The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029579	Escherichia coli strain DA33137 chromosome, complete genome	5261695	47264	87561	5261695	lysis,terminase,tail,head,portal,transposase,capsid	Enterobacteria_phage(53.85%)	52	NA	NA
AWO28503.1|47264_48725_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.7	5.1e-43
AWO28504.1|48813_50097_-	MFS transporter	NA	NA	NA	NA	NA
AWO28505.1|50882_51116_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AWO28506.1|51432_52023_+	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AWO28507.1|52250_52544_-	hypothetical protein	NA	NA	NA	NA	NA
AWO28508.1|52554_53259_-|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	1.2e-58
AWO28509.1|53268_53550_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.2e-17
AWO28510.1|53546_55946_-|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	55.3	3.9e-133
AWO28511.1|56010_56610_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	91.5	9.8e-102
AWO28512.1|56677_60157_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
AWO28513.1|60217_60859_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	86.5	1.1e-95
AWO28514.1|61504_62203_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	8.9e-131
AWO28515.1|62202_62532_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
AWO28516.1|62528_65090_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	95.9	0.0e+00
AWO28517.1|65082_65517_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AWO28518.1|65498_65921_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
AWO33293.1|65936_66677_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
AWO28519.1|66684_67080_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
AWO28520.1|67076_67655_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
AWO28521.1|67666_68020_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
AWO28522.1|68031_68430_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	2.3e-62
AWO28523.1|68471_69497_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	99.7	2.7e-192
AWO28524.1|69551_69884_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
AWO28525.1|69893_71213_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	2.2e-231
AWO28526.1|71193_72795_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
AWO28527.1|72791_72998_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AWO28528.1|72994_74920_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
AWO28529.1|74894_75440_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
AWO28530.1|75579_75681_-	hypothetical protein	NA	NA	NA	NA	NA
AWO28531.1|75828_76062_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	1.9e-21
AWO28532.1|76119_76530_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
AWO28533.1|76681_76855_-	protein GnsB	NA	NA	NA	NA	NA
AWO28534.1|77026_77299_-	hypothetical protein	NA	NA	NA	NA	NA
AWO28535.1|77329_77518_-	cold-shock protein	NA	NA	NA	NA	NA
AWO28536.1|77528_77741_-	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AWO28537.1|78103_78601_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
AWO28538.1|78597_79131_-	lysozyme from lambdoid prophage Qin	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
AWO28539.1|79127_79439_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
AWO28540.1|79443_79659_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
AWO28541.1|80412_80628_-	cold-shock protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
AWO28542.1|80928_81141_+	cold-shock protein CspF	NA	NA	NA	NA	NA
AWO28543.1|81562_82315_-	antitermination protein Q	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
AWO28544.1|82328_83378_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.0	2.8e-112
AWO28545.1|83379_83658_-	hypothetical protein	NA	NA	NA	NA	NA
AWO28546.1|83724_83976_-	hypothetical protein	NA	NA	NA	NA	NA
AWO28547.1|84192_84348_-	protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
AWO28548.1|84419_84707_-	mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
AWO28549.1|84706_84946_-	antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
AWO28550.1|84970_85276_+	hypothetical protein	NA	NA	NA	NA	NA
AWO28551.1|85478_85811_+	protein FlxA	NA	NA	NA	NA	NA
AWO28552.1|86080_86203_-	plasmid mobilization protein	NA	NA	NA	NA	NA
AWO28553.1|86247_87561_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP029579	Escherichia coli strain DA33137 chromosome, complete genome	5261695	92958	107121	5261695		Salmonella_phage(22.22%)	18	NA	NA
AWO28561.1|92958_93366_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
AWO28562.1|93534_93690_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
AWO28563.1|93649_94267_+	hypothetical protein	NA	NA	NA	NA	NA
AWO28564.1|94753_94942_+	division inhibition protein DicB	NA	NA	NA	NA	NA
AWO28565.1|94938_95130_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWO28566.1|95223_97695_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	1.2e-57
AWO28567.1|97767_98019_+	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
AWO28568.1|98038_99334_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.6	5.1e-156
AWO28569.1|99335_99464_-	transporter	NA	NA	NA	NA	NA
AWO28570.1|99521_100541_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
AWO28571.1|100552_101767_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AWO28572.1|101747_101936_-	hypothetical protein	NA	NA	NA	NA	NA
AWO28573.1|101972_102299_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.2e-23
AWO28574.1|102433_102775_+	DUF1283 domain-containing protein	NA	NA	NA	NA	NA
AWO28575.1|102809_103370_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AWO33294.1|103372_104083_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
AWO28576.1|104190_104496_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AWO28577.1|104694_107121_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.7e-213
>prophage 3
CP029579	Escherichia coli strain DA33137 chromosome, complete genome	5261695	456175	525903	5261695	lysis,terminase,tail,integrase,plate,holin,protease,head,portal,transposase,capsid	Shigella_phage(39.58%)	92	493706:493721	530863:530878
AWO33312.1|456175_456700_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.0	2.2e-33
AWO28918.1|456856_457654_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWO28919.1|457663_458215_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AWO28920.1|458383_458716_-	multidrug SMR transporter	NA	NA	NA	NA	NA
AWO28921.1|458792_458972_+|integrase	integrase	integrase	NA	NA	NA	NA
AWO33313.1|459059_459374_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
AWO28922.1|459418_459613_-	hypothetical protein	NA	NA	NA	NA	NA
AWO28923.1|459588_461247_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
AWO28924.1|461239_462235_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
AWO28925.1|462227_462914_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
AWO28926.1|462913_464287_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
AWO28927.1|464305_464749_+	flagellar protein FliJ	NA	NA	NA	NA	NA
AWO28928.1|464745_465873_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
AWO28929.1|465977_466442_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
AWO28930.1|466446_467451_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
AWO28931.1|467447_467861_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
AWO28932.1|467863_468229_+	flagellar protein FliO	NA	NA	NA	NA	NA
AWO28933.1|468228_468966_+	flagellar biosynthetic protein FliP	NA	NA	NA	NA	NA
AWO28934.1|468975_469245_+	flagellar biosynthetic protein FliQ	NA	NA	NA	NA	NA
AWO28935.1|469253_470039_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
AWO28936.1|470328_470952_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
AWO28937.1|470995_471238_-	hypothetical protein	NA	NA	NA	NA	NA
AWO28938.1|471170_471359_-	hypothetical protein	NA	NA	NA	NA	NA
