The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029652	Staphylococcus aureus strain AR_0471 chromosome, complete genome	2785050	61850	70162	2785050		Caulobacter_phage(16.67%)	7	NA	NA
AWQ99472.1|61850_63650_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.0	1.3e-53
AWQ99059.1|63873_64980_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	38.1	1.1e-37
AWQ99564.1|65110_65788_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ99744.1|65790_66891_+	NIF3 family protein	NA	A0A1S5V250	Saudi_moumouvirus	30.6	3.0e-08
AWQ99890.1|67004_68351_+	helicase domain protein	NA	A0A1V0SIR5	Klosneuvirus	34.0	2.4e-55
AWQ99110.1|68360_69251_+	putative endonuclease 4	NA	A0A2H4UU70	Bodo_saltans_virus	33.1	2.0e-26
AWR00874.1|69376_70162_+	ATPase associated with various cellular activities family protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	8.0e-19
>prophage 2
CP029652	Staphylococcus aureus strain AR_0471 chromosome, complete genome	2785050	343412	357867	2785050	integrase,terminase,portal,head	Staphylococcus_phage(55.0%)	24	340560:340577	364028:364045
340560:340577	attL	ATTCAATCATTAATATAT	NA	NA	NA	NA
AWQ99677.1|343412_344894_-|head	phage head morphogenesis, SPP1 gp7 family domain protein	head	Q4ZE35	Staphylococcus_virus	61.9	3.7e-110
AWR00705.1|344883_346332_-|portal	phage portal protein, SPP1 family	portal	Q4ZE36	Staphylococcus_virus	69.6	1.9e-196
AWR00641.1|346344_347619_-|terminase	phage terminase, large subunit, PBSX family	terminase	Q4ZE37	Staphylococcus_virus	76.4	4.2e-195
AWQ98803.1|347605_348034_-	homeo-like domain protein	NA	A1EAE0	Streptococcus_phage	45.1	1.1e-25
AWQ99144.1|348210_348675_-	sigma-70, region 4 family protein	NA	R9TMH4	Paenibacillus_phage	27.7	2.4e-07
AWR00360.1|348717_348951_-	putative membrane protein	NA	NA	NA	NA	NA
AWQ98783.1|348951_349416_-	putative small GTP-binding domain protein	NA	C9E2P0	Enterococcus_phage	43.7	2.5e-20
AWR00292.1|349657_350188_-	mazG nucleotide pyrophosphohydrolase domain protein	NA	A0A1P8VVP1	Streptococcus_phage	39.1	8.0e-23
AWQ99748.1|350180_350492_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ99622.1|350497_350656_-	hypothetical protein	NA	A0A0E3T9L7	Staphylococcus_phage	90.4	7.9e-19
AWQ98788.1|350670_350961_-	phage family protein	NA	A0A223LIA9	Staphylococcus_phage	58.1	5.5e-18
AWQ98757.1|350961_351900_-	dnaD domain protein	NA	A0A1P8L6F0	Staphylococcus_phage	48.1	4.8e-47
AWQ98671.1|351913_352462_-	putative single-strand DNA-binding protein	NA	A7TWM8	Staphylococcus_phage	92.4	4.9e-92
AWR00324.1|352488_353268_-	bacterial dnaA family protein	NA	A0A1W6JPW0	Staphylococcus_phage	88.8	9.3e-129
AWR01077.1|353268_353805_-	glycosyl hydrolases 17 family protein	NA	A0A0H3U480	Staphylococcus_phage	81.4	1.1e-75
AWR01089.1|353809_354076_-	hypothetical protein	NA	A0A2I6PDG2	Staphylococcus_phage	53.6	3.9e-18
AWR00943.1|354065_354383_-	hypothetical protein	NA	W5RAK4	Staphylococcus_phage	80.6	1.6e-39
AWQ99053.1|354469_354631_-	hypothetical protein	NA	R4IH12	Staphylococcus_phage	69.8	1.1e-12
AWQ99867.1|354801_355083_-	hypothetical protein	NA	NA	NA	NA	NA
AWR01068.1|355130_355343_-	cro/C1-type HTH DNA-binding domain protein	NA	A0A2I6PDH8	Staphylococcus_phage	83.3	6.8e-26
AWQ99370.1|355504_355870_+	helix-turn-helix family protein	NA	R9QTP6	Staphylococcus_phage	47.9	1.8e-21
AWR00967.1|356016_356400_+	hypothetical protein	NA	NA	NA	NA	NA
AWR00460.1|356411_357107_+	host cell surface-exposed lipofamily protein	NA	A0A2H4J5B8	uncultured_Caudovirales_phage	51.5	2.1e-07
AWQ99704.1|357159_357867_+|integrase	phage integrase family protein	integrase	V9QKF1	Oenococcus_phage	26.2	4.7e-10
364028:364045	attR	ATATATTAATGATTGAAT	NA	NA	NA	NA
>prophage 3
CP029652	Staphylococcus aureus strain AR_0471 chromosome, complete genome	2785050	613227	621700	2785050		Synechococcus_phage(33.33%)	9	NA	NA
AWQ99790.1|613227_613794_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.6	8.0e-29
AWQ98634.1|613796_614825_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.7	1.2e-62
AWQ99413.1|614817_616302_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.7	3.2e-45
AWR01074.1|616280_618470_-	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	39.8	3.5e-141
