The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029667	Staphylococcus aureus strain AR_0225 chromosome, complete genome	2897877	669332	727572	2897877	protease,integrase,terminase,portal,capsid,holin,head,tail	Staphylococcus_phage(97.1%)	76	683199:683216	708131:708148
AWR08318.1|669332_670076_-|protease	CAAX protease self-immunity family protein	protease	NA	NA	NA	NA
AWR06772.1|670250_670535_+	10 kDa chaperonin	NA	A0A221S386	uncultured_virus	46.2	4.7e-14
AWR07570.1|670610_672227_+	chaperonin GroL	NA	A0A240F779	uncultured_virus	54.7	3.4e-157
AWR07834.1|673137_673728_+|terminase	terminase small subunit	terminase	Q4ZE85	Staphylococcus_phage	95.8	1.1e-97
AWR06738.1|674081_674423_+	putative membrane protein	NA	NA	NA	NA	NA
AWR08961.1|674587_675031_+	acetyltransferase family protein	NA	NA	NA	NA	NA
AWR06689.1|675883_677191_-	ktr system potassium uptake protein B	NA	NA	NA	NA	NA
AWR07933.1|677351_678263_+	periplasmic binding family protein	NA	NA	NA	NA	NA
AWR06602.1|678324_679170_+	leucine carboxyl methyltransferase family protein	NA	NA	NA	NA	NA
AWR07157.1|679541_680765_-	putative succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
AWR06639.1|681199_682255_+	hypothetical protein	NA	A0A1X9IGW5	Staphylococcus_phage	34.3	2.8e-35
AWR08656.1|682276_683293_+	hypothetical protein	NA	A0A2I6PER8	Staphylococcus_phage	29.0	1.1e-25
683199:683216	attL	AAAAAGAAGAAAAATTAT	NA	NA	NA	NA
AWR07875.1|683530_684355_-	sphingomyelin phosphodiesterase	NA	A0A1P8L6H7	Staphylococcus_phage	100.0	6.8e-162
AWR08371.1|684411_685449_-|integrase	integrase	integrase	A0A1X9H022	Staphylococcus_phage	99.7	3.8e-178
AWR06763.1|685639_686353_-	pemK-like family protein	NA	A0A1X9H026	Staphylococcus_phage	100.0	5.0e-129
AWR07092.1|686430_686613_-	hypothetical protein	NA	A0A0H3U4Z4	Staphylococcus_phage	100.0	4.1e-27
AWR08537.1|687163_688096_-	exonuclease family protein	NA	A0A2I6PEZ7	Staphylococcus_phage	100.0	5.7e-173
AWR06901.1|688111_688825_-	helix-turn-helix family protein	NA	M9NUL0	Staphylococcus_phage	100.0	1.2e-130
AWR07858.1|688958_689222_+	helix-turn-helix family protein	NA	A0A2I6PF09	Staphylococcus_phage	100.0	7.2e-41
AWR08469.1|689441_689771_-	hypothetical protein	NA	A0A0H3U4Z1	Staphylococcus_phage	100.0	4.6e-53
AWR07727.1|689821_690574_+	phage antirepressor KilAC domain protein	NA	A0A0H3U319	Staphylococcus_phage	100.0	5.6e-139
AWR07614.1|690589_690766_+	hypothetical protein	NA	A0A2I6PEL1	Staphylococcus_phage	100.0	8.8e-27
AWR06845.1|690762_690981_-	putative phiSLT ORF78-like protein	NA	A0A0H3U2T9	Staphylococcus_phage	98.6	7.0e-34
AWR07538.1|691051_691372_+	hypothetical protein	NA	A0A0H3U4C3	Staphylococcus_phage	100.0	1.5e-56
AWR07074.1|691368_691530_+	hypothetical protein	NA	A0A0H3U4Y7	Staphylococcus_phage	100.0	3.8e-21
AWR08792.1|691624_691885_+	hypothetical protein	NA	A0A0H3U2W4	Staphylococcus_phage	100.0	9.3e-41
AWR06809.1|691924_692185_+	hypothetical protein	NA	A0A0H3U2T6	Staphylococcus_phage	100.0	6.8e-44
AWR08719.1|692465_694409_+	AAA domain protein	NA	A0A2I6PDH3	Staphylococcus_phage	94.7	0.0e+00
AWR07433.1|694410_695331_+	recombinase, phage RecT family protein	NA	A0A2I6PDH5	Staphylococcus_phage	100.0	2.3e-166
AWR07001.1|695543_696029_+	beta-lactamase superfamily domain protein	NA	A0A0H3U2T4	Staphylococcus_phage	100.0	4.2e-87
AWR08638.1|696029_696500_+	single-stranded DNA-binding family protein	NA	A0A0H3U4B5	Staphylococcus_phage	100.0	4.4e-81
AWR07151.1|696529_697423_+	dnaD domain protein	NA	A0A1P8L6F0	Staphylococcus_phage	100.0	3.2e-141
AWR07774.1|697429_697648_+	hypothetical protein	NA	A0A2I6PDG4	Staphylococcus_phage	100.0	1.0e-37
AWR09189.1|697656_698061_+	endodeoxyribonuclease RusA family protein	NA	A0A0H3U2W2	Staphylococcus_phage	100.0	1.4e-72
AWR08298.1|698073_698442_+	PVL ORF-50-like family protein	NA	A0A0H3U2T3	Staphylococcus_phage	100.0	2.0e-49
AWR07960.1|698445_698688_+	phage family protein	NA	A0A0H3U4B0	Staphylococcus_phage	100.0	1.1e-40
AWR08565.1|698702_699068_+	acetyltransferase family protein	NA	A0A0H3U4X7	Staphylococcus_phage	96.4	1.1e-52
AWR06629.1|699060_699297_+	hypothetical protein	NA	A0A0H3U313	Staphylococcus_phage	100.0	5.3e-35
AWR07469.1|699286_699529_+	hypothetical protein	NA	A0A2I6PF40	Staphylococcus_phage	100.0	3.7e-36
AWR08547.1|699521_700055_+	dUTP diphosphatase family protein	NA	A0A0H3U2T1	Staphylococcus_phage	100.0	1.6e-95
AWR07164.1|700208_700337_+	hypothetical protein	NA	A0A2H4PQJ7	Staphylococcus_phage	100.0	1.2e-14
AWR08900.1|700333_700540_+	hypothetical protein	NA	A0A0H3U2R7	Staphylococcus_phage	100.0	1.3e-29
AWR07293.1|700536_700923_+	hypothetical protein	NA	W5R986	Staphylococcus_phage	100.0	3.0e-64
AWR07123.1|700919_701069_+	transcriptional activator RinB family protein	NA	A0A1W6JPZ2	Staphylococcus_phage	100.0	4.8e-18
AWR07493.1|701080_701269_+	hypothetical protein	NA	A0A2I6PDV9	Staphylococcus_phage	100.0	4.6e-26
AWR09158.1|701296_701713_+	phage transcriptional regulator, RinA family protein	NA	G4KNP7	Staphylococcus_phage	100.0	1.3e-76
AWR08001.1|701944_702244_+	HNH endonuclease family protein	NA	A0EWY8	Staphylococcus_phage	100.0	4.6e-52
AWR07772.1|702373_702718_+	hypothetical protein	NA	G4KNP9	Staphylococcus_phage	100.0	9.4e-57
AWR07813.1|702714_704376_+	phage Terminase family protein	NA	A0A2I6PDJ8	Staphylococcus_phage	99.8	0.0e+00
AWR08834.1|704391_705579_+|portal	phage portal protein, HK97 family	portal	A0A2I6PDI1	Staphylococcus_phage	100.0	1.0e-219
AWR09065.1|705562_706300_+|protease	clp protease family protein	protease	G4KNQ2	Staphylococcus_phage	100.0	1.8e-129
AWR07213.1|706323_707469_+|capsid	phage major capsid protein, HK97 family	capsid	G4KNQ3	Staphylococcus_phage	100.0	9.6e-215
AWR06936.1|707488_707773_+	hypothetical protein	NA	A0A2I6PDJ3	Staphylococcus_phage	100.0	1.8e-45
AWR08387.1|707762_708047_+|head,tail	phage gp6-like head-tail connector family protein	head,tail	A0A2I6PDJ5	Staphylococcus_phage	100.0	2.3e-45
AWR07861.1|708030_708393_+|head,tail	phage head-tail joining family protein	head,tail	G4KNQ4	Staphylococcus_phage	100.0	4.4e-65
708131:708148	attR	AAAAAGAAGAAAAATTAT	NA	NA	NA	NA
AWR07413.1|708389_708794_+	hypothetical protein	NA	A0A0H3U2V1	Staphylococcus_phage	100.0	8.7e-70
AWR08791.1|709198_709843_+|tail	phage major tail, phi13 family protein	tail	A0A0H3U4E6	Staphylococcus_phage	100.0	6.5e-120
AWR08345.1|709968_710109_+	bacterial Ig-like domain family protein	NA	A0A2I6PDK6	Staphylococcus_phage	97.8	7.2e-16