AWO28939.1|471346_471574_+	DUF2525 domain-containing protein	NA	NA	NA	NA	NA
AWO28940.1|471871_472687_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
AWO28941.1|472683_474378_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
AWO28942.1|474298_474487_-	hypothetical protein	NA	NA	NA	NA	NA
AWO28943.1|474615_474798_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AWO28944.1|474876_475794_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AWO28945.1|475966_476887_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AWO28946.1|476875_477346_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	49.0	1.8e-34
AWO28947.1|477326_478745_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	4.0e-101
AWO28948.1|480853_482212_-	HAMP domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	19.4	5.1e-05
AWO33314.1|482211_482883_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
AWO28949.1|483015_483429_+	5-hydroxyisourate hydrolase	NA	NA	NA	NA	NA
AWO28950.1|483537_484542_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
AWO28951.1|484542_485178_+	sulfoxide reductase heme-binding subunit YedZ	NA	NA	NA	NA	NA
AWO28952.1|485434_486085_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
AWO28953.1|486120_486450_+	hypothetical protein	NA	NA	NA	NA	NA
AWO28954.1|487325_487505_-	hypothetical protein	NA	NA	NA	NA	NA
AWO28955.1|487544_489920_-|tail	tail fiber domain-containing protein	tail	O22004	Shigella_phage	71.8	1.1e-47
AWO28956.1|489923_490508_-	DUF2313 domain-containing protein	NA	O22003	Shigella_phage	99.0	4.6e-112
AWO28957.1|490498_491557_-|plate	phage baseplate protein	plate	M1FQW3	Enterobacteria_phage	99.1	2.5e-201
AWO28958.1|491543_491972_-|tail	phage tail protein	tail	U5P0R9	Shigella_phage	100.0	2.3e-81
AWO28959.1|491968_492517_-|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	98.4	3.3e-96
AWO28960.1|492516_493596_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.4	7.7e-206
AWO28961.1|493592_494966_-	DNA circularization protein	NA	U5P4I0	Shigella_phage	97.3	1.5e-243
493706:493721	attL	GCACCAGCGCGGGTAA	NA	NA	NA	NA
AWO28962.1|495022_495511_-	hypothetical protein	NA	NA	NA	NA	NA
AWO28963.1|495575_497477_-|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	99.1	0.0e+00
AWO28964.1|497561_497885_-|tail	phage tail assembly protein	tail	U5P0R5	Shigella_phage	99.1	1.1e-51
AWO28965.1|497881_498238_-|tail	phage tail protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
AWO28966.1|498237_499734_-|tail	phage tail protein	tail	S5FKL0	Shigella_phage	98.6	1.7e-275
AWO28967.1|499717_499888_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
AWO28968.1|499896_500457_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	97.8	9.8e-104
AWO28969.1|500453_500960_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.9	1.3e-83
AWO28970.1|500934_501345_-|head,tail	head-tail adaptor protein	head,tail	M1FJ87	Enterobacteria_phage	92.6	2.2e-68
AWO28971.1|501341_501665_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	99.1	2.2e-52
AWO28972.1|501742_502960_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	2.2e-161
AWO28973.1|502974_503574_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
AWO28974.1|503566_504793_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	95.3	3.0e-230
AWO28975.1|504940_506674_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	97.3	0.0e+00
AWO28976.1|506670_507174_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	97.6	1.3e-86
AWO28977.1|507290_507641_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	98.3	2.1e-64
AWO33315.1|507712_508057_-	DUF2441 domain-containing protein	NA	I6PCV9	Cronobacter_phage	47.3	2.7e-27
AWO28978.1|508426_508894_-|lysis	lysis protein	lysis	A0A192Y689	Salmonella_phage	84.5	1.8e-66
AWO28979.1|508890_509367_-	lysozyme	NA	K7PKV2	Enterobacteria_phage	96.8	1.2e-83
AWO28980.1|509370_509706_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	98.2	5.7e-59
AWO28981.1|509802_511194_-	ATP-binding protein	NA	NA	NA	NA	NA
AWO28982.1|511333_511912_-	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	53.3	6.2e-45
AWO28983.1|511926_512919_-	hypothetical protein	NA	S5FV02	Shigella_phage	80.3	2.5e-155
AWO28984.1|512920_513199_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	5.1e-05
AWO28985.1|513265_513517_-	hypothetical protein	NA	NA	NA	NA	NA
AWO28986.1|513733_513889_-	protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
AWO28987.1|514147_514327_-	hypothetical protein	NA	NA	NA	NA	NA
AWO28988.1|514447_514963_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	77.6	1.2e-36
AWO28989.1|515128_515311_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
AWO28990.1|515404_515761_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	1.1e-57
AWO28991.1|515738_516200_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	91.7	3.8e-37
AWO28992.1|516196_516493_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
AWO28993.1|516489_516897_-	DUF977 domain-containing protein	NA	A0A088CBK9	Shigella_phage	63.3	1.6e-39
AWO28994.1|516897_517668_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.8	1.8e-87
AWO28995.1|517701_518367_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.4e-79
AWO28996.1|519167_519719_-	hypothetical protein	NA	NA	NA	NA	NA
AWO28997.1|519702_519930_-	transcriptional regulator	NA	NA	NA	NA	NA
AWO28998.1|519956_520415_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	6.2e-24
AWO28999.1|520604_520757_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	1.7e-07
AWO33316.1|520768_521143_+	hypothetical protein	NA	NA	NA	NA	NA
AWO29000.1|521675_521864_+	cell division inhibitor	NA	NA	NA	NA	NA
AWO29001.1|521860_522049_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWO29002.1|522144_524616_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	58.2	2.7e-57
AWO29003.1|524674_524878_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AWO29004.1|524877_525903_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	2.0e-102
530863:530878	attR	GCACCAGCGCGGGTAA	NA	NA	NA	NA
>prophage 4
CP029579	Escherichia coli strain DA33137 chromosome, complete genome	5261695	633808	641326	5261695		Escherichia_phage(42.86%)	8	NA	NA
AWO29087.1|633808_634357_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.4	4.4e-48
AWO29088.1|634361_635240_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	64.5	1.9e-106
AWO29089.1|635297_636197_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.1	1.7e-28
AWO29090.1|636196_637282_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	2.3e-101
AWO29091.1|637353_637617_+	hypothetical protein	NA	NA	NA	NA	NA
AWO29092.1|637653_638547_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
AWO29093.1|638778_639774_-	N-acetyl-alpha-D-glucosaminyl-diphospho-ditrans, octacis-undecaprenol 4-epimerase	NA	A0A1V0QG29	Shearwaterpox_virus	26.0	2.5e-09
AWO29094.1|639931_641326_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	9.8e-20
>prophage 5
CP029579	Escherichia coli strain DA33137 chromosome, complete genome	5261695	688731	748777	5261695	lysis,terminase,tRNA,tail,holin,plate,integrase,head,portal,capsid	Escherichia_phage(42.59%)	64	701656:701671	739412:739427
AWO29129.1|688731_690135_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	2.7e-33
AWO29130.1|690131_690854_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
AWO29131.1|691033_691366_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AWO29132.1|691513_692875_+	U32 family peptidase	NA	Q6DW11	Phage_TP	99.2	1.6e-216
AWO29133.1|693147_693402_-	DNA-binding transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	100.0	6.1e-45
AWO29134.1|693447_694611_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	1.8e-205
AWO29135.1|694610_695090_-|tail	phage tail protein	tail	O64315	Escherichia_phage	98.1	9.6e-84
AWO29136.1|695104_697552_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.7	0.0e+00
