The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029551	Methylobacterium sp. 17Sr1-43 chromosome, complete genome	5539695	1124267	1196581	5539695	transposase,protease,tail,head,capsid	Bacillus_phage(20.0%)	59	NA	NA
AWN35173.1|1124267_1125222_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	21.3	3.1e-09
AWN35174.1|1126608_1126854_-	hypothetical protein	NA	NA	NA	NA	NA
AWN35175.1|1126937_1128275_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	23.1	1.2e-06
AWN35176.1|1128271_1128991_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AWN35177.1|1129734_1131396_-	porin	NA	NA	NA	NA	NA
AWN35178.1|1132408_1132831_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AWN35179.1|1132896_1135098_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	39.3	4.7e-125
AWN35180.1|1135321_1135792_+	MucR family transcriptional regulator	NA	NA	NA	NA	NA
AWN38854.1|1139310_1139775_-	magnesium transporter MgtC	NA	NA	NA	NA	NA
AWN38855.1|1141322_1141532_+	hypothetical protein	NA	NA	NA	NA	NA
AWN35181.1|1141643_1141979_+	hypothetical protein	NA	NA	NA	NA	NA
AWN35182.1|1142076_1142355_+	hypothetical protein	NA	NA	NA	NA	NA
AWN35183.1|1142397_1142664_-	transcriptional regulator	NA	NA	NA	NA	NA
AWN35184.1|1144490_1146806_-	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	41.4	1.7e-80
AWN35185.1|1146878_1147163_-	hypothetical protein	NA	NA	NA	NA	NA
AWN35186.1|1147745_1148432_-	hypothetical protein	NA	NA	NA	NA	NA
AWN35187.1|1149911_1150178_-	hypothetical protein	NA	NA	NA	NA	NA
AWN35188.1|1150177_1150387_-	hypothetical protein	NA	NA	NA	NA	NA
AWN35189.1|1150513_1150777_+	hypothetical protein	NA	NA	NA	NA	NA
AWN35190.1|1150806_1151001_+	hypothetical protein	NA	NA	NA	NA	NA
AWN35191.1|1151052_1151268_+	hypothetical protein	NA	NA	NA	NA	NA
AWN35192.1|1151847_1152255_+	hypothetical protein	NA	NA	NA	NA	NA
AWN35193.1|1154146_1156867_+	hybrid sensor histidine kinase/response regulator	NA	W8CYM9	Bacillus_phage	33.6	1.9e-06
AWN35194.1|1157383_1157512_-	hypothetical protein	NA	NA	NA	NA	NA
AWN35195.1|1157488_1157917_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	51.1	2.2e-15
AWN38856.1|1158124_1159324_-	serine hydrolase	NA	NA	NA	NA	NA
AWN35196.1|1159406_1160609_-	serine hydrolase	NA	G1BSP8	Mycobacterium_virus	27.3	1.3e-07
AWN35197.1|1160748_1162149_-	dihydropyrimidinase	NA	NA	NA	NA	NA
AWN35198.1|1162196_1162943_-	Asp/Glu/hydantoin racemase	NA	NA	NA	NA	NA
AWN38857.1|1162954_1163716_-	Asp/Glu/hydantoin racemase	NA	NA	NA	NA	NA
AWN35199.1|1163774_1165070_-	MFS transporter	NA	NA	NA	NA	NA
AWN35200.1|1165389_1166136_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWN35201.1|1167448_1168765_-	hypothetical protein	NA	NA	NA	NA	NA
AWN35202.1|1168683_1168881_-	hypothetical protein	NA	NA	NA	NA	NA
AWN35203.1|1169588_1170515_-	universal stress protein	NA	NA	NA	NA	NA
AWN35204.1|1170554_1170758_-	hypothetical protein	NA	NA	NA	NA	NA
AWN35205.1|1171437_1171926_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
AWN38858.1|1171928_1172624_+	anti-sigma factor	NA	NA	NA	NA	NA
AWN38859.1|1172869_1174081_+	oxidase	NA	NA	NA	NA	NA
AWN35206.1|1174092_1174416_+	sulfite:cytochrome C oxidoreductase subunit B	NA	NA	NA	NA	NA
