The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029655	Staphylococcus aureus strain AR_0469 chromosome, complete genome	2857253	468314	527557	2857253	integrase,transposase,tRNA	Staphylococcus_phage(46.15%)	56	521481:521535	526827:526881
AWQ96217.1|468314_469301_+|tRNA	putative tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
AWQ96945.1|469967_471161_-	quinone oxidoreductase	NA	NA	NA	NA	NA
AWQ96434.1|471179_472514_-	metallo-beta-lactamase superfamily protein	NA	NA	NA	NA	NA
AWQ95843.1|472544_473609_-	dsrE/DsrF/DrsH-like family protein	NA	A0A2H4PQR9	Staphylococcus_phage	41.8	7.7e-09
AWQ96019.1|473745_474006_+	metal-sensitive transcriptional repressor family protein	NA	NA	NA	NA	NA
AWQ97814.1|474005_474761_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
AWQ97856.1|475194_475521_+|tRNA	putative tRNA-dihydrouridine synthase domain protein	tRNA	NA	NA	NA	NA
AWQ97114.1|475704_477450_-	sporadically distributed, TIGR04141 family protein	NA	NA	NA	NA	NA
AWQ96117.1|478036_479545_-	kinase domain protein	NA	NA	NA	NA	NA
AWQ95875.1|479659_480286_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ96917.1|480830_481205_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ95830.1|481404_482301_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ98401.1|482310_483180_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ96209.1|483724_484282_-	K+-transporting ATPase, C subunit	NA	NA	NA	NA	NA
AWQ96655.1|484297_486319_-	K+-transporting ATPase, B subunit	NA	E4ZFI9	Streptococcus_phage	29.0	6.6e-41
AWQ96782.1|486337_488014_-	K+-transporting ATPase, A subunit	NA	NA	NA	NA	NA
AWQ96105.1|488281_490951_+	his Kinase A domain protein	NA	A0A2K9L0Z8	Tupanvirus	21.5	6.0e-10
AWQ97140.1|490925_491621_+	response regulator	NA	NA	NA	NA	NA
AWQ97875.1|492366_493269_+	C4-dicarboxylate anaerobic carrier family protein	NA	NA	NA	NA	NA
AWQ98215.1|493475_493610_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ96895.1|493779_494094_+	helix-turn-helix domain protein	NA	A0A0N7GFG6	Staphylococcus_phage	96.2	7.7e-50
AWQ96340.1|494078_494432_+	HTH-like domain protein	NA	A0A0N9S8A3	Staphylococcus_phage	91.7	4.2e-44
AWQ96310.1|494543_494921_+|integrase	integrase core domain protein	integrase	A0A0N9SIX5	Staphylococcus_phage	95.2	1.4e-61
AWQ96245.1|495171_496218_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ98225.1|496410_496707_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ96421.1|496706_498500_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ96265.1|498733_500083_+	recombinase family protein	NA	Q9T200	Bacillus_phage	25.1	1.4e-18
AWQ97424.1|500104_501733_+	recombinase family protein	NA	A0A0S2SXR4	Bacillus_phage	31.4	2.4e-46
AWQ96949.1|502250_502601_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ96036.1|502687_502999_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ97499.1|503016_503523_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ97221.1|503543_503861_+	radC-like JAB domain protein	NA	NA	NA	NA	NA
AWQ97644.1|503979_505065_+|integrase	phage integrase family protein	integrase	A0A0A8WIF9	Clostridium_phage	28.3	4.5e-12
AWQ96960.1|505061_506954_+|integrase	phage integrase family protein	integrase	NA	NA	NA	NA
AWQ96331.1|506960_507338_+|transposase	transposase C family protein	transposase	NA	NA	NA	NA
AWQ96322.1|507488_508271_+	streptomycin 3''-adenylyltransferase	NA	NA	NA	NA	NA
AWQ97703.1|508396_509128_-	rRNA adenine N-6-methyltransferase	NA	E4ZFQ0	Streptococcus_phage	47.5	1.9e-51
AWQ97366.1|509520_510183_+	ribosomal L11 methyltransferase family protein	NA	NA	NA	NA	NA
AWQ98022.1|510521_510902_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
AWQ98384.1|511165_511426_-	metal-sensitive transcriptional repressor family protein	NA	NA	NA	NA	NA
AWQ95832.1|511561_512626_+	dsrE/DsrF/DrsH-like family protein	NA	NA	NA	NA	NA
AWQ96246.1|512658_513597_+	metallo-beta-lactamase superfamily protein	NA	NA	NA	NA	NA
AWQ96705.1|513732_513993_+	rhodanese-like domain protein	NA	NA	NA	NA	NA
AWQ98316.1|514106_515216_-	ROK family protein	NA	NA	NA	NA	NA
AWQ96752.1|515723_516095_-	methicillin resistance regulatory protein MecI	NA	NA	NA	NA	NA
AWQ97270.1|516094_517750_-	methicillin resistance mecR1 protein	NA	NA	NA	NA	NA
AWQ96490.1|517951_519958_+	penicillin-binding protein 2'	NA	NA	NA	NA	NA