AWR07753.1|710158_710509_+	hypothetical protein	NA	A0A0H3U503	Staphylococcus_phage	100.0	1.3e-58
AWR06789.1|710559_710697_+	hypothetical protein	NA	A0A2I6PDX7	Staphylococcus_phage	100.0	3.4e-18
AWR07295.1|710753_715283_+|tail	phage tail tape measure protein, TP901 family, core region	tail	A0A1X9H084	Staphylococcus_phage	95.0	0.0e+00
AWR09081.1|715279_716764_+|tail	phage tail family protein	tail	A0A0H3U501	Staphylococcus_phage	100.0	2.0e-297
AWR07823.1|716779_720565_+	phage minor structural, N-terminal region domain protein	NA	A0A1X9H0H3	Staphylococcus_phage	98.4	0.0e+00
AWR08857.1|720554_720707_+	hypothetical protein	NA	D2JLG0	Staphylococcus_phage	100.0	5.2e-20
AWR06600.1|720753_721041_+	hypothetical protein	NA	D2JLG1	Staphylococcus_phage	100.0	1.3e-43
AWR08568.1|721098_721395_+	hypothetical protein	NA	D2JLG2	Staphylococcus_phage	100.0	2.9e-46
AWR08462.1|721586_721721_+	putative membrane protein	NA	D2JLG3	Staphylococcus_phage	100.0	9.3e-13
AWR06659.1|721932_722187_+|holin	holin, phage phi LC3 family	holin	D2JLG4	Staphylococcus_phage	100.0	4.1e-41
AWR07524.1|722198_722954_+	CHAP domain protein	NA	D2JLG5	Staphylococcus_phage	100.0	3.4e-152
AWR08596.1|723144_723636_+	staphylokinase	NA	A0A1X9H028	Staphylococcus_phage	100.0	9.5e-87
AWR06719.1|724324_724621_+	bacterial SH3 domain protein	NA	A0A1P8L6B4	Staphylococcus_phage	100.0	1.3e-51
AWR07663.1|724715_725165_-	chemotaxis inhibitory protein	NA	A0A1P8L6A8	Staphylococcus_phage	100.0	1.1e-78
AWR08742.1|725849_726200_+	complement inhibitor	NA	A0A1P8L6B0	Staphylococcus_phage	100.0	7.5e-54
AWR08191.1|726252_726444_-	putative membrane protein	NA	M9NS66	Staphylococcus_phage	100.0	1.7e-23
AWR07349.1|726823_727003_-	putative membrane protein	NA	A0A1W6JQ29	Staphylococcus_phage	100.0	2.2e-25
AWR07867.1|727374_727572_-	phospholipase C domain protein	NA	A0A1P8L6A7	Staphylococcus_phage	100.0	3.4e-27
>prophage 2
CP029667	Staphylococcus aureus strain AR_0225 chromosome, complete genome	2897877	789071	866827	2897877	protease,integrase,terminase,portal,transposase,capsid,holin,head,tail,tRNA	Staphylococcus_phage(74.63%)	90	784227:784244	811264:811281
784227:784244	attL	ATCATCATCTTGTTCGTC	NA	NA	NA	NA
AWR08367.1|789071_790319_+|protease	thermophilic metalloprotease family protein	protease	NA	NA	NA	NA
AWR09028.1|790408_790939_+	thioesterase superfamily protein	NA	NA	NA	NA	NA
AWR07613.1|791198_792344_-	yfkB-like domain protein	NA	NA	NA	NA	NA
AWR07610.1|792388_793435_-|integrase	phage integrase family protein	integrase	Q38045	Staphylococcus_phage	99.4	6.1e-200
AWR07829.1|793547_793727_+	putative excisionase	NA	Q4ZBP0	Staphylococcus_phage	100.0	3.7e-25
AWR08666.1|793706_794639_-	hypothetical protein	NA	A0EX19	Staphylococcus_virus	100.0	6.7e-174
AWR07961.1|794778_794946_-	hypothetical protein	NA	Q4ZDJ4	Staphylococcus_virus	98.2	3.0e-24
AWR08840.1|795015_795735_-	helix-turn-helix family protein	NA	A0A2H4PQQ2	Staphylococcus_phage	100.0	1.3e-132
AWR06603.1|795876_796095_+	helix-turn-helix family protein	NA	Q8SDX1	Staphylococcus_phage	100.0	2.9e-35
AWR09088.1|796110_796899_+	phage antirepressor KilAC domain protein	NA	R9QSV3	Staphylococcus_phage	99.2	1.0e-143
AWR09177.1|796915_797110_+	hypothetical protein	NA	A0A1X9H0A2	Staphylococcus_phage	98.4	3.3e-19
AWR08669.1|797311_797557_-	hypothetical protein	NA	E9LT77	Staphylococcus_phage	97.5	1.0e-36
AWR08239.1|797627_797849_+	hypothetical protein	NA	A0A1X9H0Q4	Staphylococcus_phage	100.0	1.5e-31
AWR08431.1|798096_798357_+	hypothetical protein	NA	Q4ZBM7	Staphylococcus_phage	97.7	2.9e-42
AWR07043.1|798366_798588_+	hypothetical protein	NA	A7TWM6	Staphylococcus_phage	100.0	3.2e-34
AWR07744.1|798580_799360_+	bacterial dnaA family protein	NA	Q9G028	Staphylococcus_virus	99.6	7.4e-142
AWR08522.1|799389_799944_+	putative single-strand DNA-binding protein	NA	A7TWM8	Staphylococcus_phage	100.0	1.0e-100
AWR09176.1|799956_800622_+	hypothetical protein	NA	Q4ZDY3	Staphylococcus_virus	99.5	5.3e-125
AWR07731.1|800621_801401_+	AP2 domain protein	NA	A0A2H4J5K3	uncultured_Caudovirales_phage	46.1	7.3e-49
AWR06692.1|801372_802176_+	putative phage replisome organizer domain protein	NA	A0A2H4JCF5	uncultured_Caudovirales_phage	99.6	2.5e-121
AWR08169.1|802185_802959_+	AFG1-like ATPase family protein	NA	A0A2H4PQI3	Staphylococcus_phage	98.4	3.3e-142
AWR08987.1|802952_803111_+	hypothetical protein	NA	Q4ZBL5	Staphylococcus_phage	96.2	9.9e-22
AWR07855.1|803123_803345_+	hypothetical protein	NA	A7TWN4	Staphylococcus_phage	100.0	1.3e-35
AWR09124.1|803354_803759_+	hypothetical protein	NA	A7TWN5	Staphylococcus_phage	97.8	3.0e-70
AWR07341.1|803763_803949_+	hypothetical protein	NA	Q4ZA46	Staphylococcus_virus	100.0	4.1e-27
AWR07159.1|803949_804312_+	PVL ORF-50-like family protein	NA	B7T0B4	Staphylococcus_virus	75.8	3.5e-46
AWR07033.1|804311_804566_+	hypothetical protein	NA	A0A2I6PDN8	Staphylococcus_phage	97.6	6.3e-42
AWR07555.1|804571_804814_+	phage family protein	NA	R9QT89	Staphylococcus_phage	97.5	3.3e-40
AWR08765.1|804828_804993_+	putative oRF29	NA	A0A2I6PF20	Staphylococcus_phage	100.0	7.6e-25
AWR08636.1|804985_805222_+	hypothetical protein	NA	A0A2I6PF11	Staphylococcus_phage	100.0	4.0e-35
AWR07279.1|805211_805454_+	hypothetical protein	NA	A0A2I6PF40	Staphylococcus_phage	100.0	3.7e-36
AWR07693.1|805446_805956_+	dUTP diphosphatase family protein	NA	Q8SDV3	Staphylococcus_phage	98.8	2.8e-89
AWR06706.1|806109_806238_+	hypothetical protein	NA	A9CR89	Staphylococcus_phage	100.0	3.7e-11
AWR06987.1|806234_806471_+	hypothetical protein	NA	C8CH06	Staphylococcus_phage	100.0	1.1e-35
AWR08922.1|806495_806732_+	hypothetical protein	NA	A7TWB3	Staphylococcus_phage	100.0	1.9e-37
AWR07872.1|806724_807108_+	hypothetical protein	NA	A0A2I6PDC1	Staphylococcus_phage	100.0	6.7e-64
AWR06869.1|807107_807281_+	transcriptional activator RinB family protein	NA	S4SVE4	Staphylococcus_phage	100.0	6.4e-22
AWR06998.1|807281_807428_+	hypothetical protein	NA	B2ZYX7	Staphylococcus_phage	100.0	2.2e-15
AWR07265.1|807451_807874_+	phage transcriptional regulator, RinA family protein	NA	Q8SDV1	Staphylococcus_phage	100.0	1.6e-74
AWR07155.1|807991_808501_+|terminase	terminase small subunit	terminase	E0Y3R8	Staphylococcus_virus	99.3	1.7e-75
AWR07740.1|808487_809765_+|terminase	phage terminase, large subunit, PBSX family	terminase	Q8SDU9	Staphylococcus_phage	100.0	3.0e-249
