hypothetical protein	NA	NA	NA	NA	NA
AWN41154.1|2670553_2670778_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWN41155.1|2671265_2675039_+	hypothetical protein	NA	NA	NA	NA	NA
AWN41156.1|2675951_2677229_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
AWN41157.1|2677289_2678273_+	hypothetical protein	NA	NA	NA	NA	NA
AWN41158.1|2678232_2679290_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AWN41159.1|2679324_2680074_+	hypothetical protein	NA	NA	NA	NA	NA
AWN41160.1|2680118_2681084_+	hypothetical protein	NA	A0A2P0QEG9	Haloarcula_hispanica_pleomorphic_virus	64.3	4.7e-05
AWN41161.1|2681430_2681676_-	hypothetical protein	NA	NA	NA	NA	NA
AWN41162.1|2681870_2682452_+	DNA invertase	NA	M9Q1K0	Clostridium_phage	44.2	7.2e-25
AWN41163.1|2682567_2682921_-	hypothetical protein	NA	NA	NA	NA	NA
AWN41164.1|2685516_2686164_+	hypothetical protein	NA	NA	NA	NA	NA
AWN41165.1|2686154_2687215_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AWN41166.1|2688626_2689616_+	HIT family hydrolase	NA	D7NW73	Streptomyces_phage	48.5	3.1e-20
AWN41167.1|2691046_2691514_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AWN41168.1|2691934_2693467_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	43.0	4.6e-111
>prophage 8
CP029550	Methylobacterium sp. 17SD2-17 chromosome, complete genome	6788375	2749706	2758152	6788375	head,protease,tail,capsid	Shigella_phage(25.0%)	13	NA	NA
AWN41209.1|2749706_2750285_-|tail	phage tail protein	tail	G9JXH3	Shigella_phage	58.1	2.2e-05
AWN41210.1|2750474_2750693_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
AWN44529.1|2750629_2751037_-	gene transfer agent family protein	NA	NA	NA	NA	NA
AWN41211.1|2751051_2751462_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
AWN41212.1|2751484_2751898_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
AWN41213.1|2751894_2752251_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
AWN41214.1|2752266_2752848_-	hypothetical protein	NA	NA	NA	NA	NA
AWN41215.1|2752846_2753638_+	peptidase S1	NA	NA	NA	NA	NA
AWN41216.1|2753883_2754753_+	peptidase S1	NA	NA	NA	NA	NA
AWN41217.1|2754798_2755053_-	hypothetical protein	NA	NA	NA	NA	NA
AWN41218.1|2755056_2756121_-	hypothetical protein	NA	J7Q326	Aeropyrum_coil-shaped_virus	29.9	4.7e-06
AWN41219.1|2756319_2757588_-|capsid	phage major capsid protein	capsid	Q3HQT0	Burkholderia_phage	41.3	6.7e-76
AWN41220.1|2757615_2758152_-|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	48.0	1.9e-27
>prophage 9
CP029550	Methylobacterium sp. 17SD2-17 chromosome, complete genome	6788375	3022119	3041735	6788375	transposase	Shigella_phage(100.0%)	15	NA	NA
AWN41414.1|3022119_3023454_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
AWN41415.1|3023610_3024930_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AWN41416.1|3025021_3026167_-	glycosyl transferase	NA	NA	NA	NA	NA
AWN41417.1|3026345_3027047_-	UDP-phosphate galactose phosphotransferase	NA	NA	NA	NA	NA
AWN41418.1|3027600_3028698_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AWN41419.1|3028946_3030908_+	hypothetical protein	NA	NA	NA	NA	NA
AWN41420.1|3031199_3031463_-	transcriptional regulator	NA	NA	NA	NA	NA
AWN41421.1|3032194_3033628_+	hypothetical protein	NA	NA	NA	NA	NA
AWN41422.1|3033629_3034037_+	hypothetical protein	NA	NA	NA	NA	NA
AWN41423.1|3035136_3035757_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	35.0	2.2e-27
AWN41424.1|3035775_3036126_-|transposase	transposase	transposase	NA	NA	NA	NA
AWN41425.1|3037714_3038314_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
AWN41426.1|3039155_3039638_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AWN41427.1|3039681_3040203_-	hypothetical protein	NA	NA	NA	NA	NA
AWN41428.1|3040322_3041735_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 10
CP029550	Methylobacterium sp. 17SD2-17 chromosome, complete genome	6788375	3194983	3244435	6788375	transposase	Staphylococcus_phage(16.67%)	37	NA	NA
AWN41541.1|3194983_3196044_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AWN41542.1|3196501_3196882_-	oxalurate catabolism protein HpxZ	NA	NA	NA	NA	NA
AWN41543.1|3196891_3198298_-	AtzE family amidohydrolase	NA	NA	NA	NA	NA
AWN41544.1|3198294_3198483_-	DUF4089 domain-containing protein	NA	NA	NA	NA	NA
AWN41545.1|3198570_3199470_-	polysaccharide deacetylase	NA	NA	NA	NA	NA
AWN41546.1|3199517_3202010_-	ABC transporter	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	3.3e-10
AWN41547.1|3202014_3202884_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWN41548.1|3204345_3204762_+	hypothetical protein	NA	NA	NA	NA	NA
AWN44564.1|3204780_3205485_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWN41549.1|3205785_3206991_+	DUF2252 domain-containing protein	NA	NA	NA	NA	NA
AWN44565.1|3208664_3209924_+	arsenic transporter	NA	NA	NA	NA	NA
AWN41550.1|3209958_3210930_+	EamA-like transporter family protein	NA	NA	NA	NA	NA
AWN41551.1|3210942_3212298_+	C4-dicarboxylate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWN41552.1|3213101_3213353_+	hypothetical protein	NA	NA	NA	NA	NA
AWN44566.1|3213687_3215970_+	hypothetical protein	NA	NA	NA	NA	NA
AWN41553.1|3216247_3217475_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	68.4	4.8e-103
AWN41554.1|3217519_3217780_+	hypothetical protein	NA	NA	NA	NA	NA
AWN41555.1|3217937_3218603_-	hypothetical protein	NA	NA	NA	NA	NA
AWN41556.1|3218599_3219079_-	hypothetical protein	NA	NA	NA	NA	NA
AWN41557.1|3219099_3220450_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWN41558.1|3222158_3222641_+	heat-shock protein	NA	A0A1D8KN82	Synechococcus_phage	41.2	2.3e-21
AWN41559.1|3222733_3223255_+	heat-shock protein	NA	NA	NA	NA	NA
AWN41560.1|3223795_3224140_+	hypothetical protein	NA	NA	NA	NA	NA
AWN44567.1|3224166_3224913_+	hypothetical protein	NA	NA	NA	NA	NA