AWQ97084.1|520003_520432_-	maoC like domain protein	NA	NA	NA	NA	NA
AWQ97425.1|520528_521272_-	glycerophosphoryl diester phosphodiesterase family protein	NA	NA	NA	NA	NA
521481:521535	attL	GGTTCTGTTGCAAAGTTGAATTTATAGTATAATTTTAACAAAAAGGAGTCTTCTG	NA	NA	NA	NA
AWQ95969.1|521536_522211_+|integrase	integrase core domain protein	integrase	A0A0N9RU54	Staphylococcus_phage	99.1	2.6e-127
AWQ97516.1|522448_523174_+	kanamycin nucleotidyltransferase	NA	NA	NA	NA	NA
AWQ96037.1|523396_523795_+	glyoxalase-like domain protein	NA	NA	NA	NA	NA
AWQ96424.1|524301_525564_+	plasmid recombination enzyme family protein	NA	NA	NA	NA	NA
AWQ97708.1|526084_526582_+	replication family protein	NA	NA	NA	NA	NA
AWQ96554.1|526639_526792_+	replication family protein	NA	A0A286QS97	Streptococcus_phage	59.2	1.3e-07
AWQ98371.1|526882_527557_+|transposase	transposase IS66 family protein	transposase	A0A0N9RU54	Staphylococcus_phage	99.1	2.6e-127
526827:526881	attR	GGTTCTGTTGCAAAGTTGAATTTATAGTATAATTTTAACAAAAAGGAGTCTTCTG	NA	NA	NA	NA
>prophage 2
CP029655	Staphylococcus aureus strain AR_0469 chromosome, complete genome	2857253	1397902	1476602	2857253	capsid,transposase,head,terminase,portal,tRNA,tail,integrase,protease,holin	Staphylococcus_phage(62.5%)	87	1393061:1393078	1420166:1420183
1393061:1393078	attL	ATCATCATCTTGTTCGTC	NA	NA	NA	NA
AWQ96732.1|1397902_1399150_+|protease	thermophilic metalloprotease family protein	protease	NA	NA	NA	NA
AWQ96623.1|1399239_1399770_+	thioesterase superfamily protein	NA	NA	NA	NA	NA
AWQ96851.1|1400029_1401175_-	radical SAM superfamily protein	NA	NA	NA	NA	NA
AWQ98395.1|1401219_1402266_-|integrase	phage integrase family protein	integrase	Q4ZE08	Staphylococcus_virus	100.0	4.2e-201
AWQ97267.1|1402476_1403157_-	pemK-like family protein	NA	A0A2H4PQQ5	Staphylococcus_phage	100.0	5.1e-123
AWQ97682.1|1403192_1403963_-	helix-turn-helix family protein	NA	A0A1X9H0P5	Staphylococcus_phage	97.3	3.2e-137
AWQ96453.1|1404367_1404811_+	putative phage transcriptional regulator	NA	A0A0H3U2S6	Staphylococcus_phage	99.3	2.0e-75
AWQ98068.1|1404825_1404969_+	putative phage protein	NA	Q4ZAL7	Staphylococcus_virus	97.9	7.4e-16
AWQ96129.1|1404958_1405168_-	hypothetical protein	NA	W5R9J5	Staphylococcus_phage	98.6	5.9e-30
AWQ96177.1|1405224_1405968_+	phage antirepressor KilAC domain protein	NA	A0A0E3T9K5	Staphylococcus_phage	99.2	8.9e-137
AWQ97767.1|1405992_1406169_+	hypothetical protein	NA	Q4ZB00	Staphylococcus_virus	100.0	3.1e-24
AWQ98186.1|1406143_1406374_-	hypothetical protein	NA	C8CGY3	Staphylococcus_phage	100.0	2.3e-35
AWQ97640.1|1406444_1406666_+	hypothetical protein	NA	B2ZYU8	Staphylococcus_phage	100.0	8.7e-32
AWQ97025.1|1406916_1407177_+	hypothetical protein	NA	Q4ZDA1	Staphylococcus_virus	98.8	4.4e-43
AWQ97165.1|1407186_1407408_+	hypothetical protein	NA	A0A0E3TAJ7	Staphylococcus_phage	100.0	2.4e-34
AWQ97239.1|1407400_1408180_+	bacterial dnaA family protein	NA	Q9G028	Staphylococcus_virus	100.0	2.5e-142
AWQ96624.1|1408209_1408764_+	putative single-strand DNA-binding protein	NA	A7TWM8	Staphylococcus_phage	100.0	1.0e-100
AWQ97211.1|1408776_1409442_+	hypothetical protein	NA	Q8SDW3	Staphylococcus_phage	99.5	7.0e-125
AWQ97831.1|1409441_1410221_+	AP2 domain protein	NA	A0A2H4J5K3	uncultured_Caudovirales_phage	46.1	7.3e-49
AWQ97659.1|1410192_1410984_+	putative phage replisome organizer domain protein	NA	A0A2H4JCF5	uncultured_Caudovirales_phage	78.3	6.6e-90
AWQ96130.1|1410993_1411767_+	bacterial dnaA family protein	NA	A0A2H4PQI3	Staphylococcus_phage	98.8	1.5e-142
AWQ95957.1|1411931_1412153_+	hypothetical protein	NA	A7TWN4	Staphylococcus_phage	100.0	1.3e-35
AWQ96718.1|1412162_1412570_+	endodeoxyribonuclease RusA family protein	NA	A9CR74	Staphylococcus_phage	97.8	3.2e-72
AWQ96985.1|1412569_1412755_+	hypothetical protein	NA	Q4ZA46	Staphylococcus_virus	95.1	1.3e-25
AWQ97286.1|1412755_1413127_+	PVL ORF-50-like family protein	NA	Q4ZAY2	Staphylococcus_virus	98.4	8.5e-56
AWQ97234.1|1413211_1413376_+	phage family protein	NA	A4ZF93	Staphylococcus_virus	98.1	1.5e-25
AWQ95864.1|1413390_1413792_+	hypothetical protein	NA	A0EWR3	Staphylococcus_virus	100.0	2.0e-71
AWQ97107.1|1413788_1414205_+	yopX family protein	NA	A0A0D4DC71	Staphylococcus_phage	60.3	1.0e-17
AWQ98166.1|1414201_1414567_+	acetyltransferase family protein	NA	A0A0F6N3K4	Staphylococcus_phage	96.3	2.4e-50
