The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028381	Escherichia coli strain RM10466 chromosome, complete genome	5044460	198505	260693	5044460	transposase,plate,tRNA,protease	Emiliania_huxleyi_virus(12.5%)	54	NA	NA
AWN67328.1|198505_199858_+|protease	zinc metalloprotease RseP	protease	NA	NA	NA	NA
AWN67329.1|199887_202320_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
AWN67330.1|202441_202927_+	chaperone protein Skp	NA	NA	NA	NA	NA
AWN67331.1|202930_203956_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AWN67332.1|204060_204516_+	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
AWN67333.1|204519_205308_+	acyl-[acyl-carrier-protein]--UDP-N- acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
AWN67334.1|205307_206456_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
AWN67335.1|206452_207049_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
AWN67336.1|207085_210568_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
AWN67337.1|210580_211540_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
AWN67338.1|211638_213780_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
AWN67339.1|213836_214226_+	VOC family protein	NA	NA	NA	NA	NA
AWN67340.1|214290_215589_+|tRNA	tRNA(Ile)-lysidine synthetase	tRNA	NA	NA	NA	NA
AWN71916.1|215637_215892_-	protein rof	NA	NA	NA	NA	NA
AWN67341.1|215884_216085_-	hypothetical protein	NA	NA	NA	NA	NA
AWN67342.1|216250_216796_+	hypothetical protein	NA	NA	NA	NA	NA
AWN67343.1|216792_217215_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AWN67344.1|217228_217939_+	copper homeostasis/adhesion lipoprotein NlpE	NA	NA	NA	NA	NA
AWN67345.1|217945_218197_-	hypothetical protein	NA	NA	NA	NA	NA
AWN67346.1|218188_219169_+|transposase	IS110 family transposase IS621	transposase	NA	NA	NA	NA
AWN67347.1|219182_219377_+	hypothetical protein	NA	NA	NA	NA	NA
AWN67348.1|220247_221966_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AWN67349.1|222077_222785_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
AWN67350.1|222781_223186_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
AWN67351.1|223303_224119_-	methionine ABC transporter substrate-binding protein MetQ	NA	NA	NA	NA	NA
AWN67352.1|224158_224812_-	methionine ABC transporter	NA	NA	NA	NA	NA
AWN67353.1|224804_225836_-	methionine import ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
AWN67354.1|226023_226596_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
AWN67355.1|232355_233159_+	2,5-diketo-D-gluconic acid reductase B	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
AWN67356.1|233155_234070_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWN67357.1|234310_235111_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
AWN67358.1|235188_235959_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWN67359.1|236006_237365_-	lytic transglycosylase	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
AWN67360.1|237436_238192_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AWN67361.1|238225_238948_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWN67362.1|238944_239412_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
AWN71917.1|239476_240208_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
AWN67363.1|240147_240327_-	hypothetical protein	NA	NA	NA	NA	NA
AWN67364.1|240747_241533_+	aminopeptidase	NA	NA	NA	NA	NA
AWN67365.1|241669_242149_-	hypothetical protein	NA	NA	NA	NA	NA
AWN67366.1|242158_243073_-	hypothetical protein	NA	NA	NA	NA	NA
AWN67367.1|243116_243599_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AWN67368.1|243622_244975_-	hypothetical protein	NA	NA	NA	NA	NA
AWN67369.1|244985_248450_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AWN67370.1|248528_250007_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AWN67371.1|249945_250689_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
AWN67372.1|250685_253445_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.4	4.7e-82
AWN67373.1|253453_254215_-	hypothetical protein	NA	NA	NA	NA	NA
AWN67374.1|254219_255551_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AWN67375.1|255553_256078_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AWN67376.1|256074_257355_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AWN67377.1|257379_258462_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AWN67378.1|258425_260276_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AWN67379.1|260279_260693_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 2
CP028381	Escherichia coli strain RM10466 chromosome, complete genome	5044460	569360	633858	5044460	tRNA,capsid,portal,terminase,lysis,tail,integrase,transposase,holin,protease,head	Enterobacteria_phage(45.28%)	74	579522:579568	625332:625378
AWN67661.1|569360_570746_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
AWN67662.1|570781_571303_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AWN67663.1|571410_571623_-	ribosome-associated protein	NA	NA	NA	NA	NA
AWN67664.1|571624_572491_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
AWN67665.1|572971_573514_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
AWN67666.1|573733_574426_+	molecular chaperone FimC	NA	NA	NA	NA	NA
AWN67667.1|574456_577066_+	fimbrial protein	NA	NA	NA	NA	NA
AWN67668.1|577078_578086_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
AWN67669.1|578096_578612_+	fimbriae assembly protein	NA	NA	NA	NA	NA
AWN67670.1|578614_579247_-	DNA-binding response regulator	NA	NA	NA	NA	NA
579522:579568	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
AWN67671.1|579581_580745_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
AWN67672.1|580600_581056_-	DNA-binding protein	NA	U5P4J3	Shigella_phage	83.3	3.4e-62
AWN67673.1|580971_581277_-	hypothetical protein	NA	U5P0J0	Shigella_phage	95.0	1.4e-48
AWN67674.1|581276_581639_-	hypothetical protein	NA	K7PH61	Enterobacteria_phage	98.3	4.4e-65
AWN67675.1|581629_582166_-	HD family hydrolase	NA	U5P0T3	Shigella_phage	97.8	9.0e-99
AWN67676.1|582293_583118_-	DUF2303 domain-containing protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
AWN67677.1|583183_583546_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
AWN71927.1|583971_584532_+	hypothetical protein	NA	NA	NA	NA	NA
AWN67678.1|584759_585386_-	LexA family transcriptional repressor	NA	K7PM82	Enterobacteria_phage	48.8	2.5e-47
AWN67679.1|585483_585684_+	cell division protein	NA	NA	NA	NA	NA
AWN71928.1|585721_586273_+	hypothetical protein	NA	U5P4K1	Shigella_phage	98.9	1.7e-100
AWN67680.1|586448_586628_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
AWN67681.1|586617_587559_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.0	4.9e-140
AWN67682.1|587555_588050_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	6.2e-86
AWN67683.1|588016_588376_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	97.2	1.5e-52
AWN67684.1|588372_588762_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
AWN67685.1|588781_589579_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	7.5e-150
AWN67686.1|589586_590576_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	97.0	2.4e-190
AWN67687.1|590593_590977_+	antitermination protein	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
AWN67688.1|591166_592264_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
AWN67689.1|592852_593068_+|holin	holin	holin	A5LH82	Enterobacteria_phage	98.6	3.4e-33
AWN67690.1|593067_593565_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
AWN67691.1|593561_594023_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	97.4	3.9e-74
AWN67692.1|594054_594348_-	lipoprotein bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
AWN67693.1|594638_595049_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
AWN67694.1|595334_595541_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
AWN67695.1|595705_595900_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
AWN71929.1|596047_596149_+	hypothetical protein	NA	NA	NA	NA	NA
AWN67696.1|596288_596834_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
AWN67697.1|596808_598734_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
AWN67698.1|598730_598937_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AWN67699.1|598933_600535_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.9e-309
AWN67700.1|600515_601835_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	2.6e-232
AWN67701.1|601844_602177_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	1.1e-54
AWN67702.1|602232_603258_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.4e-188
AWN67703.1|603299_603695_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
AWN67704.1|603706_604060_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
AWN67705.1|604071_604650_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	3.5e-80
AWN67706.1|604646_605042_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
AWN71930.1|605049_605790_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	2.0e-128
AWN67707.1|605805_606228_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	99.3	9.7e-72
AWN67708.1|606209_606644_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
AWN67709.1|606636_609198_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.6	0.0e+00
AWN67710.1|609194_609524_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