AWO29137.1|697544_697664_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AWO29138.1|697696_697972_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
AWO29139.1|698028_698547_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	3.2e-93
AWO29140.1|698559_699750_-|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	9.0e-224
AWO29141.1|700079_700673_-	lysogenic conversion protein	NA	Q858S7	Enterobacteria_phage	99.0	1.0e-106
AWO29142.1|700894_701422_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	92.6	4.9e-89
AWO29143.1|701423_703445_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	64.5	2.7e-260
701656:701671	attL	TTGCCAGGAATAACTT	NA	NA	NA	NA
AWO29144.1|703455_703986_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
AWO29145.1|703978_704887_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	4.4e-162
AWO29146.1|704891_705239_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
AWO29147.1|705235_705871_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.5	1.2e-113
AWO29148.1|705954_706740_+	hypothetical protein	NA	NA	NA	NA	NA
AWO29149.1|706811_707264_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	98.0	1.5e-75
AWO29150.1|707256_707724_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	2.5e-81
AWO29151.1|707686_707860_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	91.2	9.8e-23
AWO29152.1|707831_708257_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	98.6	1.9e-67
AWO29153.1|708244_708670_-	protein lysA	NA	U5N096	Enterobacteria_phage	95.7	2.3e-57
AWO29154.1|708684_709182_-	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
AWO29155.1|709181_709463_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
AWO29156.1|709466_709670_-|tail	phage tail protein	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
AWO29157.1|709669_710179_-|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	100.0	8.6e-91
AWO29158.1|710278_711022_-|terminase	terminase	terminase	A0A0F7LDU4	Escherichia_phage	99.2	3.0e-124
AWO29159.1|711025_712099_-|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.2	2.5e-201
AWO29160.1|712157_713012_-|capsid	capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	98.2	8.1e-134
AWO29161.1|713185_714958_+	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
AWO29162.1|714957_715992_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.4	7.1e-201
AWO29163.1|716504_717869_+	FRG domain-containing protein	NA	Q9AZ51	Lactococcus_phage	34.1	6.7e-05
AWO29164.1|717977_718928_-	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	40.8	4.6e-37
AWO29165.1|718893_719214_-	XRE family transcriptional regulator	NA	E5E3S9	Burkholderia_phage	38.7	5.9e-13
AWO29166.1|719250_719544_-	hypothetical protein	NA	NA	NA	NA	NA
AWO29167.1|719822_722111_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.2	0.0e+00
AWO29168.1|722100_722376_-	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
AWO29169.1|722372_722597_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	5.0e-35
AWO29170.1|722596_722899_-	hypothetical protein	NA	A0A0F7LDT6	Escherichia_phage	99.0	2.2e-46
AWO29171.1|722898_723123_-	DUF2732 domain-containing protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
AWO29172.1|723187_723688_-	replication protein B	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
AWO29173.1|723684_723882_-	hypothetical protein	NA	A0A0F7LDS9	Escherichia_phage	100.0	2.8e-29
AWO29174.1|723865_724222_-	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	100.0	1.1e-63
AWO29175.1|724326_724638_+	XRE family transcriptional regulator	NA	Q1JS25	Enterobacteria_phage	100.0	4.3e-53
AWO29176.1|724731_725727_+|integrase	integrase	integrase	A0A0F7LBR0	Escherichia_phage	99.7	7.1e-190
AWO29177.1|725758_726556_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
AWO29178.1|726765_728196_-	amino acid permease	NA	NA	NA	NA	NA
AWO29179.1|728405_729554_-	MFS transporter	NA	NA	NA	NA	NA
AWO29180.1|729868_730495_+	hydrolase	NA	NA	NA	NA	NA
AWO29181.1|730530_731394_-	dimethyl sulfoxide reductase	NA	NA	NA	NA	NA
AWO29182.1|731395_732013_-	dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
AWO29183.1|732023_734468_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	5.0e-221
AWO29184.1|734706_735999_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
AWO29185.1|736089_737433_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
AWO29186.1|737443_738055_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AWO29187.1|738213_742281_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
739412:739427	attR	TTGCCAGGAATAACTT	NA	NA	NA	NA
AWO29188.1|742415_742910_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AWO29189.1|743454_744420_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
AWO29190.1|744542_746309_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
AWO29191.1|746309_748031_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	2.2e-21
AWO29192.1|748072_748777_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
>prophage 6
CP029579	Escherichia coli strain DA33137 chromosome, complete genome	5261695	1304176	1339626	5261695	transposase,protease,tRNA	Moraxella_phage(16.67%)	34	NA	NA
AWO29661.1|1304176_1306531_-|protease	Lon protease	protease	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
AWO29662.1|1306718_1307993_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
AWO29663.1|1308118_1308742_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
AWO29664.1|1308987_1310286_-	trigger factor	NA	NA	NA	NA	NA
AWO29665.1|1310432_1310696_-	hypothetical protein	NA	NA	NA	NA	NA
AWO29666.1|1310629_1310947_-	protein BolA	NA	NA	NA	NA	NA
AWO29667.1|1311070_1311202_+	polymerase	NA	NA	NA	NA	NA
AWO29668.1|1311251_1311830_+	hypothetical protein	NA	NA	NA	NA	NA
AWO29669.1|1311873_1313349_+	muropeptide transporter AmpG	NA	NA	NA	NA	NA
AWO29670.1|1313808_1314756_+	cytochrome ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AWO29671.1|1314777_1316769_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AWO29672.1|1316758_1317373_+	cytochrome bo(3) ubiquinol oxidase subunit 3	NA	NA	NA	NA	NA
AWO29673.1|1317372_1317702_+	cytochrome bo(3) ubiquinol oxidase subunit 4	NA	NA	NA	NA	NA
AWO29674.1|1317713_1318604_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
AWO29675.1|1318752_1320117_+	MFS transporter	NA	NA	NA	NA	NA
AWO29676.1|1320244_1320736_-	nucleotide-binding protein	NA	NA	NA	NA	NA
AWO29677.1|1320903_1321815_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AWO29678.1|1321777_1322368_+	protein deglycase YajL	NA	NA	NA	NA	NA
AWO29679.1|1322421_1323870_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
AWO29680.1|1324075_1324318_+	exodeoxyribonuclease 7 small subunit	NA	NA	NA	NA	NA
AWO29681.1|1324317_1325217_+	farnesyl-diphosphate synthase	NA	NA	NA	NA	NA
AWO29682.1|1325241_1327104_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AWO29683.1|1327158_1328133_+	aldo/keto reductase	NA	NA	NA	NA	NA
AWO29684.1|1330112_1330628_-	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
AWO29685.1|1330605_1331583_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
AWO29686.1|1331660_1332080_-	N utilization substance protein B	NA	NA	NA	NA	NA
AWO29687.1|1332099_1332570_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
AWO29688.1|1332658_1333762_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.8	6.3e-54
AWO29689.1|1333765_1334215_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AWO29690.1|1334589_1335747_-|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	93.5	4.0e-200
AWO29691.1|1336949_1337834_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
AWO29692.1|1337871_1338219_-	HNH endonuclease	NA	NA	NA	NA	NA
AWO29693.1|1338405_1338915_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
AWO29694.1|1339116_1339626_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
>prophage 7
