The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP020653	Bordetella holmesii strain C690 chromosome, complete genome	3698268	179305	227199	3698268	transposase	Ralstonia_virus(20.0%)	46	NA	NA
AWP91694.1|179305_180526_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AWP91695.1|180641_181385_-	hypothetical protein	NA	NA	NA	NA	NA
AWP91696.1|181554_182661_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.1	1.4e-32
AWP91697.1|182671_183511_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AWP91698.1|183568_184258_+	hypothetical protein	NA	NA	NA	NA	NA
AWP91699.1|184354_184807_+	hypothetical protein	NA	NA	NA	NA	NA
AWP91700.1|184810_186031_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AWP91701.1|186254_187142_+	RNA polymerase factor sigma-32	NA	A0A248SJA5	Salicola_phage	38.5	2.1e-39
AWP91702.1|187456_188242_-	phosphodiesterase	NA	NA	NA	NA	NA
AWP91703.1|191084_191861_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AWP91704.1|192352_192613_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP91705.1|192651_193473_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AWP91706.1|193507_193777_+	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
AWP91707.1|193748_194099_+	bifunctional protein GlmU	NA	NA	NA	NA	NA
AWP91708.1|194197_195148_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AWP91709.1|195249_196866_+	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	38.2	1.5e-08
AWP94686.1|196931_197156_+	hypothetical protein	NA	NA	NA	NA	NA
AWP91710.1|197189_198065_+	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
AWP91711.1|198117_198318_-	hypothetical protein	NA	NA	NA	NA	NA
AWP91712.1|198352_199111_+	hypothetical protein	NA	NA	NA	NA	NA
AWP91713.1|199023_199710_+	hypothetical protein	NA	NA	NA	NA	NA
AWP94687.1|199714_200728_+	heme A synthase	NA	NA	NA	NA	NA
AWP91714.1|200755_201652_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
AWP94688.1|201675_202284_+	SCO family protein	NA	NA	NA	NA	NA
AWP91715.1|202296_202524_-	hypothetical protein	NA	NA	NA	NA	NA
AWP91716.1|203235_204000_+	transcriptional regulator	NA	NA	NA	NA	NA
AWP91717.1|204065_205439_+	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	35.1	6.7e-29
AWP94689.1|205537_206830_+	MFS transporter	NA	NA	NA	NA	NA
AWP94690.1|206921_208244_+	UDP-glucose 6-dehydrogenase	NA	A0A127AXI2	Bacillus_phage	37.8	1.3e-74
AWP91718.1|208240_209296_+	glycosyl transferase	NA	NA	NA	NA	NA
AWP91719.1|209296_209818_-	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AWP91720.1|209965_211798_+	glutamine--fructose-6-phosphate aminotransferase	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	48.4	5.0e-157
AWP91721.1|211964_212162_+	serum resistance protein BrkB	NA	NA	NA	NA	NA
AWP91722.1|214737_215028_-	hypothetical protein	NA	NA	NA	NA	NA
AWP94691.1|215024_216506_-	peptidase	NA	NA	NA	NA	NA
AWP91723.1|216633_217665_-	histidine kinase	NA	NA	NA	NA	NA
AWP91724.1|217738_218329_-	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AWP91725.1|218881_219799_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWP91726.1|219942_220977_+	4-hydroxythreonine-4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AWP91727.1|221006_222179_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	29.6	1.5e-34
AWP91728.1|222175_223114_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
AWP91729.1|223338_224178_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWP91730.1|224174_225638_+	sulfatase	NA	NA	NA	NA	NA
AWP94692.1|225651_226422_+	cytochrome B	NA	NA	NA	NA	NA
AWP91731.1|226435_226915_+	gluconolactonase	NA	NA	NA	NA	NA
AWP91732.1|226938_227199_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP020653	Bordetella holmesii strain C690 chromosome, complete genome	3698268	632490	677831	3698268	tRNA,transposase	Ralstonia_virus(36.36%)	41	NA	NA
AWP92078.1|632490_633711_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AWP92079.1|636720_637455_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	42.4	2.6e-40
AWP92080.1|637623_638844_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
AWP92081.1|639218_640205_+	HlyD family secretion protein	NA	NA	NA	NA	NA
AWP92082.1|640208_642932_+	ABC transporter ATP-binding protein/permease	NA	A0A2H4PQG7	Staphylococcus_phage	29.2	6.6e-20
AWP92083.1|642932_644060_+	hypothetical protein	NA	NA	NA	NA	NA
AWP92084.1|644072_645485_+	RND transporter	NA	NA	NA	NA	NA
AWP92085.1|645659_646316_-	N-acetyltransferase	NA	NA	NA	NA	NA
AWP92086.1|646336_647383_+	glycosyltransferase	NA	F1C5B0	Cronobacter_phage	39.5	1.4e-58
AWP92087.1|647379_648969_+	dolichyl-phosphate-mannose--protein mannosyltransferase	NA	NA	NA	NA	NA
AWP94713.1|648904_649414_-	sugar translocase	NA	NA	NA	NA	NA
AWP94714.1|649339_650233_+	hypothetical protein	NA	NA	NA	NA	NA
AWP92088.1|650222_651119_-	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	33.1	6.5e-09
AWP92089.1|651165_651798_-	hypothetical protein	NA	NA	NA	NA	NA
AWP92090.1|651822_652707_-	EamA family transporter	NA	NA	NA	NA	NA
AWP92091.1|652834_654316_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWP92092.1|654388_654733_+	TIGR01244 family protein	NA	NA	NA	NA	NA
AWP92093.1|654818_655283_+	universal stress protein	NA	NA	NA	NA	NA
AWP92094.1|655440_655701_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP92095.1|655739_656294_+	hypothetical protein	NA	S5WIU1	Leptospira_phage	49.7	3.3e-43
AWP92096.1|656446_658561_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.1	6.0e-61
AWP92097.1|658593_659391_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWP92098.1|659602_660553_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AWP92099.1|660585_661032_+|tRNA	cys-tRNA(pro)/cys-tRNA(cys) deacylase	tRNA	NA	NA	NA	NA
AWP92100.1|661080_661770_-	tol-pal system protein YbgF	NA	NA	NA	NA	NA
AWP92101.1|661857_662352_-	peptidoglycan-associated lipoprotein	NA	NA	NA	NA	NA
AWP92102.1|662383_663700_-	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
AWP92103.1|663716_664637_-	protein TolA	NA	NA	NA	NA	NA
AWP92104.1|664671_665133_-	protein TolR	NA	NA	NA	NA	NA
AWP92105.1|665132_665807_-	protein TolQ	NA	NA	NA	NA	NA
AWP92106.1|665809_666232_-	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
AWP92107.1|666285_668016_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	28.6	1.2e-11
AWP92108.1|668081_668651_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AWP92109.1|668631_669318_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AWP92110.1|669337_670843_+	sensor histidine kinase	NA	NA	NA	NA	NA
AWP92111.1|671071_671521_+	tripartite tricarboxylate transporter TctB	NA	NA	NA	NA	NA
AWP92112.1|671526_673047_+	hypothetical protein	NA	NA	NA	NA	NA
AWP92113.1|673100_674321_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AWP92114.1|674417_675347_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWP92115.1|675505_676411_-	oxidoreductase	NA	NA	NA	NA	NA
AWP92116.1|676610_677831_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
>prophage 3
CP020653	Bordetella holmesii strain C690 chromosome, complete genome	3698268	799263	854175	3698268	holin,transposase	Ralstonia_virus(16.67%)	53	NA	NA
AWP92218.1|799263_801363_-|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
AWP92219.1|801504_802344_-	branched chain amino acid aminotransferase	NA	NA	NA	NA	NA
AWP92220.1|803473_804361_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWP92221.1|804451_804598_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWP92222.1|804661_805666_-	ABC transporter permease	NA	NA	NA	NA	NA
AWP92223.1|806572_806833_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP92224.1|807107_807743_-	endonuclease III	NA	NA	NA	NA	NA
AWP92225.1|807763_808402_-	ferredoxin	NA	NA	NA	NA	NA
AWP92226.1|808452_809679_-	polyhydroxyalkanoate depolymerase	NA	NA	NA	NA	NA
AWP92227.1|809815_810613_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AWP92228.1|810643_810967_-	ferredoxin	NA	NA	NA	NA	NA
AWP92229.1|811131_812307_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	32.5	4.2e-48
AWP92230.1|812345_812699_+	hypothetical protein	NA	NA	NA	NA	NA
AWP92231.1|812729_813149_-	hypothetical protein	NA	NA	NA	NA	NA
AWP92232.1|813241_814081_-	hypothetical protein	NA	NA	NA	NA	NA
AWP92233.1|814277_816524_+	GTP pyrophosphokinase	NA	NA	NA	NA	NA
AWP92234.1|816543_817857_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	41.0	1.5e-83
AWP92235.1|818022_819174_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
AWP92236.1|819314_820514_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AWP92237.1|820510_821374_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AWP92238.1|821403_822282_+	acetyl-CoA carboxylase carboxyl transferase subunit beta	NA	NA	NA	NA	NA
AWP92239.1|822490_823036_+	hypothetical protein	NA	NA	NA	NA	NA
AWP92240.1|823206_823467_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP92241.1|824415_827547_-	ribonuclease E/G	NA	NA	NA	NA	NA
AWP92242.1|828126_829032_+	RNA pseudouridine synthase	NA	NA	NA	NA	NA
AWP92243.1|829033_829690_+	HAD family hydrolase	NA	NA	NA	NA	NA
AWP92244.1|829807_830767_+	mononuclear molybdenum enzyme YedY	NA	NA	NA	NA	NA
AWP92245.1|830779_831406_+	sulfoxide reductase heme-binding subunit YedZ	NA	NA	NA	NA	NA
AWP92246.1|831386_832169_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A076YN96	Rhizobium_phage	32.4	5.0e-13
AWP94718.1|832172_832883_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWP92247.1|832879_833473_-	septum formation protein Maf	NA	NA	NA	NA	NA
AWP92248.1|833690_834338_+	hypothetical protein	NA	NA	NA	NA	NA
AWP92249.1|834390_834573_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
AWP92250.1|834631_835696_+	phosphate acyltransferase	NA	NA	NA	NA	NA
AWP92251.1|835695_836682_+	3-oxoacyl-ACP synthase	NA	NA	NA	NA	NA
AWP92252.1|836741_837677_+	malonyl CoA-acyl carrier protein transacylase	NA	NA	NA	NA	NA
AWP92253.1|837679_838429_+	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.0	2.7e-16
AWP92254.1|838646_838886_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	48.5	1.6e-10
AWP92255.1|839057_840287_+	beta-ketoacyl-[acyl-carrier-protein] synthase II	NA	NA	NA	NA	NA
AWP92256.1|840289_840721_+	hypothetical protein	NA	NA	NA	NA	NA
AWP92257.1|840717_841317_+	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	26.9	2.6e-06
AWP92258.1|841329_841815_+	hypothetical protein	NA	NA	NA	NA	NA
AWP92259.1|841814_842849_+	siderophore-interacting protein	NA	NA	NA	NA	NA