AWN35207.1|1174720_1176037_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AWN35208.1|1176033_1176696_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AWN35209.1|1176803_1178558_+	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AWN35210.1|1178597_1179233_+	disulfide bond formation protein DsbA	NA	NA	NA	NA	NA
AWN35211.1|1179229_1180129_+	L,D-transpeptidase	NA	NA	NA	NA	NA
AWN35212.1|1180300_1180576_+	SinR	NA	A0A0N9STP5	Staphylococcus_phage	37.8	2.4e-10
AWN35213.1|1181227_1181920_-	hypothetical protein	NA	NA	NA	NA	NA
AWN35214.1|1181932_1182862_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AWN38860.1|1183754_1186490_-	hypothetical protein	NA	NA	NA	NA	NA
AWN35215.1|1186764_1187349_+	hypothetical protein	NA	NA	NA	NA	NA
AWN35216.1|1187598_1188255_+	hypothetical protein	NA	NA	NA	NA	NA
AWN35217.1|1190699_1191113_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
AWN35218.1|1191106_1191460_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
AWN35219.1|1191476_1192040_-	hypothetical protein	NA	NA	NA	NA	NA
AWN35220.1|1192080_1192827_+	peptidase S1	NA	NA	NA	NA	NA
AWN35221.1|1192920_1193784_+	peptidase S1	NA	NA	NA	NA	NA
AWN35222.1|1194259_1194799_+	diguanylate cyclase	NA	NA	NA	NA	NA
AWN35223.1|1194818_1196081_-|capsid	phage major capsid protein	capsid	Q3HQT0	Burkholderia_phage	40.6	2.6e-72
AWN38861.1|1196077_1196581_-|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	41.7	4.3e-26
>prophage 2
CP029551	Methylobacterium sp. 17Sr1-43 chromosome, complete genome	5539695	1743546	1772656	5539695	tail,transposase,integrase,protease	Pseudomonas_phage(14.29%)	34	1750143:1750188	1773230:1773275
AWN35675.1|1743546_1744359_+|integrase	integrase	integrase	H2BDA3	Pseudomonas_phage	24.9	1.6e-14
AWN35676.1|1744594_1745735_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.4	1.2e-36
AWN35677.1|1745766_1746045_-	hypothetical protein	NA	NA	NA	NA	NA
AWN35678.1|1746408_1746993_-	hypothetical protein	NA	NA	NA	NA	NA
AWN35679.1|1747666_1748272_+|integrase	integrase	integrase	A0A219Y9V9	Aeromonas_phage	44.1	1.0e-29
AWN35680.1|1748764_1749088_+	hypothetical protein	NA	NA	NA	NA	NA
1750143:1750188	attL	TTGGTGGGCGCACTAGGGTTCGAACCTAGGACCCGCTGATTAAGAG	NA	NA	NA	NA
AWN35681.1|1750362_1750731_+	hypothetical protein	NA	NA	NA	NA	NA
AWN35682.1|1750730_1751033_+	hypothetical protein	NA	NA	NA	NA	NA
AWN35683.1|1751814_1752402_+|protease	metalloprotease	protease	NA	NA	NA	NA
AWN35684.1|1752433_1752859_+	hypothetical protein	NA	NA	NA	NA	NA
AWN35685.1|1753020_1753638_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
AWN38907.1|1753826_1754135_+	hypothetical protein	NA	NA	NA	NA	NA
AWN35686.1|1754203_1757164_-	hypothetical protein	NA	NA	NA	NA	NA
AWN35687.1|1758358_1759576_-	flagellar hook protein FlgE	NA	NA	NA	NA	NA
AWN35688.1|1759722_1759986_+	hypothetical protein	NA	NA	NA	NA	NA
AWN35689.1|1759994_1760204_+	hypothetical protein	NA	NA	NA	NA	NA
AWN35690.1|1760200_1760410_+	hypothetical protein	NA	NA	NA	NA	NA
AWN35691.1|1760497_1760941_+	hypothetical protein	NA	NA	NA	NA	NA
AWN35692.1|1760961_1762251_-	DNA polymerase V subunit UmuC	NA	A0A1W6JNT0	Morganella_phage	42.4	3.9e-79
AWN35693.1|1762247_1762703_-	peptidase S24	NA	A0A2H4J538	uncultured_Caudovirales_phage	34.7	2.1e-19
AWN35694.1|1762827_1763076_+	hypothetical protein	NA	NA	NA	NA	NA