AWR07635.1|809775_811311_+|portal	phage portal protein, SPP1 family	portal	Q4ZDV9	Staphylococcus_virus	99.8	1.5e-292
811264:811281	attR	GACGAACAAGATGATGAT	NA	NA	NA	NA
AWR09050.1|811317_812313_+|head	phage head morphogenesis, SPP1 gp7 family domain protein	head	Q4ZDV8	Staphylococcus_virus	100.0	5.8e-184
AWR06546.1|812385_812556_+	hypothetical protein	NA	Q4ZDV7	Staphylococcus_virus	100.0	3.3e-23
AWR07821.1|812664_813285_+	hypothetical protein	NA	Q8SDU6	Staphylococcus_phage	100.0	6.4e-64
AWR08210.1|813298_814273_+|capsid	phage major capsid protein, HK97 family	capsid	Q8SDU5	Staphylococcus_phage	100.0	1.3e-183
AWR09156.1|814294_814582_+	hypothetical protein	NA	Q8SDU4	Staphylococcus_phage	100.0	6.2e-46
AWR07934.1|814590_814923_+|head,tail	phage gp6-like head-tail connector family protein	head,tail	A0A0F6N3F4	Staphylococcus_phage	100.0	5.5e-54
AWR08789.1|815221_815569_+	hypothetical protein	NA	A0A0F6N3F5	Staphylococcus_phage	100.0	4.1e-60
AWR07296.1|815580_815964_+	putative phi 11	NA	A0A0F6N3L1	Staphylococcus_phage	100.0	1.5e-68
AWR08606.1|815991_816564_+|tail	phage major tail protein, TP901-1 family	tail	A0A0F6N3L8	Staphylococcus_phage	100.0	2.0e-104
AWR08674.1|816625_816991_+	phage family protein	NA	Q8SDT9	Staphylococcus_phage	100.0	2.8e-59
AWR07798.1|817020_817365_+	hypothetical protein	NA	A0A0F6N3F7	Staphylococcus_phage	100.0	2.5e-57
AWR08588.1|817381_820849_+	putative membrane protein	NA	Q4ZDU6	Staphylococcus_virus	99.6	1.1e-282
AWR08454.1|820861_821809_+|tail	phage tail family protein	tail	B2ZYZ5	Staphylococcus_phage	100.0	3.6e-183
AWR09220.1|821817_823719_+|tail	prophage endopeptidase tail family protein	tail	Q8SDT5	Staphylococcus_phage	99.7	0.0e+00
AWR08799.1|823733_825644_+	putative minor structural protein	NA	Q4ZDD6	Staphylococcus_virus	99.2	0.0e+00
AWR07904.1|825643_827467_+	hypothetical protein	NA	A0A0H3U4S6	Staphylococcus_phage	99.3	0.0e+00
AWR08671.1|827466_827844_+	hypothetical protein	NA	Q4ZDT8	Staphylococcus_virus	99.2	8.1e-54
AWR06801.1|827847_828021_+	hypothetical protein	NA	A0A059T7K6	Staphylococcus_phage	100.0	1.3e-27
AWR06614.1|828061_828361_+	hypothetical protein	NA	A0A0F6N3M6	Staphylococcus_phage	99.0	1.3e-46
AWR08482.1|828497_830396_+	CHAP domain protein	NA	S4V9N2	Staphylococcus_phage	98.9	0.0e+00
AWR09064.1|830408_831581_+	hypothetical protein	NA	S4V7L6	Staphylococcus_phage	100.0	3.8e-198
AWR07131.1|831586_831982_+	hypothetical protein	NA	S4V997	Staphylococcus_phage	100.0	1.6e-68
AWR06572.1|832037_832475_+|holin	holin, phage phi LC3 family	holin	S4V690	Staphylococcus_phage	100.0	1.2e-72
AWR08140.1|832455_833901_+	CHAP domain protein	NA	S4V6E6	Staphylococcus_phage	100.0	1.8e-295
AWR06752.1|834167_834296_+	hypothetical protein	NA	A0A0F6N3H2	Staphylococcus_phage	100.0	1.1e-15
AWR09046.1|834478_834664_+	hypothetical protein	NA	A0A0F6N3H3	Staphylococcus_phage	100.0	2.7e-26
AWR07866.1|835417_835579_+	hypothetical protein	NA	NA	NA	NA	NA
AWR07859.1|835709_836225_+|protease	intracellular protease, PfpI family protein	protease	NA	NA	NA	NA
AWR08365.1|836565_837375_+	monofunctional glycosyltransferase	NA	NA	NA	NA	NA
AWR07767.1|837635_838454_+	regulatory protein RecX	NA	NA	NA	NA	NA
AWR08587.1|838431_838746_+	hypothetical protein	NA	NA	NA	NA	NA
AWR08820.1|838760_840278_+	putative sugar ABC transporter ATPase	NA	NA	NA	NA	NA
AWR08228.1|840286_841123_+	putative membrane protein	NA	NA	NA	NA	NA
AWR07079.1|841383_842361_-	hypothetical protein	NA	NA	NA	NA	NA
AWR07177.1|842512_843550_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AWR07762.1|843851_844394_+	hypothetical protein	NA	NA	NA	NA	NA
AWR07045.1|844684_846421_+	putative multidrug export ATP-binding/permease protein	NA	W8CYL7	Bacillus_phage	30.4	1.7e-53
AWR06964.1|846611_847706_-	hypothetical protein	NA	NA	NA	NA	NA
AWR06634.1|847998_849288_-	glutamate-1-semialdehyde-2,1-aminomutase	NA	NA	NA	NA	NA
AWR08766.1|849368_849824_+	ahpC/TSA family protein	NA	NA	NA	NA	NA
AWR08874.1|849829_850780_+	D-isomer specific 2-hydroxyacid dehydrogenase, NAD binding domain protein	NA	NA	NA	NA	NA
AWR07261.1|850876_851323_+	peroxide-responsive repressor PerR	NA	NA	NA	NA	NA
AWR07463.1|859728_861090_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWR07176.1|861582_862644_+	phosphotransferase system, EIIC family protein	NA	NA	NA	NA	NA
AWR07566.1|862901_864359_+	amino ABC transporter, permease, 3-TM region, His/Glu/Gln/Arg/opine family domain protein	NA	NA	NA	NA	NA
AWR08424.1|864351_865074_+	recF/RecN/SMC N terminal domain protein	NA	G9BWD6	Planktothrix_phage	42.7	1.3e-36
AWR08586.1|865224_866352_+	epoxyqueuosine reductase	NA	NA	NA	NA	NA
AWR08338.1|866356_866827_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 3
CP029667	Staphylococcus aureus strain AR_0225 chromosome, complete genome	2897877	895378	976219	2897877	protease,transposase,bacteriocin,tRNA	Staphylococcus_phage(89.23%)	75	NA	NA
AWR09077.1|895378_896020_-	hypothetical protein	NA	A0A2H4PQI0	Staphylococcus_phage	94.3	1.2e-110
AWR07007.1|896032_896488_-	hypothetical protein	NA	Q4ZCB9	Staphylococcus_virus	76.8	1.7e-61
AWR07231.1|897370_898306_+	leucotoxin LukEv	NA	A0A2H4PQI5	Staphylococcus_phage	100.0	1.4e-174
AWR08553.1|898307_899291_+	leucotoxin LukDv	NA	A0A2H4PQH7	Staphylococcus_phage	99.1	2.3e-185
AWR08696.1|900412_900556_+	lantibiotic gallidermin	NA	A0A2H4PQH4	Staphylococcus_phage	80.9	5.3e-14
AWR06854.1|900620_903614_+|bacteriocin	thiopeptide-type bacteriocin biosynthesis domain protein	bacteriocin	A0A2H4PQG8	Staphylococcus_phage	97.3	0.0e+00
AWR08901.1|903606_904851_+	lanthionine synthetase C-like family protein	NA	A0A2H4PQH9	Staphylococcus_phage	100.0	5.1e-238
AWR07707.1|904866_905385_+	epidermin decarboxylase	NA	A0A2H4PQG9	Staphylococcus_phage	100.0	2.0e-95
AWR08241.1|905394_906768_+	subtilase family protein	NA	A0A2H4PQH1	Staphylococcus_phage	100.0	2.9e-258
AWR06658.1|906790_907483_+	lantibiotic protection ABC transporter, ATP-binding subunit	NA	A0A2H4PQG7	Staphylococcus_phage	100.0	6.2e-124
AWR08998.1|907479_908241_+	lantibiotic protection ABC transporter permease subunit, MutE/EpiE family protein	NA	A0A2H4PQH2	Staphylococcus_phage	100.0	4.4e-131
AWR08294.1|908237_908936_+	putative membrane protein	NA	A0A2H4PQH0	Staphylococcus_phage	94.4	3.8e-113
AWR07956.1|909409_909976_-	hypothetical protein	NA	A0A2H4PQH6	Staphylococcus_phage	100.0	3.3e-99