AWP92260.1|842889_844392_+	serine peptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	31.2	1.1e-21
AWP92261.1|844476_845697_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	5.1e-182
AWP92262.1|845883_846834_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AWP92263.1|846901_848695_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	23.5	1.4e-23
AWP92264.1|848718_849603_+	S26 family signal peptidase	NA	NA	NA	NA	NA
AWP92265.1|849608_850364_+	ribonuclease III	NA	M4QNJ2	Ostreococcus_lucimarinus_virus	33.5	1.5e-19
AWP92266.1|850360_851251_+	GTPase Era	NA	NA	NA	NA	NA
AWP92267.1|851243_851831_+	DNA repair protein RecO	NA	NA	NA	NA	NA
AWP92268.1|851853_852945_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.9	2.1e-17
AWP92269.1|852954_854175_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 4
CP020653	Bordetella holmesii strain C690 chromosome, complete genome	3698268	1095081	1193676	3698268	tRNA,protease,transposase	Leptospira_phage(20.0%)	89	NA	NA
AWP92469.1|1095081_1096302_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AWP92470.1|1096389_1096980_+	EamA family transporter	NA	NA	NA	NA	NA
AWP92471.1|1096967_1097279_+	EamA family transporter	NA	NA	NA	NA	NA
AWP92472.1|1097330_1098320_+	quinone oxidoreductase	NA	NA	NA	NA	NA
AWP92473.1|1098440_1099322_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
AWP92474.1|1099495_1100350_+	hypothetical protein	NA	NA	NA	NA	NA
AWP92475.1|1100381_1101230_+	sulfurtransferase	NA	NA	NA	NA	NA
AWP92476.1|1101357_1102578_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
AWP92477.1|1102596_1103163_-	phosphohydrolase	NA	NA	NA	NA	NA
AWP92478.1|1103360_1104512_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
AWP92479.1|1104650_1105655_-	hypothetical protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
AWP92480.1|1105811_1106783_-	MFS transporter	NA	NA	NA	NA	NA
AWP92481.1|1106861_1107650_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AWP92482.1|1107721_1107958_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
AWP92483.1|1107966_1108878_+	geranyl transferase	NA	NA	NA	NA	NA
AWP92484.1|1108921_1110793_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AWP92485.1|1110953_1111751_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
AWP92486.1|1111982_1112357_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
AWP92487.1|1112433_1112757_+	primosomal replication protein N	NA	NA	NA	NA	NA
AWP92488.1|1112840_1113113_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
AWP92489.1|1113127_1113583_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
AWP92490.1|1113704_1114541_+	hypothetical protein	NA	NA	NA	NA	NA
AWP92491.1|1114537_1115911_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
AWP92492.1|1116225_1117176_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AWP92493.1|1118080_1119058_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
AWP92494.1|1119182_1120838_-	ribonuclease	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
AWP92495.1|1120886_1121351_-	peroxiredoxin	NA	NA	NA	NA	NA
AWP92496.1|1121347_1121809_-	hypothetical protein	NA	NA	NA	NA	NA
AWP92497.1|1122034_1123222_+	alanine transaminase	NA	NA	NA	NA	NA
AWP92498.1|1124518_1125928_+	threonine synthase	NA	NA	NA	NA	NA
AWP92499.1|1126121_1126382_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP92500.1|1126420_1127242_+	hypothetical protein	NA	S5WIU1	Leptospira_phage	43.7	7.2e-55
AWP92501.1|1127376_1128396_-	fructose-bisphosphatase class I	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
AWP92502.1|1128404_1131110_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
AWP92503.1|1131249_1131903_+	hypothetical protein	NA	NA	NA	NA	NA
AWP92504.1|1131965_1132328_-	DNA-binding protein	NA	NA	NA	NA	NA
AWP92505.1|1132894_1134355_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AWP92506.1|1134617_1135691_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
AWP92507.1|1135775_1136996_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
AWP92508.1|1138753_1139575_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AWP92509.1|1139613_1139874_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP94724.1|1139901_1141347_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AWP92510.1|1141360_1142464_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
AWP92511.1|1142468_1143719_+	glycolate oxidase iron-sulfur subunit	NA	NA	NA	NA	NA
AWP92512.1|1143715_1145161_-	NAD synthetase	NA	NA	NA	NA	NA
AWP92513.1|1145157_1145472_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AWP92514.1|1146773_1147994_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
AWP92515.1|1148093_1148960_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
AWP92516.1|1149020_1150001_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWP92517.1|1150147_1151068_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
AWP92518.1|1151076_1152189_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AWP92519.1|1152270_1153092_+	anion permease	NA	NA	NA	NA	NA
AWP92520.1|1153167_1153776_-	glutathione S-transferase	NA	NA	NA	NA	NA
AWP94725.1|1153913_1155290_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
AWP92521.1|1155351_1155795_+	cytochrome C	NA	NA	NA	NA	NA
AWP94726.1|1155861_1156518_-	cytochrome B	NA	NA	NA	NA	NA
AWP92522.1|1156560_1156821_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP92523.1|1156859_1157681_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AWP92524.1|1157849_1158131_-	hypothetical protein	NA	NA	NA	NA	NA
AWP92525.1|1158841_1159630_+	hypothetical protein	NA	NA	NA	NA	NA
AWP92526.1|1159626_1160733_+	AI-2E family transporter	NA	NA	NA	NA	NA
AWP92527.1|1161407_1162766_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
AWP92528.1|1162880_1163078_-	gas vesicle protein	NA	NA	NA	NA	NA
AWP92529.1|1163095_1163917_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AWP92530.1|1163955_1164216_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP92531.1|1164309_1164864_+	hypothetical protein	NA	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
AWP92532.1|1165451_1166768_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
AWP92533.1|1166780_1167794_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
AWP94727.1|1169371_1169671_+	hypothetical protein	NA	NA	NA	NA	NA
AWP92534.1|1171031_1172690_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
AWP92535.1|1172838_1174059_-	hypothetical protein	NA	NA	NA	NA	NA
AWP92536.1|1174176_1175460_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
AWP92537.1|1175463_1176405_-	transporter	NA	NA	NA	NA	NA
AWP92538.1|1176514_1176973_+	N-acetyltransferase	NA	NA	NA	NA	NA
AWP94728.1|1177353_1177974_+	DTW domain-containing protein	NA	NA	NA	NA	NA
AWP92539.1|1178381_1180802_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
AWP92540.1|1180909_1181647_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
AWP92541.1|1181693_1182938_+	hypothetical protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
AWP92542.1|1183260_1183533_+	DNA-binding protein HU	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
AWP92543.1|1184116_1184845_+	energy transducer TonB	NA	NA	NA	NA	NA
AWP92544.1|1184866_1185784_+	flagellar motor protein MotA	NA	NA	NA	NA	NA
AWP92545.1|1185783_1186293_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AWP92546.1|1186409_1187081_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AWP92547.1|1187190_1188258_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
AWP92548.1|1188241_1190122_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	3.5e-65
AWP92549.1|1190258_1191446_+	hypothetical protein	NA	NA	NA	NA	NA
AWP92550.1|1191746_1192532_+	hypothetical protein	NA	NA	NA	NA	NA
AWP92551.1|1192555_1192816_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP92552.1|1192854_1193676_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
>prophage 5
CP020653	Bordetella holmesii strain C690 chromosome, complete genome	3698268	1201703	1264117	3698268	tRNA,protease,transposase	Ralstonia_virus(28.57%)	53	NA	NA
AWP92560.1|1201703_1202924_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AWP92561.1|1202999_1203281_+	malate dehydrogenase	NA	NA	NA	NA	NA
AWP92562.1|1205112_1206108_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWP92563.1|1206150_1206921_+	5-keto-4-deoxy-D-glucarate aldolase	NA	NA	NA	NA	NA
AWP92564.1|1207046_1207310_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
AWP92565.1|1207511_1207658_-	transmembrane sensor protein	NA	NA	NA	NA	NA
AWP92566.1|1207711_1208662_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AWP92567.1|1208794_1209223_-	transmembrane sensor protein	NA	NA	NA	NA	NA
AWP92568.1|1210116_1210377_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP92569.1|1210434_1211634_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
AWP92570.1|1211779_1212157_-	cytochrome c family protein	NA	NA	NA	NA	NA
AWP92571.1|1212180_1213962_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
AWP92572.1|1213970_1214708_-	hypothetical protein	NA	NA	NA	NA	NA
AWP92573.1|1214992_1216552_-	lipid II flippase MurJ	NA	NA	NA	NA	NA
AWP92574.1|1216611_1217370_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AWP92575.1|1217466_1218123_-	adenylate kinase	NA	NA	NA	NA	NA
AWP92576.1|1218276_1219041_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AWP92577.1|1219055_1219235_-	hypothetical protein	NA	NA	NA	NA	NA
AWP92578.1|1219260_1220295_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AWP92579.1|1220291_1220705_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AWP92580.1|1220701_1221286_-	flagellar motor protein MotA	NA	NA	NA	NA	NA
AWP92581.1|1221638_1222997_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
AWP92582.1|1223090_1223669_+	superoxide dismutase [Fe]	NA	NA	NA	NA	NA
AWP92583.1|1223793_1224615_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AWP92584.1|1224653_1224914_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP92585.1|1224986_1226243_+	chloride channel protein-related protein	NA	NA	NA	NA	NA
AWP92586.1|1226346_1227552_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
AWP92587.1|1227615_1228065_-	hypothetical protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
AWP92588.1|1228197_1228443_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
AWP92589.1|1228667_1228982_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