AWQ95991.1|1414559_1414808_+	hypothetical protein	NA	A0A0E3T8I2	Staphylococcus_phage	93.9	6.5e-36
AWQ97479.1|1414800_1415310_+	dUTPase family protein	NA	M9NS45	Staphylococcus_phage	98.2	1.6e-89
AWQ97192.1|1415346_1415634_+	hypothetical protein	NA	Q4ZBK2	Staphylococcus_phage	100.0	4.3e-47
AWQ97492.1|1415626_1416013_+	hypothetical protein	NA	Q4ZBK1	Staphylococcus_phage	98.4	3.0e-64
AWQ96352.1|1416009_1416183_+	transcriptional activator RinB family protein	NA	Q4ZDF9	Staphylococcus_virus	98.2	6.4e-22
AWQ96968.1|1416183_1416330_+	hypothetical protein	NA	B2ZYX7	Staphylococcus_phage	100.0	2.2e-15
AWQ98398.1|1416353_1416776_+	phage transcriptional regulator, RinA family protein	NA	S4V7K2	Staphylococcus_phage	100.0	1.6e-74
AWQ97744.1|1416962_1417403_+|terminase	terminase small subunit	terminase	I1W650	Staphylococcus_phage	100.0	4.8e-74
AWQ96878.1|1417389_1418667_+|terminase	phage terminase, large subunit, PBSX family	terminase	S4V685	Staphylococcus_phage	100.0	1.3e-249
AWQ98085.1|1418677_1420213_+|portal	phage portal protein, SPP1 family	portal	Q4ZDN2	Staphylococcus_virus	100.0	4.5e-292
1420166:1420183	attR	GACGAACAAGATGATGAT	NA	NA	NA	NA
AWQ97848.1|1420219_1421215_+|head	phage head morphogenesis, SPP1 gp7 family domain protein	head	A0A0F6N3F1	Staphylococcus_phage	100.0	2.0e-184
AWQ98023.1|1421287_1421458_+	hypothetical protein	NA	A0A0F6N3E9	Staphylococcus_phage	100.0	1.5e-23
AWQ96789.1|1421566_1422187_+	hypothetical protein	NA	S4V984	Staphylococcus_phage	98.5	1.7e-69
AWQ98394.1|1422200_1423175_+|capsid	phage major capsid protein, HK97 family	capsid	E0Y3L0	Staphylococcus_virus	100.0	2.2e-183
AWQ97357.1|1423196_1423484_+	hypothetical protein	NA	S4V6D9	Staphylococcus_phage	98.9	1.4e-45
AWQ96632.1|1423492_1423825_+|head,tail	phage gp6-like head-tail connector family protein	head,tail	A0A0F6N3F4	Staphylococcus_phage	100.0	5.5e-54
AWQ95806.1|1424123_1424471_+	hypothetical protein	NA	A0A0F6N3F5	Staphylococcus_phage	100.0	4.1e-60
AWQ97634.1|1424482_1424866_+	hypothetical protein	NA	E0Y3L5	Staphylococcus_virus	98.4	3.8e-67
AWQ97490.1|1424884_1425466_+|tail	phage major tail protein, TP901-1 family	tail	A0A0F6N3L8	Staphylococcus_phage	100.0	4.9e-106
AWQ98365.1|1425527_1425893_+	phage family protein	NA	A0A0F6N4J9	Staphylococcus_phage	100.0	3.6e-59
AWQ98183.1|1425922_1426267_+	hypothetical protein	NA	A0A0F6N3F7	Staphylococcus_phage	100.0	2.5e-57
AWQ96859.1|1426283_1429748_+	putative membrane protein	NA	Q4ZDL9	Staphylococcus_virus	100.0	2.3e-267
AWQ96175.1|1429760_1430708_+|tail	phage tail family protein	tail	Q8SDT6	Staphylococcus_phage	99.7	6.1e-183
AWQ98052.1|1430716_1432618_+|tail	prophage endopeptidase tail family protein	tail	I1W634	Staphylococcus_phage	99.8	0.0e+00
AWQ97175.1|1432632_1434543_+	putative minor structural protein	NA	Q4ZDU1	Staphylococcus_virus	98.7	0.0e+00
AWQ97729.1|1434542_1436366_+	hypothetical protein	NA	M9NUJ5	Staphylococcus_phage	92.9	1.1e-276
AWQ98088.1|1436365_1436743_+	hypothetical protein	NA	Q9FZY7	Staphylococcus_virus	100.0	1.2e-60
AWQ98086.1|1436743_1436926_+	hypothetical protein	NA	A0A2H4PQV2	Staphylococcus_phage	100.0	1.9e-29
AWQ95869.1|1436966_1437266_+	hypothetical protein	NA	A0A0H4ITZ0	Staphylococcus_phage	100.0	7.6e-47
AWQ95954.1|1437402_1439301_+	mannosyl-glycoendo-beta-N-acetylglucosaminidase family protein	NA	Q8SDT1	Staphylococcus_phage	99.4	0.0e+00
AWQ96786.1|1439313_1440552_+	hypothetical protein	NA	A0A0F6N3G7	Staphylococcus_phage	98.8	2.5e-208
AWQ97141.1|1440557_1440953_+	hypothetical protein	NA	A1KXB6	Staphylococcus_virus	100.0	1.6e-68
AWQ96257.1|1441008_1441446_+|holin	holin, phage phi LC3 family	holin	A0A2H4PQP0	Staphylococcus_phage	100.0	4.1e-73
AWQ96205.1|1441426_1442872_+	CHAP domain protein	NA	A0EWV1	Staphylococcus_virus	99.2	6.5e-293
AWQ97253.1|1443277_1443940_+	hypothetical protein	NA	Q4ZB12	Staphylococcus_virus	100.0	7.4e-119
AWQ95994.1|1443954_1444596_+	hypothetical protein	NA	Q4ZB11	Staphylococcus_virus	100.0	9.7e-116
AWQ97369.1|1445123_1445285_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ96081.1|1445415_1445931_+|protease	intracellular protease, PfpI family protein	protease	NA	NA	NA	NA
AWQ98060.1|1446270_1447080_+	monofunctional glycosyltransferase	NA	NA	NA	NA	NA
AWQ97616.1|1447340_1448159_+	regulatory protein RecX	NA	NA	NA	NA	NA