AWN67711.1|609523_610222_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
AWN67712.1|610227_610971_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
AWN67713.1|610868_611540_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.1	2.6e-103
AWN67714.1|611600_615014_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.2	0.0e+00
AWN67715.1|615084_615684_+	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.5	4.4e-110
AWN71931.1|615748_618709_+	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	53.7	4.0e-55
AWN67716.1|618708_619284_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
AWN67717.1|619381_619972_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
AWN67718.1|620288_620522_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AWN71932.1|621069_621696_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWN67719.1|621794_622100_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
AWN67720.1|622283_623768_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWN67721.1|623954_624908_-|protease	outer membrane protease	protease	NA	NA	NA	NA
AWN67722.1|625311_625428_-	hypothetical protein	NA	NA	NA	NA	NA
625332:625378	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
AWN67723.1|625421_626183_-	porin thermoregulatory protein EnvY	NA	NA	NA	NA	NA
AWN67724.1|626239_626452_+	hypothetical protein	NA	NA	NA	NA	NA
AWN67725.1|626365_627256_-	hypothetical protein	NA	NA	NA	NA	NA
AWN67726.1|627256_630229_-	phage receptor	NA	NA	NA	NA	NA
AWN67727.1|630215_632453_-	glycosyl transferase family protein	NA	NA	NA	NA	NA
AWN67728.1|632721_633858_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 3
CP028381	Escherichia coli strain RM10466 chromosome, complete genome	5044460	903905	1008314	5044460	tRNA,capsid,portal,transposase,tail,integrase,plate,protease,head	Salmonella_phage(66.67%)	110	935535:935556	968803:968824
AWN67979.1|903905_904886_+|transposase	IS110 family transposase IS621	transposase	NA	NA	NA	NA
AWN67980.1|905146_906412_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
AWN67981.1|906563_907379_-	HAD family hydrolase	NA	NA	NA	NA	NA
AWN67982.1|907524_909957_-	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
AWN67983.1|909962_910862_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
AWN67984.1|910992_911655_+	fructose-6-phosphate aldolase	NA	C7BV14	Synechococcus_phage	32.7	1.6e-25
AWN67985.1|911833_912583_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
AWN67986.1|912582_913818_-	molybdopterin molybdotransferase	NA	NA	NA	NA	NA
AWN67987.1|914021_914987_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
AWN67988.1|916864_918403_+	glutathione-binding protein GsiB	NA	NA	NA	NA	NA
AWN67989.1|918420_919341_+	glutathione ABC transporter permease	NA	NA	NA	NA	NA
AWN67990.1|919343_920255_+	glutathione ABC transporter permease	NA	NA	NA	NA	NA
AWN71940.1|920432_922781_+	CHASE9 and EAL domain-containing protein	NA	NA	NA	NA	NA
AWN67991.1|922788_924117_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AWN67992.1|924163_925489_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
AWN67993.1|925701_926085_+	biofilm regulator BssR	NA	NA	NA	NA	NA
AWN67994.1|926195_927311_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
AWN67995.1|927307_927934_-	glutathione S-transferase	NA	NA	NA	NA	NA
AWN71941.1|928179_929382_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
AWN67996.1|929428_930187_-	DNA-binding transcriptional repressor DeoR	NA	NA	NA	NA	NA
AWN67997.1|930244_930841_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
AWN67998.1|931125_932358_+	multidrug transporter MdfA	NA	NA	NA	NA	NA
AWN67999.1|932398_932683_-	hypothetical protein	NA	NA	NA	NA	NA
AWN68000.1|932768_933584_-	HAD family hydrolase	NA	NA	NA	NA	NA
AWN68001.1|933583_934792_-	MFS transporter	NA	NA	NA	NA	NA
AWN68002.1|934875_935412_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
935535:935556	attL	CGCTGCCGCCATTTTGTCGCCA	NA	NA	NA	NA
AWN68003.1|935724_936099_-	hypothetical protein	NA	NA	NA	NA	NA
AWN68004.1|936174_937194_-|integrase	integrase	integrase	A0A0M4S6G4	Salmonella_phage	55.6	3.4e-102
AWN68005.1|937273_937870_-	DUF4276 domain-containing protein	NA	NA	NA	NA	NA
AWN68006.1|937873_939007_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
AWN68007.1|939008_939575_-	phage repressor protein	NA	F1BUN8	Cronobacter_phage	39.2	1.6e-32
AWN68008.1|939701_939923_+	regulator	NA	NA	NA	NA	NA
AWN68009.1|939955_940465_+	hypothetical protein	NA	E5G6L3	Salmonella_phage	98.2	1.7e-86
AWN71942.1|940472_940673_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
AWN68010.1|940636_940978_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.3e-55
AWN68011.1|941045_941279_+	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	97.4	1.1e-32
AWN68012.1|941278_941506_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
AWN68013.1|941502_942357_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	90.1	2.9e-147
AWN71943.1|942362_943184_+	hypothetical protein	NA	A0A0M4RCP6	Salmonella_phage	75.7	1.1e-122
AWN68014.1|943183_945556_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.1	0.0e+00
AWN68015.1|945708_945897_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
AWN68016.1|945835_946141_+	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	2.3e-35
AWN68017.1|946300_946726_-	hypothetical protein	NA	NA	NA	NA	NA
AWN68018.1|947372_947642_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	42.4	7.6e-14
AWN68019.1|947696_948743_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	89.2	9.8e-174
AWN68020.1|948742_950509_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
AWN68021.1|950651_951485_+|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	90.3	2.4e-122
AWN68022.1|951501_952560_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	92.8	4.2e-180
AWN68023.1|952563_953214_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	95.8	1.5e-111
AWN68024.1|953309_953774_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	8.4e-77
AWN68025.1|953773_953977_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	89.6	5.7e-30
AWN68026.1|953980_954196_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	78.9	3.1e-26
AWN68027.1|954176_954692_+	lysozyme	NA	E5G6N1	Salmonella_phage	92.4	1.6e-89
AWN68028.1|954688_955117_+	hypothetical protein	NA	E5G6N2	Salmonella_phage	88.7	2.8e-58
AWN68029.1|955046_955250_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	1.0e-23
AWN68030.1|955212_955644_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	91.6	1.9e-70
AWN68031.1|955636_956083_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	81.5	1.6e-56
AWN68032.1|956024_956831_-	hypothetical protein	NA	NA	NA	NA	NA
AWN68033.1|956934_957513_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	7.2e-94
AWN68034.1|957509_957869_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	87.4	4.2e-52
AWN68035.1|957855_958764_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	9.2e-144
AWN68036.1|958756_959362_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	2.0e-110
AWN68037.1|959358_961089_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	62.8	1.0e-79
AWN68038.1|961088_961523_+|tail	phage tail protein	tail	A0A0F7LDZ0	Escherichia_phage	40.6	5.5e-22
AWN68039.1|961655_962828_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	89.2	1.9e-202
AWN68040.1|962837_963353_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.2	2.4e-88
AWN68041.1|963407_963710_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	88.9	1.6e-39
AWN68042.1|963724_963844_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AWN68043.1|963836_966914_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	61.3	5.7e-312
AWN68044.1|966910_967396_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
AWN68045.1|967392_968493_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.0	2.2e-176
AWN68046.1|968583_968802_+	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AWN68047.1|969037_970723_-	transporter	NA	NA	NA	NA	NA
968803:968824	attR	CGCTGCCGCCATTTTGTCGCCA	NA	NA	NA	NA
AWN68048.1|970992_971370_+	hypothetical protein	NA	NA	NA	NA	NA
AWN68049.1|971399_971657_-	glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
AWN68050.1|971816_972104_+	hypothetical protein	NA	NA	NA	NA	NA
AWN68051.1|972087_972810_+	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
AWN68052.1|972870_973773_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
AWN68053.1|973860_974337_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
AWN68054.1|974688_975801_+	putrescine-binding periplasmic protein	NA	NA	NA	NA	NA
AWN68055.1|975895_977029_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	5.0e-30
AWN68056.1|977038_977992_+	spermidine/putrescine ABC transporter permease	NA	NA	NA	NA	NA
AWN68057.1|977988_978834_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AWN68058.1|978893_979382_+	DUF2593 domain-containing protein	NA	NA	NA	NA	NA
AWN68059.1|979422_980550_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
AWN68060.1|980724_981456_-	arginine/ornithine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWN68061.1|981747_982416_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
AWN68062.1|982415_983132_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