AWN41561.1|3225029_3225458_+	hypothetical protein	NA	NA	NA	NA	NA
AWN41562.1|3225822_3226458_-	hypothetical protein	NA	NA	NA	NA	NA
AWN41563.1|3228703_3229066_+	hypothetical protein	NA	NA	NA	NA	NA
AWN41564.1|3230458_3232975_-	hypothetical protein	NA	Q9JMN6	Wolbachia_phage	35.4	2.2e-14
AWN41565.1|3232967_3233159_-	hypothetical protein	NA	NA	NA	NA	NA
AWN41566.1|3233214_3234565_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWN41567.1|3234727_3235078_+	hypothetical protein	NA	NA	NA	NA	NA
AWN41568.1|3235218_3236276_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AWN41569.1|3236614_3236860_-	hypothetical protein	NA	NA	NA	NA	NA
AWN41570.1|3236961_3237195_-	hypothetical protein	NA	NA	NA	NA	NA
AWN41571.1|3238408_3238618_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	62.0	2.8e-11
AWN41572.1|3239125_3239326_+	hypothetical protein	NA	NA	NA	NA	NA
AWN44568.1|3243226_3244435_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	47.2	6.4e-92
>prophage 11
CP029550	Methylobacterium sp. 17SD2-17 chromosome, complete genome	6788375	4797937	4847635	6788375	transposase	Rhizobium_phage(20.0%)	42	NA	NA
AWN42687.1|4797937_4799599_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
AWN42688.1|4799706_4800234_-	DUF305 domain-containing protein	NA	NA	NA	NA	NA
AWN42689.1|4800792_4801473_+	hypothetical protein	NA	NA	NA	NA	NA
AWN42690.1|4803120_4803309_+	hypothetical protein	NA	NA	NA	NA	NA
AWN42691.1|4803346_4803970_-	resolvase	NA	NA	NA	NA	NA
AWN42692.1|4804151_4804358_-	hypothetical protein	NA	NA	NA	NA	NA
AWN42693.1|4804530_4804779_-	hypothetical protein	NA	NA	NA	NA	NA
AWN42694.1|4804934_4805636_+	RNA polymerase subunit sigma-70	NA	A0A076YQ50	Rhizobium_phage	29.6	7.4e-08
AWN42695.1|4805720_4805999_-	hypothetical protein	NA	NA	NA	NA	NA
AWN42696.1|4806270_4806480_-	hypothetical protein	NA	NA	NA	NA	NA
AWN42697.1|4806792_4807197_+	aldehyde-activating protein	NA	NA	NA	NA	NA
AWN44726.1|4807468_4808464_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWN42698.1|4808415_4809643_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	68.8	2.1e-103
AWN42699.1|4809831_4810077_-	hypothetical protein	NA	NA	NA	NA	NA
AWN42700.1|4810202_4810802_-	phasin	NA	NA	NA	NA	NA
AWN42701.1|4811507_4812233_+	hypothetical protein	NA	NA	NA	NA	NA
AWN42702.1|4813384_4813930_+	YciE/YciF family protein	NA	NA	NA	NA	NA
AWN42703.1|4814057_4815719_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
AWN42704.1|4815943_4816363_+	hypothetical protein	NA	NA	NA	NA	NA
AWN42705.1|4817021_4817210_+	hypothetical protein	NA	NA	NA	NA	NA
AWN42706.1|4817512_4819033_-	hypothetical protein	NA	NA	NA	NA	NA
AWN42707.1|4820201_4820492_+	hypothetical protein	NA	NA	NA	NA	NA
AWN42708.1|4820747_4820990_-	hypothetical protein	NA	NA	NA	NA	NA
AWN44727.1|4821464_4822673_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	47.2	6.4e-92
AWN42709.1|4822734_4822953_+	hypothetical protein	NA	NA	NA	NA	NA
AWN42710.1|4824197_4832261_+	hypothetical protein	NA	NA	NA	NA	NA
AWN42711.1|4832502_4833165_+	hypothetical protein	NA	NA	NA	NA	NA
AWN42712.1|4833458_4833722_+	hypothetical protein	NA	NA	NA	NA	NA
AWN42713.1|4834049_4835010_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	26.4	8.3e-10
AWN42714.1|4835003_4835450_-	hypothetical protein	NA	NA	NA	NA	NA
AWN42715.1|4836270_4836918_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AWN42716.1|4837360_4837561_+	hypothetical protein	NA	NA	NA	NA	NA
AWN42717.1|4837845_4838190_-	hypothetical protein	NA	NA	NA	NA	NA
AWN44728.1|4838457_4838943_-	photosystem reaction center subunit H	NA	NA	NA	NA	NA
AWN42718.1|4840398_4840659_+	hypothetical protein	NA	NA	NA	NA	NA
AWN42719.1|4841000_4841540_-	inorganic pyrophosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	31.5	2.9e-12
AWN42720.1|4841633_4842947_-	iron transporter	NA	NA	NA	NA	NA
AWN42721.1|4843056_4843704_-	hypothetical protein	NA	NA	NA	NA	NA
AWN42722.1|4843811_4844081_-	hypothetical protein	NA	NA	NA	NA	NA
AWN42723.1|4844221_4844395_+	CsbD family protein	NA	NA	NA	NA	NA
AWN42724.1|4844605_4845421_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
AWN42725.1|4846283_4847635_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 12
CP029550	Methylobacterium sp. 17SD2-17 chromosome, complete genome	6788375	4851869	4914695	6788375	transposase,integrase	Acidithiobacillus_phage(30.0%)	51	4846210:4846269	4907042:4908551
4846210:4846269	attL	TGTCCGTCGTCAGATGATTTGAGACGATCTGGGACGCTCAGGAACGGAGGCTCTGGTCCA	NA	NA	NA	NA
AWN42729.1|4851869_4853220_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWN42730.1|4853936_4854173_-	hypothetical protein	NA	NA	NA	NA	NA
AWN42731.1|4854246_4858803_-	hypothetical protein	NA	NA	NA	NA	NA
AWN42732.1|4859237_4859948_-	hypothetical protein	NA	NA	NA	NA	NA
AWN42733.1|4860215_4860497_-	hypothetical protein	NA	NA	NA	NA	NA
AWN42734.1|4860637_4861993_-	DNA methylase N-4	NA	K4HZA5	Acidithiobacillus_phage	41.9	4.3e-73
AWN42735.1|4862535_4863764_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	68.8	2.1e-103
AWN42736.1|4864665_4866963_-	formate dehydrogenase	NA	NA	NA	NA	NA
AWN42737.1|4868345_4868552_-	hypothetical protein	NA	NA	NA	NA	NA
AWN42738.1|4868610_4869474_-	transglutaminase	NA	NA	NA	NA	NA
AWN44729.1|4869703_4870048_+	response regulator	NA	NA	NA	NA	NA
AWN42739.1|4870418_4871672_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AWN42740.1|4871958_4872831_+	anti-anti-sigma factor	NA	NA	NA	NA	NA
AWN42741.1|4872835_4873237_+	anti-anti-sigma factor	NA	NA	NA	NA	NA
AWN44730.1|4873217_4873622_+	anti-sigma regulatory factor	NA	NA	NA	NA	NA
AWN42742.1|4873624_4874620_+	anti-sigma regulatory factor	NA	NA	NA	NA	NA
AWN42743.1|4876878_4878348_-	hypothetical protein	NA	A0A218MNA2	uncultured_virus	32.2	2.1e-52