AWR07633.1|910939_911647_+|protease	serine protease SplA	protease	A0A2H4PQN3	Staphylococcus_phage	100.0	2.6e-130
AWR08075.1|911771_912494_+|protease	serine protease SplB	protease	A0A2H4PQN0	Staphylococcus_phage	99.6	2.4e-131
AWR07526.1|912551_913271_+|protease	serine protease SplC	protease	A0A2H4PQP7	Staphylococcus_phage	99.2	1.2e-130
AWR07575.1|913391_914111_+|protease	serine protease SplF	protease	A0A2H4PQP9	Staphylococcus_phage	99.6	4.6e-130
AWR08484.1|914268_914985_+|protease	serine protease SplF	protease	A0A2H4PQN5	Staphylococcus_phage	100.0	1.1e-131
AWR08634.1|915135_915855_+|protease	serine protease SplF	protease	A0A2H4PQP1	Staphylococcus_phage	100.0	1.1e-131
AWR06637.1|916217_917774_+	type I restriction-modification system, M subunit	NA	A0A2H4PQP4	Staphylococcus_phage	99.4	2.3e-288
AWR07826.1|917766_918966_+	type I restriction modification DNA specificity domain protein	NA	A0A2H4PQP5	Staphylococcus_phage	99.7	5.5e-229
AWR07032.1|919815_923928_+	NACHT domain protein	NA	A0A2H4PQT3	Staphylococcus_phage	100.0	0.0e+00
AWR08203.1|924517_924826_+	hypothetical protein	NA	NA	NA	NA	NA
AWR07909.1|925695_925839_+|transposase	transposase family protein	transposase	A0A2H4PQU1	Staphylococcus_phage	100.0	6.4e-20
AWR07984.1|926442_926826_+	hypothetical protein	NA	NA	NA	NA	NA
AWR07214.1|926836_927013_+	putative membrane protein	NA	NA	NA	NA	NA
AWR07535.1|927014_927200_+	hypothetical protein	NA	NA	NA	NA	NA
AWR08566.1|927385_927955_+	hypothetical protein	NA	A0A2H4PQN8	Staphylococcus_phage	93.2	2.3e-76
AWR08201.1|928172_928724_-	hypothetical protein	NA	A0A2H4PQN4	Staphylococcus_phage	94.1	1.0e-20
AWR06780.1|928821_929010_-	hypothetical protein	NA	A0A2H4PQN6	Staphylococcus_phage	86.9	3.7e-23
AWR06607.1|929206_929677_-	hypothetical protein	NA	A0A2H4PQM7	Staphylococcus_phage	80.1	7.0e-63
AWR09044.1|929677_929833_-	hypothetical protein	NA	A0A2H4PQM7	Staphylococcus_phage	96.9	4.7e-08
AWR07932.1|929908_930904_-	hypothetical protein	NA	A0A2H4PQN2	Staphylococcus_phage	96.4	7.1e-73
AWR07922.1|930984_931599_-	excalibur calcium-binding domain protein	NA	A0A2H4PQM8	Staphylococcus_phage	87.3	9.5e-36
AWR06601.1|931910_932393_+	putative lipoprotein	NA	A0A2H4PQN7	Staphylococcus_phage	98.6	2.5e-79
AWR08131.1|932947_934030_+	O-succinylbenzoate-CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	97.5	3.8e-205
AWR06838.1|934034_935036_+	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	97.6	4.8e-186
AWR06740.1|935032_935290_-	putative membrane protein insertion efficiency factor	NA	A0A2H4PQM5	Staphylococcus_phage	100.0	7.2e-46
AWR07977.1|935355_935829_+	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	98.1	4.7e-83
AWR06672.1|935809_936580_+	prolyl oligopeptidase family protein	NA	A0A2H4PQM6	Staphylococcus_phage	98.4	7.3e-142
AWR08963.1|937077_937440_+|transposase	transposase IS200 like family protein	transposase	A0A1P8BMC0	Lactococcus_phage	37.8	1.8e-10
AWR08062.1|937575_939168_-	phosphoenolpyruvate carboxykinase	NA	A0A2H4PQN1	Staphylococcus_phage	100.0	0.0e+00
AWR06579.1|939538_940732_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	99.7	1.9e-218
AWR06646.1|940856_941765_+	nuclease-related domain protein	NA	A0A2H4PQQ8	Staphylococcus_phage	98.7	3.2e-136
AWR08921.1|941976_942810_+	aldo/keto reductase family protein	NA	A0A2H4PQR8	Staphylococcus_phage	98.6	9.6e-156
AWR07223.1|942872_943481_-|transposase	transposase DDE domain protein	transposase	A0ZS58	Staphylococcus_virus	96.0	1.3e-109
AWR07751.1|943513_944338_-	hypothetical protein	NA	A0ZS58	Staphylococcus_virus	98.2	1.7e-125
AWR07320.1|944409_944763_-	crcB-like family protein	NA	A0A2H4PQQ7	Staphylococcus_phage	99.1	1.0e-21
AWR06559.1|944759_945125_-	crcB-like family protein	NA	A0A2H4PQR0	Staphylococcus_phage	99.2	1.4e-58
AWR07119.1|945380_945683_-	putative membrane protein	NA	NA	NA	NA	NA
AWR06952.1|945942_946656_+	transaldolase	NA	M1PR54	Cyanophage	35.3	5.5e-19
AWR09093.1|947095_947731_-|protease	CAAX protease self-immunity family protein	protease	NA	NA	NA	NA
AWR09135.1|948026_948470_+	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	85.0	3.0e-55
AWR08740.1|948456_948600_-	hypothetical protein	NA	NA	NA	NA	NA
AWR08209.1|949012_949483_-	RNA polymerase sigma factor SigS	NA	A0A2H4PQT5	Staphylococcus_phage	99.4	1.0e-82
AWR07278.1|949681_949906_+	hypothetical protein	NA	NA	NA	NA	NA
AWR08884.1|950181_951036_+	mannosyl-glycoendo-beta-N-acetylglucosaminidase family protein	NA	Q4ZCC7	Staphylococcus_virus	38.6	9.8e-39
AWR08364.1|951330_951672_-	protein ArsC	NA	A0A2H4PQT9	Staphylococcus_phage	100.0	2.8e-61
AWR08283.1|951743_953033_-	arsenite/antimonite efflux pump membrane family protein	NA	A0A2H4PQU3	Staphylococcus_phage	99.5	1.1e-227
AWR06807.1|953872_955375_+	FAD-NAD(P)-binding family protein	NA	A0A2H4PQX2	Staphylococcus_phage	100.0	2.3e-30
AWR08619.1|955855_956899_+	riboflavin biosynthesis protein RibD	NA	A0A2H4PQS8	Staphylococcus_phage	99.4	6.3e-197
AWR07708.1|956905_957538_+	riboflavin synthase, alpha subunit	NA	A0A2H4PQS5	Staphylococcus_phage	99.5	1.7e-112
AWR07085.1|957548_958730_+	riboflavin biosynthesis protein RibBA	NA	A0A2H4PQS2	Staphylococcus_phage	99.7	6.6e-227
AWR07448.1|958742_959207_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	99.4	5.8e-70
AWR07584.1|959328_960330_-	proline dehydrogenase family protein	NA	A0A2H4PQT6	Staphylococcus_phage	99.7	9.0e-185
AWR07955.1|960563_961391_+	alpha/beta hydrolase family protein	NA	NA	NA	NA	NA
AWR06917.1|961737_962229_+	hypothetical protein	NA	A0A146ICT8	Staphylococcus_phage	91.6	2.4e-74
AWR07210.1|962225_962450_+	hypothetical protein	NA	Q9MBP7	Staphylococcus_prophage	81.8	4.5e-20
AWR07983.1|962969_963371_+	HTH-type transcriptional regulator rot	NA	NA	NA	NA	NA
AWR07112.1|963490_964054_-	rRNA methylase family protein	NA	A0A2H4PQV0	Staphylococcus_phage	98.9	3.2e-102
AWR07300.1|964050_965004_-	radical SAM superfamily protein	NA	A0A2H4PQV5	Staphylococcus_phage	100.0	2.2e-79
AWR08738.1|965152_966295_+	sugar (and other) transporter family protein	NA	A0A2H4PQR6	Staphylococcus_phage	100.0	2.1e-209
AWR08731.1|966585_969000_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	99.2	0.0e+00
AWR07197.1|969021_969333_+	rhodanese-like domain protein	NA	A0A2H4PQR9	Staphylococcus_phage	100.0	1.6e-52
AWR07556.1|969658_976219_+	sasC/Mrp/FmtB intercellular aggregation domain protein	NA	A0A2H4PQU6	Staphylococcus_phage	98.1	2.0e-304
>prophage 4