AWQ97917.1|1448136_1448451_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ97645.1|1448465_1449983_+	putative sugar ABC transporter ATPase	NA	NA	NA	NA	NA
AWQ97036.1|1449991_1450828_+	putative membrane protein	NA	NA	NA	NA	NA
AWQ97275.1|1451088_1452066_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ98152.1|1452217_1453255_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AWQ98070.1|1453557_1454100_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ98420.1|1454390_1456127_+	putative multidrug export ATP-binding/permease protein	NA	W8CYL7	Bacillus_phage	30.4	1.7e-53
AWQ97458.1|1456316_1457411_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ98028.1|1457703_1458993_-	glutamate-1-semialdehyde-2,1-aminomutase	NA	NA	NA	NA	NA
AWQ98182.1|1459073_1459529_+	ahpC/TSA family protein	NA	NA	NA	NA	NA
AWQ97877.1|1459534_1460485_+	D-isomer specific 2-hydroxyacid dehydrogenase, NAD binding domain protein	NA	NA	NA	NA	NA
AWQ96692.1|1460581_1461028_+	peroxide-responsive repressor PerR	NA	NA	NA	NA	NA
AWQ98053.1|1469454_1470774_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWQ96336.1|1471357_1472419_+	phosphotransferase system, EIIC family protein	NA	NA	NA	NA	NA
AWQ96980.1|1472676_1474134_+	amino ABC transporter, permease, 3-TM region, His/Glu/Gln/Arg/opine family domain protein	NA	NA	NA	NA	NA
AWQ97750.1|1474126_1474849_+	recF/RecN/SMC N terminal domain protein	NA	G9BWD6	Planktothrix_phage	42.7	1.3e-36
AWQ97227.1|1474999_1476127_+	epoxyqueuosine reductase	NA	NA	NA	NA	NA
AWQ96611.1|1476131_1476602_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 3
CP029655	Staphylococcus aureus strain AR_0469 chromosome, complete genome	2857253	1514412	1576622	2857253	tRNA,integrase,transposase,protease	Staphylococcus_phage(92.0%)	62	1516450:1516466	1551660:1551676
AWQ96210.1|1514412_1515348_+	leucotoxin LukEv	NA	A0A2H4PQI5	Staphylococcus_phage	100.0	1.4e-174
AWQ97824.1|1515349_1516333_+	leucotoxin LukDv	NA	A0A2H4PQH7	Staphylococcus_phage	99.4	1.8e-185
1516450:1516466	attL	ATTACTTTGCTAAATAG	NA	NA	NA	NA
AWQ98118.1|1516590_1516716_+	hypothetical protein	NA	NA	NA	NA	NA
AWQ97818.1|1516702_1517494_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ97826.1|1517498_1517972_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ98136.1|1518173_1518446_+	putative membrane protein	NA	A0A2H4PQH0	Staphylococcus_phage	83.5	3.1e-31
AWQ97598.1|1518649_1518769_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ96663.1|1518918_1519500_-	hypothetical protein	NA	A0A2H4PQH6	Staphylococcus_phage	64.8	9.6e-54
AWQ98413.1|1520463_1521171_+|protease	serine protease SplA	protease	A0A2H4PQN3	Staphylococcus_phage	97.0	7.9e-127
AWQ97445.1|1521295_1522018_+|protease	serine protease SplB	protease	A0A2H4PQN0	Staphylococcus_phage	98.3	3.5e-130
AWQ96839.1|1522075_1522795_+|protease	serine protease SplC	protease	A0A2H4PQP7	Staphylococcus_phage	98.7	1.3e-129
AWQ95910.1|1522915_1523635_+|protease	serine protease SplF	protease	A0A2H4PQP9	Staphylococcus_phage	99.6	4.6e-130
AWQ97129.1|1523792_1523960_+|protease	serine protease SplF domain protein	protease	A0A2H4PQP1	Staphylococcus_phage	98.2	3.4e-20
AWQ97047.1|1523960_1524512_+|protease	serine protease SplF	protease	A0A2H4PQP1	Staphylococcus_phage	100.0	3.4e-101
AWQ97764.1|1524872_1526429_+	type I restriction-modification system, M subunit	NA	A0A2H4PQP4	Staphylococcus_phage	100.0	1.6e-289
AWQ98254.1|1526421_1527651_+	type I restriction modification DNA specificity domain protein	NA	A0A2H4PQP5	Staphylococcus_phage	64.7	4.0e-134
AWQ96161.1|1528047_1528179_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ96647.1|1528192_1528603_+|transposase	putative transposase	transposase	NA	NA	NA	NA
AWQ97039.1|1529402_1529612_+	putative iSSdy1 transposon protein	NA	A0A2H4PQV6	Staphylococcus_phage	91.2	4.7e-27
AWQ97836.1|1529633_1530203_+|integrase	integrase core domain protein	integrase	A0A2I7SC85	Paenibacillus_phage	56.8	1.3e-55
AWQ97747.1|1530400_1530973_-	hypothetical protein	NA	A0A2H4PQN4	Staphylococcus_phage	93.1	2.3e-23
AWQ98425.1|1531073_1531415_-	hypothetical protein	NA	A0A2H4PQN6	Staphylococcus_phage	94.7	1.1e-54
AWQ95798.1|1531455_1532082_-	hypothetical protein	NA	A0A2H4PQM7	Staphylococcus_phage	79.8	3.1e-74
AWQ96086.1|1532156_1533152_-	hypothetical protein	NA	A0A2H4PQN2	Staphylococcus_phage	97.9	2.6e-67