AWQ99841.1|618462_619134_-	phosphoribosylformylglycinamidine synthase I	NA	NA	NA	NA	NA
AWQ98759.1|619135_619399_-	phosphoribosylformylglycinamidine synthase, purS protein	NA	NA	NA	NA	NA
AWQ99680.1|619398_620103_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	41.2	4.0e-46
AWR00581.1|620106_621231_-	N5-carboxyaminoimidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AWQ98553.1|621217_621700_-	phosphoribosylaminoimidazole carboxylase, catalytic subunit	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	8.0e-22
>prophage 4
CP029652	Staphylococcus aureus strain AR_0471 chromosome, complete genome	2785050	774286	820116	2785050	tail,head,integrase,terminase,portal,holin	Staphylococcus_phage(69.57%)	71	767385:767400	824792:824807
767385:767400	attL	CTTTTGGTAATTCTTT	NA	NA	NA	NA
AWQ98733.1|774286_774472_-	hypothetical protein	NA	A0A0F6N3H3	Staphylococcus_phage	100.0	2.7e-26
AWQ98814.1|774654_774783_-	hypothetical protein	NA	A0A0F6N3H2	Staphylococcus_phage	100.0	1.1e-15
AWQ98681.1|775049_776495_-	CHAP domain protein	NA	Q08JW9	Staphylococcus_phage	99.0	1.1e-292
AWQ99195.1|776475_776913_-|holin	holin, phage phi LC3 family	holin	A0A2H4PQP0	Staphylococcus_phage	100.0	4.1e-73
AWQ99009.1|776969_777365_-	hypothetical protein	NA	Q4ZBP5	Staphylococcus_phage	100.0	2.7e-68
AWR00884.1|777369_778608_-	hypothetical protein	NA	A0A0F6N3G7	Staphylococcus_phage	98.3	3.2e-208
AWR00671.1|778620_780495_-	mannosyl-glycoendo-beta-N-acetylglucosaminidase family protein	NA	A0A0H4IPY7	Staphylococcus_phage	99.0	0.0e+00
AWQ99821.1|780631_780931_-	hypothetical protein	NA	A0A0F6N3M6	Staphylococcus_phage	100.0	9.9e-47
AWR00362.1|780970_781144_-	hypothetical protein	NA	A0A0F6N3L7	Staphylococcus_phage	100.0	6.6e-27
AWR00798.1|781147_781525_-	hypothetical protein	NA	Q9FZY7	Staphylococcus_virus	100.0	1.2e-60
AWQ99911.1|781524_783348_-	hypothetical protein	NA	Q4ZBH7	Staphylococcus_virus	97.9	8.7e-311
AWR00809.1|783347_785246_-	putative minor structural protein	NA	Q4ZBX7	Staphylococcus_virus	98.6	0.0e+00
AWQ99625.1|785258_787145_-|tail	prophage endopeptidase tail family protein	tail	A7YGW3	Staphylococcus_virus	100.0	0.0e+00
AWR00667.1|787155_788091_-|tail	phage tail family protein	tail	Q4ZBI0	Staphylococcus_virus	100.0	8.2e-180
AWR00949.1|788105_791075_-	TMP repeat family protein	NA	Q4ZBI1	Staphylococcus_virus	99.8	1.0e-263
AWR00179.1|791077_791419_-	hypothetical protein	NA	A0A2H4PQL5	Staphylococcus_phage	76.1	9.3e-41
AWQ99292.1|791439_791934_-	phage family protein	NA	A0A0H4IPX9	Staphylococcus_phage	99.4	5.6e-87
AWQ99183.1|791995_792556_-|tail	putative tail protein	tail	A0A0H4ITY2	Staphylococcus_phage	100.0	5.9e-101
AWQ98983.1|792542_792980_-	hypothetical protein	NA	Q4ZBI5	Staphylococcus_virus	100.0	2.1e-77
AWR00495.1|792992_793343_-	hypothetical protein	NA	A0A0E3XCY8	Staphylococcus_phage	100.0	3.6e-64
AWQ98555.1|793392_793728_-|head,tail	putative head-tail adaptor	head,tail	Q4ZAA0	Staphylococcus_virus	98.2	2.6e-59
AWR00313.1|793720_794035_-|head,tail	phage gp6-like head-tail connector family protein	head,tail	Q4ZBR3	Staphylococcus_phage	100.0	2.6e-53
AWQ98922.1|794034_794361_-	rho termination factor, N-terminal domain protein	NA	Q4ZAA2	Staphylococcus_virus	94.4	8.3e-47
AWQ99950.1|794377_795190_-	hypothetical protein	NA	A0A2H4PQL1	Staphylococcus_phage	98.9	3.1e-143
AWQ99464.1|795206_795797_-	phage minor structural GP20 family protein	NA	A0A2H4PQL3	Staphylococcus_phage	98.5	2.4e-76
AWQ99868.1|795901_796108_-	hypothetical protein	NA	A0A0N9BB04	Staphylococcus_phage	100.0	3.2e-28
AWQ99825.1|796109_796718_-|head	phage head morphogenesis, SPP1 gp7 family domain protein	head	Q4ZBZ6	Staphylococcus_virus	97.5	6.4e-109
AWR00018.1|797031_798450_-|portal	phage portal protein, SPP1 family	portal	A0A0E3T8M2	Staphylococcus_phage	98.7	4.0e-271
AWQ98873.1|798463_799672_-|terminase	phage terminase, large subunit, PBSX family	terminase	R4IG95	Staphylococcus_phage	99.8	1.8e-235
AWQ98544.1|799664_800159_-|terminase	terminase small subunit	terminase	R4IH30	Staphylococcus_phage	100.0	1.1e-74
AWR00482.1|800513_800915_-	hypothetical protein	NA	A0A2H4PQK5	Staphylococcus_phage	100.0	5.6e-69