AWN42744.1|4878359_4878710_-	hypothetical protein	NA	NA	NA	NA	NA
AWN42745.1|4878930_4879785_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AWN44731.1|4879807_4881265_-	DNA methylase N-4	NA	K4HZA5	Acidithiobacillus_phage	41.0	1.0e-72
AWN42746.1|4882199_4882745_+	hypothetical protein	NA	NA	NA	NA	NA
AWN42747.1|4882758_4883295_+	DUF2924 domain-containing protein	NA	NA	NA	NA	NA
AWN42748.1|4883294_4884854_+	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	51.8	3.5e-90
AWN42749.1|4885301_4886156_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AWN42750.1|4887444_4888242_+	hypothetical protein	NA	NA	NA	NA	NA
AWN42751.1|4889448_4889715_+	hypothetical protein	NA	NA	NA	NA	NA
AWN42752.1|4889771_4891106_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
AWN42753.1|4891248_4892568_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AWN44732.1|4893362_4893929_-	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	48.2	1.6e-21
AWN42754.1|4894092_4894359_+	hypothetical protein	NA	NA	NA	NA	NA
AWN42755.1|4894719_4895457_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AWN42756.1|4896098_4896644_+	response regulator	NA	NA	NA	NA	NA
AWN42757.1|4897047_4897617_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AWN42758.1|4897606_4898341_+	anti-sigma factor	NA	NA	NA	NA	NA
AWN42759.1|4898477_4898663_+	hypothetical protein	NA	NA	NA	NA	NA
AWN42760.1|4899001_4899376_+	hypothetical protein	NA	NA	NA	NA	NA
AWN42761.1|4900036_4901629_+	ABC transporter	NA	A0A1B0RXA0	Streptococcus_phage	27.5	1.4e-30
AWN44733.1|4901892_4903110_+	ABC transporter permease	NA	NA	NA	NA	NA
AWN44734.1|4903265_4903898_-|integrase	integrase	integrase	A0A0A8WF93	Clostridium_phage	30.6	1.0e-08
AWN42762.1|4905675_4907026_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWN42763.1|4907401_4907965_+	MucR family transcriptional regulator	NA	NA	NA	NA	NA
AWN42764.1|4908124_4908304_-	hypothetical protein	NA	NA	NA	NA	NA
AWN42765.1|4908584_4909286_-	serine/threonine protein phosphatase	NA	B4UTT5	Rhizobium_phage	55.2	1.8e-67
4907042:4908551	attR	TGGACCAGAGCCTCCGTTCCTGAGCGTCCCAGATCGTCTCAAATCATCTGACGACGGACACTATCGGAAAGCGATGAGGCTTTCAGGAACGACCGGCTTGGGCGCCAAGCGGAAGGTCTGCATATAGAAGGAACGAGCGCCCGTACCGAAGCAAGCGGCGAGAGCGAGCGGCAGCTCGATGATGATCAGAACCGGAGGCCTTTGGTCAGACCACAGAGAACGCCCCCCTGCGGTTACGCTGACGTTAAGCAGAGTAGAAAGATCAACTTATCTGTGGGAAAGCTCGCCATCTTGTCGGATTGCAATTGCCGATACGCAGCAGACGCGCAGGTATGGGCGAGAAGCAGAGAGGGCCTCATTGTGTCCGACACCGTTGAAGAAGCAAACAATAACCACATCGATCTGACGGTCGACATCGTCTCCGCCTACCTGTCCAACAATCACGCATCCGTGGCCGACCTTCCGAGGCTGATCGCGAGCGTGCATGCCGCCGTGTCAGGTCTGACCCACACCCCGGAGATCAGCGAGCCGCAGGTCAAGCTCAGCCCGGCGCAAATCAAGAAGTCGATCACGCAGGACGCGCTGATCAGCTTCGAGGATGACAAGCCCTACAAGACCTTGCGCCGCCATCTCTCGATCCGCGGCCTAACACCCGAGAGCTACCGGGAGAAGTGGGGCCTGCCGCACGACTATCCGATGGTGTCGGCCTCCTACTCGGAGGCGCGCTCCTCGCTCGCCAAGAGCCTCGGTCTCGGGCAACAACGCAAAAAGGCGGCGACGAAGGCCTCTACGTCGGCCGAGACGGTGAGCGCGCCGGCACCTGCCGTTGAGGCGCCGAAGGGCCGCGGCACCCGCAAGAAGGCTGCGGCTCCCGCCAAGCCGCGCACCCGGCGCAAGGCTGCCGAGCCTGCTCTCGCAGAGTAGGGCGCGGGGCCGGCACAGGTGAGGCTTGTGCCGGCACCTCCGACCTGAGAGCGAGCGTGCTGCGTCAGTCGCTGTCTGCAGCCGCGATTGAGAAGAGCGCTGCCAGCGCGAAGTTCCCGGCCACCAGGAGGGTGAGCAGGGTCAGCATCGTCGCTCGCCTCAAGCTGCGCAGGTCCGGATGACCGCGGCCCACTGCGGCGGGCACGCACGCGTCGACTTGGACATGCTCGAGTGTTTGGCGACCTGAGGCACGGCATACGCCGAGGTCAGTGCCGGCAGATGCGCCGTGCCGACCATGAGAACGCCGGAGATAATCAAGCGAAGAACGATATCGAGCATTGTCCTACCCCTCGTGCGGCCGTTGGTGGCCGTCTCTGAGCCAGGGCGTAGAAGCTTTGCCTTTCCTCGGTATTGCGTAGTTTGTTGCGTGGTTGGCCAAGCCTTCCCTCGGTCAACTCAGAGTGCGCAGCGCAGGCCAGAATCATCTCATCCGGCAGCGGCCTTTGCAGCTGCAGAGCCCTTTGATCGGTGCTTAGAGCCAGGTGCGCCAATCGTCCTCGGTGGTCAGCAGAACCGGCGTCGCCCT	NA	NA	NA	NA
AWN42766.1|4909772_4909988_-	hypothetical protein	NA	NA	NA	NA	NA
AWN42767.1|4910144_4910387_-	hypothetical protein	NA	NA	NA	NA	NA
AWN42768.1|4910583_4911036_-	anaerobic typically selenocysteine-containing protein	NA	NA	NA	NA	NA
AWN42769.1|4911410_4911611_-	hypothetical protein	NA	NA	NA	NA	NA
AWN42770.1|4912007_4912196_-	hypothetical protein	NA	NA	NA	NA	NA
AWN42771.1|4912463_4912781_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
AWN42772.1|4912905_4913265_+	hypothetical protein	NA	NA	NA	NA	NA
AWN42773.1|4913466_4914695_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	68.8	2.1e-103
>prophage 13
CP029550	Methylobacterium sp. 17SD2-17 chromosome, complete genome	6788375	4996883	5041745	6788375	transposase	Rhizobium_phage(20.0%)	45	NA	NA
AWN42846.1|4996883_4997918_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWN42847.1|4998333_5000871_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AWN42848.1|5001166_5001457_+	hypothetical protein	NA	NA	NA	NA	NA
AWN42849.1|5001559_5001805_-	hypothetical protein	NA	NA	NA	NA	NA
AWN42850.1|5002298_5003093_+	hypothetical protein	NA	NA	NA	NA	NA
AWN42851.1|5003358_5004060_-	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
AWN42852.1|5004486_5004903_-	hypothetical protein	NA	NA	NA	NA	NA
AWN42853.1|5004938_5005184_-	hypothetical protein	NA	NA	NA	NA	NA
AWN42854.1|5005468_5005696_-	hypothetical protein	NA	NA	NA	NA	NA
AWN44739.1|5006011_5006191_+	hypothetical protein	NA	NA	NA	NA	NA
AWN42855.1|5006448_5006700_-	hypothetical protein	NA	NA	NA	NA	NA
AWN42856.1|5007000_5007603_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
AWN42857.1|5007998_5008229_-	hypothetical protein	NA	NA	NA	NA	NA
AWN42858.1|5008530_5008779_-	hypothetical protein	NA	NA	NA	NA	NA
AWN44740.1|5008934_5009636_+	RNA polymerase subunit sigma-70	NA	A0A076YQ50	Rhizobium_phage	30.9	3.5e-10
AWN42859.1|5009722_5009959_-	hypothetical protein	NA	NA	NA	NA	NA
AWN42860.1|5010411_5010630_+	hypothetical protein	NA	NA	NA	NA	NA
AWN42861.1|5010636_5010843_+	hypothetical protein	NA	NA	NA	NA	NA
AWN42862.1|5010912_5011122_+	hypothetical protein	NA	NA	NA	NA	NA