AWQ96763.1|1533232_1533847_-	excalibur calcium-binding domain protein	NA	A0A2H4PQM8	Staphylococcus_phage	93.1	1.1e-42
AWQ97092.1|1534159_1534642_+	hypothetical protein	NA	A0A2H4PQN7	Staphylococcus_phage	99.3	3.8e-80
AWQ97628.1|1534800_1536279_+	O-succinylbenzoate-CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	97.6	2.8e-283
AWQ98435.1|1536283_1537285_+	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	97.3	5.3e-185
AWQ96766.1|1537281_1537539_-	putative membrane protein insertion efficiency factor	NA	A0A2H4PQM5	Staphylococcus_phage	100.0	7.2e-46
AWQ97170.1|1537598_1538078_+	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	99.4	3.0e-85
AWQ97599.1|1538058_1538829_+	prolyl oligopeptidase family protein	NA	A0A2H4PQM6	Staphylococcus_phage	98.8	1.5e-142
AWQ98404.1|1539206_1540799_-	phosphoenolpyruvate carboxykinase	NA	A0A2H4PQN1	Staphylococcus_phage	100.0	0.0e+00
AWQ96921.1|1541170_1542367_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	99.5	4.3e-218
AWQ98056.1|1542488_1543397_+	nuclease-related domain protein	NA	A0A2H4PQQ8	Staphylococcus_phage	100.0	3.4e-138
AWQ97026.1|1543608_1544442_+	aldo/keto reductase family protein	NA	A0A2H4PQR8	Staphylococcus_phage	99.3	7.8e-158
AWQ95901.1|1544504_1545188_-|transposase	transposase DDE domain protein	transposase	A0ZS58	Staphylococcus_virus	96.5	1.2e-124
AWQ97238.1|1545626_1545791_-|transposase	putative transposase	transposase	A0A146ICT8	Staphylococcus_phage	98.1	2.9e-24
AWQ97518.1|1546438_1546792_-	crcB-like family protein	NA	A0A2H4PQQ7	Staphylococcus_phage	94.0	3.8e-21
AWQ97164.1|1546788_1547154_-	crcB-like family protein	NA	A0A2H4PQR0	Staphylococcus_phage	100.0	3.6e-59
AWQ96669.1|1547409_1547712_-	putative membrane protein	NA	NA	NA	NA	NA
AWQ98374.1|1547971_1548685_+	transaldolase	NA	M1PR54	Cyanophage	35.3	5.5e-19
AWQ96078.1|1549124_1549760_-|protease	CAAX protease self-immunity family protein	protease	NA	NA	NA	NA
AWQ96606.1|1550055_1550499_+	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	98.6	2.4e-57
AWQ96509.1|1550485_1550629_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ97178.1|1551041_1551512_-	RNA polymerase sigma factor SigS	NA	A0A2H4PQT5	Staphylococcus_phage	98.1	8.8e-82
AWQ98309.1|1551710_1551935_+	hypothetical protein	NA	NA	NA	NA	NA
1551660:1551676	attR	ATTACTTTGCTAAATAG	NA	NA	NA	NA
AWQ95905.1|1552210_1553065_+	mannosyl-glycoendo-beta-N-acetylglucosaminidase family protein	NA	Q4ZCC7	Staphylococcus_virus	38.6	9.8e-39
AWQ95916.1|1553151_1554444_-	arsenite/antimonite efflux pump membrane family protein	NA	A0A2H4PQU3	Staphylococcus_phage	99.5	5.0e-228
AWQ96467.1|1555280_1556783_+	FAD-NAD(P)-binding family protein	NA	A0A2H4PQX2	Staphylococcus_phage	98.6	1.9e-29
AWQ98248.1|1557263_1558307_+	riboflavin biosynthesis protein RibD	NA	A0A2H4PQS8	Staphylococcus_phage	98.8	5.3e-196
AWQ97554.1|1558313_1558946_+	riboflavin synthase, alpha subunit	NA	A0A2H4PQS5	Staphylococcus_phage	98.6	5.5e-111
AWQ96809.1|1558956_1560138_+	riboflavin biosynthesis protein RibBA	NA	A0A2H4PQS2	Staphylococcus_phage	99.5	5.6e-226
AWQ95819.1|1560150_1560615_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	100.0	4.5e-70
AWQ96305.1|1560736_1561738_-	proline dehydrogenase family protein	NA	A0A2H4PQT6	Staphylococcus_phage	99.4	2.6e-184
AWQ96911.1|1561970_1562798_+	alpha/beta hydrolase fold family protein	NA	NA	NA	NA	NA
AWQ97535.1|1563369_1563771_+	HTH-type transcriptional regulator rot	NA	NA	NA	NA	NA
AWQ95863.1|1563893_1564457_-	rRNA methylase family protein	NA	A0A2H4PQV0	Staphylococcus_phage	99.5	8.3e-103
AWQ97705.1|1564453_1565407_-	radical SAM superfamily protein	NA	A0A2H4PQV5	Staphylococcus_phage	100.0	2.2e-79
AWQ97579.1|1565516_1566698_+	sugar (and other) transporter family protein	NA	A0A2H4PQR6	Staphylococcus_phage	99.7	7.3e-218
AWQ96768.1|1566988_1569403_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	99.5	0.0e+00
AWQ96446.1|1569424_1569736_+	rhodanese-like domain protein	NA	A0A2H4PQR9	Staphylococcus_phage	99.0	4.8e-52
AWQ98179.1|1570061_1576622_+	sasC/Mrp/FmtB intercellular aggregation domain protein	NA	A0A2H4PQU6	Staphylococcus_phage	98.3	6.1e-306
>prophage 4
CP029655	Staphylococcus aureus strain AR_0469 chromosome, complete genome	2857253	1706626	1715669	2857253	tRNA	uncultured_Mediterranean_phage(50.0%)	7	NA	NA