CP029579	Escherichia coli strain DA33137 chromosome, complete genome	5261695	1933404	1958417	5261695	transposase,holin	Stx2-converting_phage(14.29%)	23	NA	NA
AWO30225.1|1933404_1934790_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
AWO30226.1|1935028_1936402_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
AWO30227.1|1936765_1936975_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.0	5.9e-06
AWO30228.1|1937137_1937395_-	biofilm development YmgB/AriR family protein	NA	NA	NA	NA	NA
AWO30229.1|1937439_1937628_+	hypothetical protein	NA	NA	NA	NA	NA
AWO30230.1|1939144_1939666_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
AWO30231.1|1939662_1940616_+	protein FecR	NA	NA	NA	NA	NA
AWO30232.1|1940702_1943027_+	fe(3+) dicitrate transporter fecA	NA	NA	NA	NA	NA
AWO30233.1|1943071_1943974_+	Fe(3+)-dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
AWO30234.1|1943970_1944969_+	Fe3+ dicitrate ABC transporter permease	NA	NA	NA	NA	NA
AWO30235.1|1944965_1945922_+	iron-dicitrate transporter subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	2.4e-17
AWO30236.1|1945922_1946690_+	Fe(3+) dicitrate transport ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
AWO30237.1|1947246_1947660_-	hypothetical protein	NA	NA	NA	NA	NA
AWO30238.1|1948437_1949593_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.1e-68
AWO30239.1|1949741_1951745_+|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.5e-21
AWO30240.1|1951689_1951848_+|holin	choline transporter	holin	NA	NA	NA	NA
AWO30241.1|1951807_1952221_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
AWO30242.1|1952155_1953323_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.8e-184
AWO30243.1|1953636_1953894_+	hypothetical protein	NA	NA	NA	NA	NA
AWO30244.1|1953946_1954072_-	hypothetical protein	NA	NA	NA	NA	NA
AWO33377.1|1954114_1955233_-	oxidoreductase	NA	NA	NA	NA	NA
AWO30245.1|1955244_1956462_-	MFS transporter	NA	NA	NA	NA	NA
AWO30246.1|1957088_1958417_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 8
CP029579	Escherichia coli strain DA33137 chromosome, complete genome	5261695	2178432	2230674	5261695	tRNA,terminase,tail,integrase,plate,holin,protease,head,portal,capsid	Shigella_phage(41.51%)	70	2172841:2172856	2206575:2206590
2172841:2172856	attL	GCGCACGGCGCATCAC	NA	NA	NA	NA
AWO30459.1|2178432_2178609_-|integrase	integrase	integrase	NA	NA	NA	NA
AWO30460.1|2178567_2178849_+	hypothetical protein	NA	NA	NA	NA	NA
AWO30461.1|2178947_2179484_-	ssDNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
AWO30462.1|2179738_2182561_+	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
AWO30463.1|2182595_2182952_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
AWO30464.1|2182955_2183372_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
AWO30465.1|2183482_2184196_-	acid phosphatase AphA	NA	NA	NA	NA	NA
AWO30466.1|2184557_2185100_+	hypothetical protein	NA	NA	NA	NA	NA
AWO30467.1|2185321_2186515_-	aromatic amino acid transaminase	NA	NA	NA	NA	NA
AWO30468.1|2186767_2187847_-	alanine racemase biosynthetic	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
AWO30469.1|2187899_2189315_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
AWO30470.1|2189397_2190381_+	quinone oxidoreductase	NA	NA	NA	NA	NA
AWO30471.1|2190546_2190789_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
AWO30472.1|2190922_2191960_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AWO30473.1|2192048_2193146_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	3.3e-212
AWO30474.1|2193207_2193456_+	damage-inducible protein DinI	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
AWO30475.1|2193732_2193912_-	hypothetical protein	NA	NA	NA	NA	NA
AWO30476.1|2193951_2196327_-|tail	tail fiber domain-containing protein	tail	O22004	Shigella_phage	71.8	1.1e-47
AWO30477.1|2196330_2196915_-	DUF2313 domain-containing protein	NA	O22003	Shigella_phage	99.0	4.6e-112
AWO30478.1|2196905_2197964_-|plate	phage baseplate protein	plate	M1FQW3	Enterobacteria_phage	98.9	3.6e-200
AWO30479.1|2197950_2198379_-|tail	phage tail protein	tail	U5P0R9	Shigella_phage	100.0	2.3e-81
AWO30480.1|2198375_2198924_-|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	98.4	3.3e-96
AWO30481.1|2198923_2200003_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	4.5e-206
AWO30482.1|2199999_2201370_-	DNA circularization protein	NA	S5FUX4	Shigella_phage	98.2	2.1e-253
AWO30483.1|2201388_2203224_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	99.3	1.3e-306
AWO30484.1|2203216_2203399_-	hypothetical protein	NA	NA	NA	NA	NA
AWO30485.1|2203365_2203635_-|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
AWO30486.1|2203634_2203991_-|tail	phage tail protein	tail	U5P076	Shigella_phage	99.2	9.0e-63
AWO30487.1|2203990_2205487_-|tail	phage tail protein	tail	M1FN90	Enterobacteria_phage	99.0	1.0e-272
AWO30488.1|2205470_2205641_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
AWO30489.1|2205649_2206210_-	hypothetical protein	NA	Q8SBH4	Shigella_phage	99.5	1.8e-105
AWO30490.1|2206206_2206713_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.9	1.3e-83
2206575:2206590	attR	GCGCACGGCGCATCAC	NA	NA	NA	NA
AWO30491.1|2206687_2207098_-|head,tail	head-tail adaptor protein	head,tail	M1FJ87	Enterobacteria_phage	92.6	6.3e-68
AWO30492.1|2207094_2207418_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	98.1	5.0e-52
AWO30493.1|2207496_2208726_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.0	2.2e-225
AWO30494.1|2208736_2209339_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	99.5	2.0e-110
AWO30495.1|2209331_2210558_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	99.3	6.4e-241
AWO30496.1|2210705_2212439_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.9	0.0e+00
AWO30497.1|2212435_2212939_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	99.4	5.2e-88
AWO33387.1|2213060_2213411_-	endonuclease	NA	Q8HA82	Salmonella_phage	81.0	7.1e-52
AWO30498.1|2213751_2213982_-	hypothetical protein	NA	NA	NA	NA	NA
AWO33388.1|2213959_2214166_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	78.6	5.1e-18
AWO30499.1|2214122_2214392_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	67.8	1.9e-20
AWO30500.1|2214399_2215014_-	endolysin	NA	Q8HA86	Salmonella_phage	81.9	6.5e-93
AWO30501.1|2215013_2215295_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	47.1	7.0e-18
AWO30502.1|2215281_2215668_-	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	99.2	2.0e-60
AWO33389.1|2215747_2216005_-	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	95.3	5.6e-38
AWO30503.1|2216155_2216908_-	antitermination protein	NA	Q8SBE4	Shigella_phage	99.2	3.1e-137
AWO30504.1|2217918_2218728_-	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	98.9	2.8e-152
AWO30505.1|2218747_2219137_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	98.4	3.9e-67
AWO30506.1|2219133_2219787_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	98.6	2.1e-126
AWO30507.1|2219881_2220874_-	hypothetical protein	NA	U5P0A0	Shigella_phage	98.2	1.2e-93
AWO30508.1|2220830_2221043_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	5.4e-15
AWO33390.1|2221218_2221803_-	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	60.9	5.5e-57
AWO30509.1|2221840_2222041_-	cell division protein	NA	NA	NA	NA	NA
AWO30510.1|2222138_2222765_+	helix-turn-helix domain-containing protein	NA	K7PM82	Enterobacteria_phage	48.8	3.2e-47
AWO30511.1|2223120_2223615_-	hypothetical protein	NA	NA	NA	NA	NA
AWO30512.1|2224183_2224546_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
AWO30513.1|2224611_2225436_+	hypothetical protein	NA	U5P439	Shigella_phage	98.9	8.6e-149
AWO30514.1|2225563_2226100_+	HD family hydrolase	NA	S5MW55	Escherichia_phage	99.4	4.8e-100
AWO33391.1|2226096_2226501_+	hypothetical protein	NA	K7P7C5	Enterobacteria_phage	49.4	8.8e-22
AWO30515.1|2226497_2226992_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	78.1	5.8e-68