AWN42863.1|5011427_5013050_+	thioredoxin-disulfide reductase	NA	A0A2K9L4X0	Tupanvirus	28.8	2.4e-25
AWN44741.1|5013339_5013804_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
AWN42864.1|5013820_5014501_+	methyltransferase	NA	H9YRL8	environmental_Halophage	29.3	1.0e-09
AWN42865.1|5014749_5015112_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
AWN42866.1|5016186_5017203_+	epimerase	NA	NA	NA	NA	NA
AWN42867.1|5017481_5017733_+	hypothetical protein	NA	NA	NA	NA	NA
AWN42868.1|5017998_5018628_-	hypothetical protein	NA	NA	NA	NA	NA
AWN42869.1|5018945_5019185_+	hypothetical protein	NA	NA	NA	NA	NA
AWN42870.1|5019785_5020352_+	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	44.6	8.0e-21
AWN42871.1|5020512_5020692_-	hypothetical protein	NA	NA	NA	NA	NA
AWN42872.1|5020825_5021029_+	hypothetical protein	NA	NA	NA	NA	NA
AWN44742.1|5021250_5022459_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	47.2	6.4e-92
AWN42873.1|5022751_5023084_-	hypothetical protein	NA	NA	NA	NA	NA
AWN42874.1|5023545_5023725_-	hypothetical protein	NA	NA	NA	NA	NA
AWN42875.1|5023862_5024126_-	hypothetical protein	NA	NA	NA	NA	NA
AWN42876.1|5024833_5025874_+	hypothetical protein	NA	NA	NA	NA	NA
AWN42877.1|5026503_5026923_-	transcriptional regulator	NA	NA	NA	NA	NA
AWN42878.1|5027026_5027797_+	oxidoreductase	NA	NA	NA	NA	NA
AWN42879.1|5030329_5030560_+	hypothetical protein	NA	NA	NA	NA	NA
AWN42880.1|5031388_5032006_-	hypothetical protein	NA	NA	NA	NA	NA
AWN44743.1|5033958_5034324_+	hypothetical protein	NA	NA	NA	NA	NA
AWN42881.1|5034245_5035238_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AWN42882.1|5036071_5037742_+	sodium-independent anion transporter	NA	NA	NA	NA	NA
AWN42883.1|5037838_5039158_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AWN42884.1|5039280_5040615_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
AWN42885.1|5040752_5041745_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 14
CP029550	Methylobacterium sp. 17SD2-17 chromosome, complete genome	6788375	5389178	5422284	6788375	portal,integrase,head,tail,capsid	Sinorhizobium_phage(23.53%)	43	5384892:5384907	5402506:5402521
5384892:5384907	attL	CGCCCTGCGGCGCGCG	NA	NA	NA	NA
AWN43127.1|5389178_5390270_-|integrase	integrase	integrase	K7PLZ2	Enterobacterial_phage	23.6	1.8e-05
AWN43128.1|5390266_5390503_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43129.1|5390772_5391024_+	pilus assembly protein PilZ	NA	NA	NA	NA	NA
AWN43130.1|5391081_5391330_+	pilus assembly protein PilZ	NA	NA	NA	NA	NA
AWN43131.1|5392157_5392751_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43132.1|5392747_5392963_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43133.1|5392966_5393404_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43134.1|5393403_5393835_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43135.1|5394559_5395396_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43136.1|5395369_5395591_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43137.1|5395587_5395785_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43138.1|5395784_5396213_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43139.1|5396637_5396934_+	hypothetical protein	NA	Q8W6G9	Sinorhizobium_phage	36.7	3.4e-07
AWN43140.1|5397752_5398556_+	oxidoreductase	NA	B4UTW5	Rhizobium_phage	36.5	1.5e-44
AWN43141.1|5398562_5399129_+	hypothetical protein	NA	A0A173H0W0	Pseudoalteromonas_phage	43.3	8.5e-23
AWN43142.1|5399219_5399750_+	Fis family transcriptional regulator	NA	A0A291AY26	Shigella_phage	37.1	1.3e-20
AWN43143.1|5399749_5400709_+	oxidoreductase	NA	B4UTX3	Rhizobium_phage	47.6	3.8e-79
AWN44784.1|5400732_5401344_+	methyltransferase	NA	A0A076GD02	Sinorhizobium_phage	54.6	2.8e-56
AWN43144.1|5401501_5403142_+	ATP-dependent helicase	NA	B4UTX6	Rhizobium_phage	43.0	9.2e-118
5402506:5402521	attR	CGCCCTGCGGCGCGCG	NA	NA	NA	NA
AWN43145.1|5403138_5403558_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43146.1|5403559_5404297_+	hypothetical protein	NA	A0A2H4JCU9	uncultured_Caudovirales_phage	30.6	3.4e-11
AWN43147.1|5404293_5406021_+	hypothetical protein	NA	A0A2I7S8Y8	Vibrio_phage	26.0	2.7e-11
AWN43148.1|5406153_5406339_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43149.1|5407398_5408130_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43150.1|5408301_5408556_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43151.1|5408689_5408920_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43152.1|5409046_5409415_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43153.1|5409688_5410207_+	hypothetical protein	NA	NA	NA	NA	NA
AWN44785.1|5410316_5410592_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43154.1|5410695_5410920_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43155.1|5410981_5411218_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43156.1|5411705_5412326_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43157.1|5412273_5414376_+	hypothetical protein	NA	G8EXZ6	Synechococcus_phage	35.3	7.2e-91
AWN43158.1|5414390_5414663_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43159.1|5414662_5416309_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	33.4	2.5e-62
AWN43160.1|5416321_5417578_+	peptidase S49	NA	A0A248XD65	Klebsiella_phage	47.6	2.8e-90
AWN43161.1|5417580_5417949_+|head	head decoration protein	head	A0A291AUM0	Sinorhizobium_phage	48.1	2.3e-16
AWN43162.1|5417955_5418987_+|capsid	capsid protein	capsid	Q6UYI3	Burkholderia_phage	35.7	2.4e-47
AWN43163.1|5419346_5419622_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43164.1|5419618_5420161_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43165.1|5420184_5420397_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43166.1|5420403_5421912_+|tail	phage tail protein	tail	S5FKL0	Shigella_phage	37.9	2.5e-77