CP029667	Staphylococcus aureus strain AR_0225 chromosome, complete genome	2897877	1101678	1110721	2897877	tRNA	uncultured_Mediterranean_phage(50.0%)	7	NA	NA
AWR08268.1|1101678_1102683_+	holliday junction DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	1.7e-05
AWR07765.1|1102684_1103710_+|tRNA	tRNA ribosyltransferase-isomerase	tRNA	NA	NA	NA	NA
AWR08266.1|1103732_1104872_+|tRNA	queuine tRNA-ribosyltransferase	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.7	5.4e-85
AWR08175.1|1104890_1105151_+	preprotein translocase, YajC subunit	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.3	8.2e-05
AWR07147.1|1105425_1107705_+	protein-export membrane protein SecD	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.8	1.8e-31
AWR07662.1|1107907_1110181_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.8	1.2e-62
AWR08868.1|1110202_1110721_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.5	5.6e-29
>prophage 5
CP029667	Staphylococcus aureus strain AR_0225 chromosome, complete genome	2897877	1179858	1188170	2897877		Caulobacter_phage(16.67%)	7	NA	NA
AWR07400.1|1179858_1181658_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.0	4.6e-54
AWR06707.1|1181881_1182988_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	38.1	1.1e-37
AWR08213.1|1183118_1183796_+	hypothetical protein	NA	NA	NA	NA	NA
AWR06645.1|1183798_1184899_+	NIF3 family protein	NA	A0A1S5V250	Saudi_moumouvirus	29.6	5.2e-08
AWR07937.1|1185012_1186359_+	DEAD/DEAH box helicase family protein	NA	A0A1V0SIR5	Klosneuvirus	33.7	5.3e-55
AWR07714.1|1186368_1187259_+	putative endonuclease 4	NA	A0A2H4UU70	Bodo_saltans_virus	33.1	2.0e-26
AWR08151.1|1187402_1188170_+	ABC transporter family protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	7.8e-19
>prophage 6
CP029667	Staphylococcus aureus strain AR_0225 chromosome, complete genome	2897877	1244004	1286899	2897877	integrase,terminase,portal,capsid,holin,tail	Staphylococcus_phage(94.92%)	61	1248964:1248984	1286565:1286585
AWR09057.1|1244004_1245753_+	sensor protein SrrB	NA	A0A1V0SGX0	Hokovirus	33.6	1.7e-21
AWR09068.1|1245997_1246927_+	hypothetical protein	NA	NA	NA	NA	NA
AWR08404.1|1246919_1247765_+	hypothetical protein	NA	NA	NA	NA	NA
AWR06674.1|1247791_1248946_+	hypothetical protein	NA	B5WZK7	Staphylococcus_phage	97.2	1.5e-114
1248964:1248984	attL	AGGGCAAAAAAAGGGCGGATT	NA	NA	NA	NA
AWR06925.1|1248988_1250194_-|integrase	phage integrase family protein	integrase	A0A2I6PEN0	Staphylococcus_phage	100.0	7.7e-223
AWR08549.1|1250319_1250934_+	hypothetical protein	NA	A0A2I6PEZ0	Staphylococcus_phage	100.0	6.7e-106
AWR08295.1|1250930_1251056_-	hypothetical protein	NA	A0A2I6PEK8	Staphylococcus_phage	100.0	3.3e-12
AWR06973.1|1251166_1251562_-	hypothetical protein	NA	A0A2I6PEJ7	Staphylococcus_phage	100.0	3.8e-70
AWR08446.1|1251590_1252025_-	putative translation initiation factor IF-2	NA	A0A2I6PEM0	Staphylococcus_phage	96.5	3.6e-21
AWR06836.1|1252042_1252504_-	hypothetical protein	NA	A0A2I6PEK4	Staphylococcus_phage	98.7	2.9e-85
AWR08992.1|1252516_1252846_-	helix-turn-helix family protein	NA	A0A2I6PEN2	Staphylococcus_phage	100.0	3.2e-54
AWR06768.1|1253006_1253198_+	helix-turn-helix family protein	NA	A0A2I6PEL6	Staphylococcus_phage	100.0	2.3e-28
AWR09184.1|1253281_1253458_+	hypothetical protein	NA	A0A2I6PEL1	Staphylococcus_phage	100.0	8.8e-27
AWR08686.1|1253454_1253673_-	hypothetical protein	NA	A0A2I6PE22	Staphylococcus_phage	98.6	9.2e-34
AWR07282.1|1253740_1253956_+	hypothetical protein	NA	A0A2I6PEK7	Staphylococcus_phage	100.0	1.0e-32
AWR06986.1|1253980_1254244_+	homeo-like domain protein	NA	A0A2I6PEL8	Staphylococcus_phage	100.0	2.5e-46
AWR07847.1|1254509_1254827_+	hypothetical protein	NA	A0A2I6PEL3	Staphylococcus_phage	100.0	1.1e-35
AWR07426.1|1254819_1255122_+	hypothetical protein	NA	A0A1X9IGX2	Staphylococcus_phage	100.0	2.4e-48
AWR08583.1|1255126_1255387_+	hypothetical protein	NA	A0A2I6PEM2	Staphylococcus_phage	100.0	3.4e-43
AWR07432.1|1255400_1255763_+	hypothetical protein	NA	A0A2I6PEM7	Staphylococcus_phage	100.0	3.7e-56
AWR07008.1|1255759_1256926_+	hypothetical protein	NA	A0A2I6PEL9	Staphylococcus_phage	100.0	1.4e-221
AWR08035.1|1256951_1257509_+	hypothetical protein	NA	A0A2I6PEP8	Staphylococcus_phage	100.0	1.8e-97
AWR08115.1|1257567_1259529_+	DNA polymerase A family protein	NA	A0A2I6PEL4	Staphylococcus_phage	100.0	0.0e+00
AWR07154.1|1259541_1259727_+	hypothetical protein	NA	A0A2I6PEM8	Staphylococcus_phage	100.0	7.0e-27
AWR06932.1|1259726_1260128_+	PVL ORF-50-like family protein	NA	A0A2I6PEL5	Staphylococcus_phage	100.0	1.2e-68
AWR07985.1|1260127_1260385_+	hypothetical protein	NA	A0A2I6PEN5	Staphylococcus_phage	100.0	2.6e-43
AWR07580.1|1260387_1260588_+	hypothetical protein	NA	A0A2I6PEM3	Staphylococcus_phage	100.0	2.5e-30
AWR09000.1|1260602_1260845_+	phage family protein	NA	A0A2I6PEV3	Staphylococcus_phage	100.0	1.5e-40
AWR09089.1|1260859_1261108_+	hypothetical protein	NA	A0A2I6PEP2	Staphylococcus_phage	100.0	1.4e-38
AWR08483.1|1261100_1261637_+	dUTPase family protein	NA	A0A2I6PEN6	Staphylococcus_phage	100.0	1.6e-95
AWR09214.1|1261673_1261880_+	hypothetical protein	NA	A0A2I6PEM9	Staphylococcus_phage	100.0	1.6e-19
AWR08524.1|1261876_1262080_+	hypothetical protein	NA	A0A2I6PEQ8	Staphylococcus_phage	100.0	3.4e-30
AWR06696.1|1262072_1262309_+	hypothetical protein	NA	A0A2I6PEM4	Staphylococcus_phage	100.0	2.8e-36
AWR08425.1|1262301_1262688_+	hypothetical protein	NA	A0A1X9IGZ2	Staphylococcus_phage	100.0	3.0e-64
AWR08152.1|1262684_1262837_+	transcriptional activator RinB family protein	NA	A0A2I6PEM5	Staphylococcus_phage	100.0	2.0e-19
AWR08036.1|1262904_1263105_+	hypothetical protein	NA	A0A2I6PEP5	Staphylococcus_phage	100.0	4.9e-26
AWR06799.1|1263392_1265840_+	virulence-associated E family protein	NA	A0A2I6PEP4	Staphylococcus_phage	100.0	0.0e+00
AWR08964.1|1265863_1265986_-	hypothetical protein	NA	Q4ZCF9	Staphylococcus_virus	95.0	6.9e-15
AWR07796.1|1266180_1266471_+	VRR-NUC domain protein	NA	A0A2I6PE31	Staphylococcus_phage	100.0	6.5e-51
AWR07587.1|1266460_1267819_+	type III restriction enzyme, res subunit	NA	A0A1X9IH01	Staphylococcus_phage	99.8	2.8e-261
AWR07777.1|1267831_1268269_+	phage transcriptional regulator, RinA family protein	NA	A0A2I6PEN3	Staphylococcus_phage	100.0	7.9e-77
AWR08083.1|1268425_1268740_+	HNH endonuclease family protein	NA	A0A2I6PEN4	Staphylococcus_phage	100.0	5.0e-57