AWQ99532.1|800915_801089_-	transcriptional activator RinB family protein	NA	A0A0H4ISR0	Staphylococcus_phage	94.7	9.2e-21
AWR00364.1|801085_801292_-	hypothetical protein	NA	A0A0H4IPW6	Staphylococcus_phage	100.0	4.5e-30
AWR00793.1|801288_801534_-	hypothetical protein	NA	A0A0H4ITX2	Staphylococcus_phage	100.0	2.0e-37
AWR00213.1|801570_802104_-	dUTP diphosphatase family protein	NA	Q4ZCN7	Staphylococcus_virus	99.4	3.5e-95
AWR00490.1|802096_802345_-	hypothetical protein	NA	A0A2H4PQK1	Staphylococcus_phage	95.1	4.5e-37
AWR00185.1|802337_802613_-	hypothetical protein	NA	Q4ZBD3	Staphylococcus_virus	100.0	2.3e-45
AWR00383.1|802612_803017_-	hypothetical protein	NA	A0A0H4IPW3	Staphylococcus_phage	100.0	1.6e-71
AWQ99433.1|803030_803273_-	phage family protein	NA	A0A1P8L6E3	Staphylococcus_phage	98.8	1.1e-40
AWR00322.1|803276_803633_-	PVL ORF-50-like family protein	NA	A0A0F6N3E3	Staphylococcus_phage	100.0	6.5e-61
AWR00388.1|803760_804066_-	hypothetical protein	NA	A0A0F6N4H9	Staphylococcus_phage	100.0	1.7e-49
AWR00290.1|804066_804252_-	hypothetical protein	NA	A0A0F6N3K7	Staphylococcus_phage	100.0	1.1e-27
AWR00301.1|804256_804661_-	hypothetical protein	NA	A1KX76	Staphylococcus_virus	100.0	9.6e-69
AWR00244.1|804670_804892_-	hypothetical protein	NA	Q9G021	Staphylococcus_phage	98.6	4.9e-35
AWR00981.1|804894_805110_-	putative phage protein	NA	A9CR72	Staphylococcus_phage	95.8	1.5e-33
AWQ98491.1|805106_806348_-	dnaB-like helicase C terminal domain protein	NA	A0A0E3T8L1	Staphylococcus_phage	98.5	2.0e-226
AWR00497.1|806431_806701_-	hypothetical protein	NA	Q4ZBE2	Staphylococcus_virus	100.0	2.6e-46
AWQ99833.1|806700_807510_-	dnaD domain protein	NA	Q4ZBE3	Staphylococcus_virus	97.8	6.1e-107
AWQ99722.1|807481_808177_-	hypothetical protein	NA	A0A2I6PDA6	Staphylococcus_phage	97.7	3.5e-127
AWQ99942.1|808188_808623_-	single-stranded DNA-binding family protein	NA	A0A0H3U4B5	Staphylococcus_phage	72.4	1.0e-55
AWQ99177.1|808622_809246_-	hypothetical protein	NA	A0A2H4PQQ6	Staphylococcus_phage	99.5	5.2e-114
AWQ98696.1|809238_809460_-	hypothetical protein	NA	A0A1X9H047	Staphylococcus_phage	100.0	1.2e-33
AWQ99618.1|809469_809730_-	hypothetical protein	NA	C8CGY6	Staphylococcus_phage	100.0	8.9e-44
AWQ98567.1|809821_809983_-	hypothetical protein	NA	Q4ZAZ7	Staphylococcus_virus	100.0	2.5e-20
AWR00389.1|809975_810197_-	hypothetical protein	NA	B2ZYU8	Staphylococcus_phage	100.0	8.7e-32
AWR00508.1|810267_810921_+	hypothetical protein	NA	A0A0H4IPV1	Staphylococcus_phage	100.0	4.5e-116
AWQ99385.1|810930_811074_-	hypothetical protein	NA	A0A0H4ITW0	Staphylococcus_phage	100.0	1.9e-16
AWR00284.1|811089_811842_-	phage antirepressor KilAC domain protein	NA	S4SW96	Staphylococcus_phage	99.6	3.7e-138
AWR00493.1|811843_812029_-	helix-turn-helix family protein	NA	A0A0H4IP57	Staphylococcus_phage	100.0	1.3e-25
AWQ99949.1|812474_812957_+	hypothetical protein	NA	A0A0N9BAX2	Staphylococcus_phage	99.4	4.1e-82
AWR00429.1|813057_813237_-	hypothetical protein	NA	A0A0N9BAV3	Staphylococcus_phage	100.0	1.7e-25
AWR01062.1|813250_813487_-	cro/C1-type HTH DNA-binding domain protein	NA	A0A0N9BAY2	Staphylococcus_phage	100.0	1.5e-37
AWR00502.1|813638_813953_+	helix-turn-helix family protein	NA	A0A0N9BAW4	Staphylococcus_phage	100.0	9.8e-53
AWR00458.1|813965_814427_+	hypothetical protein	NA	A0A2K9VBR7	Staphylococcus_phage	100.0	1.2e-83
AWR00240.1|814610_815048_+	hypothetical protein	NA	Q4ZE05	Staphylococcus_virus	100.0	2.0e-75
AWQ99367.1|815041_815449_+	hypothetical protein	NA	Q4ZE06	Staphylococcus_virus	100.0	3.8e-73
AWR00993.1|815445_815643_-	putative periplasmic protein involved in polysaccharide export	NA	Q4ZA73	Staphylococcus_virus	100.0	1.5e-30
AWR00168.1|815755_816805_+|integrase	phage integrase family protein	integrase	A1KWY3	Staphylococcus_virus	100.0	1.6e-203
AWR00112.1|816872_818270_-	feS assembly protein SufB	NA	NA	NA	NA	NA
AWQ98763.1|818420_818885_-	SUF system FeS assembly protein, NifU family	NA	NA	NA	NA	NA
AWR00237.1|818874_820116_-	putative cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.5	1.8e-110
824792:824807	attR	CTTTTGGTAATTCTTT	NA	NA	NA	NA
>prophage 5