AWN43167.1|5421924_5422284_+|tail	phage tail protein	tail	Q8W622	Enterobacteria_phage	36.3	1.2e-11
>prophage 15
CP029550	Methylobacterium sp. 17SD2-17 chromosome, complete genome	6788375	5425436	5456416	6788375	plate,tail,transposase	Pseudomonas_phage(15.38%)	39	NA	NA
AWN43170.1|5425436_5425958_+	hypothetical protein	NA	B5TK71	Pseudomonas_phage	39.5	1.9e-16
AWN43171.1|5425957_5426629_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43172.1|5426632_5427757_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43173.1|5427753_5428368_+	hypothetical protein	NA	A0A0C4UQZ3	Shigella_phage	30.5	2.4e-10
AWN44786.1|5428376_5428856_+|tail	phage tail protein	tail	S5FNR6	Shigella_phage	38.2	2.3e-13
AWN43174.1|5428859_5429945_+|plate	baseplate J protein	plate	F6MIL6	Haemophilus_phage	32.7	2.7e-25
AWN43175.1|5429937_5430768_+	hypothetical protein	NA	F6MIL7	Haemophilus_phage	33.7	1.1e-05
AWN43176.1|5430843_5431839_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43177.1|5431871_5432339_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43178.1|5432353_5432899_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43179.1|5432903_5433266_+	hypothetical protein	NA	A0A1B1IQ35	uncultured_Mediterranean_phage	45.6	1.4e-07
AWN43180.1|5433276_5434497_+	hypothetical protein	NA	A0A0K0N6P9	Gordonia_phage	41.1	5.0e-36
AWN43181.1|5434496_5435135_+	hypothetical protein	NA	A0A1B1ITV0	uncultured_Mediterranean_phage	44.4	5.1e-08
AWN43182.1|5435166_5435358_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43183.1|5435395_5436235_+	peptidoglycan-binding protein	NA	A0A0A8IK88	Aurantimonas_phage	64.3	1.6e-65
AWN43184.1|5436456_5436960_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43185.1|5437121_5437439_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43186.1|5437435_5437891_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43187.1|5437887_5438130_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43188.1|5438923_5440723_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43189.1|5441132_5441336_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43190.1|5441920_5443157_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	49.8	3.7e-63
AWN43191.1|5443348_5443822_+	SRPBCC family protein	NA	NA	NA	NA	NA
AWN43192.1|5443900_5444164_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43193.1|5444326_5444581_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43194.1|5444653_5445121_-	MucR family transcriptional regulator	NA	NA	NA	NA	NA
AWN43195.1|5445714_5446809_+	hemolysin	NA	NA	NA	NA	NA
AWN43196.1|5446948_5447716_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AWN43197.1|5448397_5448853_+	peptidase S24	NA	A0A2H4J538	uncultured_Caudovirales_phage	41.7	1.3e-18
AWN43198.1|5448849_5450139_+	DNA polymerase V subunit UmuC	NA	A0A1W6JNT0	Morganella_phage	43.0	1.6e-80
AWN43199.1|5450325_5450724_+	exopolysaccharide production protein YjbE	NA	NA	NA	NA	NA
AWN43200.1|5450964_5451237_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43201.1|5451401_5451674_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43202.1|5451979_5452198_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43203.1|5452236_5452437_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43204.1|5452558_5453618_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AWN43205.1|5454275_5454545_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43206.1|5454808_5455207_+	exopolysaccharide production protein YjbE	NA	NA	NA	NA	NA
AWN43207.1|5455253_5456416_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	35.5	1.9e-37
>prophage 16
CP029550	Methylobacterium sp. 17SD2-17 chromosome, complete genome	6788375	5720258	5766321	6788375	transposase,integrase	EBPR_podovirus(16.67%)	43	5701858:5701875	5761100:5761117
5701858:5701875	attL	GCCGTTCGCCCGCCAGGG	NA	NA	NA	NA
AWN43431.1|5720258_5721308_-|integrase	integrase	integrase	F8TUV0	EBPR_podovirus	59.8	1.9e-116
AWN43432.1|5721297_5721486_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43433.1|5721485_5722196_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43434.1|5722630_5722876_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43435.1|5723068_5724442_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AWN43436.1|5724763_5726818_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
AWN43437.1|5726817_5728344_-	circadian clock protein KaiC	NA	NA	NA	NA	NA
AWN43438.1|5729631_5730630_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AWN43439.1|5731336_5732041_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43440.1|5732178_5733171_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AWN43441.1|5733200_5734085_-	glutamine amidotransferase	NA	NA	NA	NA	NA
AWN43442.1|5734100_5734343_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43443.1|5734511_5734955_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43444.1|5734979_5735975_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2I2L5E1	Orpheovirus	28.3	1.7e-18
AWN43445.1|5736254_5736443_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43446.1|5736444_5736699_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43447.1|5736870_5737344_-	DUF3597 domain-containing protein	NA	NA	NA	NA	NA
AWN43448.1|5737506_5738442_+	histidine kinase	NA	NA	NA	NA	NA
AWN43449.1|5738814_5739024_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	56.9	1.2e-11
AWN43450.1|5739771_5740206_-	DUF1810 domain-containing protein	NA	A0A2H4UVK5	Bodo_saltans_virus	38.6	3.6e-13
AWN43451.1|5740626_5741304_-	phosphohydrolase	NA	NA	NA	NA	NA
AWN43452.1|5741427_5742411_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWN43453.1|5742614_5743625_+	cobalamin biosynthesis protein CobW	NA	NA	NA	NA	NA
