The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP020649	Bordetella bronchiseptica strain E010 chromosome, complete genome	5204290	1729774	1779786	5204290	tail,terminase,integrase,head,protease	Bordetella_phage(93.88%)	57	1729723:1729749	1772312:1772338
1729723:1729749	attL	TGGGTTCGAGTCCCATCAGCCACCCCA	NA	NA	NA	NA
AWP74451.1|1729774_1730980_-|integrase	integrase	integrase	Q774Z5	Bordetella_phage	100.0	2.2e-233
AWP74452.1|1730955_1731165_-	excisionase	NA	Q774Z6	Bordetella_phage	100.0	2.4e-31
AWP74453.1|1731157_1731385_-	hypothetical protein	NA	Q774Z7	Bordetella_phage	100.0	5.8e-39
AWP74454.1|1731381_1732776_-	hypothetical protein	NA	Q774Z8	Bordetella_phage	100.0	4.2e-273
AWP74455.1|1732772_1732997_-	hypothetical protein	NA	Q774Z9	Bordetella_phage	100.0	2.2e-38
AWP74456.1|1732993_1733200_-	hypothetical protein	NA	Q775A0	Bordetella_phage	100.0	5.3e-31
AWP74457.1|1733196_1733415_-	hypothetical protein	NA	Q775A1	Bordetella_phage	100.0	3.4e-36
AWP74458.1|1733411_1733675_-	VRR-NUC domain-containing protein	NA	Q775A2	Bordetella_phage	100.0	5.3e-44
AWP74459.1|1733763_1735830_-	DNA polymerase I	NA	Q775A3	Bordetella_phage	100.0	0.0e+00
AWP74460.1|1735829_1736018_-	hypothetical protein	NA	Q775A4	Bordetella_phage	100.0	2.3e-33
AWP77556.1|1736135_1736684_-	hypothetical protein	NA	Q775A5	Bordetella_phage	100.0	1.2e-98
AWP74461.1|1736856_1738113_-	hypothetical protein	NA	Q775A7	Bordetella_phage	99.8	1.2e-237
AWP74462.1|1738109_1738541_-	hypothetical protein	NA	Q775A8	Bordetella_phage	100.0	1.2e-74
AWP74463.1|1738537_1739563_-	hypothetical protein	NA	Q775A9	Bordetella_phage	90.6	2.5e-89
AWP74464.1|1739567_1740044_-	hypothetical protein	NA	Q775B0	Bordetella_phage	100.0	4.5e-41
AWP74465.1|1740049_1740481_-	hypothetical protein	NA	Q775B1	Bordetella_phage	100.0	8.4e-71
AWP74466.1|1740612_1740828_-	hypothetical protein	NA	Q775B2	Bordetella_phage	100.0	3.7e-35
AWP74467.1|1740824_1741496_-	hypothetical protein	NA	Q94MM0	Bordetella_phage	100.0	9.5e-130
AWP74468.1|1741580_1741829_+	transcriptional regulator	NA	Q775B3	Bordetella_phage	100.0	6.8e-41
AWP74469.1|1741825_1742581_+	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	100.0	2.1e-146
AWP74470.1|1742597_1745162_+	DNA primase	NA	Q775B5	Bordetella_phage	100.0	0.0e+00
AWP77557.1|1745173_1745464_-	hypothetical protein	NA	Q775B6	Bordetella_phage	100.0	2.4e-53
AWP74471.1|1745765_1746002_+	hypothetical protein	NA	Q775B7	Bordetella_phage	100.0	4.8e-36
AWP74472.1|1746020_1746605_+|terminase	terminase	terminase	Q775B8	Bordetella_phage	100.0	1.2e-91
AWP77558.1|1746703_1748203_+|terminase	terminase	terminase	Q775B9	Bordetella_phage	99.8	3.6e-302
AWP74473.1|1748246_1748711_+	GNAT family N-acetyltransferase	NA	Q775C0	Bordetella_phage	100.0	9.6e-81
AWP74474.1|1748707_1749166_+	hypothetical protein	NA	Q775C1	Bordetella_phage	100.0	4.9e-77
AWP74475.1|1749169_1749577_+	hypothetical protein	NA	Q775C2	Bordetella_phage	100.0	1.3e-17
AWP74476.1|1749578_1751246_+|head,tail	phage head-tail adapter protein	head,tail	T1S9Z7	Salmonella_phage	45.3	4.6e-133
AWP74477.1|1751258_1751588_+	hypothetical protein	NA	Q775C4	Bordetella_phage	100.0	5.4e-54
AWP74478.1|1751630_1751978_+	endopeptidase	NA	Q775C5	Bordetella_phage	100.0	4.1e-60
AWP74479.1|1751934_1752624_+|protease	protease	protease	Q775C6	Bordetella_phage	100.0	1.0e-110
AWP74480.1|1752637_1753633_+	hypothetical protein	NA	Q775C7	Bordetella_phage	100.0	2.3e-188
AWP74481.1|1753688_1754111_+	hypothetical protein	NA	Q775C8	Bordetella_phage	100.0	5.9e-69
AWP77559.1|1754138_1754330_+	hypothetical protein	NA	Q775C9	Bordetella_phage	98.4	1.0e-28