CP029652	Staphylococcus aureus strain AR_0471 chromosome, complete genome	2785050	851572	870178	2785050	integrase,terminase,capsid	Staphylococcus_phage(63.16%)	24	851212:851263	866833:866884
851212:851263	attL	AAAAAGCCCACATCCACAAAGGTTGTAGGCTACAAATATGGAGACGGCGGGA	NA	NA	NA	NA
AWQ98767.1|851572_852295_+	enterotoxin type E	NA	A0A1X9H080	Staphylococcus_phage	34.9	2.1e-26
AWQ98672.1|852461_853262_-	enterotoxin type C-3	NA	A0A097PAT7	Streptococcus_pyogenes_phage	47.5	6.1e-51
AWQ99762.1|854049_854610_+	putative penicillin binding protein	NA	Q4ZBG8	Staphylococcus_virus	68.1	5.4e-62
AWR00113.1|854912_855044_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ98800.1|855486_856191_+	toxic shock syndrome toxin-1	NA	NA	NA	NA	NA
AWR00315.1|856345_856915_-|terminase	terminase small subunit	terminase	Q4ZE85	Staphylococcus_phage	97.4	7.9e-101
AWR00452.1|856911_857253_-	putative pathogenicity island protein	NA	A0A1W6JQM3	Staphylococcus_phage	100.0	1.7e-58
AWR01029.1|857255_857783_-|capsid	putative determinant of capsid size	capsid	Q4ZE87	Staphylococcus_phage	96.0	5.4e-88
AWQ99002.1|857833_858052_-	hypothetical protein	NA	NA	NA	NA	NA
AWR00763.1|858069_858648_-	putative pathogenicity island protein	NA	A0A2H4JBG0	uncultured_Caudovirales_phage	38.9	4.8e-29
AWQ98668.1|858659_859001_-	putative saPI1 ORF8-like protein	NA	Q4ZE66	Staphylococcus_phage	98.2	2.4e-57
AWQ98626.1|859450_860092_-	putative saPI1 ORF9-like protein	NA	Q4ZE67	Staphylococcus_phage	94.8	4.5e-113
AWR00488.1|860088_860373_-	putative pathogenicity island protein	NA	A0A1W6JQE4	Staphylococcus_phage	92.6	1.0e-45
AWQ99149.1|860374_860737_-	putative interference protein with phage growth	NA	A0A1W6JQD5	Staphylococcus_phage	99.2	8.9e-66
AWQ99279.1|861022_862492_-	virulence-associated E family protein	NA	A0A1W6JQD6	Staphylococcus_phage	99.2	2.9e-288
AWR00477.1|862508_863378_-	primase C terminal 1 family protein	NA	A0A1W6JQL5	Staphylococcus_phage	96.5	9.3e-162
AWQ98485.1|863465_863759_-	hypothetical protein	NA	A0A1W6JQH0	Staphylococcus_phage	61.8	8.9e-24
AWR00449.1|863759_864170_-	hypothetical protein	NA	A0A2H4JBF1	uncultured_Caudovirales_phage	85.8	2.4e-59
AWQ99068.1|864171_864309_-	putative membrane protein	NA	NA	NA	NA	NA
AWR00836.1|864321_864540_-	helix-turn-helix family protein	NA	NA	NA	NA	NA
AWR00395.1|864727_865657_+	hypothetical protein	NA	Q9AZH9	Lactococcus_phage	35.6	2.2e-12
AWQ99857.1|866354_866756_+|integrase	phage integrase family protein	integrase	A0A0A8WF08	Clostridium_phage	36.3	6.7e-14
AWQ99737.1|867319_867784_-	ssrA-binding protein	NA	W5RAM5	Staphylococcus_phage	100.0	1.5e-81
866833:866884	attR	AAAAAGCCCACATCCACAAAGGTTGTAGGCTACAAATATGGAGACGGCGGGA	NA	NA	NA	NA
AWR00099.1|867805_870178_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	38.8	4.3e-92
>prophage 6
CP029652	Staphylococcus aureus strain AR_0471 chromosome, complete genome	2785050	924324	936900	2785050		uncultured_Caudovirales_phage(50.0%)	11	NA	NA
AWQ99430.1|924324_925296_-	fecCD transport family protein	NA	A0A2H4IY97	uncultured_Caudovirales_phage	79.9	1.0e-140
AWQ99502.1|925441_925606_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ99252.1|925670_926642_-	ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	91.3	3.2e-171
AWR00196.1|926759_928865_-	ribonucleoside-diphosphate reductase, alpha subunit	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	91.7	0.0e+00
AWQ98554.1|928827_929226_-	nrdI protein	NA	A0A2H4J545	uncultured_Caudovirales_phage	72.0	1.2e-52
AWR00023.1|930027_930894_+	eamA-like transporter family protein	NA	NA	NA	NA	NA
AWQ98871.1|930913_931414_+	7-cyano-7-deazaguanine reductase	NA	E7DN65	Pneumococcus_phage	71.5	5.9e-52
AWQ99259.1|931755_933261_+	H+ symporter family protein	NA	A0A0P0IY73	Acinetobacter_phage	32.2	2.6e-58
AWQ99828.1|933530_934448_+	putative lipid kinase	NA	A0A1V0SBJ0	Catovirus	22.4	2.1e-07
AWR00039.1|935135_935684_-	putative 5'(3')-deoxyribonucleotidase	NA	NA	NA	NA	NA
AWR00863.1|935841_936900_-	histidinol-phosphate transaminase	NA	A0A0H3TLT9	Faustovirus	26.9	2.6e-20
>prophage 7
CP029652	Staphylococcus aureus strain AR_0471 chromosome, complete genome	2785050	948876	956695	2785050		Pandoravirus(16.67%)	10	NA	NA