AWN43454.1|5743674_5744409_+	nitrile hydratase subunit beta	NA	NA	NA	NA	NA
AWN43455.1|5744422_5745046_+	nitrile hydratase subunit alpha	NA	NA	NA	NA	NA
AWN43456.1|5745055_5745367_+	nitrile hydratase accessory protein	NA	NA	NA	NA	NA
AWN44806.1|5745950_5746172_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43457.1|5746398_5747136_+	3-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
AWN43458.1|5747197_5748100_+	oxidoreductase	NA	NA	NA	NA	NA
AWN43459.1|5748520_5748706_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43460.1|5748790_5749510_-	arginase	NA	NA	NA	NA	NA
AWN43461.1|5749487_5750548_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AWN43462.1|5754270_5754909_-	phosphohydrolase	NA	NA	NA	NA	NA
AWN43463.1|5755037_5755892_-	hypothetical protein	NA	NA	NA	NA	NA
AWN44807.1|5756370_5757579_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	47.2	6.4e-92
AWN43464.1|5757672_5758422_-	alpha/beta hydrolase	NA	H9NCP0	Mycobacterium_phage	25.4	1.6e-05
AWN43465.1|5758418_5759696_-	multidrug transporter CflA	NA	NA	NA	NA	NA
AWN43466.1|5759692_5760967_-	glycosyl transferase family 28	NA	NA	NA	NA	NA
AWN44808.1|5761129_5762116_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
5761100:5761117	attR	CCCTGGCGGGCGAACGGC	NA	NA	NA	NA
AWN44809.1|5762507_5763149_+	phosphohydrolase	NA	NA	NA	NA	NA
AWN44810.1|5763432_5763885_+	hypothetical protein	NA	NA	NA	NA	NA
AWN44811.1|5763972_5764908_+	quinone oxidoreductase	NA	NA	NA	NA	NA
AWN43467.1|5765564_5766321_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 17
CP029550	Methylobacterium sp. 17SD2-17 chromosome, complete genome	6788375	5881379	5918235	6788375	transposase	Enterobacteria_phage(50.0%)	32	NA	NA
AWN44823.1|5881379_5882588_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	47.5	1.3e-92
AWN43551.1|5883049_5883502_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43552.1|5883758_5885110_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWN43553.1|5885480_5885957_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43554.1|5886102_5887476_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AWN43555.1|5888837_5889894_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AWN43556.1|5889946_5890426_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43557.1|5890502_5890934_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43558.1|5891147_5892392_-	MFS transporter	NA	NA	NA	NA	NA
AWN44824.1|5893328_5893811_+	heat-shock protein	NA	E3SM62	Prochlorococcus_phage	40.3	3.7e-19
AWN44825.1|5893923_5894412_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43559.1|5894633_5894864_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43560.1|5895047_5895944_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AWN43561.1|5896059_5898030_-	guanylate cyclase	NA	NA	NA	NA	NA
AWN43562.1|5898169_5898733_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43563.1|5898760_5898973_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43564.1|5899511_5899757_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43565.1|5900029_5900281_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43566.1|5900497_5900923_+	MucR family transcriptional regulator	NA	NA	NA	NA	NA
AWN44826.1|5901004_5901292_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43567.1|5902716_5904180_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43568.1|5904690_5905542_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43569.1|5906046_5907180_-	aminomethyltransferase	NA	NA	NA	NA	NA
AWN43570.1|5907311_5907695_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43571.1|5907819_5909571_-	amino acid permease	NA	NA	NA	NA	NA
AWN43572.1|5910258_5911610_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWN43573.1|5912938_5913187_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43574.1|5913634_5914657_-	putative 2-aminoethylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWN43575.1|5914653_5914911_-	transcriptional regulator	NA	NA	NA	NA	NA
AWN43576.1|5915179_5915875_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43577.1|5915977_5916847_-	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	46.3	1.1e-50
AWN43578.1|5916843_5918235_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	34.1	4.8e-43
>prophage 18
CP029550	Methylobacterium sp. 17SD2-17 chromosome, complete genome	6788375	6102019	6216467	6788375	tRNA,transposase,integrase	Indivirus(20.0%)	99	6164529:6164573	6215058:6215102
AWN43754.1|6102019_6103370_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWN43755.1|6106097_6106460_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43756.1|6106503_6106704_+	hypothetical protein	NA	NA	NA	NA	NA
AWN44843.1|6106745_6107012_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43757.1|6107440_6107662_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43758.1|6108241_6108451_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43759.1|6108557_6110975_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
AWN43760.1|6112701_6113241_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43761.1|6113339_6114284_+	pseudouridine-5-phosphate glycosidase	NA	NA	NA	NA	NA
AWN43762.1|6114306_6114456_-	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
AWN43763.1|6115011_6115335_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43764.1|6116037_6117295_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	53.2	3.0e-76
AWN44844.1|6117767_6118976_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	47.2	1.1e-91
AWN43765.1|6120493_6121828_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