AWP92590.1|1234235_1236341_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
AWP92591.1|1236394_1238704_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
AWP92592.1|1240057_1241725_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AWP92593.1|1241727_1242393_+	hypothetical protein	NA	NA	NA	NA	NA
AWP92594.1|1242525_1246332_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AWP92595.1|1246557_1247703_+	branched chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWP92596.1|1247821_1248751_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWP92597.1|1248747_1249824_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AWP92598.1|1249820_1250627_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
AWP92599.1|1250623_1251355_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
AWP92600.1|1251558_1251741_+	hypothetical protein	NA	NA	NA	NA	NA
AWP92601.1|1251731_1252970_-	ammonia channel protein	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
AWP92602.1|1253017_1253356_-	transcriptional regulator	NA	NA	NA	NA	NA
AWP92603.1|1253603_1254554_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AWP92604.1|1254872_1255055_+	hypothetical protein	NA	NA	NA	NA	NA
AWP92605.1|1255120_1256341_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AWP92606.1|1256434_1257655_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
AWP92607.1|1257651_1257978_+	hypothetical protein	NA	NA	NA	NA	NA
AWP92608.1|1258099_1259599_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AWP92609.1|1260019_1260217_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AWP92610.1|1260232_1260592_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AWP92611.1|1260664_1261687_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
AWP92612.1|1261699_1264117_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 6
CP020653	Bordetella holmesii strain C690 chromosome, complete genome	3698268	1273464	1319838	3698268	holin,transposase,tRNA	Staphylococcus_phage(18.18%)	47	NA	NA
AWP92622.1|1273464_1275426_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	29.9	2.3e-27
AWP92623.1|1275554_1275803_-	hypothetical protein	NA	NA	NA	NA	NA
AWP92624.1|1275932_1276211_-	hypothetical protein	NA	NA	NA	NA	NA
AWP92625.1|1276304_1276757_+	hypothetical protein	NA	G1JW61	Mycobacterium_phage	36.3	8.9e-07
AWP92626.1|1276753_1277224_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AWP92627.1|1277515_1278109_+	twin-arginine translocation pathway signal	NA	NA	NA	NA	NA
AWP92628.1|1278156_1278441_+	CsbD family protein	NA	NA	NA	NA	NA
AWP92629.1|1278497_1278680_-	hypothetical protein	NA	NA	NA	NA	NA
AWP92630.1|1278831_1279035_+	hypothetical protein	NA	NA	NA	NA	NA
AWP92631.1|1279129_1279372_+	hypothetical protein	NA	NA	NA	NA	NA
AWP92632.1|1279519_1279732_+	hypothetical protein	NA	NA	NA	NA	NA
AWP92633.1|1279859_1280942_+	N-acylglucosamine 2-epimerase	NA	NA	NA	NA	NA
AWP92634.1|1281032_1281248_+	hypothetical protein	NA	NA	NA	NA	NA
AWP92635.1|1281254_1281620_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
AWP92636.1|1281673_1283473_-	metal ABC transporter permease	NA	W8CYL7	Bacillus_phage	28.4	8.7e-45
AWP94731.1|1283541_1283997_+	2,5-diketo-D-gluconic acid reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.5	1.9e-20
AWP92637.1|1284020_1284281_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP92638.1|1284319_1285141_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AWP92639.1|1285164_1285620_+	2,5-diketo-D-gluconic acid reductase	NA	A0A2H4PQR8	Staphylococcus_phage	48.3	2.1e-35
AWP92640.1|1285624_1286611_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
AWP92641.1|1286657_1286864_-	hypothetical protein	NA	NA	NA	NA	NA
AWP92642.1|1286860_1288036_-	hypothetical protein	NA	NA	NA	NA	NA
AWP92643.1|1288213_1288867_+	serine/threonine protein phosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	47.7	6.3e-54
AWP92644.1|1288861_1291384_-	penicillin-binding protein	NA	NA	NA	NA	NA
AWP92645.1|1291555_1293472_-	S9 family peptidase	NA	NA	NA	NA	NA
AWP92646.1|1293604_1294051_+	hypothetical protein	NA	NA	NA	NA	NA
AWP92647.1|1294079_1294508_-	phenylacetic acid degradation protein	NA	NA	NA	NA	NA
AWP92648.1|1295135_1296356_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
AWP92649.1|1297090_1297552_-|tRNA	glutamyl-tRNA amidotransferase	tRNA	A0A292GL36	Xanthomonas_phage	44.1	2.0e-17
AWP92650.1|1297690_1298917_+	nitric oxide dioxygenase	NA	NA	NA	NA	NA
AWP92651.1|1298938_1299376_+	BadM/Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
AWP92652.1|1299498_1300746_+	D-amino acid dehydrogenase small subunit	NA	NA	NA	NA	NA
AWP92653.1|1300753_1301587_-	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
AWP92654.1|1301583_1302111_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AWP92655.1|1302200_1303421_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AWP92656.1|1303428_1305093_-	long-chain-fatty-acid--CoA ligase	NA	Q75ZG1	Hepacivirus	27.3	2.0e-40
AWP92657.1|1305100_1305610_-	hypothetical protein	NA	NA	NA	NA	NA
AWP92658.1|1305606_1306221_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
AWP92659.1|1306221_1307415_-	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
AWP92660.1|1307424_1309809_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AWP92661.1|1309868_1311161_-	fatty acid transporter	NA	NA	NA	NA	NA
AWP92662.1|1311182_1313141_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AWP92663.1|1313137_1314430_-	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
AWP92664.1|1314440_1316771_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AWP92665.1|1316796_1317465_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWP92666.1|1317844_1318789_+	serine acetyltransferase	NA	NA	NA	NA	NA
AWP92667.1|1318887_1319838_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 7
CP020653	Bordetella holmesii strain C690 chromosome, complete genome	3698268	1587654	1646994	3698268	transposase	Ralstonia_virus(10.53%)	54	NA	NA
AWP92898.1|1587654_1588875_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AWP92899.1|1589229_1589706_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
AWP92900.1|1589964_1590573_-	hypothetical protein	NA	NA	NA	NA	NA
AWP92901.1|1590591_1591263_+	rRNA methyltransferase	NA	NA	NA	NA	NA
AWP92902.1|1593349_1594192_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	6.5e-27
AWP92903.1|1594188_1595532_+	phosphoglucosamine mutase	NA	A0A1X9I671	Streptococcus_phage	27.1	2.7e-06
AWP92904.1|1595716_1596532_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWP92905.1|1596597_1598079_-	exopolyphosphatase	NA	NA	NA	NA	NA
AWP92906.1|1598277_1600350_+	RNA degradosome polyphosphate kinase	NA	NA	NA	NA	NA
AWP92907.1|1600569_1601607_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	40.2	8.5e-53
AWP92908.1|1601728_1603651_+	hypothetical protein	NA	NA	NA	NA	NA
AWP92909.1|1603678_1604455_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.7	5.6e-17
AWP92910.1|1605282_1605792_+	hypothetical protein	NA	NA	NA	NA	NA
AWP92911.1|1606869_1607640_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
AWP94747.1|1607636_1608647_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
AWP92912.1|1609954_1610215_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP92913.1|1610253_1611075_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.1e-55
AWP92914.1|1611075_1611819_+	hypothetical protein	NA	A0A1B0VBP7	Salmonella_phage	47.2	8.0e-53
AWP92915.1|1611823_1612195_-	hypothetical protein	NA	NA	NA	NA	NA
AWP92916.1|1612255_1612501_+	hypothetical protein	NA	NA	NA	NA	NA
AWP92917.1|1612607_1614107_-	2-aminoadipate aminotransferase	NA	NA	NA	NA	NA
AWP92918.1|1614234_1614504_-	hypothetical protein	NA	NA	NA	NA	NA
AWP92919.1|1614728_1615064_+	hypothetical protein	NA	NA	NA	NA	NA
AWP92920.1|1615322_1615454_+	entericidin	NA	NA	NA	NA	NA
AWP92921.1|1615483_1615981_+	hypothetical protein	NA	NA	NA	NA	NA
AWP92922.1|1615990_1616365_+	hypothetical protein	NA	NA	NA	NA	NA
AWP94748.1|1616455_1617748_+	aspartate carbamoyltransferase	NA	Q84489	Paramecium_bursaria_Chlorella_virus	37.2	2.2e-42
AWP92923.1|1617864_1618764_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.5	5.9e-42
AWP92924.1|1618915_1619134_+	hypothetical protein	NA	NA	NA	NA	NA
AWP92925.1|1619607_1621284_-	MFS transporter	NA	NA	NA	NA	NA
AWP92926.1|1621468_1622992_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	2.2e-20
AWP92927.1|1622963_1623659_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AWP92928.1|1623999_1625061_+	DNA recombination/repair protein RecA	NA	A0A0S2MVG1	Bacillus_phage	64.0	5.7e-113
AWP92929.1|1625106_1625658_+	recombination regulator RecX	NA	NA	NA	NA	NA
AWP92930.1|1625664_1626585_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWP92931.1|1626724_1629022_+	5-methyltetrahydropteroyltriglutamate-- homocysteine methyltransferase	NA	NA	NA	NA	NA
AWP92932.1|1629077_1630298_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AWP94749.1|1630556_1631162_+	hypothetical protein	NA	NA	NA	NA	NA
AWP92933.1|1631172_1632333_+	succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
AWP92934.1|1632354_1633236_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.4	1.1e-19
AWP92935.1|1633532_1634231_+	hypothetical protein	NA	W8EBD0	Pseudomonas_phage	33.8	8.9e-22
AWP92936.1|1634372_1635095_+	hypothetical protein	NA	A0A2R2YAT9	Pseudomonas_phage	43.8	8.0e-42
AWP92937.1|1635213_1636152_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
AWP92938.1|1636182_1636962_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
AWP92939.1|1636948_1638172_+	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
AWP92940.1|1638176_1639724_+	heme biosynthesis protein HemY	NA	NA	NA	NA	NA
AWP92941.1|1639759_1640293_+	inorganic pyrophosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	1.8e-51
AWP94750.1|1640536_1641232_+	5-carboxymethyl-2-hydroxymuconate isomerase	NA	NA	NA	NA	NA
AWP92942.1|1641246_1641378_+	entericidin	NA	NA	NA	NA	NA
AWP92943.1|1641425_1642550_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AWP92944.1|1642555_1644895_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.3	6.9e-151
AWP92945.1|1644891_1645299_-	heat-shock protein Hsp20	NA	NA	NA	NA	NA
AWP92946.1|1645560_1645821_+	hypothetical protein	NA	NA	NA	NA	NA
AWP92947.1|1646043_1646994_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 8