AWO30516.1|2226978_2227536_+	hypothetical protein	NA	Q08J58	Stx2-converting_phage	60.9	2.4e-70
AWO30517.1|2227537_2227729_+	hypothetical protein	NA	G9L660	Escherichia_phage	100.0	9.5e-27
AWO30518.1|2227731_2228466_+	DUF551 domain-containing protein	NA	S5MC19	Escherichia_phage	98.4	1.6e-138
AWO30519.1|2228465_2229038_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	100.0	2.4e-110
AWO30520.1|2229074_2229347_+	pyocin activator protein PrtN	NA	S5MQM5	Escherichia_phage	96.6	5.7e-41
AWO30521.1|2229380_2229842_-	hypothetical protein	NA	NA	NA	NA	NA
AWO30522.1|2229847_2230429_-	DUF4065 domain-containing protein	NA	A0A139ZPG5	Marinitoga_camini_virus	29.6	8.8e-07
AWO30523.1|2230551_2230674_-|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
>prophage 9
CP029579	Escherichia coli strain DA33137 chromosome, complete genome	5261695	3818824	3825964	5261695		Escherichia_phage(83.33%)	6	NA	NA
AWO31960.1|3818824_3819463_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AWO31961.1|3819459_3820722_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
AWO31962.1|3820718_3821627_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.1e-117
AWO31963.1|3821822_3822590_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
AWO31964.1|3822640_3823297_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	5.0e-51
AWO31965.1|3823402_3825964_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	9.2e-32
>prophage 10
CP029579	Escherichia coli strain DA33137 chromosome, complete genome	5261695	4447583	4457026	5261695		Enterobacteria_phage(85.71%)	10	NA	NA
AWO32511.1|4447583_4448510_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
AWO32512.1|4448514_4449246_+	ABC transporter permease	NA	NA	NA	NA	NA
AWO32513.1|4449226_4449334_-	hypothetical protein	NA	NA	NA	NA	NA
AWO32514.1|4449393_4450125_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
AWO32515.1|4450346_4452032_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.5	7.3e-304
AWO32516.1|4452028_4452748_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AWO32517.1|4452794_4453265_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AWO32518.1|4453306_4453768_-	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AWO32519.1|4453892_4455893_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
AWO32520.1|4455889_4457026_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	2.5e-162
>prophage 11
CP029579	Escherichia coli strain DA33137 chromosome, complete genome	5261695	4468465	4566720	5261695	lysis,tRNA,terminase,tail,integrase,holin,plate,protease,head,portal,capsid	Escherichia_phage(39.22%)	98	4450039:4450056	4574586:4574603
4450039:4450056	attL	CAATCCGTAACGCCTCTG	NA	NA	NA	NA
AWO32523.1|4468465_4470499_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.3	2.3e-54
AWO32524.1|4470630_4471740_+	protein mrp	NA	NA	NA	NA	NA
AWO32525.1|4472002_4472284_+	DUF2574 domain-containing protein	NA	NA	NA	NA	NA
AWO32526.1|4472207_4472390_-	hypothetical protein	NA	NA	NA	NA	NA
AWO32527.1|4472579_4473122_+	hypothetical protein	NA	NA	NA	NA	NA
AWO32528.1|4473202_4473877_+	fimbrial assembly protein	NA	NA	NA	NA	NA
AWO32529.1|4473892_4476373_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AWO32530.1|4476388_4477423_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
AWO32531.1|4477504_4477843_-	nickel/cobalt homeostasis protein RcnB	NA	NA	NA	NA	NA
AWO32532.1|4478061_4478886_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
AWO32533.1|4479006_4479279_+	transcriptional regulator	NA	NA	NA	NA	NA
AWO32534.1|4479501_4480290_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
AWO32535.1|4480286_4481087_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AWO32536.1|4481151_4481970_+	hypothetical protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.1e-23
AWO32537.1|4482021_4482768_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWO32538.1|4482741_4483707_-	sugar kinase	NA	NA	NA	NA	NA
AWO32539.1|4483703_4484708_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.7	4.4e-14
AWO32540.1|4484704_4485982_-	MFS transporter	NA	NA	NA	NA	NA
AWO32541.1|4486238_4487291_+	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
AWO32542.1|4487520_4488375_+	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
AWO32543.1|4489670_4490123_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
AWO32544.1|4490153_4490438_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
AWO32545.1|4490441_4491797_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
AWO32546.1|4491844_4492885_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
AWO32547.1|4492984_4493764_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AWO32548.1|4493845_4494745_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	4.8e-12
AWO32549.1|4495159_4495477_+	hypothetical protein	NA	NA	NA	NA	NA
AWO32550.1|4495464_4495656_+	hypothetical protein	NA	NA	NA	NA	NA
AWO32551.1|4495753_4496767_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
AWO32552.1|4496882_4497182_-	XRE family transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
AWO32553.1|4497296_4497572_+	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
AWO32554.1|4497749_4498250_+	replication protein B	NA	M1SV55	Escherichia_phage	99.4	1.3e-91
AWO32555.1|4498313_4498538_+	DUF2732 domain-containing protein	NA	S4TP68	Salmonella_phage	98.6	3.0e-32
AWO32556.1|4498537_4498840_+	hypothetical protein	NA	Q7Y4C1	Escherichia_virus	98.0	1.5e-45
AWO32557.1|4498839_4499064_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
AWO32558.1|4499060_4499336_+	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	98.9	6.6e-45
AWO32559.1|4499325_4501611_+	replication endonuclease	NA	Q858T4	Yersinia_virus	97.5	0.0e+00
AWO32560.1|4501607_4501937_+	DUF3850 domain-containing protein	NA	Q7Y4B7	Escherichia_virus	98.7	5.1e-36
AWO32561.1|4501975_4502737_-	hypothetical protein	NA	P79670	Escherichia_phage	100.0	3.2e-142
AWO32562.1|4502911_4504672_-	Overcoming lysogenization defect protein	NA	NA	NA	NA	NA
AWO32563.1|4505054_4506089_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.7	2.7e-200
AWO32564.1|4506088_4507861_-	oxidoreductase	NA	A0A0F7LCM8	Escherichia_phage	100.0	0.0e+00
AWO32565.1|4508034_4508889_+|capsid	capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
AWO32566.1|4508947_4510021_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.2	2.5e-201
AWO32567.1|4510024_4510768_+|terminase	terminase	terminase	A0A0F7LDU4	Escherichia_phage	99.2	3.0e-124
AWO32568.1|4510867_4511377_+|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	100.0	8.6e-91
AWO32569.1|4511376_4511580_+|tail	phage tail protein	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
AWO32570.1|4511583_4511865_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
AWO32571.1|4511864_4512362_+	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
AWO32572.1|4512376_4512802_+	protein lysA	NA	U5N096	Enterobacteria_phage	95.7	2.3e-57
AWO32573.1|4512789_4513215_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	98.6	1.9e-67
AWO32574.1|4513186_4513360_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	91.2	9.8e-23
AWO32575.1|4513322_4513790_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	2.5e-81
AWO32576.1|4513782_4514235_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	98.0	1.5e-75
AWO32577.1|4514337_4515411_-	hypothetical protein	NA	NA	NA	NA	NA
AWO33482.1|4515497_4516127_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	95.2	1.8e-106
AWO32578.1|4516123_4516471_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
AWO32579.1|4516475_4517384_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	100.0	1.2e-162
AWO32580.1|4517376_4517907_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	98.9	3.9e-102
AWO32581.1|4517917_4519942_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	71.9	6.5e-299