AWN43766.1|6121888_6122242_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43767.1|6122838_6123180_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43768.1|6123398_6123608_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43769.1|6123741_6124104_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43770.1|6124252_6124468_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43771.1|6124709_6124916_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43772.1|6125442_6125661_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43773.1|6125868_6126105_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43774.1|6126612_6127677_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43775.1|6127919_6128255_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43776.1|6128322_6128547_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43777.1|6128634_6128892_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43778.1|6129049_6130444_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
AWN43779.1|6130940_6131156_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43780.1|6133382_6133640_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43781.1|6133885_6135685_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43782.1|6136732_6137029_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43783.1|6137068_6138030_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	26.4	8.3e-10
AWN43784.1|6138042_6140178_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43785.1|6142052_6142241_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43786.1|6142638_6142839_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43787.1|6143287_6143875_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43788.1|6143895_6144249_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43789.1|6144461_6144830_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43790.1|6144953_6145915_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	26.4	8.3e-10
AWN43791.1|6145998_6146229_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43792.1|6146489_6146717_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43793.1|6146879_6147840_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	24.4	1.8e-09
AWN43794.1|6147936_6149598_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
AWN43795.1|6149662_6149875_+	hypothetical protein	NA	NA	NA	NA	NA
AWN44845.1|6150256_6150532_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43796.1|6151047_6151335_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43797.1|6151595_6152384_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43798.1|6152394_6153057_-	FkbM family methyltransferase	NA	NA	NA	NA	NA
AWN43799.1|6153165_6154038_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43800.1|6154080_6154782_-	serine/threonine protein phosphatase	NA	B4UTT5	Rhizobium_phage	55.7	9.1e-67
AWN43801.1|6154986_6155298_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43802.1|6155442_6156240_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43803.1|6156241_6156538_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43804.1|6157380_6157836_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43805.1|6157839_6158022_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43806.1|6158113_6158455_+	hypothetical protein	NA	NA	NA	NA	NA
AWN44846.1|6158804_6159065_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43807.1|6159313_6159568_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43808.1|6159741_6160098_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43809.1|6160470_6161748_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
AWN43810.1|6162004_6162241_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43811.1|6162877_6163213_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43812.1|6163172_6164441_+|integrase	integrase	integrase	F8TUV0	EBPR_podovirus	27.9	1.6e-21
6164529:6164573	attL	TGGTGAGCGCGCTGGGACTCGAACCCAGGACCTACAGATTAAAAG	NA	NA	NA	NA
AWN43813.1|6164731_6165880_+|integrase	integrase	integrase	A0A221SAN4	Ralstonia_phage	37.4	8.9e-43
AWN43814.1|6166390_6166807_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43815.1|6167600_6168839_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43816.1|6169038_6169698_+	serine/threonine protein phosphatase	NA	V9QL63	Rhizobium_phage	40.9	1.7e-38
AWN43817.1|6170490_6173232_+	ATPase	NA	Q8QNA6	Ectocarpus_siliculosus_virus	27.2	2.6e-16
AWN43818.1|6173231_6174965_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	19.8	3.8e-05
AWN43819.1|6175542_6179133_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43820.1|6179702_6179957_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43821.1|6180111_6181926_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43822.1|6181927_6182599_+	3'-5' exonuclease	NA	NA	NA	NA	NA
AWN43823.1|6182868_6183234_-	DUF485 domain-containing protein	NA	NA	NA	NA	NA
AWN43824.1|6183675_6184736_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AWN43825.1|6184845_6185988_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43826.1|6186100_6186409_+	hypothetical protein	NA	NA	NA	NA	NA
AWN44847.1|6186468_6187401_+|integrase	integrase	integrase	NA	NA	NA	NA
AWN43827.1|6187666_6188701_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWN43828.1|6189944_6190235_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43829.1|6190341_6191430_-	hypothetical protein	NA	NA	NA	NA	NA
AWN44848.1|6192068_6193157_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AWN43830.1|6193339_6193588_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43831.1|6193594_6193795_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43832.1|6194064_6194307_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43833.1|6194443_6195208_-	cyclic nucleotide-binding protein	NA	NA	NA	NA	NA