CP020653	Bordetella holmesii strain C690 chromosome, complete genome	3698268	1671460	1718874	3698268	tRNA,transposase	Leptospira_phage(30.0%)	55	NA	NA
AWP92970.1|1671460_1671721_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP92971.1|1671778_1672078_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AWP92972.1|1672647_1674051_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
AWP92973.1|1674063_1674714_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
AWP92974.1|1674855_1676076_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AWP92975.1|1676106_1677183_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
AWP92976.1|1677329_1678460_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AWP92977.1|1678646_1680272_+	hypothetical protein	NA	NA	NA	NA	NA
AWP92978.1|1680278_1681094_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AWP94753.1|1681141_1682179_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWP92979.1|1682230_1682890_+	N-(5'-phosphoribosyl)anthranilate isomerase	NA	NA	NA	NA	NA
AWP92980.1|1683348_1683537_-	hypothetical protein	NA	NA	NA	NA	NA
AWP92981.1|1684733_1685111_-	hypothetical protein	NA	S5WIU1	Leptospira_phage	53.4	4.5e-28
AWP92982.1|1685031_1685418_-	hypothetical protein	NA	NA	NA	NA	NA
AWP92983.1|1685456_1685717_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP92984.1|1686115_1686805_+	anion permease	NA	NA	NA	NA	NA
AWP92985.1|1686904_1687066_-	hypothetical protein	NA	NA	NA	NA	NA
AWP92986.1|1687105_1687423_+	hypothetical protein	NA	NA	NA	NA	NA
AWP92987.1|1687507_1687744_-	hypothetical protein	NA	NA	NA	NA	NA
AWP92988.1|1687933_1688182_-	hypothetical protein	NA	NA	NA	NA	NA
AWP92989.1|1688295_1689666_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AWP92990.1|1689666_1690407_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AWP92991.1|1690893_1692846_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
AWP92992.1|1692866_1693415_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	29.3	3.8e-12
AWP92993.1|1693580_1694537_+	glutathione synthase	NA	NA	NA	NA	NA
AWP94754.1|1694550_1694949_+	PTS mannose transporter subunit IIA	NA	NA	NA	NA	NA
AWP94755.1|1695011_1695281_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AWP92994.1|1695309_1697085_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
AWP92995.1|1697132_1697342_-	hypothetical protein	NA	NA	NA	NA	NA
AWP92996.1|1697388_1697811_-	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AWP92997.1|1697930_1698908_+	ornithine cyclodeaminase	NA	NA	NA	NA	NA
AWP92998.1|1698976_1700140_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWP92999.1|1700308_1701196_+	ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB	NA	NA	NA	NA	NA
AWP93000.1|1701206_1701848_+	ectoine/hydroxyectoine ABC transporter permease subunit EhuC	NA	NA	NA	NA	NA
AWP93001.1|1701844_1702516_+	ectoine/hydroxyectoine ABC transporter permease subunit EhuD	NA	NA	NA	NA	NA
AWP93002.1|1702515_1703286_+	ectoine/hydroxyectoine ABC transporter ATP-binding protein EhuA	NA	G9BWD6	Planktothrix_phage	35.8	2.0e-27
AWP93003.1|1703336_1703786_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	Q2NP83	Xanthomonas_phage	62.8	2.3e-47
AWP93004.1|1703827_1704286_-	hypothetical protein	NA	NA	NA	NA	NA
AWP93005.1|1704306_1704939_-	hypothetical protein	NA	NA	NA	NA	NA
AWP93006.1|1705048_1705516_+	hydrolase	NA	NA	NA	NA	NA
AWP93007.1|1705537_1706080_+	hydrolase	NA	NA	NA	NA	NA
AWP93008.1|1706092_1706797_+	dipeptidase E	NA	NA	NA	NA	NA
AWP93009.1|1706815_1707286_-	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AWP93010.1|1707378_1708119_+	permease	NA	NA	NA	NA	NA
AWP93011.1|1708162_1708423_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP93012.1|1708461_1708758_+	hypothetical protein	NA	NA	NA	NA	NA
AWP93013.1|1708592_1709018_+	hypothetical protein	NA	S5WIU1	Leptospira_phage	53.3	3.3e-19
AWP93014.1|1709298_1710510_-	phosphopantothenate synthase	NA	Q9HH70	Methanothermobacter_phage	30.4	2.2e-36
AWP93015.1|1710570_1711086_-	signal peptidase II	NA	NA	NA	NA	NA
AWP93016.1|1711088_1713950_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
AWP94756.1|1713939_1714905_-	bifunctional riboflavin kinase/FMN adenylyltransferase	NA	NA	NA	NA	NA
AWP93017.1|1715661_1717137_+	rRNA methyltransferase	NA	NA	NA	NA	NA
AWP93018.1|1717141_1717417_-	hypothetical protein	NA	NA	NA	NA	NA
AWP93019.1|1717753_1718014_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP93020.1|1718052_1718874_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.1e-55
>prophage 9
CP020653	Bordetella holmesii strain C690 chromosome, complete genome	3698268	1725419	1782291	3698268	holin,transposase,integrase	Escherichia_phage(20.0%)	52	1718808:1718867	1768916:1768994
1718808:1718867	attL	GCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCC	NA	NA	NA	NA
AWP93024.1|1725419_1726370_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AWP94757.1|1726366_1728274_-	ABC transporter	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
AWP93025.1|1728288_1729179_-	ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AWP93026.1|1729185_1730319_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
AWP93027.1|1730318_1731140_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
AWP93028.1|1731164_1732355_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
AWP93029.1|1732656_1732938_+|integrase	integrase	integrase	NA	NA	NA	NA
AWP93030.1|1733103_1733424_+	hypothetical protein	NA	NA	NA	NA	NA
AWP93031.1|1734746_1735007_+	hypothetical protein	NA	NA	NA	NA	NA
AWP93032.1|1735085_1735346_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP93033.1|1735499_1736270_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
AWP94758.1|1736266_1737277_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
AWP93034.1|1737311_1738154_+	hypothetical protein	NA	S5WIU1	Leptospira_phage	46.0	1.3e-54
AWP93035.1|1738616_1739402_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
AWP93036.1|1740261_1740522_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP93037.1|1740560_1741382_+	hypothetical protein	NA	S5WIU1	Leptospira_phage	43.7	7.2e-55
AWP93038.1|1742447_1743452_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
AWP93039.1|1743527_1744340_+	nucleotide pyrophosphatase	NA	NA	NA	NA	NA
AWP93040.1|1744567_1746739_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
AWP93041.1|1746792_1748112_-	MFS transporter	NA	NA	NA	NA	NA
AWP93042.1|1748200_1749421_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AWP93043.1|1749639_1750500_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWP93044.1|1750496_1751720_-	MFS transporter	NA	NA	NA	NA	NA
AWP93045.1|1752018_1752516_+	osmotically inducible protein Y	NA	NA	NA	NA	NA
AWP93046.1|1752554_1753337_-	hydrolase	NA	NA	NA	NA	NA
AWP93047.1|1753362_1753581_-	SlyX protein	NA	NA	NA	NA	NA
AWP93048.1|1753655_1753925_+	hypothetical protein	NA	NA	NA	NA	NA
AWP93049.1|1754144_1754609_+	N-acetyltransferase	NA	NA	NA	NA	NA
AWP93050.1|1754682_1754964_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AWP94759.1|1755080_1756064_-|integrase	integrase	integrase	NA	NA	NA	NA
AWP93051.1|1756307_1757306_+	cointegrate resolution protein	NA	NA	NA	NA	NA
AWP93052.1|1757408_1757840_+	energy transducer TonB	NA	NA	NA	NA	NA
AWP93053.1|1757904_1758816_+	3-phosphoglycerate dehydrogenase	NA	M1HBE3	Paramecium_bursaria_Chlorella_virus	30.7	3.7e-20
AWP93054.1|1758948_1761030_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	NA	NA	NA	NA
AWP93055.1|1761068_1761773_-	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
AWP93056.1|1761865_1762750_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWP93057.1|1762825_1763227_-	hypothetical protein	NA	NA	NA	NA	NA
AWP93058.1|1763317_1763464_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
AWP93059.1|1763725_1764661_-	transcriptional regulator	NA	NA	NA	NA	NA
AWP93060.1|1764742_1765396_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AWP93061.1|1766012_1766489_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AWP93062.1|1766513_1767308_-	ABC transporter permease	NA	NA	NA	NA	NA
AWP93063.1|1767324_1768305_-	taurine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWP93064.1|1768477_1768690_-	hypothetical protein	NA	NA	NA	NA	NA
AWP93065.1|1769103_1770879_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.4	3.5e-38
1768916:1768994	attR	GCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAG	NA	NA	NA	NA
AWP93066.1|1770894_1772559_-	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
AWP93067.1|1772571_1775283_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
AWP94760.1|1775828_1777583_+	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
AWP93068.1|1777579_1778206_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AWP93069.1|1778202_1779057_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.8	1.4e-29
AWP93070.1|1779176_1781231_+	oligopeptidase A	NA	NA	NA	NA	NA
AWP93071.1|1781340_1782291_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 10
CP020653	Bordetella holmesii strain C690 chromosome, complete genome	3698268	1795055	1844067	3698268	transposase	Ralstonia_virus(33.33%)	46	NA	NA
AWP93084.1|1795055_1796276_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AWP93085.1|1796351_1797473_-	transporter	NA	NA	NA	NA	NA
AWP93086.1|1797510_1798224_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
AWP93087.1|1798234_1799455_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
AWP93088.1|1799537_1800092_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AWP93089.1|1800237_1801188_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AWP94761.1|1801147_1801309_-	branched-chain amino acid ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AWP93090.1|1801349_1802276_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWP93091.1|1802289_1803162_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWP93092.1|1803324_1804272_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWP94762.1|1804610_1805192_+	PIN domain-containing protein	NA	NA	NA	NA	NA
AWP94763.1|1805185_1805695_-	threonine dehydratase	NA	NA	NA	NA	NA
AWP93093.1|1805769_1806720_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AWP93094.1|1806699_1807452_-	serine/threonine dehydratase	NA	NA	NA	NA	NA
AWP93095.1|1807464_1808196_-	hypothetical protein	NA	NA	NA	NA	NA
AWP93096.1|1808352_1810518_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