AWR00356.1|948876_950028_-	chorismate binding enzyme family protein	NA	S4VNU7	Pandoravirus	36.1	2.1e-23
AWQ99457.1|950011_950605_-	glutamine amidotransferase of anthranilate synthase/aminodeoxychorismate synthase family protein	NA	A0A0P0IKJ1	Acinetobacter_phage	44.0	8.9e-39
AWQ99484.1|950955_951624_+	queuosine biosynthesis protein QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.5	7.4e-66
AWR00377.1|951625_952045_+	queuosine biosynthesis protein QueD	NA	S4U060	uncultured_phage	28.7	6.3e-07
AWQ99353.1|952048_952762_+	7-cyano-7-deazaguanosine (preQ0) biosynthesis protein QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.5	6.5e-52
AWQ99182.1|952860_953445_+	putative membrane protein	NA	NA	NA	NA	NA
AWQ98973.1|953724_954165_+	electron transfer DM13 family protein	NA	NA	NA	NA	NA
AWQ98856.1|954505_954979_+	doxX family protein	NA	NA	NA	NA	NA
AWQ99202.1|954953_955640_+	response regulator	NA	NA	NA	NA	NA
AWQ98596.1|955639_956695_+	histidine protein kinase SaeS	NA	A0A1V0SGX0	Hokovirus	29.8	3.6e-14
>prophage 8
CP029652	Staphylococcus aureus strain AR_0471 chromosome, complete genome	2785050	2412685	2465424	2785050	tail,head,integrase,portal,holin,protease,capsid	Staphylococcus_phage(87.14%)	73	2421500:2421517	2445983:2446000
AWR00666.1|2412685_2413429_-|protease	CAAX protease self-immunity family protein	protease	NA	NA	NA	NA
AWQ99397.1|2413603_2413888_+	10 kDa chaperonin	NA	A0A221S386	uncultured_virus	46.2	4.7e-14
AWR01003.1|2413963_2415580_+	chaperonin GroL	NA	A0A240F779	uncultured_virus	54.7	3.4e-157
AWR01086.1|2416140_2417448_-	ktr system potassium uptake protein B	NA	NA	NA	NA	NA
AWR00881.1|2417843_2419067_-	putative succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
AWQ98658.1|2419497_2420553_+	hypothetical protein	NA	A0A2I6PER8	Staphylococcus_phage	34.6	6.0e-38
AWQ99582.1|2420574_2421594_+	leucotoxin LukDv	NA	A0A2I6PEU3	Staphylococcus_phage	39.8	2.6e-54
2421500:2421517	attL	AAAAAGAAGAAAAATTAT	NA	NA	NA	NA
AWR00530.1|2421850_2422675_-	sphingomyelin phosphodiesterase	NA	A0A1P8L6H7	Staphylococcus_phage	100.0	6.8e-162
AWQ98560.1|2422731_2423769_-|integrase	integrase	integrase	A0EWV2	Staphylococcus_phage	99.7	3.4e-179
AWQ98805.1|2423827_2424292_-	putative lipoprotein	NA	A0EWV3	Staphylococcus_phage	100.0	1.1e-28
AWR00542.1|2424391_2424574_-	hypothetical protein	NA	R9QT81	Staphylococcus_phage	100.0	5.3e-27
AWQ99602.1|2424729_2425428_-	ion transport family protein	NA	A0A1B0Y2S3	Lactobacillus_phage	29.8	4.4e-13
AWQ99066.1|2425609_2426242_-	helix-turn-helix family protein	NA	Q4ZB06	Staphylococcus_virus	90.4	1.9e-103
AWR00358.1|2426395_2426623_+	helix-turn-helix domain protein	NA	Q4ZB05	Staphylococcus_virus	98.7	3.5e-36
AWQ98749.1|2426645_2427434_+	phage antirepressor KilAC domain protein	NA	R9QSV3	Staphylococcus_phage	99.2	1.8e-143
AWR00061.1|2427450_2427645_+	hypothetical protein	NA	Q4ZDS1	Staphylococcus_virus	100.0	1.0e-23
AWQ98859.1|2427639_2427996_-	hypothetical protein	NA	A0A1P8L6H1	Staphylococcus_phage	100.0	6.1e-59
AWR00652.1|2428045_2428237_+	hypothetical protein	NA	Q4ZDR9	Staphylococcus_virus	100.0	2.1e-26
AWQ98981.1|2428238_2428466_-	hypothetical protein	NA	A7TWL9	Staphylococcus_phage	98.7	1.9e-37
AWQ99784.1|2428524_2428845_+	hypothetical protein	NA	Q4ZDR7	Staphylococcus_virus	100.0	1.5e-56
AWR00227.1|2429095_2429398_+	hypothetical protein	NA	A1KWZ5	Staphylococcus_virus	63.6	1.2e-26
AWQ98622.1|2429401_2429662_+	hypothetical protein	NA	A0A0H3U2T6	Staphylococcus_phage	95.3	3.2e-41
AWQ99569.1|2429942_2431886_+	AAA domain protein	NA	S4V9K6	Staphylococcus_phage	98.9	0.0e+00
AWR00077.1|2431887_2432808_+	recombinase, phage RecT family protein	NA	A0A2I6PDH5	Staphylococcus_phage	99.0	7.3e-165
AWR01015.1|2433020_2433506_+	beta-lactamase superfamily domain protein	NA	A0A2I6PDI9	Staphylococcus_phage	99.4	2.7e-86
AWQ99026.1|2433506_2433977_+	single-stranded DNA-binding protein ssb	NA	A0A1W6JPL9	Staphylococcus_phage	100.0	8.0e-83
AWR00934.1|2434324_2434891_+	dnaD domain protein	NA	W5R8H6	Staphylococcus_phage	96.8	8.7e-76
AWR00177.1|2434897_2435116_+	hypothetical protein	NA	A0A1P8L6E4	Staphylococcus_phage	100.0	1.4e-37