AWN43834.1|6195944_6196763_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AWN43835.1|6197449_6198259_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AWN43836.1|6198576_6199381_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AWN43837.1|6199446_6200700_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AWN44849.1|6202795_6203038_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43838.1|6203955_6204312_+	hypothetical protein	NA	NA	NA	NA	NA
AWN43839.1|6205096_6206044_-|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	31.0	2.7e-21
AWN43840.1|6206305_6207298_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AWN43841.1|6207921_6208308_+	ATP F0F1 synthase subunit I	NA	NA	NA	NA	NA
AWN43842.1|6208731_6210015_-	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	9.9e-27
AWN43843.1|6210568_6210991_-	hypothetical protein	NA	NA	NA	NA	NA
AWN43844.1|6213344_6214446_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.2	2.2e-51
AWN43845.1|6215285_6216467_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	53.1	9.9e-98
6215058:6215102	attR	TGGTGAGCGCGCTGGGACTCGAACCCAGGACCTACAGATTAAAAG	NA	NA	NA	NA
>prophage 19
CP029550	Methylobacterium sp. 17SD2-17 chromosome, complete genome	6788375	6445112	6510665	6788375	transposase,integrase	Enterobacteria_phage(25.0%)	58	6443791:6443806	6486662:6486677
6443791:6443806	attL	GGCCGTGCCGTGGCGC	NA	NA	NA	NA
AWN44881.1|6445112_6446303_+|integrase	integrase	integrase	NA	NA	NA	NA
AWN44001.1|6446814_6447087_+	hypothetical protein	NA	NA	NA	NA	NA
AWN44002.1|6447159_6449241_+	hypothetical protein	NA	A0A1B2LRQ1	Wolbachia_phage	27.1	3.5e-21
AWN44003.1|6449628_6450201_+	hypothetical protein	NA	NA	NA	NA	NA
AWN44004.1|6450957_6451626_+	hypothetical protein	NA	NA	NA	NA	NA
AWN44882.1|6452332_6452593_+	hypothetical protein	NA	NA	NA	NA	NA
AWN44005.1|6452887_6454239_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWN44006.1|6454409_6454661_-	hypothetical protein	NA	NA	NA	NA	NA
AWN44007.1|6454789_6454993_+	hypothetical protein	NA	NA	NA	NA	NA
AWN44008.1|6455503_6456505_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AWN44009.1|6456573_6457714_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.0	3.6e-36
AWN44010.1|6457745_6458579_-	hypothetical protein	NA	NA	NA	NA	NA
AWN44011.1|6458905_6459289_+	hypothetical protein	NA	NA	NA	NA	NA
AWN44012.1|6459297_6459852_-	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	49.6	8.1e-26
AWN44013.1|6460507_6461233_-	hypothetical protein	NA	NA	NA	NA	NA
AWN44014.1|6461950_6462244_+	hypothetical protein	NA	NA	NA	NA	NA
AWN44015.1|6462438_6462663_-	hypothetical protein	NA	NA	NA	NA	NA
AWN44016.1|6462828_6463989_-	AI-2E family transporter	NA	NA	NA	NA	NA
AWN44017.1|6464789_6467024_+	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	32.1	6.1e-48
AWN44018.1|6467116_6467464_+	hypothetical protein	NA	NA	NA	NA	NA
AWN44019.1|6467692_6468259_+	hypothetical protein	NA	NA	NA	NA	NA
AWN44020.1|6468323_6468872_+	MucR family transcriptional regulator	NA	NA	NA	NA	NA
AWN44021.1|6469189_6471157_+	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
AWN44022.1|6471420_6473106_-	histidine kinase	NA	NA	NA	NA	NA
AWN44023.1|6473911_6474361_+	VrrB protein	NA	NA	NA	NA	NA
AWN44883.1|6475611_6476070_-	MgtC/SapB family transporter	NA	G3MA03	Bacillus_virus	36.2	6.5e-13
AWN44884.1|6476112_6477279_-	porin	NA	NA	NA	NA	NA
AWN44024.1|6477700_6479074_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AWN44025.1|6479562_6479874_-	sulfite:cytochrome C oxidoreductase subunit B	NA	NA	NA	NA	NA
AWN44885.1|6479886_6481092_-	oxidase	NA	NA	NA	NA	NA
AWN44886.1|6481158_6482313_-	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
AWN44887.1|6482417_6483329_-	succinyl-CoA synthetase subunit alpha	NA	NA	NA	NA	NA
AWN44026.1|6483328_6484456_-	succinate--CoA ligase	NA	NA	NA	NA	NA
AWN44027.1|6484452_6485937_-	sulfoacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
AWN44028.1|6486013_6487321_-	MFS transporter	NA	NA	NA	NA	NA
6486662:6486677	attR	GCGCCACGGCACGGCC	NA	NA	NA	NA
AWN44029.1|6487559_6488426_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWN44030.1|6488996_6490775_-	sulfoacetaldehyde acetyltransferase	NA	NA	NA	NA	NA
AWN44031.1|6491004_6491766_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AWN44888.1|6491795_6492743_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
AWN44032.1|6493471_6493669_+	hypothetical protein	NA	NA	NA	NA	NA
AWN44033.1|6494106_6495099_-	catalase	NA	NA	NA	NA	NA
AWN44034.1|6495732_6496767_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWN44035.1|6497751_6498003_+	hypothetical protein	NA	NA	NA	NA	NA
AWN44036.1|6498100_6498604_-	chromosome condensation protein CrcB	NA	NA	NA	NA	NA
AWN44037.1|6498665_6499499_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
AWN44038.1|6499657_6500587_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWN44039.1|6500720_6501224_+	cupin	NA	NA	NA	NA	NA
AWN44040.1|6501251_6502478_+	MFS transporter	NA	NA	NA	NA	NA
AWN44041.1|6502515_6503715_+	patatin	NA	NA	NA	NA	NA
AWN44042.1|6503921_6504188_+	hypothetical protein	NA	NA	NA	NA	NA
AWN44043.1|6504646_6505405_-	hypothetical protein	NA	NA	NA	NA	NA
AWN44044.1|6505538_6505907_-	septal ring lytic transglycosylase RlpA family lipoprotein	NA	F5B3X9	Synechococcus_phage	69.0	1.6e-25
AWN44045.1|6506159_6506393_+	hypothetical protein	NA	NA	NA	NA	NA
AWN44046.1|6506437_6506980_+	hypothetical protein	NA	NA	NA	NA	NA
AWN44047.1|6507138_6507390_+	hypothetical protein	NA	NA	NA	NA	NA
AWN44048.1|6507660_6507957_+	hypothetical protein	NA	NA	NA	NA	NA
AWN44049.1|6508407_6509277_-	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	46.7	1.1e-50
AWN44050.1|6509273_6510665_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	34.3	7.4e-44