AWQ98214.1|1706626_1707631_+	holliday junction DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	1.7e-05
AWQ97752.1|1707632_1708658_+|tRNA	tRNA ribosyltransferase-isomerase	tRNA	NA	NA	NA	NA
AWQ97946.1|1708680_1709820_+|tRNA	queuine tRNA-ribosyltransferase	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.7	5.4e-85
AWQ98131.1|1709838_1710099_+	preprotein translocase, YajC subunit	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.3	8.2e-05
AWQ97321.1|1710373_1712653_+	protein-export membrane protein SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.8	1.8e-31
AWQ98193.1|1712855_1715129_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.3	8.1e-64
AWQ97000.1|1715150_1715669_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.5	5.6e-29
>prophage 5
CP029655	Staphylococcus aureus strain AR_0469 chromosome, complete genome	2857253	2333979	2342452	2857253		Synechococcus_phage(33.33%)	9	NA	NA
AWQ97200.1|2333979_2334546_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.1	6.1e-29
AWQ96422.1|2334548_2335577_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.7	3.4e-62
AWQ97537.1|2335569_2337054_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.7	1.9e-45
AWQ97103.1|2337032_2339222_-	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	39.8	3.5e-141
AWQ97673.1|2339214_2339886_-	phosphoribosylformylglycinamidine synthase I	NA	NA	NA	NA	NA
AWQ98410.1|2339887_2340151_-	phosphoribosylformylglycinamidine synthase, purS protein	NA	NA	NA	NA	NA
AWQ98417.1|2340150_2340855_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	42.1	7.3e-48
AWQ97367.1|2340858_2341983_-	N5-carboxyaminoimidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AWQ96717.1|2341969_2342452_-	phosphoribosylaminoimidazole carboxylase, catalytic subunit	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	8.0e-22
>prophage 6
CP029655	Staphylococcus aureus strain AR_0469 chromosome, complete genome	2857253	2489008	2545932	2857253	capsid,head,terminase,portal,tail,integrase,transposase,holin	Staphylococcus_phage(76.81%)	80	2513180:2513196	2547829:2547845
AWQ96807.1|2489008_2490328_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWQ96273.1|2490533_2490917_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ96110.1|2491046_2491964_-	lipoyl synthase	NA	NA	NA	NA	NA
AWQ98181.1|2492047_2493367_-	5'-nucleotidase, C-terminal domain protein	NA	NA	NA	NA	NA
AWQ96834.1|2493393_2494221_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
AWQ98015.1|2494233_2495082_-	hypothetical protein	NA	NA	NA	NA	NA
AWQ96444.1|2495466_2496534_-	nitronate monooxygenase family protein	NA	NA	NA	NA	NA
AWQ98198.1|2496547_2497588_-	CBS domain protein	NA	NA	NA	NA	NA
AWQ95997.1|2497952_2498267_+	putative membrane protein	NA	NA	NA	NA	NA
AWQ96127.1|2499096_2499282_-	hypothetical protein	NA	A0A0F6N3H3	Staphylococcus_phage	100.0	2.7e-26
AWQ97346.1|2499464_2499593_-	hypothetical protein	NA	A0A0F6N3H2	Staphylococcus_phage	100.0	1.1e-15
AWQ98352.1|2499991_2500549_+	putative penicillin binding protein	NA	A0A0F6N4L1	Staphylococcus_phage	100.0	7.4e-96
AWQ98104.1|2500608_2501871_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A0F6N3N1	Staphylococcus_phage	99.8	3.7e-252
AWQ98428.1|2502007_2502283_-|holin	holin, SPP1 family	holin	A0A0F6N3M0	Staphylococcus_phage	100.0	8.6e-45
AWQ98211.1|2502338_2502734_-	hypothetical protein	NA	A1KXB6	Staphylococcus_virus	100.0	1.6e-68
AWQ97932.1|2502739_2503978_-	hypothetical protein	NA	A0A0F6N3G7	Staphylococcus_phage	98.8	2.5e-208
AWQ96903.1|2503990_2505889_-	mannosyl-glycoendo-beta-N-acetylglucosaminidase family protein	NA	Q8SDT1	Staphylococcus_phage	99.4	0.0e+00
AWQ96867.1|2506025_2506325_-	hypothetical protein	NA	A0A0H4ITZ0	Staphylococcus_phage	100.0	7.6e-47
AWQ96969.1|2506365_2506548_-	hypothetical protein	NA	A0A2H4PQV2	Staphylococcus_phage	100.0	1.9e-29
AWQ96842.1|2506548_2506926_-	hypothetical protein	NA	Q9FZY7	Staphylococcus_virus	100.0	1.2e-60
AWQ98230.1|2506925_2508749_-	hypothetical protein	NA	M9NUJ5	Staphylococcus_phage	92.9	1.1e-276
AWQ97563.1|2508748_2510659_-	putative minor structural protein	NA	Q4ZDU1	Staphylococcus_virus	98.7	0.0e+00
AWQ97303.1|2510673_2512575_-|tail	prophage endopeptidase tail family protein	tail	I1W634	Staphylococcus_phage	99.8	0.0e+00