AWO32582.1|4519943_4520471_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	92.6	8.3e-89
AWO32583.1|4520761_4521988_+	DUF4263 domain-containing protein	NA	Q858S8	Enterobacteria_phage	99.4	1.1e-181
AWO32584.1|4522274_4523465_+|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	9.0e-224
AWO32585.1|4523477_4523996_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	3.2e-93
AWO32586.1|4524052_4524328_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
AWO32587.1|4524360_4524480_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AWO32588.1|4524472_4526920_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.7	0.0e+00
AWO32589.1|4526934_4527414_+|tail	phage tail protein	tail	O64315	Escherichia_phage	98.1	9.6e-84
AWO32590.1|4527413_4528577_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	1.8e-205
AWO32591.1|4528566_4528878_+	DNA-binding transcriptional regulator	NA	M1SNR2	Escherichia_phage	99.0	1.4e-51
AWO32592.1|4529197_4531480_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
AWO32593.1|4531534_4532392_-	formate transporter FocA	NA	NA	NA	NA	NA
AWO32594.1|4532797_4534558_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
AWO32595.1|4534687_4535380_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AWO32596.1|4535578_4536667_+	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
AWO32597.1|4536737_4538021_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AWO32598.1|4538190_4538955_+|protease	metalloprotease	protease	NA	NA	NA	NA
AWO32599.1|4539127_4539811_+	(d)CMP kinase	NA	NA	NA	NA	NA
AWO32600.1|4539921_4541595_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
AWO32601.1|4541754_4542039_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
AWO32602.1|4542245_4544510_+	ComEC family protein	NA	NA	NA	NA	NA
AWO32603.1|4544546_4546295_+	lipid A export ATP-binding/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
AWO32604.1|4546291_4547278_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AWO32605.1|4547314_4548547_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AWO32606.1|4548598_4548781_+	protein YcaR	NA	NA	NA	NA	NA
AWO32607.1|4548777_4549524_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AWO32608.1|4549677_4550571_+	hypothetical protein	NA	NA	NA	NA	NA
AWO32609.1|4550547_4551327_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
AWO32610.1|4551462_4552248_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
AWO32611.1|4552244_4553567_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
AWO32612.1|4553547_4554252_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
AWO32613.1|4554251_4558712_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
AWO32614.1|4558972_4560820_+	L,D-transpeptidase	NA	NA	NA	NA	NA
AWO33483.1|4561000_4561549_+	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
AWO32615.1|4561575_4562223_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AWO32616.1|4562273_4563464_-	aspartate aminotransferase	NA	NA	NA	NA	NA
AWO32617.1|4563648_4564722_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	55.1	2.3e-101
AWO32618.1|4565319_4566720_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
4574586:4574603	attR	CAATCCGTAACGCCTCTG	NA	NA	NA	NA
>prophage 12
CP029579	Escherichia coli strain DA33137 chromosome, complete genome	5261695	4738498	4813343	5261695	lysis,terminase,tRNA,tail,holin,integrase,head,transposase,capsid	Enterobacteria_phage(38.78%)	91	4738402:4738461	4812737:4813454
4738402:4738461	attL	TTTTTGTGCACAGAAAACCCCCAGCTAGGCTGGGGGTTCCGGAAAGCTTTCAGCTTTAAG	NA	NA	NA	NA
AWO32794.1|4738498_4739008_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
AWO32795.1|4739129_4740092_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
AWO32796.1|4740235_4743682_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
AWO32797.1|4743809_4744883_-	hypothetical protein	NA	NA	NA	NA	NA
AWO32798.1|4745143_4746343_+	lipoprotein-releasing system protein LolC	NA	NA	NA	NA	NA
AWO32799.1|4746335_4747037_+	lipoprotein-releasing system ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	39.8	5.4e-35
AWO32800.1|4747036_4748281_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
AWO32801.1|4748309_4749221_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AWO32802.1|4749236_4750058_+	NAD-dependent deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
AWO32803.1|4750194_4750980_-	hypothetical protein	NA	NA	NA	NA	NA
AWO32804.1|4750976_4751438_-	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
AWO32805.1|4751495_4752542_-	spermidine/putrescine-binding periplasmic protein	NA	NA	NA	NA	NA
AWO32806.1|4752538_4753333_-	spermidine/putrescine ABC transporter permease	NA	NA	NA	NA	NA
AWO32807.1|4753499_4754618_-|integrase	integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
AWO32808.1|4754586_4754856_-	excisionase	NA	NA	NA	NA	NA
AWO32809.1|4754917_4757389_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
AWO32810.1|4757482_4757674_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWO32811.1|4757670_4757859_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AWO33492.1|4758208_4758463_+	hypothetical protein	NA	NA	NA	NA	NA
AWO32812.1|4758427_4758646_-	hypothetical protein	NA	NA	NA	NA	NA
AWO32813.1|4758717_4759017_-	hypothetical protein	NA	NA	NA	NA	NA
AWO32814.1|4759000_4759159_-	hypothetical protein	NA	NA	NA	NA	NA
AWO32815.1|4759343_4759763_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
AWO32816.1|4759863_4760145_+	Cro/Cl family transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
AWO32817.1|4760128_4760554_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AWO33493.1|4760576_4761539_+	DNA-binding protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
AWO32818.1|4761579_4762002_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	91.4	3.3e-64
AWO32819.1|4762059_4762416_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
AWO32820.1|4762509_4762692_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
AWO32821.1|4763344_4763524_+	hypothetical protein	NA	NA	NA	NA	NA
AWO32822.1|4763726_4763939_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
AWO32823.1|4764106_4764385_+	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
AWO32824.1|4764386_4765445_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	7.5e-89
AWO32825.1|4765445_4765826_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.3e-35
AWO32826.1|4765822_4766644_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	5.1e-77
AWO33494.1|4767038_4767125_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
AWO32827.1|4767613_4767826_-	hypothetical protein	NA	NA	NA	NA	NA
AWO32828.1|4767896_4768232_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	1.4e-44
AWO32829.1|4768492_4768681_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
AWO32830.1|4768677_4768839_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	91.3	5.4e-15
AWO32831.1|4768988_4769204_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
AWO32832.1|4769208_4770099_+	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	70.9	2.1e-108
AWO32833.1|4770135_4770669_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	6.7e-102
AWO32834.1|4770792_4771008_+	hypothetical protein	NA	NA	NA	NA	NA
AWO33495.1|4771156_4771624_+|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	84.4	6.7e-66
AWO32835.1|4771880_4772261_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	2.6e-39
AWO32836.1|4772383_4772737_-	hypothetical protein	NA	NA	NA	NA	NA
AWO33496.1|4772624_4772945_-	hypothetical protein	NA	NA	NA	NA	NA
AWO32837.1|4772879_4773098_+	DNA-packaging protein	NA	NA	NA	NA	NA
AWO32838.1|4773219_4773729_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
AWO32839.1|4773700_4775629_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	1.4e-261
AWO32840.1|4775612_4775819_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	55.4	3.0e-10