AWN35695.1|1763091_1763343_+	hypothetical protein	NA	NA	NA	NA	NA
AWN35696.1|1763634_1765179_-	hypothetical protein	NA	NA	NA	NA	NA
AWN35697.1|1765700_1766048_+	hypothetical protein	NA	NA	NA	NA	NA
AWN35698.1|1766168_1766636_-	hypothetical protein	NA	NA	NA	NA	NA
AWN35699.1|1766625_1767222_-	hypothetical protein	NA	NA	NA	NA	NA
AWN35700.1|1767346_1767745_-	hypothetical protein	NA	NA	NA	NA	NA
AWN35701.1|1767748_1768528_-	hypothetical protein	NA	R9U4A9	Rhizobium_phage	50.2	4.6e-43
AWN35702.1|1768614_1769676_-	hypothetical protein	NA	R4JDM6	Burkholderia_phage	24.0	4.5e-09
AWN38908.1|1769680_1769905_-|tail	phage tail protein	tail	NA	NA	NA	NA
AWN35703.1|1770019_1770448_+	HNH endonuclease	NA	NA	NA	NA	NA
AWN35704.1|1770462_1770783_-	hypothetical protein	NA	NA	NA	NA	NA
AWN35705.1|1771001_1771541_+	hypothetical protein	NA	NA	NA	NA	NA
AWN35706.1|1771474_1772656_+|integrase	integrase	integrase	NA	NA	NA	NA
1773230:1773275	attR	TTGGTGGGCGCACTAGGGTTCGAACCTAGGACCCGCTGATTAAGAG	NA	NA	NA	NA
>prophage 3
CP029551	Methylobacterium sp. 17Sr1-43 chromosome, complete genome	5539695	2881740	2887914	5539695		uncultured_Caudovirales_phage(50.0%)	10	NA	NA
AWN36601.1|2881740_2882571_+	metallophosphoesterase	NA	A0A076YQ07	Rhizobium_phage	37.0	2.5e-31
AWN38994.1|2882591_2882888_+	hypothetical protein	NA	NA	NA	NA	NA
AWN36602.1|2882976_2883165_-	hypothetical protein	NA	NA	NA	NA	NA
AWN36603.1|2883164_2884211_-	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	37.6	1.9e-60
AWN36604.1|2884203_2884659_-	hypothetical protein	NA	G9L674	Escherichia_phage	40.0	4.4e-22
AWN36605.1|2885024_2885690_+	hypothetical protein	NA	NA	NA	NA	NA
AWN36606.1|2885812_2886559_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	63.9	1.2e-80
AWN36607.1|2886609_2886969_+	transcriptional regulator	NA	NA	NA	NA	NA
AWN36608.1|2886961_2887489_+	ArsR family transcriptional regulator	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	44.6	1.1e-27
AWN36609.1|2887488_2887914_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	66.4	5.8e-48
>prophage 4
CP029551	Methylobacterium sp. 17Sr1-43 chromosome, complete genome	5539695	5441025	5450384	5539695		uncultured_Mediterranean_phage(50.0%)	12	NA	NA
AWN38663.1|5441025_5441484_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	52.8	5.4e-36
AWN38664.1|5441578_5442001_-	hypothetical protein	NA	NA	NA	NA	NA
AWN38665.1|5442050_5442599_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	50.9	1.4e-33
AWN38666.1|5442643_5443147_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	32.5	3.2e-21
AWN38667.1|5443371_5443752_+	hypothetical protein	NA	NA	NA	NA	NA
AWN38668.1|5444045_5446766_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	31.7	3.8e-100
AWN38669.1|5446899_5447196_-	hypothetical protein	NA	NA	NA	NA	NA
AWN38670.1|5447239_5447911_-	trna delta -isopentenylpyrophosphate transferase	NA	A0A1X9SGU5	Bradyrhizobium_phage	38.1	8.0e-28
AWN39237.1|5448089_5448356_-	hypothetical protein	NA	NA	NA	NA	NA
AWN38671.1|5448643_5449261_+	hypothetical protein	NA	NA	NA	NA	NA
AWN38672.1|5449247_5449610_+	transcriptional regulator	NA	NA	NA	NA	NA
AWN38673.1|5449658_5450384_+	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	35.1	8.7e-12