AWR08535.1|1268866_1269172_+|terminase	phage terminase, small subunit	terminase	A0A2I6PEQ6	Staphylococcus_phage	100.0	2.9e-49
AWR08219.1|1269161_1270853_+	phage Terminase family protein	NA	A0A1X9IGU0	Staphylococcus_phage	100.0	0.0e+00
AWR06619.1|1270857_1272096_+|portal	phage portal protein, HK97 family	portal	A0A2I6PER5	Staphylococcus_phage	100.0	6.9e-235
AWR07297.1|1272079_1272853_+	peptidase S49 family protein	NA	A0A2I6PEQ7	Staphylococcus_phage	100.0	2.4e-137
AWR08574.1|1272936_1274196_+|capsid	phage major capsid protein, HK97 family	capsid	A0A2I6PEQ3	Staphylococcus_phage	98.2	4.0e-182
AWR08912.1|1274204_1275266_+	peptidase M23 family protein	NA	A0A1X9IGU9	Staphylococcus_phage	100.0	5.1e-202
AWR06742.1|1275265_1276090_+|tail	phage tail family protein	tail	A0A2I6PER3	Staphylococcus_phage	100.0	4.1e-159
AWR06924.1|1276098_1277682_+|tail	prophage endopeptidase tail family protein	tail	A0A2I6PEQ5	Staphylococcus_phage	100.0	9.3e-309
AWR07441.1|1277681_1277972_+	putative phage protein	NA	U5U457	Staphylococcus_phage	100.0	2.1e-49
AWR09021.1|1277987_1279898_+	putative minor structural protein	NA	A0A2I6PEQ9	Staphylococcus_phage	100.0	0.0e+00
AWR08798.1|1279897_1281364_+	hypothetical protein	NA	A0A2I6PES7	Staphylococcus_phage	100.0	1.5e-273
AWR08875.1|1281363_1281753_+	hypothetical protein	NA	A0A2I6PER1	Staphylococcus_phage	100.0	2.2e-62
AWR07208.1|1281745_1281910_+	hypothetical protein	NA	A0A2I6PES4	Staphylococcus_phage	100.0	4.9e-24
AWR06865.1|1281955_1282255_+	hypothetical protein	NA	A0A2I6PER2	Staphylococcus_phage	100.0	2.0e-31
AWR09141.1|1282390_1282693_+|holin	holin, SPP1 family	holin	A0A2I6PET6	Staphylococcus_phage	100.0	7.0e-48
AWR07444.1|1282703_1284158_+	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A2I6PET7	Staphylococcus_phage	100.0	5.7e-289
AWR08206.1|1284547_1285486_+	gamma-hemolysin component C	NA	A0A2I6PER8	Staphylococcus_phage	100.0	3.7e-180
AWR08977.1|1285487_1286465_+	lukF-PV	NA	A0A2I6PEU3	Staphylococcus_phage	100.0	7.5e-184
AWR09010.1|1286713_1286899_+	hypothetical protein	NA	A0ZS61	Staphylococcus_virus	100.0	1.7e-25
1286565:1286585	attR	AGGGCAAAAAAAGGGCGGATT	NA	NA	NA	NA
>prophage 7
CP029667	Staphylococcus aureus strain AR_0225 chromosome, complete genome	2897877	1316455	1408734	2897877	protease,lysis,transposase,head,tRNA	Staphylococcus_phage(20.0%)	61	NA	NA
AWR07215.1|1316455_1317658_+|head	poly A polymerase head domain protein	head	H7BUW3	unidentified_phage	42.5	3.2e-35
AWR08983.1|1317644_1318616_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
AWR07870.1|1318639_1321333_+	hypothetical protein	NA	A0A1X9I5C8	Streptococcus_phage	34.4	8.2e-47
AWR09019.1|1321654_1322947_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.0	1.9e-54
AWR07135.1|1323274_1323961_+	dnaD domain protein	NA	Q938N2	Temperate_phage	32.6	5.5e-08
AWR07245.1|1323950_1324610_+	endonuclease III	NA	NA	NA	NA	NA
AWR08402.1|1324614_1324956_+	hypothetical protein	NA	NA	NA	NA	NA
AWR08261.1|1325521_1327705_-	penicillin binding transpeptidase domain protein	NA	NA	NA	NA	NA
AWR06922.1|1327701_1328328_-	recombination protein U	NA	A0A1C8E9C3	Bacillus_phage	35.5	1.7e-24
AWR06678.1|1328867_1329218_+	hypothetical protein	NA	NA	NA	NA	NA
AWR07991.1|1329210_1329774_+	hypothetical protein	NA	NA	NA	NA	NA
AWR07319.1|1329787_1330132_+	cell cycle protein GpsB	NA	NA	NA	NA	NA
AWR07284.1|1330232_1330349_+	hypothetical protein	NA	NA	NA	NA	NA
AWR08196.1|1330782_1331928_+	hypothetical protein	NA	NA	NA	NA	NA
AWR08928.1|1332011_1332344_+	putative exported protein	NA	NA	NA	NA	NA
AWR07494.1|1332549_1333890_-	pepSY-associated TM helix family protein	NA	NA	NA	NA	NA
AWR08838.1|1334193_1337634_+	small GTP-binding domain protein	NA	NA	NA	NA	NA
AWR08445.1|1337653_1338532_+	5'-3' exonuclease	NA	S5M4P0	Bacillus_phage	29.5	6.2e-20
AWR09229.1|1339006_1340125_+	alanine dehydrogenase	NA	NA	NA	NA	NA
AWR06650.1|1340219_1341260_+	threonine ammonia-lyase	NA	NA	NA	NA	NA
AWR07579.1|1341290_1342613_+	amino acid permease family protein	NA	NA	NA	NA	NA
AWR06767.1|1342769_1344161_+	quinolone resistance protein NorB	NA	NA	NA	NA	NA
AWR08434.1|1344558_1375713_+	hyperosmolarity resistance protein Ebh	NA	NA	NA	NA	NA
AWR09244.1|1375771_1376173_-	reverse transcriptase-like family protein	NA	NA	NA	NA	NA
AWR09180.1|1376517_1376649_+	hypothetical protein	NA	NA	NA	NA	NA
AWR08463.1|1376713_1377418_-	conserved hypothetical integral membrane family protein	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	23.8	8.4e-12
AWR07942.1|1377635_1377857_+	hypothetical protein	NA	NA	NA	NA	NA
AWR08447.1|1377868_1378120_+	scaffold Nfu/NifU N terminal family protein	NA	NA	NA	NA	NA
AWR08772.1|1378157_1379282_+	conserved virulence factor C	NA	NA	NA	NA	NA
AWR09211.1|1379297_1379735_+	bacillithiol system oxidoreductase, YphP/YqiW family protein	NA	NA	NA	NA	NA
AWR08154.1|1380158_1381115_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	85.2	1.6e-167
AWR08929.1|1381314_1381794_+	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	79.9	2.0e-73
AWR07513.1|1381808_1382648_+	EDD, DegV family domain protein	NA	A0A0N9SI50	Staphylococcus_phage	77.3	2.3e-48
AWR07508.1|1382733_1383267_+	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
AWR08958.1|1383259_1383688_+	methionine-R-sulfoxide reductase	NA	NA	NA	NA	NA
AWR07031.1|1383699_1384200_+	glucose-specific phosphotransferase enzyme IIA component	NA	NA	NA	NA	NA
AWR08616.1|1384199_1384421_+	hypothetical protein	NA	NA	NA	NA	NA
AWR08419.1|1384612_1386103_+|protease	putative CtpA-like serine protease	protease	A0A0R6PIZ1	Moraxella_phage	30.5	2.3e-22
AWR08972.1|1386502_1387012_+	acetyltransferase domain protein	NA	NA	NA	NA	NA
AWR08855.1|1387023_1388094_+	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
AWR08534.1|1388110_1388725_+	PAP2 superfamily protein	NA	NA	NA	NA	NA
AWR07742.1|1388855_1389341_-|transposase	transposase IS200 like family protein	transposase	A0A1P8BMC0	Lactococcus_phage	35.4	4.9e-19
AWR08316.1|1389861_1389993_+	hypothetical protein	NA	NA	NA	NA	NA
AWR08220.1|1390254_1390914_+	response regulator	NA	W8CYM9	Bacillus_phage	33.8	1.1e-34
AWR07414.1|1390910_1392266_+	signal transduction histidine-protein kinase ArlS	NA	A0A1V0SGX0	Hokovirus	27.8	3.5e-14
AWR09144.1|1392549_1395348_+	oxoglutarate dehydrogenase (succinyl-transferring), E1 component	NA	NA	NA	NA	NA
AWR06894.1|1395361_1396630_+	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