AWP93097.1|1810607_1810877_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
AWP94764.1|1810965_1811172_-	hypothetical protein	NA	NA	NA	NA	NA
AWP93098.1|1811170_1811689_+	hypothetical protein	NA	NA	NA	NA	NA
AWP93099.1|1811707_1812487_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AWP93100.1|1812654_1813671_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
AWP93101.1|1813743_1814235_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
AWP93102.1|1814245_1815961_-	acetolactate synthase, large subunit, biosynthetic type	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
AWP93103.1|1816431_1817043_+	hypothetical protein	NA	NA	NA	NA	NA
AWP94765.1|1817124_1818075_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AWP93104.1|1819726_1820968_-	MFS transporter	NA	NA	NA	NA	NA
AWP93105.1|1820979_1821753_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
AWP93106.1|1821779_1822730_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AWP93107.1|1822828_1823611_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
AWP93108.1|1825652_1827038_+	alcaligin biosynthesis enzyme	NA	NA	NA	NA	NA
AWP93109.1|1827056_1827662_+	siderophore biosynthesis protein	NA	NA	NA	NA	NA
AWP93110.1|1827658_1829515_+	IucA/IucC family protein	NA	NA	NA	NA	NA
AWP93111.1|1829511_1830312_+	siderophore ferric iron reductase	NA	NA	NA	NA	NA
AWP93112.1|1830326_1831520_+	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
AWP93113.1|1831587_1832562_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWP93114.1|1832684_1833908_+	MFS transporter	NA	S4TR35	Salmonella_phage	29.4	9.8e-24
AWP93115.1|1834018_1836223_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AWP93116.1|1836517_1837147_+	antibiotic resistance protein	NA	NA	NA	NA	NA
AWP93117.1|1837154_1837361_-	hypothetical protein	NA	NA	NA	NA	NA
AWP93118.1|1838298_1838559_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP94766.1|1838601_1839342_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWP93119.1|1839325_1840306_+	hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	29.2	5.6e-14
AWP93120.1|1840448_1840943_+	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
AWP93121.1|1840944_1841862_+	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AWP93122.1|1841941_1843126_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AWP93123.1|1843116_1844067_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 11
CP020653	Bordetella holmesii strain C690 chromosome, complete genome	3698268	1963333	2019737	3698268	transposase,integrase	Leptospira_phage(22.22%)	48	1958017:1958032	1987972:1987987
1958017:1958032	attL	GGCTGTTGCCGGCAAG	NA	NA	NA	NA
AWP93237.1|1963333_1963594_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP93238.1|1963811_1966019_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AWP93239.1|1966291_1967089_+	enterobactin-dependent positive regulator	NA	NA	NA	NA	NA
AWP93240.1|1967134_1968190_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AWP93241.1|1968224_1968419_-|integrase	integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	52.8	1.1e-06
AWP93242.1|1968415_1969297_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
AWP93243.1|1969653_1970538_+	hypothetical protein	NA	NA	NA	NA	NA
AWP93244.1|1970962_1973191_+	isocitrate dehydrogenase, NADP-dependent	NA	NA	NA	NA	NA
AWP93245.1|1973475_1973940_+	hypothetical protein	NA	NA	NA	NA	NA
AWP93246.1|1973946_1975464_+	hypothetical protein	NA	NA	NA	NA	NA
AWP93247.1|1975512_1976265_-	polar amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.3	4.3e-30
AWP93248.1|1976272_1976926_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWP93249.1|1976962_1977727_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWP93250.1|1977868_1978450_-	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
AWP93251.1|1978732_1979116_-	hypothetical protein	NA	NA	NA	NA	NA
AWP93252.1|1979700_1980030_+	hypothetical protein	NA	NA	NA	NA	NA
AWP93253.1|1980401_1981208_+	EamA family transporter	NA	NA	NA	NA	NA
AWP93254.1|1981209_1981938_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.1	1.8e-09
AWP94771.1|1981934_1982699_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	2.3e-18
AWP93255.1|1982698_1984582_-	ABC transporter permease	NA	NA	NA	NA	NA
AWP94772.1|1984594_1985800_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWP93256.1|1985867_1986722_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AWP93257.1|1986737_1987448_-	hypothetical protein	NA	NA	NA	NA	NA
AWP93258.1|1987516_1988251_-	hypothetical protein	NA	NA	NA	NA	NA
1987972:1987987	attR	GGCTGTTGCCGGCAAG	NA	NA	NA	NA
AWP93259.1|1988427_1989219_+	hydratase	NA	NA	NA	NA	NA
AWP93260.1|1989241_1990786_-	hypothetical protein	NA	A0A0R6PEZ3	Moraxella_phage	42.9	8.8e-38
AWP93261.1|1991530_1992730_+	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AWP93262.1|1993166_1993790_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AWP93263.1|1993795_1997452_+	virulence sensor protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	32.0	6.5e-39
AWP93264.1|1999640_2001338_+	MFS transporter	NA	NA	NA	NA	NA
AWP93265.1|2001722_2001983_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP93266.1|2002021_2002843_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AWP93267.1|2002875_2003190_+	glutamate decarboxylase	NA	NA	NA	NA	NA
AWP93268.1|2003291_2004980_+	transporter	NA	NA	NA	NA	NA
AWP93269.1|2005059_2005437_+	hypothetical protein	NA	NA	NA	NA	NA
AWP93270.1|2005573_2006299_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWP93271.1|2006431_2007418_+	C4-dicarboxylate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWP93272.1|2007420_2007894_+	TRAP transporter permease DctQ	NA	NA	NA	NA	NA
AWP93273.1|2007898_2009182_+	TRAP transporter permease DctM	NA	NA	NA	NA	NA
AWP93274.1|2009178_2010069_+	CoA ester lyase	NA	NA	NA	NA	NA
AWP93275.1|2010065_2011763_+	thiamine pyrophosphate-binding protein	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	25.9	1.8e-31
AWP93276.1|2013087_2014587_+	aldehyde dehydrogenase PuuC	NA	NA	NA	NA	NA
AWP93277.1|2014659_2015178_+	hypothetical protein	NA	NA	NA	NA	NA
AWP93278.1|2015251_2016142_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
AWP93279.1|2016256_2017453_+	alpha-hydroxy-acid oxidizing enzyme	NA	NA	NA	NA	NA
AWP93280.1|2017487_2018252_-	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWP93281.1|2018616_2019438_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.1e-55
AWP93282.1|2019476_2019737_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 12
CP020653	Bordetella holmesii strain C690 chromosome, complete genome	3698268	2330602	2426939	3698268	tRNA,protease,transposase	Escherichia_phage(14.81%)	89	NA	NA
AWP93547.1|2330602_2332117_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
AWP93548.1|2332129_2332417_+	hypothetical protein	NA	NA	NA	NA	NA
AWP94788.1|2332437_2333325_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AWP94789.1|2333475_2333982_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AWP93549.1|2333978_2334935_+	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AWP93550.1|2335122_2336469_+	protein FpvAIII	NA	NA	NA	NA	NA
AWP93551.1|2337414_2338185_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
AWP94790.1|2338181_2339192_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
AWP93552.1|2339261_2339507_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP93553.1|2339494_2339953_+	hypothetical protein	NA	NA	NA	NA	NA
AWP93554.1|2340008_2340203_-	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AWP93555.1|2340204_2340546_-	ferredoxin, 2Fe-2S type, ISC system	NA	NA	NA	NA	NA
AWP93556.1|2340555_2342418_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.8e-98
AWP93557.1|2342457_2342964_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
AWP93558.1|2342967_2343291_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
AWP93559.1|2343292_2343697_-	iron-sulfur cluster scaffold-like protein	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
AWP93560.1|2343733_2344945_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
AWP93561.1|2344966_2345515_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
AWP93562.1|2345739_2346231_-	protein tyrosine phosphatase	NA	NA	NA	NA	NA
AWP93563.1|2346445_2348476_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AWP93564.1|2348550_2349753_+	aromatic amino acid aminotransferase	NA	NA	NA	NA	NA
AWP93565.1|2350256_2351231_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWP93566.1|2352264_2352546_+	hypothetical protein	NA	NA	NA	NA	NA
AWP93567.1|2352632_2352806_+	osmotically inducible protein OsmC	NA	NA	NA	NA	NA
AWP93568.1|2352917_2353262_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AWP93569.1|2353333_2354002_+	anti-sigma factor	NA	NA	NA	NA	NA
AWP93570.1|2355417_2356461_+	alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
AWP94791.1|2356457_2356559_+	hypothetical protein	NA	NA	NA	NA	NA
AWP93571.1|2356650_2356911_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP93572.1|2356949_2357771_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AWP93573.1|2358020_2358674_+	repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
AWP93574.1|2358789_2360010_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AWP93575.1|2360060_2362490_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
AWP93576.1|2362655_2363954_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
AWP93577.1|2364058_2364712_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
AWP93578.1|2364714_2366025_-	trigger factor	NA	NA	NA	NA	NA
AWP93579.1|2366252_2366792_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
AWP93580.1|2366852_2367233_+	hypothetical protein	NA	A4PE56	Ralstonia_virus	71.6	2.0e-44
AWP93581.1|2367276_2367537_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP94792.1|2367822_2368833_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
AWP93582.1|2368829_2369600_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
AWP93583.1|2369844_2370345_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.3	9.5e-42
AWP93584.1|2370312_2370804_-	SpoVR like family protein	NA	NA	NA	NA	NA
AWP93585.1|2370913_2371117_-	cold-shock protein CspA	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
AWP93586.1|2371434_2371755_-	hypothetical protein	NA	NA	NA	NA	NA
AWP93587.1|2371738_2372074_-	hypothetical protein	NA	NA	NA	NA	NA