AWN68063.1|983138_983870_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWN68064.1|983887_984616_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
AWN68065.1|984833_985349_-	lipoprotein	NA	NA	NA	NA	NA
AWN68066.1|985474_985798_+	hypothetical protein	NA	NA	NA	NA	NA
AWN68067.1|985794_986625_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
AWN71944.1|986621_987635_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AWN68068.1|987733_989164_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AWN68069.1|989174_990176_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AWN68070.1|990212_991931_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
AWN68071.1|992063_993032_-	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AWN68072.1|993043_994696_-	hydroxylamine reductase	NA	NA	NA	NA	NA
AWN68073.1|994839_995739_-	transporter	NA	NA	NA	NA	NA
AWN68074.1|996233_996929_-	aquaporin	NA	NA	NA	NA	NA
AWN68075.1|997354_999013_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AWN68076.1|999009_1000002_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
AWN68077.1|1000116_1001232_+	MacA family efflux pump subunit	NA	NA	NA	NA	NA
AWN68078.1|1001228_1003175_+	macrolide ABC transporter permease/ATP-binding protein MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
AWN68079.1|1003247_1003472_-	cold-shock protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
AWN68080.1|1003794_1004115_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
AWN68081.1|1004145_1006422_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
AWN68082.1|1007106_1007325_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AWN68083.1|1007609_1008314_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
>prophage 4
CP028381	Escherichia coli strain RM10466 chromosome, complete genome	5044460	1109965	1164915	5044460	capsid,portal,terminase,lysis,tail,integrase,holin,protease,head	Escherichia_phage(38.6%)	70	1110830:1110889	1160181:1160242
AWN68163.1|1109965_1110625_-	BAX inhibitor protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
1110830:1110889	attL	TTTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAAGAC	NA	NA	NA	NA
AWN68164.1|1111032_1112052_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	50.3	2.6e-86
AWN68165.1|1112020_1112272_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AWN68166.1|1112338_1114741_-	exonuclease	NA	V5UQJ3	Shigella_phage	58.1	3.7e-176
AWN68167.1|1114833_1115022_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWN68168.1|1115018_1115207_-	cell division inhibitor	NA	NA	NA	NA	NA
AWN68169.1|1115235_1115571_+	hypothetical protein	NA	NA	NA	NA	NA
AWN71948.1|1116062_1116278_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	84.2	5.3e-10
AWN68170.1|1116433_1116586_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
AWN68171.1|1116897_1117374_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
AWN68172.1|1117498_1117822_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	43.5	1.4e-09
AWN68173.1|1117805_1118231_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AWN68174.1|1118241_1118442_-	hypothetical protein	NA	NA	NA	NA	NA
AWN68175.1|1119122_1119785_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.4e-79
AWN68176.1|1119818_1120535_+	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	63.0	1.1e-72
AWN71949.1|1120567_1120849_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	74.2	7.2e-31
AWN68177.1|1120845_1121151_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.1	4.4e-50
AWN68178.1|1121137_1121740_+	hypothetical protein	NA	A0A2R2Z315	Escherichia_phage	49.5	5.3e-39
AWN68179.1|1121837_1122263_+	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	85.1	1.2e-16
AWN71950.1|1122492_1122780_+	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	96.8	4.0e-53
AWN68180.1|1122776_1123121_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	93.0	3.3e-54
AWN68181.1|1123354_1123567_+	type I toxin-antitoxin system hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	97.1	2.8e-27
AWN68182.1|1123735_1124008_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	2.1e-11
AWN68183.1|1124009_1125059_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	58.2	3.6e-115
AWN68184.1|1125076_1125457_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	100.0	4.9e-67
AWN68185.1|1125672_1125870_+	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
AWN68186.1|1126020_1127079_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	99.1	2.3e-207
AWN68187.1|1127461_1128421_+	Shiga toxin Stx2 subunit A	NA	Q776Q3	Enterobacteria_phage	99.7	2.1e-175
AWN68188.1|1128432_1128702_+	Shiga toxin Stx2 subunit B	NA	Q6DWN4	Enterobacteria_phage	100.0	1.2e-43
AWN68189.1|1128999_1129323_-	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	98.1	6.5e-60
AWN68190.1|1129566_1131504_+	DUF1737 domain-containing protein	NA	S5MDQ7	Escherichia_phage	94.8	0.0e+00
AWN68191.1|1131654_1131834_+	DUF1378 domain-containing protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
AWN68192.1|1131874_1132120_+	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	98.8	3.2e-19
AWN68193.1|1132197_1132413_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
AWN68194.1|1132416_1133208_+	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
AWN68195.1|1133719_1134253_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	1.4e-99
AWN68196.1|1134376_1134592_+	hypothetical protein	NA	NA	NA	NA	NA
AWN71951.1|1134740_1135208_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	93.5	4.3e-73
AWN71952.1|1135237_1135417_+	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	76.9	1.5e-10
AWN68197.1|1135359_1135611_+	hypothetical protein	NA	H6WZK4	Escherichia_phage	94.2	2.7e-29
AWN68198.1|1135546_1135873_+	hypothetical protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
AWN68199.1|1136004_1136205_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
AWN68200.1|1136246_1136612_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
AWN68201.1|1136901_1137465_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
AWN68202.1|1137461_1139123_+|terminase	terminase large subunit	terminase	Q6H9U9	Enterobacteria_phage	99.5	0.0e+00
AWN68203.1|1139186_1141124_+|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	99.5	0.0e+00
AWN71953.1|1141168_1141390_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
AWN68204.1|1141335_1143921_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	96.9	0.0e+00
AWN68205.1|1143917_1144244_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
AWN68206.1|1144253_1144604_+|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	99.1	6.0e-59
AWN68207.1|1144600_1145047_+	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	2.0e-75
AWN68208.1|1145043_1145388_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	4.2e-57
AWN68209.1|1145454_1146171_+|tail	phage tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.2	2.3e-126
AWN68210.1|1146185_1146560_+|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
AWN68211.1|1146583_1146865_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.9	1.0e-45
AWN68212.1|1146912_1150155_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	87.7	0.0e+00
AWN68213.1|1150147_1150489_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	82.3	6.9e-52
AWN68214.1|1150488_1151187_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.7	2.1e-132
AWN68215.1|1151197_1151941_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	97.6	3.8e-148
AWN68216.1|1151838_1152519_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.0	7.7e-111
AWN68217.1|1152758_1156445_+|tail	phage tail protein	tail	S5MW25	Escherichia_phage	88.0	0.0e+00
AWN68218.1|1156643_1156784_+	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	95.7	2.9e-17
AWN68219.1|1156928_1158641_+|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	51.0	1.2e-67
AWN68220.1|1158650_1158863_+|tail	phage tail protein	tail	NA	NA	NA	NA
AWN71954.1|1158874_1159549_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	90.1	9.6e-114
AWN68221.1|1159712_1160042_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
AWN68222.1|1160696_1161815_+	hydrogenase-1 small chain	NA	NA	NA	NA	NA
1160181:1160242	attR	TTTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAAGACCG	NA	NA	NA	NA
AWN68223.1|1161811_1163605_+	hydrogenase 2 large subunit	NA	NA	NA	NA	NA
AWN68224.1|1163623_1164331_+	Ni/Fe-hydrogenase B-type cytochrome subunit	NA	NA	NA	NA	NA
AWN68225.1|1164327_1164915_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 5
CP028381	Escherichia coli strain RM10466 chromosome, complete genome	5044460	1312056	1428837	5044460	tRNA,capsid,portal,terminase,lysis,tail,integrase,plate,holin,protease,head	Shigella_phage(28.57%)	162	1330621:1330642	1392386:1392407
AWN68374.1|1312056_1313175_-|integrase	integrase	integrase	Q77Z04	Phage_21	43.6	1.5e-82
AWN68375.1|1313143_1313413_-	excisionase	NA	NA	NA	NA	NA
AWN68376.1|1313474_1315919_-	exonuclease	NA	V5UQJ3	Shigella_phage	56.7	1.4e-170
AWN68377.1|1316011_1316200_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWN68378.1|1316196_1316385_-	cell division inhibitor	NA	NA	NA	NA	NA
AWN68379.1|1316413_1316764_+	hypothetical protein	NA	NA	NA	NA	NA
AWN68380.1|1316681_1316924_+	hypothetical protein	NA	NA	NA	NA	NA