AWP74482.1|1754405_1755077_+	hypothetical protein	NA	Q775D0	Bordetella_phage	100.0	1.7e-126
AWP74483.1|1755076_1757122_+	hypothetical protein	NA	Q775D1	Bordetella_phage	100.0	0.0e+00
AWP74484.1|1757181_1757829_+	hypothetical protein	NA	Q775D2	Bordetella_phage	100.0	5.6e-79
AWP74485.1|1757834_1759997_+	lysin	NA	Q775D3	Bordetella_phage	100.0	0.0e+00
AWP74486.1|1759993_1766152_+	hypothetical protein	NA	Q775D4	Bordetella_phage	100.0	0.0e+00
AWP74487.1|1766213_1767740_+	hypothetical protein	NA	Q775D5	Bordetella_phage	100.0	7.5e-114
AWP74488.1|1767755_1768901_+	hypothetical protein	NA	F4YCR9	Synechococcus_phage	36.0	5.0e-38
AWP74489.1|1768931_1769318_+	hypothetical protein	NA	Q775D7	Bordetella_phage	100.0	6.6e-67
AWP74490.1|1769596_1770583_+	Retron-type reverse transcriptase	NA	Q775D8	Bordetella_phage	100.0	6.6e-196
AWP74491.1|1770563_1770812_+	hypothetical protein	NA	Q775D9	Bordetella_phage	100.0	1.6e-42
AWP74492.1|1770821_1771073_+	hypothetical protein	NA	Q775E0	Bordetella_phage	100.0	4.4e-40
AWP74493.1|1771074_1771566_+	hypothetical protein	NA	Q775E1	Bordetella_phage	100.0	1.5e-92
AWP77560.1|1771626_1772199_+	hypothetical protein	NA	Q775E2	Bordetella_phage	100.0	4.6e-85
AWP77561.1|1773692_1773911_+	hypothetical protein	NA	NA	NA	NA	NA
1772312:1772338	attR	TGGGTTCGAGTCCCATCAGCCACCCCA	NA	NA	NA	NA
AWP77562.1|1774438_1774735_+	hypothetical protein	NA	NA	NA	NA	NA
AWP74494.1|1774724_1775009_+	hypothetical protein	NA	NA	NA	NA	NA
AWP74495.1|1775735_1776008_+	hypothetical protein	NA	NA	NA	NA	NA
AWP74496.1|1776077_1776842_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
AWP74497.1|1776838_1777438_-	hypothetical protein	NA	NA	NA	NA	NA
AWP77563.1|1777542_1778388_-	hypothetical protein	NA	A0A1I9SA48	Rhodococcus_phage	35.3	7.0e-37
AWP74498.1|1778455_1779082_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AWP74499.1|1779114_1779786_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
>prophage 2
CP020649	Bordetella bronchiseptica strain E010 chromosome, complete genome	5204290	2348247	2356313	5204290	tRNA	Moraxella_phage(28.57%)	9	NA	NA
AWP74984.1|2348247_2348835_+	thymidylate synthase	NA	A0A1X9I5T8	Streptococcus_phage	46.8	2.1e-16
AWP74985.1|2348853_2349237_-	thiol reductase thioredoxin	NA	V9SJ74	Achromobacter_phage	25.8	8.1e-09
AWP74986.1|2349372_2350398_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
AWP74987.1|2350603_2351896_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.0	2.2e-66
AWP74988.1|2352030_2353071_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	51.6	9.3e-92
AWP74989.1|2353115_2353763_-	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AWP74990.1|2353888_2354647_+	5'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	51.2	6.2e-69
AWP77593.1|2354721_2355411_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.9	4.2e-32
AWP74991.1|2355428_2356313_+	peptidase	NA	A0A292GJG6	Xanthomonas_phage	49.5	4.6e-15
>prophage 3
CP020649	Bordetella bronchiseptica strain E010 chromosome, complete genome	5204290	3161738	3197320	5204290	terminase,protease,tail	Pseudomonas_phage(10.71%)	50	NA	NA
AWP75665.1|3161738_3163043_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	53.8	5.4e-129
AWP75666.1|3163147_3163801_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	57.5	6.8e-56
AWP75667.1|3163803_3165114_-	trigger factor	NA	NA	NA	NA	NA
AWP75668.1|3165292_3165871_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	33.7	7.9e-24
AWP75669.1|3165968_3166175_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.1	8.1e-16
AWP75670.1|3166520_3167087_-	hypothetical protein	NA	NA	NA	NA	NA