AWP93588.1|2372128_2372341_-	autotransporter	NA	NA	NA	NA	NA
AWP93589.1|2372416_2372755_+|transposase	transposase	transposase	A0A218MNG9	uncultured_virus	50.0	3.7e-05
AWP93590.1|2373149_2374721_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
AWP93591.1|2375514_2375826_+	hypothetical protein	NA	NA	NA	NA	NA
AWP93592.1|2376018_2376840_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AWP93593.1|2376878_2377139_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP93594.1|2377266_2377461_-	hypothetical protein	NA	NA	NA	NA	NA
AWP93595.1|2385090_2386554_+	ribonuclease E/G	NA	NA	NA	NA	NA
AWP93596.1|2386686_2388237_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
AWP93597.1|2388548_2389370_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AWP93598.1|2389408_2389669_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP93599.1|2390782_2391640_+	EamA family transporter	NA	NA	NA	NA	NA
AWP93600.1|2391692_2392190_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWP93601.1|2392310_2393726_+	hypothetical protein	NA	NA	NA	NA	NA
AWP93602.1|2393735_2394920_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AWP93603.1|2394916_2396515_+	MFS transporter	NA	NA	NA	NA	NA
AWP93604.1|2396610_2397729_-	tartrate dehydrogenase	NA	NA	NA	NA	NA
AWP93605.1|2397697_2397943_-	hypothetical protein	NA	NA	NA	NA	NA
AWP93606.1|2398353_2398539_+	hypothetical protein	NA	NA	NA	NA	NA
AWP93607.1|2398694_2399606_+	EamA family transporter	NA	NA	NA	NA	NA
AWP94793.1|2399727_2400570_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
AWP93608.1|2400772_2402146_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AWP93609.1|2402455_2403967_-	ATP-binding protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
AWP93610.1|2404119_2404851_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AWP93611.1|2404957_2406259_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
AWP93612.1|2406266_2407175_+	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AWP93613.1|2407171_2407765_+	nicotinate-nicotinamide nucleotide adenylyltransferase	NA	NA	NA	NA	NA
AWP93614.1|2407808_2408222_+	ribosome silencing factor RsfS	NA	NA	NA	NA	NA
AWP93615.1|2408218_2408689_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
AWP93616.1|2408695_2409301_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AWP93617.1|2411102_2412887_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AWP93618.1|2412883_2414269_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
AWP93619.1|2414254_2415217_-	serine/threonine dehydratase	NA	NA	NA	NA	NA
AWP93620.1|2415286_2415916_-	DNA-binding protein	NA	NA	NA	NA	NA
AWP93621.1|2415953_2417162_-	MFS transporter	NA	NA	NA	NA	NA
AWP93622.1|2417283_2417853_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWP93623.1|2417984_2419538_+	methyltransferase	NA	NA	NA	NA	NA
AWP93624.1|2419841_2421062_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AWP93625.1|2421469_2422372_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWP93626.1|2422368_2423238_+	manganese/iron transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
AWP93627.1|2423234_2424086_+	hypothetical protein	NA	NA	NA	NA	NA
AWP93628.1|2424082_2424907_+	hypothetical protein	NA	NA	NA	NA	NA
AWP93629.1|2426678_2426939_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 13
CP020653	Bordetella holmesii strain C690 chromosome, complete genome	3698268	2472597	2534619	3698268	tRNA,protease,transposase	Rhodococcus_phage(20.0%)	49	NA	NA
AWP93668.1|2472597_2473245_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
AWP93669.1|2473329_2473956_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AWP94796.1|2474020_2474866_+	hypothetical protein	NA	A0A1I9SA48	Rhodococcus_phage	35.1	2.4e-37
AWP93670.1|2475195_2475747_+	hypothetical protein	NA	NA	NA	NA	NA
AWP93671.1|2476510_2476804_-	hypothetical protein	NA	NA	NA	NA	NA
AWP93672.1|2477018_2477348_-	alkylhydroperoxidase	NA	NA	NA	NA	NA
AWP93673.1|2477931_2479392_+	cardiolipin synthase	NA	NA	NA	NA	NA
AWP93674.1|2479951_2481187_-	MFS transporter	NA	NA	NA	NA	NA
AWP93675.1|2481313_2481787_-	hypothetical protein	NA	NA	NA	NA	NA
AWP93676.1|2481783_2482794_-	hypothetical protein	NA	NA	NA	NA	NA
AWP93677.1|2482858_2483824_-	serine/threonine dehydratase	NA	NA	NA	NA	NA
AWP93678.1|2483948_2484209_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP93679.1|2486484_2487402_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWP93680.1|2487700_2488651_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AWP93681.1|2488756_2490043_+	phospholipase	NA	NA	NA	NA	NA
AWP93682.1|2490136_2490736_+	hypothetical protein	NA	NA	NA	NA	NA
AWP93683.1|2490960_2491482_-	hypothetical protein	NA	NA	NA	NA	NA
AWP93684.1|2491747_2492302_+	hypothetical protein	NA	NA	NA	NA	NA
AWP93685.1|2492321_2493683_-	hypothetical protein	NA	NA	NA	NA	NA
AWP93686.1|2494035_2496615_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	NA	NA	NA	NA
AWP93687.1|2496661_2497768_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
AWP93688.1|2497914_2498424_+	dehydratase	NA	NA	NA	NA	NA
AWP93689.1|2498447_2499428_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AWP93690.1|2499385_2500849_+	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
AWP93691.1|2500845_2502018_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AWP93692.1|2502014_2503235_+	CoA transferase	NA	NA	NA	NA	NA
AWP93693.1|2503231_2504029_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWP93694.1|2512550_2513513_-	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AWP93695.1|2513509_2514028_-	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AWP93696.1|2514181_2514502_+	amidohydrolase	NA	NA	NA	NA	NA
AWP93697.1|2515187_2515448_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP93698.1|2515486_2516308_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	44.4	2.9e-56
AWP93699.1|2517717_2518485_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AWP93700.1|2518494_2519160_-	hypothetical protein	NA	NA	NA	NA	NA
AWP93701.1|2519096_2519456_-	hypothetical protein	NA	NA	NA	NA	NA
AWP93702.1|2519488_2520319_-	5-carboxymethyl-2-hydroxymuconate isomerase	NA	NA	NA	NA	NA
AWP93703.1|2520346_2520907_-	glyoxalase	NA	NA	NA	NA	NA
AWP93704.1|2521021_2521822_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AWP93705.1|2521816_2523406_-	hypothetical protein	NA	NA	NA	NA	NA
AWP93706.1|2523518_2524277_-	iron ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.7	7.4e-14
AWP94797.1|2524273_2525203_-	enterobactin ABC transporter permease	NA	NA	NA	NA	NA
AWP93707.1|2525228_2526218_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	43.8	1.4e-65
AWP93708.1|2526220_2527135_-	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWP93709.1|2527421_2528573_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AWP93710.1|2528617_2529052_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
AWP93711.1|2529073_2529826_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
AWP93712.1|2530012_2530987_-	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
AWP93713.1|2531850_2533323_-	amidase	NA	NA	NA	NA	NA
AWP93714.1|2533398_2534619_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
>prophage 14
CP020653	Bordetella holmesii strain C690 chromosome, complete genome	3698268	2566177	2634134	3698268	tRNA,transposase	Leptospira_phage(25.0%)	59	NA	NA
AWP93743.1|2566177_2567128_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AWP93744.1|2567124_2569191_-	cation acetate symporter	NA	NA	NA	NA	NA
AWP93745.1|2569190_2569463_-	hypothetical protein	NA	NA	NA	NA	NA
AWP93746.1|2570157_2570247_+	potassium-transporting ATPase subunit F	NA	NA	NA	NA	NA
AWP93747.1|2570246_2572031_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
AWP93748.1|2572054_2574220_+	potassium-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	26.9	7.8e-24
AWP93749.1|2574230_2574830_+	potassium-transporting ATPase subunit C	NA	NA	NA	NA	NA
AWP93750.1|2577593_2578289_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AWP93751.1|2578297_2579539_-	hypothetical protein	NA	NA	NA	NA	NA
AWP93752.1|2579688_2580669_-	hypothetical protein	NA	NA	NA	NA	NA
AWP93753.1|2580867_2582124_-	isocitrate dehydrogenase (NADP(+))	NA	Q77Z09	Phage_21	64.8	1.2e-11
AWP93754.1|2582326_2582752_+	hypothetical protein	NA	NA	NA	NA	NA
AWP93755.1|2582802_2583165_-	cytochrome	NA	NA	NA	NA	NA
AWP94800.1|2583693_2584581_+	ATP-binding protein	NA	NA	NA	NA	NA
AWP93756.1|2586016_2586391_-	hypothetical protein	NA	NA	NA	NA	NA
AWP93757.1|2586723_2589474_+	peptidase M16	NA	A0A2K9LA15	Tupanvirus	28.1	1.5e-19
AWP93758.1|2589642_2590788_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	60.8	4.0e-19
AWP93759.1|2590888_2592814_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.7	2.7e-145
AWP93760.1|2592902_2593277_-	thiol reductase thioredoxin	NA	NA	NA	NA	NA
AWP93761.1|2593298_2593829_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AWP93762.1|2593942_2594176_-	hypothetical protein	NA	NA	NA	NA	NA
AWP93763.1|2594262_2595354_-	ferrochelatase	NA	NA	NA	NA	NA
AWP93764.1|2595386_2596391_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
AWP93765.1|2596500_2597400_+	NAD kinase	NA	NA	NA	NA	NA
AWP93766.1|2597421_2599077_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AWP93767.1|2600754_2601015_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP93768.1|2601729_2602146_-	transcriptional repressor	NA	NA	NA	NA	NA
AWP94801.1|2602416_2602914_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AWP93769.1|2602929_2603721_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
AWP93770.1|2603778_2604765_-	UDP-N-acetylenolpyruvoylglucosamine reductase	NA	NA	NA	NA	NA
AWP93771.1|2605699_2605960_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP93772.1|2605998_2606553_+	hypothetical protein	NA	S5WIU1	Leptospira_phage	50.3	1.1e-43
AWP93773.1|2607069_2607723_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
AWP94802.1|2607904_2608612_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWP93774.1|2608608_2611224_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
AWP93775.1|2611280_2612465_+	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
AWP93776.1|2612525_2613134_+	lysine transporter LysE	NA	NA	NA	NA	NA
AWP93777.1|2613256_2614282_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AWP93778.1|2614345_2614876_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AWP93779.1|2614755_2615097_-	hypothetical protein	NA	NA	NA	NA	NA