AWN68381.1|1316871_1317429_+	hypothetical protein	NA	NA	NA	NA	NA
AWN68382.1|1317542_1317695_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
AWN68383.1|1317972_1318260_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AWN68384.1|1318260_1318452_-	stability determinant	NA	NA	NA	NA	NA
AWN68385.1|1318420_1318840_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	56.2	1.2e-08
AWN68386.1|1318900_1319293_-	hypothetical protein	NA	NA	NA	NA	NA
AWN68387.1|1319374_1319656_+	hypothetical protein	NA	NA	NA	NA	NA
AWN68388.1|1319659_1320085_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AWN68389.1|1320095_1320296_-	hypothetical protein	NA	NA	NA	NA	NA
AWN68390.1|1320976_1321639_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.4e-79
AWN68391.1|1321672_1322389_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.1	8.7e-73
AWN68392.1|1322385_1322703_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	75.0	1.4e-35
AWN68393.1|1322699_1322981_+	hypothetical protein	NA	A0A0U2SAZ1	Escherichia_phage	92.5	1.3e-45
AWN68394.1|1323152_1323335_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	93.3	3.8e-25
AWN68395.1|1323500_1324016_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	77.6	2.5e-37
AWN68396.1|1324249_1324462_+	type I toxin-antitoxin system hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	67.1	6.4e-16
AWN68397.1|1324628_1324901_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	1.9e-12
AWN68398.1|1324902_1325952_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	7.7e-110
AWN68399.1|1325964_1326339_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	6.4e-35
AWN68400.1|1326335_1327157_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.7	2.9e-80
AWN68401.1|1327383_1327581_+	TrmB family transcriptional regulator	NA	A0A0P0ZDH6	Stx2-converting_phage	100.0	8.0e-29
AWN68402.1|1327731_1328790_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	96.3	9.5e-201
AWN68403.1|1329172_1330132_+	Shiga toxin Stx2 subunit A	NA	Q5TJL6	Enterobacteria_phage	99.4	6.2e-175
AWN68404.1|1330143_1330413_+	Shiga toxin Stx2 subunit B	NA	Q6DWN4	Enterobacteria_phage	100.0	1.2e-43
1330621:1330642	attL	CACCGGGAGGCACCCGGCACCA	NA	NA	NA	NA
AWN68405.1|1330914_1332852_+	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	93.5	0.0e+00
AWN68406.1|1332989_1333169_+	DUF1378 domain-containing protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
AWN68407.1|1333209_1333455_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
AWN68408.1|1333532_1333748_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
AWN68409.1|1333751_1334543_+	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	86.7	4.0e-34
AWN68410.1|1335054_1335588_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.9	6.9e-99
AWN68411.1|1335711_1335927_+	hypothetical protein	NA	NA	NA	NA	NA
AWN71961.1|1336075_1336543_+|lysis	lysis protein	lysis	A0A0H4IT10	Shigella_phage	86.5	6.1e-67
AWN68412.1|1336566_1336791_+	hypothetical protein	NA	NA	NA	NA	NA
AWN68413.1|1337236_1337785_+|terminase	terminase small subunit	terminase	K7PJS9	Enterobacteria_phage	60.0	4.6e-58
AWN71962.1|1337777_1339685_+|terminase	terminase	terminase	A0A0K2FJ14	Enterobacteria_phage	66.8	4.3e-260
AWN68414.1|1339668_1339875_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
AWN68415.1|1339871_1341464_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	5.8e-186
AWN68416.1|1341453_1342959_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.4	1.5e-98
AWN68417.1|1342995_1343343_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.0	4.4e-22
AWN68418.1|1343400_1344429_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.7e-114
AWN68419.1|1344480_1344864_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
AWN68420.1|1344856_1345210_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.8e-40
AWN68421.1|1345225_1345801_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.3	1.7e-50
AWN68422.1|1345797_1346193_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	80.9	2.2e-57
AWN68423.1|1346200_1346950_+|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	94.4	1.6e-130
AWN68424.1|1346965_1347397_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
AWN68425.1|1347423_1347837_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.8	2.3e-41
AWN68426.1|1347817_1350397_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.4	0.0e+00
AWN68427.1|1350393_1350723_+|tail	phage tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
AWN68428.1|1350722_1351421_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.7	2.1e-132
AWN68429.1|1351431_1352175_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	94.7	8.3e-143
AWN68430.1|1352072_1352717_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	74.3	3.5e-89
AWN68431.1|1353627_1357314_+	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	88.3	0.0e+00
AWN68432.1|1357512_1357653_+	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	95.7	2.9e-17
AWN68433.1|1357797_1359501_+|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	51.9	3.3e-70
AWN68434.1|1359510_1359723_+|tail	phage tail protein	tail	NA	NA	NA	NA
AWN71963.1|1359734_1360409_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	90.1	3.3e-114
AWN68435.1|1360572_1360902_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
AWN68436.1|1361067_1361931_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
AWN68437.1|1361914_1363051_-	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
AWN71964.1|1363029_1363245_-	hypothetical protein	NA	NA	NA	NA	NA
AWN68438.1|1363300_1364530_+	peptidase T	NA	NA	NA	NA	NA
AWN68439.1|1364675_1365797_-	50S ribosomal protein L16 arginine hydroxylase	NA	NA	NA	NA	NA
AWN68440.1|1366045_1367275_+	DUF4102 domain-containing protein	NA	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	1.5e-133
AWN68441.1|1367649_1367838_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	5.9e-13
AWN68442.1|1368086_1368290_-	hypothetical protein	NA	NA	NA	NA	NA
AWN68443.1|1368347_1368527_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	58.6	1.5e-10
AWN68444.1|1368747_1368975_-	hypothetical protein	NA	NA	NA	NA	NA
AWN68445.1|1369032_1369212_-	hypothetical protein	NA	NA	NA	NA	NA
AWN68446.1|1369404_1369602_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
AWN68447.1|1369594_1369807_+	hypothetical protein	NA	NA	NA	NA	NA
AWN68448.1|1369796_1370036_+	hypothetical protein	NA	NA	NA	NA	NA
AWN68449.1|1370028_1370262_+	hypothetical protein	NA	NA	NA	NA	NA
AWN68450.1|1370494_1370794_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AWN68451.1|1370790_1372200_+	DNA primase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	58.9	3.4e-113
AWN71965.1|1372402_1372654_+	hypothetical protein	NA	NA	NA	NA	NA
AWN68452.1|1372650_1373073_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AWN68453.1|1373197_1373437_-	hypothetical protein	NA	NA	NA	NA	NA
AWN68454.1|1373490_1373697_+	hypothetical protein	NA	NA	NA	NA	NA
AWN68455.1|1373696_1374752_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.4	2.1e-70
AWN68456.1|1374763_1375099_+|head	head decoration protein	head	NA	NA	NA	NA
AWN68457.1|1375111_1375525_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
AWN68458.1|1375771_1376356_+|terminase	terminase small subunit	terminase	K7PJS9	Enterobacteria_phage	57.2	3.2e-57
AWN68459.1|1376335_1376560_-	hypothetical protein	NA	NA	NA	NA	NA
AWN68460.1|1376611_1376893_+	hypothetical protein	NA	NA	NA	NA	NA
AWN68461.1|1377742_1379203_-	sensor protein PhoQ	NA	NA	NA	NA	NA
AWN68462.1|1379202_1379874_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AWN68463.1|1380041_1381412_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
AWN71966.1|1381415_1382057_-	lysogenization protein HflD	NA	NA	NA	NA	NA
AWN68464.1|1382092_1383199_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AWN68465.1|1383252_1383714_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AWN68466.1|1383723_1384377_-	23S rRNA pseudouridine synthase E	NA	NA	NA	NA	NA
AWN68467.1|1384548_1385799_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
AWN68468.1|1386205_1388533_-	AAA family ATPase	NA	NA	NA	NA	NA
AWN68469.1|1388851_1389979_-|integrase	integrase	integrase	O21925	Phage_21	60.5	2.7e-121
AWN68470.1|1389959_1390205_-	excisionase	NA	NA	NA	NA	NA
AWN68471.1|1390259_1390796_-	HD family hydrolase	NA	U5P0T3	Shigella_phage	94.3	3.9e-94
AWN68472.1|1390924_1391749_-	DUF2303 domain-containing protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
AWN68473.1|1391814_1392177_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
AWN68474.1|1392249_1392474_+	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	67.7	9.8e-15
1392386:1392407	attR	TGGTGCCGGGTGCCTCCCGGTG	NA	NA	NA	NA
AWN68475.1|1392614_1392860_+	hypothetical protein	NA	NA	NA	NA	NA
AWN68476.1|1392777_1393053_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	97.8	7.0e-47
AWN68477.1|1393061_1393265_-	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	68.3	8.9e-15
AWN68478.1|1393541_1394234_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	99.6	2.3e-126
AWN68479.1|1394331_1394592_+	XRE family transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
AWN68480.1|1394584_1395136_+	hypothetical protein	NA	S5FXP0	Shigella_phage	98.4	2.9e-100