AWP75671.1|3167170_3167374_-	cold-shock protein CspA	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.1	1.6e-16
AWP75672.1|3167680_3168001_-	hypothetical protein	NA	NA	NA	NA	NA
AWP75673.1|3168042_3168324_-	hypothetical protein	NA	NA	NA	NA	NA
AWP75674.1|3168398_3169646_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AWP75675.1|3170028_3170358_+	hypothetical protein	NA	NA	NA	NA	NA
AWP75676.1|3170684_3171356_+	DUF159 family protein	NA	Q5QF62	Pseudomonas_virus	40.3	1.6e-36
AWP75677.1|3171362_3171563_-	hypothetical protein	NA	NA	NA	NA	NA
AWP75678.1|3171561_3172191_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWP75679.1|3172190_3172472_+	hypothetical protein	NA	NA	NA	NA	NA
AWP75680.1|3172468_3173002_-	hypothetical protein	NA	NA	NA	NA	NA
AWP75681.1|3172983_3173535_-	lysozyme	NA	NA	NA	NA	NA
AWP75682.1|3173513_3173756_-	hypothetical protein	NA	NA	NA	NA	NA
AWP75683.1|3173760_3174573_-	hypothetical protein	NA	NA	NA	NA	NA
AWP75684.1|3174572_3174836_-	hypothetical protein	NA	NA	NA	NA	NA
AWP75685.1|3175054_3175471_-	hypothetical protein	NA	NA	NA	NA	NA
AWP75686.1|3175475_3179432_-	hypothetical protein	NA	A0A0B5A1N2	Achromobacter_phage	41.3	5.5e-217
AWP75687.1|3179424_3179814_-	hypothetical protein	NA	A0A0G3EYJ9	Achromobacter_phage	50.0	3.0e-35
AWP75688.1|3179810_3180344_-	hypothetical protein	NA	A5A3Q9	Burkholderia_phage	46.9	1.1e-40
AWP75689.1|3180411_3180771_-	hypothetical protein	NA	NA	NA	NA	NA
AWP75690.1|3180780_3183216_-|tail	phage tail tape measure protein	tail	A0A1V0E821	Vibrio_phage	34.8	1.2e-97
AWP75691.1|3183241_3183532_-	hypothetical protein	NA	A0A2H4JBP7	uncultured_Caudovirales_phage	43.0	2.0e-15
AWP75692.1|3183549_3183879_-	hypothetical protein	NA	A0A2H4J121	uncultured_Caudovirales_phage	44.0	2.9e-15
AWP75693.1|3183888_3184407_-|tail	phage tail protein	tail	A0A1S5R1H0	Pseudomonas_phage	38.3	5.4e-24
AWP75694.1|3184661_3185162_-	HNH endonuclease	NA	A0A1I9SEX5	Klebsiella_phage	45.1	4.4e-31
AWP75695.1|3185169_3185592_-	hypothetical protein	NA	I6PDJ8	Cronobacter_phage	29.2	2.6e-08
AWP75696.1|3185588_3185987_-	hypothetical protein	NA	A0A088FBW9	Salmonella_phage	37.8	2.6e-18
AWP75697.1|3185983_3186379_-	hypothetical protein	NA	A0A2D2W284	Stenotrophomonas_phage	35.0	6.0e-07
AWP75698.1|3186378_3186579_-	hypothetical protein	NA	NA	NA	NA	NA
AWP75699.1|3186580_3187060_-	hypothetical protein	NA	A0A088C4X4	Shewanella_sp._phage	39.3	1.2e-12
AWP75700.1|3187053_3187503_-	hypothetical protein	NA	I6WLM5	Burkholderia_virus	51.6	2.2e-29
AWP75701.1|3187565_3187817_-	hypothetical protein	NA	NA	NA	NA	NA
AWP75702.1|3187826_3188795_-	hypothetical protein	NA	R9TJ64	Synechococcus_phage	72.3	1.3e-124
AWP75703.1|3188821_3189424_-	hypothetical protein	NA	R9TF81	Synechococcus_phage	47.5	2.6e-30
AWP75704.1|3189546_3189789_-	hypothetical protein	NA	A0A0H5AUE5	Pseudomonas_phage	54.5	1.5e-16
AWP75705.1|3189794_3190850_-	hypothetical protein	NA	A0A0H5BBX3	Pseudomonas_phage	50.8	5.2e-98
AWP75706.1|3190878_3192297_-	hypothetical protein	NA	R9TF43	Synechococcus_phage	42.1	4.8e-99
AWP75707.1|3192299_3193577_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	64.7	2.4e-150
AWP75708.1|3193563_3194049_-|terminase	terminase	terminase	C7U0W1	Enterobacteria_phage	62.3	1.2e-38
AWP75709.1|3194240_3194501_-	hypothetical protein	NA	NA	NA	NA	NA
AWP75710.1|3194513_3194954_-	hypothetical protein	NA	NA	NA	NA	NA
AWP75711.1|3194950_3195157_-	hypothetical protein	NA	NA	NA	NA	NA
AWP77646.1|3195153_3195972_-	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	43.8	1.2e-22
AWP75712.1|3196091_3196568_-	hypothetical protein	NA	NA	NA	NA	NA
AWP75713.1|3196564_3197320_-	hypothetical protein	NA	U6C6D0	Ralstonia_phage	38.0	1.7e-26