AWQ98851.1|2435124_2435529_+	endodeoxyribonuclease RusA family protein	NA	O80087	Staphylococcus_phage	99.3	1.4e-72
AWQ99022.1|2435541_2435910_+	PVL ORF-50-like family protein	NA	I1W656	Staphylococcus_phage	98.4	1.2e-49
AWR00560.1|2435991_2436156_+	phage family protein	NA	C8CH00	Staphylococcus_phage	98.1	4.5e-25
AWR00455.1|2436170_2436515_+	acetyltransferase family protein	NA	A0A0F6N3K4	Staphylococcus_phage	90.0	2.2e-45
AWQ98753.1|2436507_2436756_+	hypothetical protein	NA	A0EWY0	Staphylococcus_phage	97.6	3.5e-37
AWR01026.1|2436748_2437285_+	dUTPase family protein	NA	M1SNY5	Staphylococcus_phage	98.3	1.5e-93
AWQ99332.1|2437438_2437567_+	hypothetical protein	NA	A9CR89	Staphylococcus_phage	95.2	3.2e-10
AWQ98705.1|2437563_2437770_+	hypothetical protein	NA	A0A2I6PDB6	Staphylococcus_phage	86.8	1.9e-25
AWQ98950.1|2437766_2437970_+	hypothetical protein	NA	B2ZYX5	Staphylococcus_phage	95.5	5.7e-30
AWQ99305.1|2437962_2438112_+	transcriptional activator RinB family protein	NA	A0A1W6JPZ2	Staphylococcus_phage	98.0	1.1e-17
AWQ99453.1|2438318_2438921_+	hypothetical protein	NA	D2JLD8	Staphylococcus_phage	99.5	4.5e-107
AWR00215.1|2438917_2439121_+	hypothetical protein	NA	R9QT57	Staphylococcus_phage	100.0	6.3e-29
AWR00797.1|2439148_2439565_+	phage transcriptional regulator, RinA family protein	NA	G4KNP7	Staphylococcus_phage	100.0	1.3e-76
AWR00803.1|2439796_2440096_+	HNH endonuclease family protein	NA	G4KNP8	Staphylococcus_phage	99.0	7.9e-52
AWQ99734.1|2440226_2440571_+	hypothetical protein	NA	G4KNP9	Staphylococcus_phage	100.0	9.4e-57
AWQ98693.1|2440567_2442229_+	phage Terminase family protein	NA	A0A075M4D3	Staphylococcus_phage	100.0	0.0e+00
AWR00387.1|2442244_2443432_+|portal	phage portal protein, HK97 family	portal	A0A2I6PDI1	Staphylococcus_phage	99.7	3.0e-219
AWQ98745.1|2443415_2444153_+|protease	clp protease family protein	protease	G4KNQ2	Staphylococcus_phage	100.0	1.8e-129
AWQ98806.1|2444176_2445322_+|capsid	phage major capsid protein, HK97 family	capsid	G4KNQ3	Staphylococcus_phage	100.0	9.6e-215
AWQ98883.1|2445341_2445602_+	hypothetical protein	NA	A0A0H3U504	Staphylococcus_phage	98.8	3.2e-41
AWQ99230.1|2445614_2445899_+|head,tail	phage gp6-like head-tail connector family protein	head,tail	A0A2I6PDJ5	Staphylococcus_phage	100.0	2.3e-45
AWR00750.1|2445882_2446245_+|head,tail	phage head-tail joining family protein	head,tail	G4KNQ4	Staphylococcus_phage	100.0	4.4e-65
2445983:2446000	attR	AAAAAGAAGAAAAATTAT	NA	NA	NA	NA
AWR00453.1|2446241_2446646_+	hypothetical protein	NA	A0A1W6JPJ1	Staphylococcus_phage	100.0	2.5e-69
AWQ98635.1|2446642_2447050_+	hypothetical protein	NA	G4KNQ6	Staphylococcus_phage	100.0	7.1e-72
AWR00093.1|2447050_2447695_+|tail	phage major tail, phi13 family protein	tail	A0A2I6PDI6	Staphylococcus_phage	100.0	1.1e-119
AWR00966.1|2447820_2447961_+	bacterial Ig-like domain family protein	NA	A0A2I6PDK6	Staphylococcus_phage	100.0	2.5e-16
AWQ99181.1|2448010_2448361_+	hypothetical protein	NA	G4KNQ8	Staphylococcus_phage	100.0	7.8e-59
AWR00892.1|2448411_2448549_+	hypothetical protein	NA	A0A2I6PDX7	Staphylococcus_phage	100.0	3.4e-18
AWQ99361.1|2448605_2453135_+|tail	phage tail tape measure protein, TP901 family, core region	tail	A0A2I6PDK2	Staphylococcus_phage	99.7	0.0e+00
AWR00272.1|2453131_2454616_+|tail	phage tail family protein	tail	A0A2I6PDJ0	Staphylococcus_phage	100.0	1.2e-297
AWR00571.1|2454631_2458417_+	phage minor structural, N-terminal region domain protein	NA	A0A1X9H0H3	Staphylococcus_phage	98.5	0.0e+00
AWQ99735.1|2458406_2458559_+	hypothetical protein	NA	D2JLG0	Staphylococcus_phage	100.0	5.2e-20
AWQ98557.1|2458605_2458893_+	hypothetical protein	NA	D2JLG1	Staphylococcus_phage	100.0	1.3e-43
AWQ99065.1|2459016_2459247_+	hypothetical protein	NA	D2JLG2	Staphylococcus_phage	100.0	1.2e-31
AWQ99591.1|2459438_2459573_+	putative membrane protein	NA	D2JLG3	Staphylococcus_phage	100.0	9.3e-13
AWR00713.1|2459784_2460039_+|holin	holin, phage phi LC3 family	holin	D2JLG4	Staphylococcus_phage	100.0	4.1e-41
AWQ99637.1|2460050_2460806_+	CHAP domain protein	NA	D2JLG5	Staphylococcus_phage	100.0	3.4e-152
AWQ99018.1|2460996_2461488_+	staphylokinase	NA	A0A1X9H028	Staphylococcus_phage	100.0	9.5e-87