AWN68481.1|1395311_1395491_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
AWN68482.1|1395480_1396422_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.4	8.6e-153
AWN68483.1|1396418_1396913_+	PerC family transcriptional regulator	NA	S5MW49	Escherichia_phage	96.9	6.2e-86
AWN68484.1|1396912_1397566_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	2.5e-127
AWN68485.1|1397562_1397889_+	LexA family transcriptional regulator	NA	A5LH73	Enterobacteria_phage	100.0	1.6e-53
AWN68486.1|1397885_1398275_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
AWN68487.1|1398294_1399137_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	91.5	6.3e-139
AWN68488.1|1399144_1400134_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	1.6e-194
AWN68489.1|1400151_1400499_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	85.0	8.0e-56
AWN68490.1|1400512_1401604_-	hypothetical protein	NA	Q332C0	Clostridium_botulinum_C_phage	35.4	5.3e-05
AWN68491.1|1401583_1401715_+	hypothetical protein	NA	NA	NA	NA	NA
AWN68492.1|1402196_1402913_-	hypothetical protein	NA	NA	NA	NA	NA
AWN68493.1|1403288_1403615_+|holin	phage holin, lambda family	holin	S5FM86	Shigella_phage	98.1	3.4e-56
AWN68494.1|1403618_1404095_+	lysozyme	NA	S5FV07	Shigella_phage	98.7	8.3e-88
AWN68495.1|1404078_1404471_+	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	89.2	6.5e-54
AWN68496.1|1404923_1405274_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	6.8e-63
AWN68497.1|1405391_1405895_+|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	100.0	1.0e-88
AWN68498.1|1405891_1407625_+|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.6	0.0e+00
AWN68499.1|1407636_1407819_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
AWN68500.1|1407818_1409060_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	2.6e-242
AWN68501.1|1409001_1409688_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.6	2.5e-125
AWN68502.1|1409702_1410908_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.5	1.2e-223
AWN68503.1|1410957_1411158_+	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
AWN68504.1|1411160_1411484_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
AWN68505.1|1411480_1411891_+|head,tail	head-tail adaptor protein	head,tail	M1FJ87	Enterobacteria_phage	97.8	5.9e-74
AWN68506.1|1411865_1412372_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	100.0	1.7e-91
AWN68507.1|1412368_1412929_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	100.0	1.0e-105
AWN68508.1|1412937_1413108_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
AWN68509.1|1413091_1414588_+|tail	phage tail protein	tail	M1FN90	Enterobacteria_phage	99.2	1.2e-273
AWN68510.1|1414587_1414944_+|tail	phage tail protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
AWN68511.1|1414943_1415213_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	98.9	7.8e-43
AWN68512.1|1415179_1415368_+	hypothetical protein	NA	NA	NA	NA	NA
AWN68513.1|1415354_1417190_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.3	1.5e-307
AWN68514.1|1417208_1418579_+	DNA circularization protein	NA	S5FUX4	Shigella_phage	99.1	3.9e-255
AWN68515.1|1418575_1419655_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.4	4.5e-206
AWN68516.1|1419654_1420203_+|plate	phage baseplate assembly protein V	plate	Q8SBG6	Shigella_phage	99.5	1.5e-96
AWN68517.1|1420199_1420628_+|tail	phage tail protein	tail	U5P0R9	Shigella_phage	100.0	2.3e-81
AWN68518.1|1420614_1421673_+|plate	phage baseplate protein	plate	Q8SBG4	Shigella_phage	98.6	8.1e-200
AWN68519.1|1421663_1422248_+	DUF2313 domain-containing protein	NA	O22003	Shigella_phage	99.5	2.4e-113
AWN68520.1|1422251_1422899_+	hypothetical protein	NA	U5P0I1	Shigella_phage	64.4	8.4e-67
AWN68521.1|1422901_1423333_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	74.6	4.3e-43
AWN68522.1|1423304_1423907_-|tail	tail fiber assembly protein	tail	A0A0F7LDQ5	Escherichia_phage	88.4	8.9e-95
AWN68523.1|1423906_1424437_-|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	96.6	4.4e-98
AWN68524.1|1424466_1425021_+	DNA-invertase	NA	A0A1S6L009	Salmonella_phage	88.9	4.4e-88
AWN68525.1|1425127_1425961_+	5-methylcytosine-specific restriction enzyme A	NA	NA	NA	NA	NA
AWN68526.1|1426194_1426359_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-24
AWN68527.1|1426461_1426785_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	8.0e-42
AWN68528.1|1427480_1427885_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
AWN68529.1|1428105_1428837_-	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
>prophage 6
CP028381	Escherichia coli strain RM10466 chromosome, complete genome	5044460	1527274	1596106	5044460	capsid,terminase,lysis,tail,integrase,holin,protease,head	Escherichia_phage(29.63%)	84	1527107:1527134	1582301:1582328
1527107:1527134	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
AWN68626.1|1527274_1528405_-|integrase	integrase	integrase	O21940	Phage_21	51.4	4.0e-104
AWN68627.1|1528382_1528631_-	excisionase	NA	NA	NA	NA	NA
AWN68628.1|1528695_1531167_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	1.3e-54
AWN68629.1|1531262_1531451_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWN68630.1|1531447_1531636_-	cell division inhibitor	NA	NA	NA	NA	NA
AWN68631.1|1531544_1531736_+	hypothetical protein	NA	NA	NA	NA	NA
AWN71976.1|1532184_1532487_+	hypothetical protein	NA	NA	NA	NA	NA
AWN71975.1|1532410_1532779_-	hypothetical protein	NA	NA	NA	NA	NA
AWN68632.1|1532790_1532943_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
AWN68633.1|1533132_1533591_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	6.2e-24
AWN68634.1|1533617_1533845_+	transcriptional regulator	NA	NA	NA	NA	NA
AWN68635.1|1533828_1534350_+	hypothetical protein	NA	NA	NA	NA	NA
AWN68636.1|1534330_1535296_+	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	5.0e-55
AWN68637.1|1535302_1536043_+	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.1	4.7e-114
AWN68638.1|1536072_1536834_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	64.0	8.4e-74
AWN68639.1|1536893_1537088_+	hypothetical protein	NA	NA	NA	NA	NA
AWN68640.1|1537429_1537981_+	hypothetical protein	NA	A0A0N7C203	Escherichia_phage	53.3	5.5e-43
AWN68641.1|1537977_1538151_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	80.6	3.1e-08
AWN68642.1|1538195_1538408_+	type I toxin-antitoxin system hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	5.6e-28
AWN68643.1|1538510_1538828_-	transcriptional regulator	NA	NA	NA	NA	NA
AWN68644.1|1539416_1539644_+	hypothetical protein	NA	NA	NA	NA	NA
AWN68645.1|1539697_1539967_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	52.5	1.2e-11
AWN68646.1|1539968_1541018_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	4.5e-110
AWN68647.1|1541030_1541393_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.9	2.4e-34
AWN68648.1|1541385_1542051_+	antiterminator	NA	I6PDF8	Cronobacter_phage	52.0	1.6e-60
AWN68649.1|1542304_1543018_+	hypothetical protein	NA	NA	NA	NA	NA
AWN68650.1|1543191_1543389_+	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	96.9	6.8e-28
AWN68651.1|1543539_1544598_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.6	4.4e-206
AWN68652.1|1545078_1545507_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
AWN68653.1|1546203_1546929_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWN68654.1|1547018_1547297_+	hypothetical protein	NA	NA	NA	NA	NA
AWN68655.1|1548786_1550751_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	A0A0P0ZBH7	Stx2-converting_phage	78.8	6.5e-296
AWN68656.1|1550885_1551065_+	DUF1378 domain-containing protein	NA	A0A2R2Z345	Escherichia_phage	93.2	5.4e-24
AWN68657.1|1551105_1551351_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
AWN68658.1|1551428_1551644_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
AWN71977.1|1551647_1552316_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	76.7	6.0e-60
AWN68659.1|1552295_1552616_-	hypothetical protein	NA	NA	NA	NA	NA
AWN68660.1|1552741_1553275_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	97.2	7.4e-101
AWN68661.1|1553398_1553614_+	hypothetical protein	NA	NA	NA	NA	NA
AWN71978.1|1553762_1554230_+|lysis	lysis protein	lysis	A0A0H4IT10	Shigella_phage	87.1	7.9e-67
AWN68662.1|1554410_1554956_+	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	68.6	7.4e-64
AWN68663.1|1554983_1555184_+	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	76.9	1.1e-09
AWN68664.1|1555105_1555357_+	hypothetical protein	NA	H6WZK4	Escherichia_phage	98.6	2.2e-31
AWN68665.1|1555292_1555619_+	hypothetical protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
AWN68666.1|1555750_1555951_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
AWN68667.1|1555992_1556358_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.9	1.0e-61
AWN68668.1|1556326_1556464_+	DNase	NA	NA	NA	NA	NA
AWN71979.1|1556646_1557210_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
AWN68669.1|1557206_1558868_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.6	0.0e+00
AWN68670.1|1558931_1560869_+|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	99.7	0.0e+00
AWN71980.1|1560913_1561135_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
AWN68671.1|1563499_1563826_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