AWQ98426.1|2512583_2513531_-|tail	phage tail family protein	tail	Q8SDT6	Staphylococcus_phage	99.7	6.1e-183
2513180:2513196	attL	TGTTTTTATCTAATTTC	NA	NA	NA	NA
AWQ96670.1|2513543_2517008_-	putative membrane protein	NA	Q4ZDL9	Staphylococcus_virus	100.0	2.3e-267
AWQ98399.1|2517024_2517369_-	hypothetical protein	NA	A0A0F6N3F7	Staphylococcus_phage	100.0	2.5e-57
AWQ95968.1|2517398_2517764_-	phage family protein	NA	A0A0F6N4J9	Staphylococcus_phage	100.0	3.6e-59
AWQ95817.1|2517825_2518407_-|tail	phage major tail protein, TP901-1 family	tail	A0A0F6N3L8	Staphylococcus_phage	100.0	4.9e-106
AWQ96417.1|2518425_2518809_-	hypothetical protein	NA	E0Y3L5	Staphylococcus_virus	98.4	3.8e-67
AWQ97316.1|2518820_2519168_-	hypothetical protein	NA	A0A0F6N3F5	Staphylococcus_phage	100.0	4.1e-60
AWQ98310.1|2519466_2519799_-|head,tail	phage gp6-like head-tail connector family protein	head,tail	A0A0F6N3F4	Staphylococcus_phage	100.0	5.5e-54
AWQ95963.1|2519807_2520095_-	hypothetical protein	NA	S4V6D9	Staphylococcus_phage	98.9	1.4e-45
AWQ98329.1|2520116_2521091_-|capsid	phage major capsid protein, HK97 family	capsid	E0Y3L0	Staphylococcus_virus	100.0	2.2e-183
AWQ97195.1|2521104_2521461_-	hypothetical protein	NA	B2ZYY4	Staphylococcus_phage	96.6	1.2e-38
AWQ98223.1|2521594_2521723_-	hypothetical protein	NA	A0A0F6N3K8	Staphylococcus_phage	100.0	1.2e-09
AWQ97741.1|2521831_2522002_-	hypothetical protein	NA	A0A0F6N3E9	Staphylococcus_phage	100.0	1.5e-23
AWQ96951.1|2522074_2523070_-|head	phage head morphogenesis, SPP1 gp7 family domain protein	head	A0A0F6N3F1	Staphylococcus_phage	100.0	2.0e-184
AWQ96682.1|2523076_2524615_-|portal	phage portal protein, SPP1 family	portal	A0A0F6N4I8	Staphylococcus_phage	100.0	2.4e-293
AWQ98173.1|2524625_2525921_-|terminase	phage terminase, large subunit, PBSX family	terminase	A0A0F6N3L3	Staphylococcus_phage	100.0	3.0e-257
AWQ96171.1|2525923_2526418_-|terminase	terminase small subunit	terminase	A0A0F6N3K6	Staphylococcus_phage	100.0	7.8e-89
AWQ97988.1|2526605_2527028_-	phage transcriptional regulator, RinA family protein	NA	A0A0F6N3E5	Staphylococcus_phage	100.0	1.2e-74
AWQ96935.1|2527198_2527372_-	transcriptional activator RinB family protein	NA	Q4ZBK0	Staphylococcus_phage	100.0	6.4e-22
AWQ97240.1|2527364_2527601_-	hypothetical protein	NA	Q4ZDP0	Staphylococcus_virus	100.0	2.8e-36
AWQ98099.1|2527593_2527797_-	hypothetical protein	NA	A0A0N9BAX5	Staphylococcus_phage	100.0	5.2e-31
AWQ97876.1|2527793_2527988_-	hypothetical protein	NA	A0A2I6PEC2	Staphylococcus_phage	100.0	6.0e-29
AWQ96783.1|2527984_2528191_-	hypothetical protein	NA	A0A0H3U2R7	Staphylococcus_phage	72.1	1.0e-18
AWQ96788.1|2528227_2528761_-	dUTP diphosphatase family protein	NA	A1KX16	Staphylococcus_virus	99.4	2.4e-96
AWQ96435.1|2528753_2528924_-	hypothetical protein	NA	A7TWH6	Staphylococcus_phage	91.1	1.5e-20
AWQ97643.1|2528910_2529165_-	hypothetical protein	NA	A1KX15	Staphylococcus_virus	97.6	2.5e-38
AWQ98303.1|2529157_2529523_-	acetyltransferase family protein	NA	A0A0F6N3K4	Staphylococcus_phage	100.0	3.5e-54
AWQ96091.1|2529537_2529651_-	phage family protein	NA	A0A0F6N3E1	Staphylococcus_phage	94.6	4.6e-13
AWQ96054.1|2529783_2530140_-	PVL ORF-50-like family protein	NA	A0A0F6N3E3	Staphylococcus_phage	100.0	6.5e-61
AWQ97588.1|2530267_2530573_-	hypothetical protein	NA	A0A0F6N4H9	Staphylococcus_phage	100.0	1.7e-49
AWQ96382.1|2530573_2530759_-	hypothetical protein	NA	A0A0F6N3K7	Staphylococcus_phage	100.0	1.1e-27
AWQ96996.1|2530763_2531168_-	hypothetical protein	NA	A1KX76	Staphylococcus_virus	100.0	9.6e-69
AWQ95965.1|2531177_2531399_-	hypothetical protein	NA	A0A0H3U2V4	Staphylococcus_phage	100.0	2.2e-35
AWQ96016.1|2531411_2531570_-	hypothetical protein	NA	A0A2H4PQI7	Staphylococcus_phage	100.0	4.5e-22
AWQ97704.1|2531563_2532343_-	bacterial dnaA family protein	NA	G4KNP1	Staphylococcus_phage	100.0	3.8e-146
AWQ96795.1|2532352_2533123_-	conserved phage family protein	NA	G4KNP0	Staphylococcus_phage	100.0	6.4e-122
AWQ96744.1|2533188_2533470_+	pTS system, fructose subfamily, IIA component domain protein	NA	A0A1W6JPU7	Staphylococcus_phage	100.0	2.6e-49
AWQ97094.1|2533608_2534283_-	hypothetical protein	NA	R4IH15	Staphylococcus_phage	96.9	1.4e-125
AWQ98064.1|2534296_2534725_-	single-stranded DNA-binding protein ssb	NA	B2ZYV4	Staphylococcus_phage	100.0	3.9e-60