AWQ99855.1|2462176_2462473_+	bacterial SH3 domain protein	NA	A0A1P8L6B4	Staphylococcus_phage	100.0	1.3e-51
AWQ99440.1|2462567_2463017_-	chemotaxis inhibitory protein	NA	A0A1P8L6A8	Staphylococcus_phage	99.3	2.5e-78
AWQ99906.1|2463701_2464052_+	complement inhibitor	NA	A0A1P8L6B0	Staphylococcus_phage	100.0	7.5e-54
AWR00336.1|2464104_2464296_-	putative membrane protein	NA	M9NS66	Staphylococcus_phage	100.0	1.7e-23
AWQ98547.1|2464440_2464596_+	hypothetical protein	NA	A0A1P8L6A1	Staphylococcus_phage	100.0	1.4e-20
AWQ98556.1|2464675_2464855_-	putative membrane protein	NA	A0A1W6JQ29	Staphylococcus_phage	100.0	2.2e-25
AWR00392.1|2465226_2465424_-	phospholipase C domain protein	NA	A0A1P8L6A7	Staphylococcus_phage	93.8	8.3e-26
>prophage 9
CP029652	Staphylococcus aureus strain AR_0471 chromosome, complete genome	2785050	2594520	2645258	2785050	transposase,integrase,protease,tRNA	Staphylococcus_phage(84.21%)	49	2594502:2594520	2600296:2600314
2594502:2594520	attL	TTGGTATGTCAACAATTTT	NA	NA	NA	NA
AWQ98623.1|2594520_2595327_-|integrase	integrase core domain protein	integrase	A0A2I7SC85	Paenibacillus_phage	54.5	1.1e-76
AWR01084.1|2595368_2595650_-|transposase	transposase family protein	transposase	A0A0C5AJ30	Paenibacillus_phage	64.5	6.5e-24
AWR00519.1|2596041_2596218_+	hypothetical protein	NA	A0A2H4PQN4	Staphylococcus_phage	91.4	4.1e-24
AWR00987.1|2596527_2597181_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ98727.1|2597190_2598897_-	description family protein	NA	NA	NA	NA	NA
AWR01046.1|2599165_2599447_+|transposase	transposase family protein	transposase	A0A0C5AJ30	Paenibacillus_phage	64.5	6.5e-24
AWR01080.1|2599488_2600295_+|integrase	integrase core domain protein	integrase	A0A2I7SC85	Paenibacillus_phage	54.5	1.1e-76
AWQ98988.1|2600291_2600468_-	hypothetical protein	NA	NA	NA	NA	NA
2600296:2600314	attR	AAAATTGTTGACATACCAA	NA	NA	NA	NA
AWQ99051.1|2600496_2600838_-	hypothetical protein	NA	A0A2H4PQN6	Staphylococcus_phage	91.2	4.8e-53
AWR00331.1|2600878_2601505_-	hypothetical protein	NA	A0A2H4PQM7	Staphylococcus_phage	84.1	3.9e-85
AWQ99898.1|2601580_2602576_-	hypothetical protein	NA	A0A2H4PQN2	Staphylococcus_phage	97.2	1.9e-73
AWQ98971.1|2602656_2603271_-	excalibur calcium-binding domain protein	NA	A0A2H4PQM8	Staphylococcus_phage	68.1	4.6e-22
AWR00198.1|2603582_2604065_+	hypothetical protein	NA	A0A2H4PQN7	Staphylococcus_phage	98.6	1.9e-79
AWQ99575.1|2604223_2605702_+	O-succinylbenzoate-CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	95.1	1.0e-277
AWR00833.1|2605706_2606708_+	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	97.6	3.1e-185
AWR00984.1|2606704_2606962_-	putative membrane protein insertion efficiency factor	NA	A0A2H4PQM5	Staphylococcus_phage	97.6	1.0e-44
AWR00665.1|2607021_2607501_+	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	99.4	3.0e-85
AWQ99205.1|2607481_2608252_+	prolyl oligopeptidase family protein	NA	A0A2H4PQM6	Staphylococcus_phage	97.6	6.8e-140
AWR00985.1|2608631_2610224_-	phosphoenolpyruvate carboxykinase	NA	A0A2H4PQN1	Staphylococcus_phage	99.8	0.0e+00
AWR00382.1|2610595_2611789_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	99.5	4.3e-218
AWQ99587.1|2611913_2612822_+	nuclease-related domain protein	NA	A0A2H4PQQ8	Staphylococcus_phage	99.7	9.8e-138
AWQ99203.1|2613033_2613867_+	aldo/keto reductase family protein	NA	A0A2H4PQR8	Staphylococcus_phage	99.3	3.5e-158
AWQ98504.1|2614116_2614470_-	crcB-like family protein	NA	A0A2H4PQQ7	Staphylococcus_phage	91.5	2.7e-19
AWQ99989.1|2614466_2614832_-	crcB-like family protein	NA	A0A2H4PQR0	Staphylococcus_phage	99.2	6.2e-59
AWQ99803.1|2615087_2615237_-	putative membrane protein	NA	NA	NA	NA	NA
AWQ99083.1|2615648_2616362_+	transaldolase	NA	M1PR54	Cyanophage	35.3	5.5e-19
AWQ99212.1|2616861_2617482_-|protease	CAAX protease self-immunity family protein	protease	NA	NA	NA	NA
AWQ99917.1|2617648_2618284_-|protease	CAAX protease self-immunity family protein	protease	NA	NA	NA	NA
AWR01055.1|2618580_2619024_+	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	77.9	1.1e-49
AWR00476.1|2619010_2619250_-	comK family protein	NA	NA	NA	NA	NA