AWN68672.1|1563835_1564186_+|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	99.1	6.0e-59
AWN68673.1|1564182_1564629_+	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
AWN68674.1|1564625_1564970_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	4.2e-57
AWN68675.1|1565036_1565753_+|tail	phage tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	98.7	8.9e-126
AWN68676.1|1565767_1566142_+|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	7.8e-65
AWN68677.1|1566165_1566447_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.9	1.0e-45
AWN68678.1|1566494_1569737_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	87.7	0.0e+00
AWN68679.1|1569729_1570071_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	82.1	2.6e-51
AWN71981.1|1570278_1571433_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	66.7	1.1e-138
AWN68680.1|1571643_1572342_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.7	2.1e-132
AWN68681.1|1572352_1573096_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	94.7	4.1e-142
AWN68682.1|1572993_1573674_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.6	5.0e-110
AWN68683.1|1574584_1578280_+|tail	phage tail protein	tail	Q6H9T2	Enterobacteria_phage	84.2	0.0e+00
AWN68684.1|1578348_1578972_+	hypothetical protein	NA	A0A1U8QHD6	Enterobacteria_phage	59.9	9.0e-66
AWN68685.1|1579121_1580126_+|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	97.3	1.3e-53
AWN68686.1|1580194_1580866_+|tail	phage tail protein	tail	S5MBX6	Escherichia_phage	83.9	3.3e-106
AWN68687.1|1580913_1581177_-	hypothetical protein	NA	NA	NA	NA	NA
AWN68688.1|1582478_1582985_-	hypothetical protein	NA	NA	NA	NA	NA
1582301:1582328	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
AWN68689.1|1583030_1583531_-	YciE/YciF family protein	NA	NA	NA	NA	NA
AWN68690.1|1583616_1583796_-	hypothetical protein	NA	NA	NA	NA	NA
AWN68691.1|1584176_1584983_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AWN68692.1|1584982_1586176_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AWN71982.1|1586187_1587546_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.0e-37
AWN68693.1|1587549_1589145_-	bifunctional glutamine amidotransferase/anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
AWN68694.1|1589144_1590707_-	anthranilate synthase component I	NA	NA	NA	NA	NA
AWN71983.1|1590798_1590843_-	trp operon leader peptide	NA	NA	NA	NA	NA
AWN68695.1|1590980_1591862_+	phosphatase	NA	NA	NA	NA	NA
AWN68696.1|1591858_1592479_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AWN68697.1|1592579_1593452_+	23S rRNA pseudouridylate synthase B	NA	NA	NA	NA	NA
AWN68698.1|1593491_1594082_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
AWN68699.1|1594078_1594837_-	NAD(P)-dependent oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	1.5e-06
AWN68700.1|1595056_1596106_+|protease	protease	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 7
CP028381	Escherichia coli strain RM10466 chromosome, complete genome	5044460	1877653	1940162	5044460	portal,terminase,lysis,tail,holin	Escherichia_phage(50.85%)	82	NA	NA
AWN68946.1|1877653_1878325_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	86.1	3.2e-109
AWN68947.1|1878393_1879662_-|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	98.2	1.9e-54
AWN68948.1|1879805_1879946_-	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	95.7	2.9e-17
AWN68949.1|1880144_1883831_-|tail	phage tail protein	tail	S5MW25	Escherichia_phage	88.1	0.0e+00
AWN68950.1|1884070_1884751_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.0	5.9e-111
AWN68951.1|1884648_1885392_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	93.9	4.6e-141
AWN68952.1|1885402_1886101_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.3	1.4e-131
AWN68953.1|1886100_1886430_-|tail	phage tail protein	tail	S5MW28	Escherichia_phage	100.0	5.6e-59
AWN68954.1|1886426_1889072_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	93.2	0.0e+00
AWN68955.1|1889115_1889424_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
AWN68956.1|1889450_1889873_-|tail	phage minor tail protein G	tail	S5MQJ3	Escherichia_phage	100.0	5.1e-73
AWN68957.1|1889889_1890639_-|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	98.8	5.3e-137
AWN68958.1|1890646_1891045_-|tail	phage tail protein	tail	S5MW30	Escherichia_phage	100.0	2.7e-71
AWN68959.1|1891054_1891681_-|tail	phage tail protein	tail	S5MBY4	Escherichia_phage	100.0	7.8e-102
AWN68960.1|1891683_1891965_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
AWN68961.1|1891957_1892284_-	DUF2190 domain-containing protein	NA	Q9EYD5	Enterobacteria_phage	99.1	4.0e-49
AWN71991.1|1892370_1894326_-	peptidase S14	NA	S5M7Q8	Escherichia_phage	98.8	0.0e+00
AWN68962.1|1894339_1895842_-|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	99.8	5.4e-290
AWN68963.1|1895841_1896078_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	100.0	4.5e-34
AWN68964.1|1897546_1897828_-	hypothetical protein	NA	NA	NA	NA	NA
AWN68965.1|1898085_1899975_-	peptidase	NA	Q8VNN5	Enterobacteria_phage	51.4	1.6e-182
AWN68966.1|1899971_1900166_-	hypothetical protein	NA	NA	NA	NA	NA
AWN68967.1|1900260_1900446_-	hypothetical protein	NA	NA	NA	NA	NA
AWN68968.1|1900946_1902701_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	39.6	3.9e-90
AWN68969.1|1902697_1902997_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AWN68970.1|1903002_1903236_-	hypothetical protein	NA	NA	NA	NA	NA
AWN68971.1|1903237_1903459_-	hypothetical protein	NA	NA	NA	NA	NA
AWN68972.1|1903431_1903674_-	hypothetical protein	NA	NA	NA	NA	NA
AWN68973.1|1903663_1903894_-	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	49.1	4.5e-07
AWN68974.1|1903890_1904085_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
AWN68975.1|1904283_1904589_+	hypothetical protein	NA	NA	NA	NA	NA
AWN68976.1|1904841_1905186_-	hypothetical protein	NA	NA	NA	NA	NA
AWN68977.1|1905266_1905848_-	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	61.3	3.4e-51
AWN68978.1|1905907_1906132_-	hypothetical protein	NA	NA	NA	NA	NA
AWN68979.1|1906124_1907363_-	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	35.1	6.6e-60
AWN68980.1|1907524_1908532_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.7	5.3e-201
AWN68981.1|1908528_1909005_-	DUF1441 domain-containing protein	NA	Q9EYD0	Enterobacteria_phage	96.8	1.3e-80
AWN68982.1|1909457_1909925_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	100.0	7.7e-78
AWN68983.1|1910223_1910757_-	lysozyme	NA	G9L6J6	Escherichia_phage	95.5	1.1e-99
AWN71992.1|1911268_1911754_-	hypothetical protein	NA	NA	NA	NA	NA
AWN68984.1|1911757_1911973_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
AWN68985.1|1912050_1912296_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	98.8	7.4e-16
AWN68986.1|1912336_1912516_-	DUF1378 domain-containing protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
AWN68987.1|1912666_1914613_-	DUF1737 domain-containing protein	NA	S5MDQ7	Escherichia_phage	97.8	0.0e+00
AWN68988.1|1914683_1914869_+	hypothetical protein	NA	Q8VNP0	Enterobacteria_phage	92.9	2.8e-15
AWN68989.1|1915125_1915395_-	Shiga toxin Stx2 subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
AWN68990.1|1915406_1916366_-	Shiga toxin Stx2 subunit A	NA	Q6DWN9	Enterobacteria_phage	100.0	1.6e-175
AWN68991.1|1916851_1917673_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	57.2	1.2e-86
AWN68992.1|1917669_1918044_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.4	4.7e-38
AWN68993.1|1918056_1919106_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	2.5e-108
AWN68994.1|1919107_1919380_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.2e-12
AWN68995.1|1919515_1919773_+	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
AWN68996.1|1919778_1920078_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	99.0	3.9e-51
AWN68997.1|1920282_1920678_-	hypothetical protein	NA	A0A193GYM6	Enterobacter_phage	61.2	2.5e-37
AWN68998.1|1920667_1920886_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	70.3	1.2e-06
AWN68999.1|1921015_1921327_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	79.6	6.5e-49
AWN69000.1|1921323_1921515_-	hypothetical protein	NA	A0A291AXE7	Shigella_phage	42.1	1.4e-06
AWN69001.1|1921507_1921807_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.9	4.8e-49
AWN71993.1|1921803_1922085_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	66.7	5.7e-28
AWN69002.1|1922089_1922524_-	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	60.9	2.0e-35
AWN69003.1|1922539_1923265_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.4	2.0e-77
AWN69004.1|1923298_1923961_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.8	1.2e-79
AWN69005.1|1924641_1924842_+	hypothetical protein	NA	NA	NA	NA	NA
AWN69006.1|1924852_1925278_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AWN69007.1|1925274_1925502_-	cell division protein	NA	NA	NA	NA	NA
AWN69008.1|1925597_1926245_+	helix-turn-helix domain-containing protein	NA	A0A1P8DTH0	Proteus_phage	25.9	6.1e-09
AWN69009.1|1926573_1926975_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	81.6	6.5e-09
AWN69010.1|1927796_1927985_+	cell division inhibitor	NA	NA	NA	NA	NA
AWN69011.1|1927981_1928170_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWN69012.1|1928265_1930737_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	59.3	8.5e-59