AWP93780.1|2615093_2615801_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AWP93781.1|2615810_2616704_-	carboxyvinyl-carboxyphosphonate phosphorylmutase	NA	NA	NA	NA	NA
AWP93782.1|2616687_2617446_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWP93783.1|2617737_2620413_+	aconitate hydratase 1	NA	NA	NA	NA	NA
AWP93784.1|2620429_2621791_+	dihydroorotase	NA	NA	NA	NA	NA
AWP93785.1|2621810_2622533_+	hydrolase	NA	NA	NA	NA	NA
AWP93786.1|2622537_2623536_+	GTP-binding protein	NA	NA	NA	NA	NA
AWP93787.1|2623956_2624265_+	hypothetical protein	NA	NA	NA	NA	NA
AWP93788.1|2624312_2624885_+	hypothetical protein	NA	NA	NA	NA	NA
AWP93789.1|2624862_2625267_-	hypothetical protein	NA	NA	NA	NA	NA
AWP93790.1|2625385_2626303_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWP93791.1|2626312_2626894_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AWP93792.1|2626890_2627643_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AWP93793.1|2627685_2628405_+	arginyltransferase	NA	NA	NA	NA	NA
AWP93794.1|2628447_2629503_+	dihydroorotate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AWP93795.1|2630512_2630773_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP93796.1|2630811_2631633_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.1e-55
AWP93797.1|2632192_2632771_-	Phasin (PHA-granule associated protein)	NA	NA	NA	NA	NA
AWP93798.1|2632913_2634134_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
>prophage 15
CP020653	Bordetella holmesii strain C690 chromosome, complete genome	3698268	2937001	3046788	3698268	tRNA,protease,transposase	Leptospira_phage(19.05%)	94	NA	NA
AWP94053.1|2937001_2937781_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AWP94054.1|2937803_2938751_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
AWP94055.1|2938752_2938953_+	thiamine biosynthesis protein ThiS	NA	NA	NA	NA	NA
AWP94056.1|2939287_2939548_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP94057.1|2939586_2940408_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AWP94058.1|2940728_2941445_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
AWP94059.1|2941441_2942335_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWP94060.1|2942498_2943719_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AWP94061.1|2943871_2944954_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
AWP94062.1|2946633_2947617_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWP94063.1|2947679_2949092_-	signal recognition particle protein	NA	NA	NA	NA	NA
AWP94064.1|2949209_2950052_+	hypothetical protein	NA	NA	NA	NA	NA
AWP94065.1|2950330_2950939_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
AWP94066.1|2950954_2951575_+	glutathione S-transferase	NA	NA	NA	NA	NA
AWP94813.1|2951640_2952348_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
AWP94067.1|2952352_2953075_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
AWP94068.1|2953061_2953352_-	inner-membrane translocator	NA	NA	NA	NA	NA
AWP94069.1|2953427_2954648_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	2.1e-183
AWP94814.1|2955372_2956224_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWP94070.1|2956275_2957529_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWP94071.1|2957705_2958494_-	DUF1445 domain-containing protein	NA	NA	NA	NA	NA
AWP94072.1|2958613_2959528_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWP94073.1|2959660_2961553_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
AWP94074.1|2961738_2963118_+	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
AWP94075.1|2963562_2963859_+	site-specific recombinase	NA	NA	NA	NA	NA
AWP94076.1|2963902_2964163_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP94077.1|2964201_2964756_+	hypothetical protein	NA	S5WIU1	Leptospira_phage	50.3	1.1e-43
AWP94078.1|2964769_2964994_-	hypothetical protein	NA	NA	NA	NA	NA
AWP94079.1|2967659_2968262_-	3-methyladenine DNA glycosylase	NA	NA	NA	NA	NA
AWP94080.1|2968395_2968854_+	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
AWP94081.1|2968855_2969455_-	iron transport sensor protein	NA	NA	NA	NA	NA
AWP94082.1|2969463_2970273_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWP94083.1|2970307_2971162_+	anion permease	NA	NA	NA	NA	NA
AWP94084.1|2971281_2971869_+	histidine utilization protein HutD	NA	NA	NA	NA	NA
AWP94085.1|2971865_2973245_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
AWP94086.1|2981567_2982908_+	8-amino-7-oxononanoate synthase	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
AWP94087.1|2982921_2983773_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
AWP94088.1|2983784_2985050_-	capsule biosynthesis protein CapA	NA	NA	NA	NA	NA
AWP94089.1|2985111_2987142_-	beta-3-deoxy-D-manno-oct-2-ulosonic acid transferase	NA	NA	NA	NA	NA
AWP94090.1|2988141_2988402_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP94091.1|2988440_2988995_+	hypothetical protein	NA	S5WIU1	Leptospira_phage	50.3	1.1e-43
AWP94092.1|2988991_2989846_-	sulfatase	NA	NA	NA	NA	NA
AWP94093.1|2989838_2990633_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AWP94094.1|2990848_2991799_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AWP94095.1|2991897_2992848_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AWP94096.1|2993450_2994248_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWP94097.1|2994287_2994941_-	DL-methionine transporter permease subunit	NA	NA	NA	NA	NA
AWP94098.1|2994921_2995986_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
AWP94099.1|2996149_2998375_-	glycosyl hydrolase	NA	NA	NA	NA	NA
AWP94100.1|2998620_3000465_-	FAD-dependent cmnm(5)s(2)U34 oxidoreductase	NA	NA	NA	NA	NA
AWP94101.1|3000581_3001454_+	inositol monophosphatase	NA	NA	NA	NA	NA
AWP94102.1|3001500_3003201_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
AWP94103.1|3003263_3004463_+	amidohydrolase	NA	NA	NA	NA	NA
AWP94104.1|3004473_3005352_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWP94105.1|3005458_3006496_+	hypothetical protein	NA	NA	NA	NA	NA
AWP94815.1|3006576_3006981_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AWP94106.1|3006992_3008450_+	magnesium transporter	NA	NA	NA	NA	NA
AWP94107.1|3009092_3009689_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
AWP94108.1|3009849_3010308_-	transcriptional regulator	NA	NA	NA	NA	NA
AWP94109.1|3011085_3012057_-	hypothetical protein	NA	NA	NA	NA	NA
AWP94110.1|3012178_3012598_+	hypothetical protein	NA	NA	NA	NA	NA
AWP94111.1|3013473_3013734_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP94112.1|3013889_3015110_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
AWP94113.1|3015171_3016059_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
AWP94114.1|3016076_3017381_-|protease	protease modulator HflK	protease	NA	NA	NA	NA
AWP94115.1|3017346_3018453_-	GTPase HflX	NA	NA	NA	NA	NA
AWP94116.1|3018540_3018777_-	RNA-binding protein Hfq	NA	NA	NA	NA	NA
AWP94117.1|3018960_3020034_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
AWP94118.1|3020030_3021386_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
AWP94119.1|3021410_3022568_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
AWP94120.1|3022573_3023212_-	hypothetical protein	NA	NA	NA	NA	NA
AWP94121.1|3023215_3024511_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
AWP94122.1|3024543_3025830_-	4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase	NA	NA	NA	NA	NA
AWP94123.1|3025842_3026331_-	transcriptional regulator	NA	NA	NA	NA	NA
AWP94124.1|3026327_3027476_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
AWP94125.1|3027505_3027931_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	42.9	2.4e-22
AWP94126.1|3028250_3031130_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.1	1.1e-137
AWP94127.1|3031183_3032404_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
AWP94128.1|3032452_3033316_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AWP94129.1|3033315_3033909_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AWP94130.1|3034200_3034461_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AWP94131.1|3034960_3035212_-	hypothetical protein	NA	NA	NA	NA	NA
AWP94132.1|3035198_3037820_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.5	2.8e-84
AWP94133.1|3037903_3038929_-	pilus assembly protein	NA	NA	NA	NA	NA
AWP94134.1|3038925_3039510_-	prepilin-type cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
AWP94135.1|3039533_3040634_-	pilus assembly protein	NA	NA	NA	NA	NA
AWP94136.1|3040626_3040881_-	pilus assembly protein	NA	NA	NA	NA	NA
AWP94137.1|3040977_3041853_-	pilus assembly protein	NA	NA	NA	NA	NA
AWP94138.1|3041845_3042295_-	pilus assembly protein	NA	NA	NA	NA	NA
AWP94139.1|3042272_3043397_-	pilus assembly protein	NA	NA	NA	NA	NA
AWP94140.1|3043389_3044976_-	hypothetical protein	NA	NA	NA	NA	NA
AWP94141.1|3044972_3045731_-	pilus assembly protein	NA	NA	NA	NA	NA
AWP94142.1|3045667_3046489_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AWP94143.1|3046527_3046788_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 16
CP020653	Bordetella holmesii strain C690 chromosome, complete genome	3698268	3096676	3152327	3698268	tRNA,protease,transposase	Ralstonia_virus(25.0%)	41	NA	NA
AWP94182.1|3096676_3097897_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AWP94818.1|3097938_3099195_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWP94183.1|3099435_3100581_+	Bcr/CflA family drug resistance efflux transporter	NA	NA	NA	NA	NA
AWP94184.1|3100887_3101124_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
AWP94185.1|3101204_3101372_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
AWP94186.1|3101528_3102617_+	hypothetical protein	NA	NA	NA	NA	NA
AWP94187.1|3102642_3103863_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
AWP94188.1|3106081_3106513_+	DNA-binding protein	NA	NA	NA	NA	NA
AWP94189.1|3106639_3107152_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWP94819.1|3107184_3108345_+	MFS transporter	NA	NA	NA	NA	NA
AWP94190.1|3108416_3111074_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	38.7	7.5e-170
AWP94191.1|3111085_3111763_+	hypothetical protein	NA	NA	NA	NA	NA
AWP94192.1|3111762_3112812_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
AWP94193.1|3112835_3114095_+	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	46.2	1.9e-94
AWP94194.1|3114101_3114491_+	hypothetical protein	NA	NA	NA	NA	NA