AWQ99185.1|2619443_2619602_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ99020.1|2619566_2620037_-	RNA polymerase sigma factor SigS	NA	A0A2H4PQT5	Staphylococcus_phage	85.2	3.8e-69
AWQ99060.1|2620235_2620460_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ98714.1|2620734_2621589_+	mannosyl-glycoendo-beta-N-acetylglucosaminidase family protein	NA	Q4ZCC7	Staphylococcus_virus	38.6	9.8e-39
AWR00282.1|2621675_2622968_-	arsenite/antimonite efflux pump membrane family protein	NA	A0A2H4PQU3	Staphylococcus_phage	94.9	3.0e-217
AWQ98793.1|2623924_2625427_+	FAD-NAD(P)-binding family protein	NA	A0A2H4PQX2	Staphylococcus_phage	100.0	2.3e-30
AWR00426.1|2625908_2626952_+	riboflavin biosynthesis protein RibD	NA	A0A2H4PQS8	Staphylococcus_phage	98.8	1.2e-195
AWQ99753.1|2626958_2627591_+	riboflavin synthase, alpha subunit	NA	A0A2H4PQS5	Staphylococcus_phage	97.6	2.1e-110
AWQ98702.1|2627601_2628783_+	riboflavin biosynthesis protein RibBA	NA	A0A2H4PQS2	Staphylococcus_phage	99.5	5.6e-226
AWR00824.1|2628795_2629260_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	98.7	2.2e-69
AWR00394.1|2629381_2630383_-	proline dehydrogenase family protein	NA	A0A2H4PQT6	Staphylococcus_phage	99.4	2.6e-184
AWR01069.1|2630616_2631444_+	alpha/beta hydrolase family protein	NA	NA	NA	NA	NA
AWR00381.1|2632014_2632416_+	HTH-type transcriptional regulator rot	NA	NA	NA	NA	NA
AWQ99277.1|2632532_2633096_-	rRNA methylase family protein	NA	A0A2H4PQV0	Staphylococcus_phage	98.4	4.1e-102
AWR00144.1|2633092_2634046_-	radical SAM superfamily protein	NA	A0A2H4PQV5	Staphylococcus_phage	100.0	2.2e-79
AWQ99096.1|2634155_2635337_+	major Facilitator Superfamily protein	NA	A0A2H4PQR6	Staphylococcus_phage	99.7	9.6e-218
AWQ98769.1|2635628_2638043_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	98.7	0.0e+00
AWQ99330.1|2638064_2638376_+	rhodanese-like domain protein	NA	A0A2H4PQR9	Staphylococcus_phage	97.1	6.9e-51
AWQ99584.1|2638700_2645258_+	sasC/Mrp/FmtB intercellular aggregation domain protein	NA	A0A2H4PQU6	Staphylococcus_phage	87.6	2.3e-292
>prophage 10
CP029652	Staphylococcus aureus strain AR_0471 chromosome, complete genome	2785050	2768542	2777586	2785050	tRNA	uncultured_Mediterranean_phage(50.0%)	7	NA	NA
AWR00075.1|2768542_2769547_+	holliday junction DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	1.7e-05
AWQ99442.1|2769548_2770574_+|tRNA	tRNA ribosyltransferase-isomerase	tRNA	NA	NA	NA	NA
AWR00255.1|2770596_2771736_+|tRNA	queuine tRNA-ribosyltransferase	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.7	5.4e-85
AWQ99645.1|2771754_2772015_+	preprotein translocase, YajC subunit	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.3	8.2e-05
AWR00675.1|2772289_2774569_+	protein-export membrane protein SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	36.2	4.1e-31
AWR00990.1|2774772_2777046_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.5	7.3e-65
AWQ98880.1|2777067_2777586_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.8	2.1e-28
>prophage 1
CP029650	Staphylococcus aureus strain AR_0471 plasmid unnamed1, complete sequence	40931	23950	32124	40931	integrase,transposase	Paenibacillus_phage(28.57%)	9	28614:28630	36949:36965
AWQ98461.1|23950_24544_-	resolvase, N terminal domain protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.1	1.5e-41
AWQ98468.1|24807_25188_-	methicillin resistance regulatory protein MecI	NA	NA	NA	NA	NA
AWQ98462.1|25177_26935_-	regulatory protein BlaR1	NA	NA	NA	NA	NA
AWQ98443.1|27041_27887_+	beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	34.4	1.2e-31
AWQ98452.1|28255_28864_+	putative transposon DNA-invertase bin3	NA	E5FFF9	Burkholderia_phage	28.5	6.2e-11
28614:28630	attL	TTTCAGAACAAGAGAGA	NA	NA	NA	NA
AWQ98465.1|29623_30430_-|integrase	integrase core domain protein	integrase	A0A2I7SC85	Paenibacillus_phage	54.5	1.1e-76
AWQ98467.1|30471_30753_-|transposase	transposase family protein	transposase	A0A0C5AJ30	Paenibacillus_phage	64.5	6.5e-24
AWQ98456.1|30764_31283_-	putative enterotoxin	NA	A0A075M4C7	Staphylococcus_phage	36.1	2.1e-15
AWQ98455.1|31392_32124_-	toxin beta-grasp domain protein	NA	A0EX09	Staphylococcus_phage	35.9	6.9e-25
36949:36965	attR	TCTCTCTTGTTCTGAAA	NA	NA	NA	NA