AWO32841.1|4777396_4778902_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.1	1.0e-99
AWO32842.1|4778938_4779286_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	59.1	6.8e-23
AWO32843.1|4779343_4780372_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.4e-116
AWO32844.1|4780375_4780798_+	hypothetical protein	NA	NA	NA	NA	NA
AWO32845.1|4780790_4781144_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
AWO32846.1|4781159_4781735_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	56.8	1.6e-48
AWO32847.1|4781731_4782127_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
AWO32848.1|4782134_4782887_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	2.7e-133
AWO32849.1|4782900_4783332_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	1.8e-41
AWO32850.1|4783358_4783772_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
AWO32851.1|4783752_4786314_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.5	0.0e+00
AWO32852.1|4786310_4786640_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AWO32853.1|4786639_4787338_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	3.2e-128
AWO32854.1|4787348_4788092_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
AWO32855.1|4787989_4788670_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.9	3.7e-113
AWO32856.1|4789013_4792706_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	86.0	0.0e+00
AWO32857.1|4792773_4793373_+	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
AWO32858.1|4793524_4796551_+	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	54.6	1.4e-55
AWO32859.1|4796550_4797135_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
AWO32860.1|4797107_4797245_+|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AWO33497.1|4797189_4797816_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWO32861.1|4797914_4798181_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.8	1.5e-17
AWO32862.1|4798412_4799276_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
AWO32863.1|4799259_4800396_-	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
AWO33498.1|4800374_4800590_-	hypothetical protein	NA	NA	NA	NA	NA
AWO32864.1|4800645_4801872_+	peptidase T	NA	NA	NA	NA	NA
AWO32865.1|4801920_4803042_-	50S ribosomal protein L16 arginine hydroxylase	NA	NA	NA	NA	NA
AWO32866.1|4803117_4804578_-	sensor protein PhoQ	NA	NA	NA	NA	NA
AWO32867.1|4804577_4805249_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AWO32868.1|4805418_4806789_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
AWO33499.1|4806792_4807434_-	lysogenization protein HflD	NA	NA	NA	NA	NA
AWO32869.1|4807469_4808576_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AWO32870.1|4808629_4809091_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AWO32871.1|4809100_4809739_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AWO32872.1|4810071_4810407_-	DUF1493 domain-containing protein	NA	NA	NA	NA	NA
AWO32873.1|4810406_4810856_-	hypothetical protein	NA	NA	NA	NA	NA
AWO32874.1|4811438_4812689_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	98.1	6.5e-23
AWO32875.1|4812724_4812928_+	hypothetical protein	NA	NA	NA	NA	NA
AWO32876.1|4812833_4813343_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
4812737:4813454	attR	TTTTTGTGCACAGAAAACCCCCAGCTAGGCTGGGGGTTCCGGAAAGCTTTCAGCTTTAAGCCAGTTATTAAAACCCCTTTTGATTTGTTAAAACACCTTGCGGTCTGGCAACTGCAAGTGTCAAACAAGAAATCAAAAGGGGGTCCCAATGGGGAACGAAAAGAGCTTAGCGCACACCCGATGGAACTGTAAATATCACATAGTTTTTGCGCCAAAATACCGAAGACAGGTGTTCTACAGAGAGAAGCGTAGAGCAATAGGCAGTATTTTGAGAAAGCTGTGTGAGTGGAAAAGTGTACGGATTCTGGAAGCTGAATGCTGTGCAGATCATATCCATATGCTTGTGGAGATCCCGCCCAAAATGAGCGTATCCGGCTTTATGGGATATCTGAAAGGGAAAAGCAGTCTGATGCTTTACGAGCAGTTTGGTGATTTGAAATTCAAATACAGGAACAGGGAGTTCTGGTGCAGAGGGTACTACGTCGATACGGTGGGTAAGAACACGGCGAAGATACAGGATTACATAAAGCACCAGCTTGAAGAGGATAAAATGGGAGAGCAGTTATCGATTCCCTATCCGGGCAGCCCGTTTACGGGCCGTAAGTAACGAAGTTGGATGCAAATGTCAGATCGTGTGCGCCTGTTAGGGCGCGGCTGGTAAGAGAGCCTTATAGGCGCATTTGAAAAACCTCCGGCTATGCCGGAGGATATTTATTTT	NA	NA	NA	NA
>prophage 13
CP029579	Escherichia coli strain DA33137 chromosome, complete genome	5261695	5032062	5083947	5261695	tRNA,terminase,tail,holin,coat	Escherichia_phage(53.19%)	62	NA	NA
AWO33081.1|5032062_5033010_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	39.5	2.4e-17
AWO33082.1|5034326_5035310_+	zinc transporter ZntB	NA	NA	NA	NA	NA
AWO33083.1|5035584_5035758_+	hypothetical protein	NA	NA	NA	NA	NA
AWO33084.1|5035787_5037161_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
AWO33085.1|5037289_5038225_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
AWO33086.1|5038276_5039512_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
AWO33087.1|5039513_5039729_-	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
AWO33513.1|5039828_5040017_-	DUF1187 domain-containing protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
AWO33512.1|5040054_5040204_-	restriction alleviation protein, Lar family	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
AWO33088.1|5040259_5041069_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
AWO33089.1|5041061_5043662_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.4	3.9e-248
AWO33090.1|5043763_5044039_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
AWO33514.1|5044113_5044284_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
AWO33091.1|5044283_5044505_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
AWO33092.1|5044633_5044912_+	hypothetical protein	NA	NA	NA	NA	NA
AWO33093.1|5044946_5045435_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
AWO33094.1|5045431_5045587_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
AWO33095.1|5045597_5045777_-	hypothetical protein	NA	NA	NA	NA	NA
AWO33096.1|5045764_5045983_-	hypothetical protein	NA	NA	NA	NA	NA
AWO33097.1|5046019_5046439_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
AWO33098.1|5046518_5046773_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
AWO33099.1|5046769_5047192_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
AWO33100.1|5047269_5048058_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
AWO33101.1|5048064_5048811_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	78.5	1.1e-110
AWO33102.1|5048782_5049595_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.4	3.6e-115
AWO33103.1|5049610_5050033_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	7.4e-64
AWO33515.1|5050452_5050698_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	4.5e-13
AWO33104.1|5050818_5051592_-	KilA-N domain-containing protein	NA	A0A1L2BWW1	Bacteriophage	42.6	9.6e-09
AWO33105.1|5052114_5052240_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	90.2	4.0e-10
AWO33516.1|5052322_5052664_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
AWO33106.1|5053531_5054131_+	DUF1367 domain-containing protein	NA	A0A0U2RT94	Escherichia_phage	92.0	2.9e-106
AWO33107.1|5054130_5054421_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	7.4e-47
AWO33108.1|5054417_5054960_+	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	76.3	5.8e-77
AWO33109.1|5055181_5055751_+	hypothetical protein	NA	NA	NA	NA	NA
AWO33110.1|5055719_5056022_-	hypothetical protein	NA	NA	NA	NA	NA
AWO33111.1|5056098_5056440_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	90.1	6.2e-53
AWO33112.1|5056443_5056920_+	lysozyme	NA	K7PKV2	Enterobacteria_phage	95.6	5.0e-85
AWO33113.1|5057136_5057322_+	Spanin from lambdoid prophage Rac, outer membrane subunit	NA	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
AWO33114.1|5057518_5058976_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
AWO33115.1|5058914_5059196_+	hypothetical protein	NA	NA	NA	NA	NA
AWO33116.1|5059113_5059905_+	transcriptional regulator	NA	R4TG31	Halovirus	40.2	2.8e-48
AWO33117.1|5059897_5060830_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.1e-83