AWN69013.1|1930807_1931059_+	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.9e-15
AWN69014.1|1931094_1932369_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	61.7	2.8e-154
AWN69015.1|1932397_1932505_-	transporter	NA	NA	NA	NA	NA
AWN69016.1|1932562_1933582_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	1.6e-16
AWN69017.1|1933593_1934808_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AWN69018.1|1934788_1934977_-	hypothetical protein	NA	NA	NA	NA	NA
AWN69019.1|1935013_1935340_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AWN69020.1|1935474_1935816_+	DUF1283 domain-containing protein	NA	NA	NA	NA	NA
AWN69021.1|1935850_1936411_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AWN71994.1|1936413_1937124_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
AWN69022.1|1937231_1937537_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AWN69023.1|1937735_1940162_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
>prophage 8
CP028381	Escherichia coli strain RM10466 chromosome, complete genome	5044460	2446924	2483399	5044460	capsid,portal,terminase,lysis,tail,plate,integrase,holin,protease,head	Escherichia_phage(54.55%)	49	2451982:2452009	2481583:2481610
AWN69514.1|2446924_2448328_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
AWN69515.1|2448324_2449047_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.4e-30
AWN69516.1|2449237_2449570_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AWN69517.1|2449778_2450075_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
AWN69518.1|2450076_2450373_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AWN69519.1|2450475_2451837_+|protease	protease	protease	Q6DW11	Phage_TP	100.0	1.1e-217
2451982:2452009	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
AWN69520.1|2452109_2452364_-	transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	100.0	6.1e-45
AWN69521.1|2452409_2453573_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	5.4e-205
AWN69522.1|2453572_2454052_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.9e-84
AWN69523.1|2454066_2456514_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.6	0.0e+00
AWN72020.1|2456506_2456626_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AWN69524.1|2456658_2456934_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
AWN69525.1|2456990_2457509_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
AWN69526.1|2457521_2458712_-|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	4.8e-225
AWN69527.1|2458835_2459306_-|tail	phage tail protein	tail	A0A0F7LDZ0	Escherichia_phage	42.8	1.2e-22
AWN69528.1|2459272_2461003_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	64.0	1.2e-83
AWN69529.1|2460999_2461611_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
AWN69530.1|2461603_2462512_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.7	7.5e-162
AWN69531.1|2462516_2462864_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
AWN69532.1|2462860_2463496_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	4.2e-111
AWN69533.1|2463562_2464015_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
AWN69534.1|2464007_2464475_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	97.4	9.7e-81
AWN69535.1|2464437_2464611_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
AWN69536.1|2464582_2465008_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7L9Y0	Escherichia_phage	95.7	8.0e-66
AWN69537.1|2464995_2465421_-	protein lysA	NA	A0A0F7LBP4	Escherichia_phage	96.5	8.6e-60
AWN69538.1|2465435_2465933_-	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
AWN69539.1|2465932_2466214_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
AWN69540.1|2466217_2466421_-|tail	phage tail protein	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
AWN69541.1|2466420_2466930_-|head	head completion/stabilization protein	head	Q858W4	Yersinia_virus	100.0	3.0e-91
AWN69542.1|2467029_2467767_-|terminase	terminase	terminase	Q94MJ2	Enterobacteria_phage	98.4	1.2e-128
AWN69543.1|2467770_2468844_-|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.4	1.9e-201
AWN69544.1|2468902_2469757_-|capsid	capsid scaffolding protein	capsid	Q94MH0	Enterobacteria_phage	97.5	1.7e-131
AWN69545.1|2469930_2471703_+	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	99.5	0.0e+00
AWN69546.1|2471702_2472737_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.7	4.2e-201
AWN69547.1|2473089_2474244_-	DNA cytosine methyltransferase	NA	Q83VT0	Escherichia_phage	99.4	3.2e-210
AWN69548.1|2474264_2474534_+	XRE family transcriptional regulator	NA	Q83VS9	Escherichia_phage	100.0	3.6e-40
AWN69549.1|2474511_2475567_+	restriction endonuclease, SacI family	NA	Q83VS8	Escherichia_phage	100.0	2.2e-197
AWN69550.1|2475660_2477931_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.2	0.0e+00
AWN69551.1|2477920_2478196_-	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
AWN69552.1|2478192_2478417_-	hypothetical protein	NA	S4TRY6	Salmonella_phage	97.3	2.5e-34
AWN69553.1|2478416_2478719_-	hypothetical protein	NA	U5N0U2	Enterobacteria_phage	98.0	5.0e-46
AWN69554.1|2478718_2478943_-	DUF2732 domain-containing protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
AWN69555.1|2479006_2479507_-	replication protein B	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
AWN69556.1|2479684_2479960_-	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
AWN69557.1|2480074_2480374_+	XRE family transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
AWN69558.1|2480489_2481503_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	1.4e-193
AWN69559.1|2481630_2481780_-	hypothetical protein	NA	NA	NA	NA	NA
2481583:2481610	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
AWN69560.1|2481767_2482085_-	hypothetical protein	NA	NA	NA	NA	NA
AWN69561.1|2482499_2483399_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
>prophage 9
CP028381	Escherichia coli strain RM10466 chromosome, complete genome	5044460	2521424	2530865	5044460		Enterobacteria_phage(85.71%)	10	NA	NA
AWN69592.1|2521424_2522561_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
AWN69593.1|2522557_2524558_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
AWN69594.1|2524681_2525143_+	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AWN69595.1|2525183_2525654_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AWN69596.1|2525700_2526420_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AWN69597.1|2526416_2528102_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AWN69598.1|2528323_2529055_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AWN69599.1|2529114_2529222_+	hypothetical protein	NA	NA	NA	NA	NA
AWN69600.1|2529202_2529934_-	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AWN69601.1|2529938_2530865_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 10
CP028381	Escherichia coli strain RM10466 chromosome, complete genome	5044460	2992568	3085279	5044460	tRNA,capsid,portal,transposase,lysis,tail,plate,integrase,head	Salmonella_phage(69.09%)	102	3036355:3036401	3068909:3068955
AWN70018.1|2992568_2993306_-|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
AWN70019.1|2993437_2994772_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
AWN70020.1|2994980_2995862_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWN70021.1|2995964_2996552_+	cysteine/O-acetylserine efflux protein	NA	NA	NA	NA	NA
AWN70022.1|2996607_2996991_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
AWN70023.1|2997295_2997985_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
AWN70024.1|2998032_2999070_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AWN70025.1|2999059_2999263_-	hypothetical protein	NA	NA	NA	NA	NA
AWN70026.1|2999276_2999696_+	thiol disulfide reductase thioredoxin	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
AWN72029.1|2999764_3000463_+	DTW domain-containing protein	NA	NA	NA	NA	NA
AWN70027.1|3000494_3003155_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AWN70028.1|3003268_3004624_+	phosphatidylserine synthase	NA	NA	NA	NA	NA
AWN70029.1|3004669_3004993_+	lipoprotein	NA	NA	NA	NA	NA
AWN70030.1|3004989_3006288_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	32.2	2.2e-45
AWN70031.1|3006269_3006383_-	alpha-ketoglutarate permease	NA	NA	NA	NA	NA
AWN70032.1|3012154_3014728_-	chaperone protein ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
AWN70033.1|3014857_3015589_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AWN70034.1|3015585_3016566_-	ribosomal large subunit pseudouridine synthase D	NA	NA	NA	NA	NA
AWN70035.1|3016700_3017438_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AWN70036.1|3017467_3017674_+	hypothetical protein	NA	NA	NA	NA	NA
AWN70037.1|3017708_3018050_+	ribosome-associated inhibitor A	NA	NA	NA	NA	NA
AWN72030.1|3018153_3018201_+	hypothetical protein	NA	NA	NA	NA	NA
AWN70038.1|3018299_3019460_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AWN70039.1|3019502_3020624_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AWN70040.1|3020634_3021705_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
AWN70041.1|3021914_3022280_+	hypothetical protein	NA	NA	NA	NA	NA