AWR07128.1|1397209_1398019_+	putative lactoylglutathione lyase	NA	NA	NA	NA	NA
AWR07527.1|1398047_1398251_+	putative hypothetical protein YozC	NA	NA	NA	NA	NA
AWR07807.1|1398431_1399223_+	sigma-54 interaction domain protein	NA	R4TG24	Halovirus	28.2	2.1e-11
AWR07023.1|1399236_1401123_+	cobalamin biosynthesis CobT VWA domain protein	NA	NA	NA	NA	NA
AWR08794.1|1401347_1402691_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
AWR08592.1|1403043_1403436_+|transposase	transposase DDE domain protein	transposase	A0A146ICT8	Staphylococcus_phage	93.2	7.7e-15
AWR07637.1|1403480_1403648_+|transposase	putative transposase	transposase	Q9MBP7	Staphylococcus_prophage	89.1	2.9e-19
AWR09202.1|1403703_1404840_-	telA-like protein	NA	A0A291I9K4	Lactobacillus_phage	28.3	7.4e-34
AWR08262.1|1404871_1405459_-|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis family protein	lysis	NA	NA	NA	NA
AWR09085.1|1405519_1405789_-	acylphosphatase family protein	NA	NA	NA	NA	NA
AWR06787.1|1405951_1406260_+	hypothetical protein	NA	NA	NA	NA	NA
AWR08023.1|1406430_1406631_+	cold shock protein CspA	NA	Q9AZD3	Lactococcus_phage	66.2	8.4e-18
AWR07758.1|1406827_1407229_+	putative membrane protein	NA	NA	NA	NA	NA
AWR06920.1|1407468_1408734_-	diaminopimelate decarboxylase	NA	A0A0P0YM38	Yellowstone_lake_phycodnavirus	23.2	6.2e-13
>prophage 8
CP029667	Staphylococcus aureus strain AR_0225 chromosome, complete genome	2897877	1501869	1507913	2897877	head	Staphylococcus_phage(66.67%)	10	NA	NA
AWR09022.1|1501869_1502004_-	hypothetical protein	NA	Q4ZE35	Staphylococcus_virus	76.2	2.9e-14
AWR07988.1|1502206_1502332_-	hypothetical protein	NA	NA	NA	NA	NA
AWR08100.1|1502340_1502457_-	hypothetical protein	NA	NA	NA	NA	NA
AWR07803.1|1502883_1503132_-	hypothetical protein	NA	NA	NA	NA	NA
AWR08048.1|1503252_1503837_-|head	phage head morphogenesis, SPP1 gp7 family domain protein	head	Q4ZE35	Staphylococcus_virus	72.0	2.0e-30
AWR08701.1|1503882_1504134_-	hypothetical protein	NA	NA	NA	NA	NA
AWR08712.1|1504878_1505064_-	hypothetical protein	NA	A0A0F6N3H3	Staphylococcus_phage	78.7	2.4e-19
AWR08187.1|1506302_1506509_-	hypothetical protein	NA	A0A2H4PQT0	Staphylococcus_phage	59.7	1.3e-13
AWR08293.1|1506802_1507015_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	71.0	3.1e-18
AWR09074.1|1507715_1507913_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	48.4	1.7e-10
>prophage 9
CP029667	Staphylococcus aureus strain AR_0225 chromosome, complete genome	2897877	1764624	1773097	2897877		Synechococcus_phage(33.33%)	9	NA	NA
AWR07473.1|1764624_1765191_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.1	6.1e-29
AWR08781.1|1765193_1766222_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.4	1.3e-61
AWR08665.1|1766214_1767699_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.7	3.2e-45
AWR08108.1|1767677_1769867_-	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	39.7	1.0e-140
AWR07799.1|1769859_1770531_-	phosphoribosylformylglycinamidine synthase I	NA	NA	NA	NA	NA
AWR07268.1|1770532_1770796_-	phosphoribosylformylglycinamidine synthase, purS protein	NA	NA	NA	NA	NA
AWR08231.1|1770795_1771500_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	42.1	7.3e-48
AWR06779.1|1771503_1772628_-	N5-carboxyaminoimidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AWR06839.1|1772614_1773097_-	phosphoribosylaminoimidazole carboxylase, catalytic subunit	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	6.2e-22
>prophage 10
CP029667	Staphylococcus aureus strain AR_0225 chromosome, complete genome	2897877	2017884	2032615	2897877		uncultured_Caudovirales_phage(50.0%)	13	NA	NA
AWR06746.1|2017884_2018646_-	ABC transporter family protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	31.6	8.5e-18
AWR08937.1|2018642_2019599_-	fecCD transport family protein	NA	A0A2H4J116	uncultured_Caudovirales_phage	57.8	1.2e-05
AWR09040.1|2019585_2020557_-	fecCD transport family protein	NA	A0A2H4IY97	uncultured_Caudovirales_phage	78.9	4.3e-139
AWR07241.1|2020595_2020751_-	hypothetical protein	NA	NA	NA	NA	NA
AWR06890.1|2021264_2022236_-	ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	91.3	4.2e-171
AWR06991.1|2022353_2024459_-	ribonucleoside-diphosphate reductase, alpha subunit	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	91.7	0.0e+00
AWR07529.1|2024421_2024820_-	nrdI protein	NA	A0A2H4J545	uncultured_Caudovirales_phage	72.0	1.2e-52
AWR07897.1|2025620_2026487_+	eamA-like transporter family protein	NA	NA	NA	NA	NA
AWR06617.1|2026506_2027007_+	7-cyano-7-deazaguanine reductase	NA	E7DN65	Pneumococcus_phage	71.5	5.9e-52
AWR08494.1|2027347_2028853_+	H+ symporter family protein	NA	A0A0P0IY73	Acinetobacter_phage	32.2	2.0e-58
AWR07560.1|2029122_2030040_+	putative lipid kinase	NA	A0A1V0SBJ0	Catovirus	22.0	3.7e-07
AWR07609.1|2030663_2031206_-	putative 5'(3')-deoxyribonucleotidase	NA	NA	NA	NA	NA
AWR07865.1|2031556_2032615_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	26.7	7.9e-22
>prophage 11
CP029667	Staphylococcus aureus strain AR_0225 chromosome, complete genome	2897877	2044587	2052407	2897877		Pandoravirus(16.67%)	10	NA	NA
AWR08881.1|2044587_2045739_-	chorismate binding enzyme family protein	NA	A0A0B5J984	Pandoravirus	35.7	1.6e-23
AWR06613.1|2045722_2046190_-	glutamine amidotransferase of anthranilate synthase/aminodeoxychorismate synthase family protein	NA	A0A0P0IKJ1	Acinetobacter_phage	43.2	2.3e-29
AWR07889.1|2046666_2047335_+	queuosine biosynthesis protein QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.5	9.6e-66
AWR06861.1|2047336_2047756_+	queuosine biosynthesis protein QueD	NA	S4U060	uncultured_phage	28.7	6.3e-07
AWR07953.1|2047759_2048473_+	7-cyano-7-deazaguanosine (preQ0) biosynthesis protein QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.5	6.5e-52
AWR07362.1|2048571_2049156_+	putative membrane protein	NA	NA	NA	NA	NA
AWR07093.1|2049435_2049876_+	electron transfer DM13 family protein	NA	NA	NA	NA	NA
AWR07788.1|2050217_2050691_+	doxX family protein	NA	NA	NA	NA	NA
AWR09103.1|2050665_2051352_+	response regulator	NA	NA	NA	NA	NA
AWR06577.1|2051351_2052407_+	histidine protein kinase SaeS	NA	A0A1V0SGX0	Hokovirus	30.0	2.1e-14
>prophage 12
CP029667	Staphylococcus aureus strain AR_0225 chromosome, complete genome	2897877	2758319	2801833	2897877	integrase,transposase	Staphylococcus_phage(50.0%)	49	2760763:2760822	2801834:2801893