AWQ97155.1|2534724_2535348_-	hypothetical protein	NA	A0A2H4PQQ6	Staphylococcus_phage	100.0	1.4e-114
AWQ97857.1|2535340_2535562_-	hypothetical protein	NA	A7TWM6	Staphylococcus_phage	100.0	3.2e-34
AWQ96029.1|2535571_2535832_-	hypothetical protein	NA	Q4ZDA1	Staphylococcus_virus	100.0	1.2e-43
AWQ97685.1|2535836_2536139_-	hypothetical protein	NA	A0A0F6N3N3	Staphylococcus_phage	100.0	1.4e-48
AWQ96449.1|2536386_2536608_-	hypothetical protein	NA	A0A0F6N3I2	Staphylococcus_phage	100.0	1.5e-31
AWQ97758.1|2536621_2537071_-	hypothetical protein	NA	A1KWZ2	Staphylococcus_virus	100.0	3.0e-79
AWQ98353.1|2537110_2537335_-	hypothetical protein	NA	A0A0F6N4M2	Staphylococcus_phage	100.0	3.2e-34
AWQ98080.1|2537335_2538103_-	phage antirepressor KilAC domain protein	NA	A0A0F6N3N8	Staphylococcus_phage	100.0	1.1e-142
AWQ98004.1|2538102_2538297_-	helix-turn-helix family protein	NA	A0A0F6N3M9	Staphylococcus_phage	100.0	1.1e-25
AWQ95932.1|2538559_2538892_+	helix-turn-helix domain protein	NA	R4IH08	Staphylococcus_phage	100.0	4.1e-57
AWQ96708.1|2538908_2539583_+	hypothetical protein	NA	A0A0F6N3H6	Staphylococcus_phage	100.0	4.9e-126
AWQ96027.1|2539610_2540336_+	short C-terminal domain protein	NA	A0A0F6N4L7	Staphylococcus_phage	100.0	9.9e-125
AWQ97536.1|2540367_2541300_+	putative phage protein	NA	A0EWN8	Staphylococcus_virus	100.0	3.9e-174
AWQ96535.1|2541279_2541459_-	putative excisionase	NA	A0EWN7	Staphylococcus_virus	100.0	8.3e-25
AWQ97422.1|2541571_2542621_+|integrase	phage integrase family protein	integrase	A1KWY3	Staphylococcus_virus	99.7	4.5e-203
AWQ96332.1|2542688_2544086_-	feS assembly protein SufB	NA	NA	NA	NA	NA
AWQ96638.1|2544236_2544701_-	SUF system FeS assembly protein, NifU family	NA	NA	NA	NA	NA
AWQ96051.1|2544690_2545932_-	putative cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.8	8.2e-111
2547829:2547845	attR	TGTTTTTATCTAATTTC	NA	NA	NA	NA
>prophage 7
CP029655	Staphylococcus aureus strain AR_0469 chromosome, complete genome	2857253	2633177	2645895	2857253		uncultured_Caudovirales_phage(50.0%)	10	NA	NA
AWQ97065.1|2633177_2634149_-	fecCD transport family protein	NA	A0A2H4IY97	uncultured_Caudovirales_phage	78.9	4.3e-139
AWQ97217.1|2634523_2635495_-	ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	91.3	4.2e-171
AWQ98377.1|2635612_2637718_-	ribonucleoside-diphosphate reductase, alpha subunit	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	91.7	0.0e+00
AWQ96700.1|2637680_2638079_-	nrdI protein	NA	A0A2H4J545	uncultured_Caudovirales_phage	72.0	1.2e-52
AWQ96325.1|2638879_2639746_+	eamA-like transporter family protein	NA	NA	NA	NA	NA
AWQ97331.1|2639765_2640266_+	7-cyano-7-deazaguanine reductase	NA	E7DN65	Pneumococcus_phage	71.5	5.9e-52
AWQ97435.1|2640606_2642112_+	H+ symporter family protein	NA	A0A0P0IY73	Acinetobacter_phage	32.2	2.0e-58
AWQ97885.1|2642381_2643299_+	putative lipid kinase	NA	A0A1V0SBJ0	Catovirus	22.0	2.1e-07
AWQ96104.1|2643955_2644498_-	putative 5'(3')-deoxyribonucleotidase	NA	NA	NA	NA	NA
AWQ97559.1|2644836_2645895_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	26.7	7.9e-22
>prophage 8
CP029655	Staphylococcus aureus strain AR_0469 chromosome, complete genome	2857253	2657866	2665687	2857253		Pandoravirus(16.67%)	10	NA	NA
AWQ95853.1|2657866_2659018_-	chorismate binding enzyme family protein	NA	S4VNU7	Pandoravirus	35.7	6.0e-23
AWQ98277.1|2659001_2659595_-	glutamine amidotransferase of anthranilate synthase/aminodeoxychorismate synthase family protein	NA	A0A0P0IKJ1	Acinetobacter_phage	42.9	4.4e-38
AWQ97278.1|2659945_2660614_+	queuosine biosynthesis protein QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.5	9.6e-66
AWQ96192.1|2660615_2661035_+	queuosine biosynthesis protein QueD	NA	S4U060	uncultured_phage	28.7	6.3e-07
AWQ96896.1|2661038_2661752_+	7-cyano-7-deazaguanosine (preQ0) biosynthesis protein QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.5	6.5e-52
AWQ96228.1|2661850_2662435_+	putative membrane protein	NA	NA	NA	NA	NA
AWQ97870.1|2662714_2663155_+	electron transfer DM13 family protein	NA	NA	NA	NA	NA
AWQ98237.1|2663497_2663971_+	doxX family protein	NA	NA	NA	NA	NA
AWQ98370.1|2663945_2664632_+	response regulator	NA	NA	NA	NA	NA
AWQ96287.1|2664631_2665687_+	histidine protein kinase SaeS	NA	A0A1V0SGX0	Hokovirus	29.8	3.6e-14