AWN70042.1|3022429_3022948_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
AWN70043.1|3022937_3024164_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AWN70044.1|3024179_3024662_+	hypothetical protein	NA	NA	NA	NA	NA
AWN70045.1|3024738_3025086_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AWN70046.1|3025127_3025895_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AWN70047.1|3025925_3026474_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AWN70048.1|3026492_3026741_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AWN70049.1|3026877_3028239_-	signal recognition particle protein	NA	NA	NA	NA	NA
AWN72031.1|3028405_3029197_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
AWN72032.1|3029262_3030504_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AWN70050.1|3030558_3031152_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AWN70051.1|3031148_3031343_-	molecular chaperone GrpE	NA	NA	NA	NA	NA
AWN70052.1|3031274_3032153_+	NAD(+) kinase	NA	NA	NA	NA	NA
AWN70053.1|3032238_3033900_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AWN70054.1|3034048_3034390_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AWN70055.1|3034451_3034742_-	RnfH family protein	NA	NA	NA	NA	NA
AWN70056.1|3034731_3035208_-	ubiquinone-binding protein	NA	NA	NA	NA	NA
AWN70057.1|3035339_3035822_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
3036355:3036401	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
AWN70058.1|3036522_3037005_+	hypothetical protein	NA	Q19UP0	Mannheimia_phage	33.7	2.0e-17
AWN70059.1|3037031_3037250_-	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	77.8	7.5e-28
AWN70060.1|3037318_3038419_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	85.8	6.9e-178
AWN70061.1|3038415_3038901_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	1.7e-67
AWN70062.1|3038897_3041975_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.7	0.0e+00
AWN70063.1|3041967_3042087_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AWN70064.1|3042101_3042404_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	90.0	8.2e-41
AWN70065.1|3042458_3042974_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.2	1.1e-88
AWN70066.1|3042983_3044156_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	7.8e-204
AWN70067.1|3044288_3044723_-|tail	phage tail protein	tail	A0A0F7LDZ0	Escherichia_phage	40.6	4.2e-22
AWN70068.1|3044722_3046453_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	62.8	4.7e-80
AWN70069.1|3046449_3047055_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	5.2e-111
AWN70070.1|3047047_3047956_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	91.1	4.1e-144
AWN70071.1|3047942_3048302_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	87.4	1.5e-52
AWN70072.1|3048298_3048877_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	1.2e-93
AWN70073.1|3048945_3049392_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.5e-62
AWN70074.1|3049384_3049816_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	9.9e-72
AWN70075.1|3049778_3049982_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	74.6	4.0e-23
AWN70076.1|3049911_3050340_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.2	1.9e-46
AWN70077.1|3050336_3050714_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	3.9e-16
AWN72033.1|3050715_3051189_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AWN70078.1|3051208_3051424_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AWN70079.1|3051427_3051631_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AWN70080.1|3051630_3052095_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
AWN70081.1|3052190_3052841_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	95.4	3.3e-111
AWN70082.1|3052844_3053903_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	3.8e-181
AWN70083.1|3053919_3054753_-|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.2e-121
AWN70084.1|3054895_3056662_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AWN70085.1|3056661_3057690_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.7	4.0e-172
AWN70086.1|3057737_3058655_-	restriction endonuclease	NA	NA	NA	NA	NA
AWN70087.1|3058617_3059820_-	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	36.2	2.9e-60
AWN70088.1|3060146_3060452_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AWN70089.1|3060390_3060579_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
AWN70090.1|3060731_3063146_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.0	0.0e+00
AWN70091.1|3063142_3064000_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.5	1.5e-159
AWN70092.1|3063996_3064224_-	hypothetical protein	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
AWN70093.1|3064223_3064457_-	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	97.4	3.2e-32
AWN70094.1|3064524_3064866_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	96.5	1.1e-54
AWN70095.1|3064948_3065197_+	hypothetical protein	NA	NA	NA	NA	NA
AWN70096.1|3065282_3065579_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	92.3	2.2e-22
AWN70097.1|3065586_3066096_-	hypothetical protein	NA	E5G6L3	Salmonella_phage	99.4	3.4e-87
AWN70098.1|3066128_3066371_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
AWN70099.1|3066492_3067125_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	51.9	3.7e-59
AWN70100.1|3067127_3068144_+|integrase	integrase	integrase	E5G6L0	Salmonella_phage	94.7	1.4e-188
AWN70101.1|3068154_3068823_+	hypothetical protein	NA	NA	NA	NA	NA
AWN70102.1|3069158_3070400_+	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	47.3	2.6e-101
3068909:3068955	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
AWN70103.1|3070538_3071633_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWN70104.1|3072890_3074052_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	2.6e-50
AWN70105.1|3074066_3075365_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWN70106.1|3075382_3076545_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AWN70107.1|3076572_3076806_-	hypothetical protein	NA	NA	NA	NA	NA
AWN72034.1|3077522_3081128_+	hypothetical protein	NA	NA	NA	NA	NA
AWN70108.1|3081166_3081913_+	hypothetical protein	NA	NA	NA	NA	NA
AWN70109.1|3081899_3082079_+	hypothetical protein	NA	NA	NA	NA	NA
AWN70110.1|3082346_3083228_-	hypothetical protein	NA	NA	NA	NA	NA
AWN70111.1|3083341_3083581_+	hypothetical protein	NA	A0A1V0E8E5	Vibrio_phage	49.2	2.5e-08
AWN70112.1|3083746_3084046_+	GTP-binding protein	NA	NA	NA	NA	NA
AWN70113.1|3084066_3085279_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	56.8	2.4e-99
>prophage 11
CP028381	Escherichia coli strain RM10466 chromosome, complete genome	5044460	3160673	3167813	5044460		Escherichia_phage(83.33%)	6	NA	NA
AWN70183.1|3160673_3163235_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
AWN70184.1|3163340_3163997_+	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
AWN70185.1|3164047_3164815_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	9.7e-70
AWN70186.1|3165010_3165919_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AWN70187.1|3165915_3167178_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	3.7e-135
AWN70188.1|3167174_3167813_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 1
CP028382	Escherichia coli strain RM10466 plasmid pRM10466-1, complete sequence	160675	71615	81057	160675		Cronobacter_phage(25.0%)	14	NA	NA
AWN72191.1|71615_73574_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.4	2.1e-20
AWN72192.1|73633_73867_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AWN72265.1|73924_74458_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	71.8	2.3e-46
AWN72193.1|75222_75657_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AWN72194.1|75670_75892_-	hypothetical protein	NA	NA	NA	NA	NA
AWN72195.1|75892_76576_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	5.1e-30
AWN72196.1|76652_76958_-	hypothetical protein	NA	NA	NA	NA	NA
AWN72266.1|76961_77864_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
AWN72268.1|77901_78171_-	hypothetical protein	NA	NA	NA	NA	NA
AWN72267.1|78282_78531_+	protein ImpC	NA	Q2A098	Sodalis_phage	46.7	4.1e-14
AWN72197.1|78527_78965_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	48.4	3.7e-26
AWN72198.1|78964_79957_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	59.2	2.3e-100
AWN72199.1|79986_80235_+	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	58.8	1.7e-20
AWN72200.1|80430_81057_+	cobyrinic acid ac-diamide synthase	NA	E5FFJ3	Burkholderia_phage	31.1	2.0e-17
>prophage 2
CP028382	Escherichia coli strain RM10466 plasmid pRM10466-1, complete sequence	160675	140623	148608	160675	transposase	Stx2-converting_phage(33.33%)	7	NA	NA
AWN72251.1|140623_142711_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	32.2	6.8e-09
AWN72252.1|142971_143394_-	entry exclusion protein 2	NA	NA	NA	NA	NA
AWN72253.1|144444_144900_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	45.2	2.3e-26
AWN72254.1|144886_145930_-	peptidase	NA	A0A1B0T6A2	Bacillus_phage	28.3	3.5e-06
AWN72255.1|146218_147811_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.8	2.3e-174
AWN72256.1|147841_148192_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	6.9e-39
AWN72257.1|148188_148608_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	88.7	6.5e-44