AWR08639.1|2758319_2759333_-|transposase	transposase IS116/IS110/IS902 family protein	transposase	A0A1X9I619	Streptococcus_phage	38.0	6.0e-51
AWR08200.1|2759819_2760635_-	alpha/beta hydrolase fold family protein	NA	NA	NA	NA	NA
2760763:2760822	attL	AGGTTCTGTTGCAAAGTAAAAAAATATAGCTAACCACTAATTTATCATGTCAGTGTTCGC	NA	NA	NA	NA
AWR07902.1|2760822_2761188_-	DDE domain protein	NA	A0A0N9RU54	Staphylococcus_phage	95.9	1.3e-61
AWR06939.1|2761250_2761496_-|transposase	putative transposase	transposase	A0A0N9RU54	Staphylococcus_phage	98.5	1.9e-32
AWR08539.1|2761539_2761692_+	putative cadmium-transporting ATPase domain protein	NA	NA	NA	NA	NA
AWR08732.1|2761768_2762200_-	universal stress family protein	NA	NA	NA	NA	NA
AWR09107.1|2762701_2763148_+	arginine repressor, C-terminal domain protein	NA	NA	NA	NA	NA
AWR08403.1|2763416_2764652_+	arginine deiminase	NA	NA	NA	NA	NA
AWR08774.1|2764737_2766159_+	arginine-ornithine antiporter	NA	NA	NA	NA	NA
AWR09213.1|2766200_2766890_+	HTH-type transcriptional regulator ArcR	NA	NA	NA	NA	NA
AWR07618.1|2766927_2767926_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
AWR06700.1|2767945_2768875_+	carbamate kinase	NA	NA	NA	NA	NA
AWR08174.1|2768974_2769799_-|integrase	integrase core domain protein	integrase	A0A0N9SIX5	Staphylococcus_phage	89.4	2.9e-64
AWR08046.1|2770782_2771133_+	hypothetical protein	NA	NA	NA	NA	NA
AWR08299.1|2771366_2771531_+	hypothetical protein	NA	NA	NA	NA	NA
AWR07711.1|2771546_2772050_+	hypothetical protein	NA	NA	NA	NA	NA
AWR06847.1|2772153_2772288_+	hypothetical protein	NA	NA	NA	NA	NA
AWR06826.1|2772542_2773670_-	alcohol dehydrogenase GroES-like domain protein	NA	A0A2K9L7I1	Tupanvirus	30.9	6.9e-16
AWR08384.1|2773851_2773980_+	hypothetical protein	NA	NA	NA	NA	NA
AWR08997.1|2774167_2774665_+	acetyltransferase domain protein	NA	NA	NA	NA	NA
AWR07975.1|2774975_2775128_-	hypothetical protein	NA	NA	NA	NA	NA
AWR08775.1|2775176_2775986_+|integrase	integrase core domain protein	integrase	A0A0N9SIX5	Staphylococcus_phage	94.8	6.4e-56
AWR08373.1|2776556_2776916_+	tic20-like family protein	NA	NA	NA	NA	NA
AWR07412.1|2776992_2777322_-	hypothetical protein	NA	NA	NA	NA	NA
AWR06567.1|2777413_2777605_-	hypothetical protein	NA	NA	NA	NA	NA
AWR07517.1|2777701_2778667_-	HNH endonuclease family protein	NA	NA	NA	NA	NA
AWR07317.1|2779068_2779239_+	hypothetical protein	NA	NA	NA	NA	NA
AWR08182.1|2780155_2780776_-	hypothetical protein	NA	NA	NA	NA	NA
AWR08336.1|2780904_2781276_-	HNH endonuclease family protein	NA	NA	NA	NA	NA
AWR09105.1|2781272_2781410_-	hypothetical protein	NA	NA	NA	NA	NA
AWR07770.1|2781528_2782533_+	metallo-beta-lactamase superfamily protein	NA	NA	NA	NA	NA
AWR08582.1|2782610_2782784_+	putative rhodanese-like protein	NA	NA	NA	NA	NA
AWR08281.1|2783156_2784647_-	divergent AAA domain protein	NA	NA	NA	NA	NA
AWR07201.1|2785319_2786369_-	putative actin depolymerizing protein	NA	NA	NA	NA	NA
AWR07311.1|2786507_2786798_+	hypothetical protein	NA	NA	NA	NA	NA
AWR06770.1|2786797_2788585_+	hypothetical protein	NA	NA	NA	NA	NA
AWR07938.1|2788818_2790168_+	resolvase, N terminal domain protein	NA	Q9T200	Bacillus_phage	24.8	1.4e-18
AWR08092.1|2790189_2791818_+	recombinase family protein	NA	A0A0S2SXR4	Bacillus_phage	31.4	5.4e-46
AWR08497.1|2792552_2792690_+	hypothetical protein	NA	NA	NA	NA	NA
AWR08243.1|2792776_2793088_+	hypothetical protein	NA	NA	NA	NA	NA
AWR08703.1|2793102_2793609_+	hypothetical protein	NA	NA	NA	NA	NA
AWR08307.1|2793744_2795268_+|transposase	transposase DDE domain protein	transposase	A0ZS58	Staphylococcus_virus	75.2	1.6e-209
AWR06849.1|2795258_2795519_-	hypothetical protein	NA	NA	NA	NA	NA
AWR06699.1|2795490_2796477_-	blaR1 peptidase M56 family protein	NA	NA	NA	NA	NA
AWR08948.1|2796576_2798583_+	penicillin-binding protein 2'	NA	NA	NA	NA	NA
AWR06554.1|2798628_2799057_-	maoC like domain protein	NA	NA	NA	NA	NA
AWR07482.1|2799153_2799897_-	glycerophosphoryl diester phosphodiesterase family protein	NA	NA	NA	NA	NA
AWR06919.1|2800733_2800901_-	HMG-CoA synthase domain protein	NA	NA	NA	NA	NA
AWR07181.1|2801158_2801833_+|integrase	integrase core domain protein	integrase	A0A0N9RU54	Staphylococcus_phage	99.1	2.6e-127
2801834:2801893	attR	GCGAACACTGACATGATAAATTAGTGGTTAGCTATATTTTTTTACTTTGCAACAGAACCT	NA	NA	NA	NA
>prophage 1
CP029666	Staphylococcus aureus strain AR_0225 plasmid unnamed1, complete sequence	27063	7465	22558	27063	transposase,integrase	Staphylococcus_phage(41.67%)	18	16610:16665	20619:20674
AWR06483.1|7465_8311_-	beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	34.0	7.5e-31
AWR06499.1|8417_10175_+	regulatory protein BlaR1	NA	NA	NA	NA	NA
AWR06497.1|10164_10545_+	methicillin resistance regulatory protein MecI	NA	NA	NA	NA	NA
AWR06503.1|10808_11387_+	resolvase, N terminal domain protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.7	4.9e-42
AWR06500.1|12056_12302_+|transposase	putative transposase TnpA	transposase	A0A0N9RU54	Staphylococcus_phage	98.8	1.1e-40
AWR06482.1|12363_12729_+	DDE domain protein	NA	A0A0N9SKD3	Staphylococcus_phage	99.2	1.4e-63
AWR06508.1|12897_13245_-	WYL domain protein	NA	E4ZFP5	Streptococcus_phage	99.1	7.0e-60
AWR06489.1|13744_14539_-	aminoglycoside 3'-phosphotransferase	NA	E4ZFP6	Streptococcus_phage	100.0	2.3e-154
AWR06478.1|14631_15162_-	acetyltransferase family protein	NA	A0A1B0RXL7	Streptococcus_phage	97.8	1.3e-89
AWR06502.1|15934_16609_-|integrase	integrase core domain protein	integrase	A0A0N9SKD3	Staphylococcus_phage	98.7	2.6e-127
16610:16665	attL	ACAGAAGACTCCTTTTTGTTAAAATTATATTATAAATTCAACTTTGCAACAGAACC	NA	NA	NA	NA
AWR06505.1|16638_16842_-	bacitracin resistance BacA family protein	NA	NA	NA	NA	NA
AWR06490.1|16855_17545_-	ABC-2 transporter family protein	NA	NA	NA	NA	NA
AWR06491.1|17585_18506_-	ABC transporter family protein	NA	A0A2H4PQG7	Staphylococcus_phage	42.2	1.0e-41
AWR06501.1|18630_19233_-	histidine kinase-, DNA gyrase B-, and HSP90-like ATPase family protein	NA	Q6XLV6	Feldmannia_irregularis_virus	29.6	2.8e-08
AWR06486.1|19329_19512_-	putative membrane protein	NA	NA	NA	NA	NA
AWR06507.1|19508_19874_-	transcriptional regulatory, C terminal family protein	NA	NA	NA	NA	NA
AWR06496.1|19943_20618_-|integrase	integrase core domain protein	integrase	A0A0N9RU54	Staphylococcus_phage	97.3	1.7e-126
AWR06485.1|21091_22558_+	ABC transporter family protein	NA	A0A2I4R674	Erysipelothrix_phage	37.7	6.6e-67
20619:20674	attR	ACAGAAGACTCCTTTTTGTTAAAATTATATTATAAATTCAACTTTGCAACAGAACC	NA	NA	NA	NA