AWP94195.1|3114642_3114927_+	N-acetyltransferase	NA	NA	NA	NA	NA
AWP94196.1|3114923_3115313_+	hypothetical protein	NA	NA	NA	NA	NA
AWP94197.1|3115325_3116519_-	secretion protein	NA	NA	NA	NA	NA
AWP94198.1|3116515_3118276_-|protease	protease/lipase ABC transporter ATP-binding protein	protease	F2Y2R6	Organic_Lake_phycodnavirus	28.5	3.5e-14
AWP94199.1|3118272_3119574_-	hypothetical protein	NA	NA	NA	NA	NA
AWP94200.1|3119811_3120072_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP94201.1|3120110_3120932_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AWP94202.1|3127332_3128850_-	propionyl-CoA--succinate CoA transferase	NA	NA	NA	NA	NA
AWP94820.1|3130117_3132475_+	mechanosensitive ion channel protein	NA	NA	NA	NA	NA
AWP94203.1|3132476_3133247_-	hypothetical protein	NA	NA	NA	NA	NA
AWP94204.1|3133243_3134122_-	EamA family transporter	NA	NA	NA	NA	NA
AWP94205.1|3134305_3134596_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AWP94821.1|3134611_3135154_-	DNA polymerase III subunit epsilon	NA	A0A0A7RWA3	Clostridium_phage	29.7	7.2e-11
AWP94206.1|3135377_3137969_+	aconitate hydratase B	NA	NA	NA	NA	NA
AWP94207.1|3140633_3141236_+	hypothetical protein	NA	NA	NA	NA	NA
AWP94822.1|3141484_3144190_+	aconitate hydratase	NA	NA	NA	NA	NA
AWP94208.1|3144255_3145038_-	dioxygenase	NA	NA	NA	NA	NA
AWP94209.1|3145199_3146405_+	hypothetical protein	NA	NA	NA	NA	NA
AWP94210.1|3146411_3147500_+	hypothetical protein	NA	NA	NA	NA	NA
AWP94211.1|3147657_3148215_+	elongation factor P	NA	NA	NA	NA	NA
AWP94212.1|3148296_3148731_-	hypothetical protein	NA	NA	NA	NA	NA
AWP94213.1|3148804_3149509_-	hypothetical protein	NA	NA	NA	NA	NA
AWP94214.1|3149610_3150993_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AWP94215.1|3151002_3151455_-	hypothetical protein	NA	NA	NA	NA	NA
AWP94216.1|3151473_3152028_-	hypothetical protein	NA	S5WIU1	Leptospira_phage	50.3	1.1e-43
AWP94217.1|3152066_3152327_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 17
CP020653	Bordetella holmesii strain C690 chromosome, complete genome	3698268	3351183	3417903	3698268	tRNA,transposase	Synechococcus_phage(12.5%)	60	NA	NA
AWP94390.1|3351183_3352095_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
AWP94391.1|3352096_3354232_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AWP94392.1|3354228_3354768_+	D-glycero-beta-D-manno-heptose-1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
AWP94393.1|3354771_3355500_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AWP94394.1|3355486_3356320_+	hypothetical protein	NA	NA	NA	NA	NA
AWP94395.1|3356324_3357251_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWP94834.1|3357329_3358745_+	FAD-binding dehydrogenase	NA	NA	NA	NA	NA
AWP94396.1|3358731_3359814_+	tricarballylate utilization protein B	NA	NA	NA	NA	NA
AWP94397.1|3359927_3360323_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
AWP94398.1|3360328_3360862_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	35.6	7.5e-13
AWP94399.1|3363252_3364482_+	hypothetical protein	NA	NA	NA	NA	NA
AWP94400.1|3364482_3365925_-	pyruvate kinase	NA	NA	NA	NA	NA
AWP94401.1|3366020_3367163_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	38.0	3.2e-37
AWP94402.1|3367181_3367661_+	thioesterase	NA	NA	NA	NA	NA
AWP94403.1|3367689_3368478_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase	NA	NA	NA	NA	NA
AWP94404.1|3368491_3370030_-	molecular chaperone SurA	NA	NA	NA	NA	NA
AWP94835.1|3370026_3372435_-	LPS biosynthesis protein	NA	NA	NA	NA	NA
AWP94405.1|3372588_3373656_+	aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
AWP94406.1|3373655_3374336_+	mannose-1-phosphate guanylyltransferase	NA	NA	NA	NA	NA
AWP94407.1|3374477_3375203_+	hypothetical protein	NA	NA	NA	NA	NA
AWP94408.1|3375211_3375535_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
AWP94409.1|3375588_3376236_-	hypothetical protein	NA	NA	NA	NA	NA
AWP94410.1|3376371_3376785_+	hypothetical protein	NA	NA	NA	NA	NA
AWP94411.1|3376870_3377920_+	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
AWP94412.1|3378065_3379016_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AWP94413.1|3379054_3379762_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWP94414.1|3379729_3380551_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	44.0	1.9e-55
AWP94415.1|3380589_3380850_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP94416.1|3380907_3382416_-	sulfite reductase	NA	NA	NA	NA	NA
AWP94417.1|3382572_3384096_-	phospholipase D family protein	NA	NA	NA	NA	NA
AWP94418.1|3384150_3384798_-	carbonic anhydrase	NA	NA	NA	NA	NA
AWP94419.1|3384940_3385282_-	hypothetical protein	NA	NA	NA	NA	NA
AWP94420.1|3385439_3385772_+	PsiF repeat family protein	NA	NA	NA	NA	NA
AWP94421.1|3385820_3386861_-	cyclase	NA	NA	NA	NA	NA
AWP94422.1|3386864_3387644_-	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
AWP94423.1|3387679_3387976_-	hypothetical protein	NA	NA	NA	NA	NA
AWP94424.1|3387990_3388266_-	muconolactone delta-isomerase	NA	NA	NA	NA	NA
AWP94425.1|3388333_3388978_-	3-oxoadipate CoA-transferase	NA	NA	NA	NA	NA
AWP94426.1|3388980_3389070_-	3-oxoadipate CoA-transferase	NA	NA	NA	NA	NA
AWP94427.1|3389260_3390046_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AWP94428.1|3390083_3390809_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AWP94429.1|3390822_3392163_-	short-chain fatty acid transporter	NA	NA	NA	NA	NA
AWP94430.1|3392257_3393190_-	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
AWP94431.1|3393418_3396190_-	peptidase S8	NA	NA	NA	NA	NA
AWP94432.1|3396629_3399476_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
AWP94433.1|3399622_3400336_+	7-cyano-7-deazaguanine synthase	NA	A0A0A0RPC6	Escherichia_phage	41.4	1.6e-47
AWP94434.1|3400348_3400891_-	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	45.8	1.1e-27
AWP94435.1|3400996_3401905_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.7	4.4e-05
AWP94436.1|3401996_3403853_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
AWP94437.1|3404036_3405077_-	GntR family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.2	4.3e-20
AWP94438.1|3405219_3406125_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
AWP94439.1|3407812_3408763_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AWP94440.1|3408819_3409587_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
AWP94836.1|3409704_3410349_+	hypothetical protein	NA	NA	NA	NA	NA
AWP94441.1|3410612_3410909_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
AWP94442.1|3411055_3412126_+	rRNA methyltransferase	NA	NA	NA	NA	NA
AWP94443.1|3412820_3413675_+	hypothetical protein	NA	NA	NA	NA	NA
AWP94444.1|3413700_3414921_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
AWP94837.1|3415820_3417170_+	autotransporter	NA	NA	NA	NA	NA
AWP94445.1|3417642_3417903_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 18
CP020653	Bordetella holmesii strain C690 chromosome, complete genome	3698268	3611653	3662753	3698268	tRNA,holin,transposase	Catovirus(18.18%)	42	NA	NA
AWP94618.1|3611653_3613444_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	24.5	5.5e-07
AWP94619.1|3613485_3614121_-	hypothetical protein	NA	A0A2I7S9X1	Vibrio_phage	29.0	1.2e-12
AWP94620.1|3614123_3614438_-	FmdB family transcriptional regulator	NA	NA	NA	NA	NA
AWP94621.1|3615988_3617611_-|holin	choline dehydrogenase	holin	A0A1V0S9J5	Catovirus	29.6	5.4e-46
AWP94622.1|3617781_3617886_-	dihydrodipicolinate synthase	NA	NA	NA	NA	NA
AWP94623.1|3617878_3618589_-	dihydrodipicolinate synthase	NA	NA	NA	NA	NA
AWP94624.1|3618863_3619352_-	diguanylate cyclase	NA	NA	NA	NA	NA
AWP94625.1|3619493_3620693_+	2-aminoadipate aminotransferase	NA	NA	NA	NA	NA
AWP94626.1|3620768_3621692_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
AWP94627.1|3622026_3622407_+	hypothetical protein	NA	NA	NA	NA	NA
AWP94845.1|3622550_3623324_-	transcriptional regulator GlcC	NA	NA	NA	NA	NA
AWP94846.1|3623520_3625692_+	malate synthase G	NA	NA	NA	NA	NA
AWP94628.1|3625749_3626823_-	lipase	NA	G9BWD6	Planktothrix_phage	37.1	2.6e-28
AWP94629.1|3626815_3628585_-	spermidine/putrescine ABC transporter permease	NA	NA	NA	NA	NA
AWP94630.1|3628599_3629709_-	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWP94631.1|3629824_3632314_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
AWP94632.1|3632300_3632972_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AWP94633.1|3633495_3634542_+	oxidoreductase	NA	NA	NA	NA	NA
AWP94634.1|3634550_3635120_+	N-acetyltransferase	NA	NA	NA	NA	NA
AWP94635.1|3635528_3636221_+	aminotransferase DegT	NA	NA	NA	NA	NA
AWP94636.1|3636217_3637300_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	33.2	1.1e-45
AWP94637.1|3637324_3638578_+	glycosyltransferase WbuB	NA	NA	NA	NA	NA
AWP94638.1|3638582_3639770_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	NA	NA	NA	NA
AWP94639.1|3639766_3640360_+	sugar transferase	NA	NA	NA	NA	NA
AWP94640.1|3640746_3642684_+	polysaccharide biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	27.9	2.2e-25
AWP94641.1|3642817_3643768_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AWP94642.1|3643849_3644557_-	hypothetical protein	NA	NA	NA	NA	NA
AWP94643.1|3644620_3647257_+	DNA topoisomerase III	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	26.3	8.0e-23
AWP94644.1|3647386_3648607_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.1e-181
AWP94645.1|3648685_3649741_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWP94646.1|3649740_3650511_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AWP94647.1|3651078_3651879_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
AWP94648.1|3651967_3653395_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AWP94649.1|3653489_3654044_-	hypothetical protein	NA	S5WIU1	Leptospira_phage	50.3	1.1e-43
AWP94650.1|3654082_3654343_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWP94847.1|3654408_3655107_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AWP94651.1|3657070_3657550_+	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AWP94652.1|3657537_3658464_-	bestrophin	NA	NA	NA	NA	NA
AWP94653.1|3658580_3659108_+	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
AWP94654.1|3659133_3660354_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
AWP94848.1|3660749_3661418_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	40.7	2.3e-35
AWP94655.1|3662492_3662753_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