AWO33118.1|5060807_5061017_+	hypothetical protein	NA	NA	NA	NA	NA
AWO33119.1|5061020_5062115_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.5	4.5e-113
AWO33120.1|5062095_5063397_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
AWO33121.1|5063399_5064806_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.0	3.0e-186
AWO33122.1|5064789_5065902_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	7.1e-114
AWO33123.1|5066006_5066771_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.2	6.9e-84
AWO33124.1|5066869_5068009_+|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	75.0	9.7e-159
AWO33125.1|5068231_5068627_+	protein singed	NA	NA	NA	NA	NA
AWO33126.1|5068626_5069010_+	glutamate 5-kinase	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
AWO33127.1|5069010_5069391_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
AWO33128.1|5069387_5069780_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
AWO33129.1|5069806_5070769_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	38.6	8.4e-55
AWO33130.1|5070829_5071279_+	hypothetical protein	NA	NA	NA	NA	NA
AWO33131.1|5071750_5074984_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	33.0	7.4e-103
AWO33132.1|5074976_5075315_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
AWO33133.1|5075314_5076013_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.5	1.1e-125
AWO33134.1|5076018_5076762_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	1.0e-145
AWO33135.1|5077360_5080840_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
AWO33136.1|5080907_5081507_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	91.5	9.8e-102
AWO33137.1|5081571_5083947_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	69.0	1.8e-167
>prophage 1
CP029580	Escherichia coli strain DA33137 plasmid pDA33137-178, complete sequence	178078	2169	54528	178078	integrase,transposase	Escherichia_phage(50.0%)	43	11112:11126	31969:31983
AWO33525.1|2169_3432_+|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AWO33526.1|3681_4557_+	class A extended-spectrum beta-lactamase CTX-M-14	NA	A0A1B0VBP7	Salmonella_phage	99.6	6.1e-153
AWO33527.1|4636_5560_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
AWO33528.1|7310_8015_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
AWO33529.1|8144_8861_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	5.4e-139
AWO33530.1|9288_9993_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AWO33531.1|9969_10503_+	tunicamycin resistance protein	NA	NA	NA	NA	NA
AWO33532.1|10984_11176_-	hypothetical protein	NA	NA	NA	NA	NA
11112:11126	attL	AGAATATTGACGGCA	NA	NA	NA	NA
AWO33533.1|11181_11427_+	hypothetical protein	NA	NA	NA	NA	NA
AWO33534.1|11477_12614_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
AWO33535.1|14056_14761_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AWO33536.1|14814_15036_-	hypothetical protein	NA	NA	NA	NA	NA
AWO33537.1|15036_15720_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	5.1e-30
AWO33702.1|16104_17007_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
AWO33538.1|17044_17317_-	hypothetical protein	NA	NA	NA	NA	NA
AWO33539.1|17873_18845_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	99.4	7.0e-174
AWO33540.1|18844_20011_-	protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
AWO33541.1|20598_21354_-	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
AWO33542.1|22073_22880_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
AWO33543.1|22880_23186_-	toxin CcdB	NA	NA	NA	NA	NA
AWO33544.1|23187_23406_-	antitoxin CcdA	NA	NA	NA	NA	NA
AWO33545.1|24113_25109_+	nucleotidyltransferase	NA	NA	NA	NA	NA
AWO33546.1|25112_26045_+	hypothetical protein	NA	NA	NA	NA	NA
AWO33547.1|27092_30209_-	DEAD/DEAH box helicase	NA	A0A220A398	Liberibacter_phage	24.0	3.7e-27
AWO33548.1|30330_31614_-	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	26.5	2.2e-10
AWO33703.1|31610_33167_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	3.2e-104
31969:31983	attR	AGAATATTGACGGCA	NA	NA	NA	NA
AWO33549.1|33349_33571_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
AWO33550.1|33570_33951_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
AWO33551.1|33955_34135_+	PdcA protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
AWO33552.1|34162_34522_+	pdcB	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
AWO33553.1|34808_35126_-	type I deoxyribonuclease HsdR	NA	NA	NA	NA	NA
AWO33554.1|36130_37147_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	4.9e-186
AWO33704.1|37354_38758_+	S-methylmethionine permease	NA	NA	NA	NA	NA
AWO33555.1|38744_39677_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
AWO33556.1|43019_43997_+	repFIB replication protein A	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
AWO33557.1|44281_45022_-	site-specific recombinase	NA	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
AWO33558.1|45142_45322_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
AWO33559.1|45688_46858_+	hypothetical protein	NA	NA	NA	NA	NA
AWO33560.1|47704_47977_-	transcriptional regulator	NA	NA	NA	NA	NA
AWO33561.1|49219_51190_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
AWO33562.1|51196_51988_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
AWO33563.1|52726_53509_-|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	100.0	2.0e-139
AWO33564.1|53505_54528_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.2e-201
>prophage 2
CP029580	Escherichia coli strain DA33137 plasmid pDA33137-178, complete sequence	178078	84189	109230	178078	protease,transposase	Escherichia_phage(54.55%)	31	NA	NA
AWO33595.1|84189_84894_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AWO33706.1|85859_86333_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
AWO33596.1|86463_87252_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
AWO33597.1|87457_87805_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AWO33598.1|87798_88638_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AWO33599.1|88567_88747_-	hypothetical protein	NA	NA	NA	NA	NA
AWO33600.1|88765_88969_+	hypothetical protein	NA	NA	NA	NA	NA
AWO33601.1|89124_90330_+	chromate transporter	NA	NA	NA	NA	NA
AWO33602.1|90340_90646_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AWO33603.1|90661_90844_-	resolvase	NA	NA	NA	NA	NA
AWO33707.1|90872_91637_+|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AWO33604.1|91827_92184_-	hypothetical protein	NA	NA	NA	NA	NA
AWO33605.1|92129_92714_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AWO33606.1|92713_93952_-	MFS transporter	NA	NA	NA	NA	NA
AWO33607.1|93948_94854_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AWO33608.1|94975_95680_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWO33609.1|95814_95910_+	23S rRNA methyltransferase attenuator leader peptide ErmL	NA	NA	NA	NA	NA
AWO33610.1|96035_96773_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.6	6.3e-135
AWO33611.1|96777_96888_+	hypothetical protein	NA	E4ZFP9	Streptococcus_phage	88.6	1.9e-08
AWO33612.1|97874_98579_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AWO33613.1|99541_100402_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
AWO33614.1|100414_100957_+	tunicamycin resistance protein	NA	NA	NA	NA	NA
AWO33615.1|101166_101871_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWO33616.1|101816_101999_-	hypothetical protein	NA	NA	NA	NA	NA
AWO33617.1|101995_103528_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AWO33618.1|104157_104862_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AWO33619.1|105160_106021_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AWO33620.1|106297_107608_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AWO33621.1|107791_107896_-	hypothetical protein	NA	NA	NA	NA	NA
AWO33622.1|107892_108357_-	mRNA interferase PemK	NA	NA	NA	NA	NA
AWO33623.1|108576_109230_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
