The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029686	Lactobacillus paracasei strain Lpc10 chromosome, complete genome	3052122	532206	541465	3052122	protease,integrase	Streptococcus_phage(33.33%)	8	526287:526300	548588:548601
526287:526300	attL	CGCTGAGCCAAACT	NA	NA	NA	NA
AWR90150.1|532206_532704_+|integrase	integrase	integrase	U5U4L5	Lactobacillus_phage	87.9	2.2e-59
AWR90151.1|533108_533699_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	52.3	1.1e-52
AWR90152.1|533815_534271_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWR90153.1|534656_535604_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.7	9.2e-54
AWR90154.1|535608_536637_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	51.2	2.3e-90
AWR90155.1|536633_537521_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	31.4	1.1e-08
AWR90156.1|537683_538223_-	hypothetical protein	NA	NA	NA	NA	NA
AWR90157.1|538573_541465_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	5.4e-307
548588:548601	attR	AGTTTGGCTCAGCG	NA	NA	NA	NA
>prophage 2
CP029686	Lactobacillus paracasei strain Lpc10 chromosome, complete genome	3052122	937683	951092	3052122	integrase	Lactobacillus_phage(85.71%)	26	947032:947046	954971:954985
AWR90520.1|937683_938112_-	DUF1492 domain-containing protein	NA	A0A0P0IJK8	Lactobacillus_phage	96.5	2.3e-73
AWR90521.1|938722_938911_-	hypothetical protein	NA	U5U4N2	Lactobacillus_phage	74.5	4.8e-15
AWR90522.1|938914_939157_-	hypothetical protein	NA	NA	NA	NA	NA
AWR90523.1|939443_939821_-	hypothetical protein	NA	NA	NA	NA	NA
AWR90524.1|939866_940385_-	DNA polymerase III subunit epsilon	NA	NA	NA	NA	NA
AWR90525.1|940384_941209_-	DNA replication protein	NA	A0A0P0I3L9	Lactobacillus_phage	75.5	3.0e-117
AWR90526.1|941223_941973_-	DNA replication protein DnaD	NA	A0A0N7IRA7	Lactobacillus_phage	56.9	4.0e-36
AWR90527.1|941965_942280_-	hypothetical protein	NA	NA	NA	NA	NA
AWR90528.1|942356_942560_-	hypothetical protein	NA	NA	NA	NA	NA
AWR90529.1|942552_942645_-	hypothetical protein	NA	A0A0P0IZE0	Lactobacillus_phage	100.0	1.6e-11
AWR90530.1|942644_943001_-	DUF771 domain-containing protein	NA	U5U4L9	Lactobacillus_phage	96.6	5.9e-62
AWR90531.1|943066_943318_+	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
AWR90532.1|943310_943466_-	hypothetical protein	NA	NA	NA	NA	NA
AWR90533.1|943512_944040_-	hypothetical protein	NA	A0A2H4J505	uncultured_Caudovirales_phage	41.7	3.6e-15
AWR90534.1|945133_945373_+	hypothetical protein	NA	NA	NA	NA	NA
AWR90535.1|945379_945613_-	hypothetical protein	NA	NA	NA	NA	NA
AWR90536.1|945613_945826_-	XRE family transcriptional regulator	NA	A0A1B0YC38	Lactobacillus_phage	95.7	1.6e-30
AWR90537.1|946083_946410_+	XRE family transcriptional regulator	NA	A0A1B0Y3N1	Lactobacillus_phage	97.2	3.2e-54
AWR90538.1|946406_946811_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1B0Y2S4	Lactobacillus_phage	94.0	2.4e-72
AWR90539.1|946883_947663_+	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	91.5	3.2e-105
947032:947046	attL	TTGACAATGGTATTC	NA	NA	NA	NA
AWR90540.1|947796_948402_+	hypothetical protein	NA	A0A097BY73	Enterococcus_phage	56.1	3.8e-13
AWR90541.1|948504_948693_+	hypothetical protein	NA	NA	NA	NA	NA
AWR90542.1|948856_949138_+	hypothetical protein	NA	A0A0P0HRW5	Lactobacillus_phage	53.8	2.1e-22
AWR90543.1|949160_949496_+	hypothetical protein	NA	NA	NA	NA	NA
AWR90544.1|949550_949814_+	hypothetical protein	NA	NA	NA	NA	NA
AWR90545.1|949922_951092_+|integrase	site-specific integrase	integrase	Q6J1W6	Lactobacillus_phage	94.3	1.7e-211
954971:954985	attR	TTGACAATGGTATTC	NA	NA	NA	NA
>prophage 3
CP029686	Lactobacillus paracasei strain Lpc10 chromosome, complete genome	3052122	1414862	1456072	3052122	bacteriocin,transposase,protease	Streptococcus_phage(33.33%)	44	NA	NA
AWR90941.1|1414862_1416947_+|bacteriocin	bacteriocin-associated protein	bacteriocin	NA	NA	NA	NA
AWR90942.1|1416939_1417596_+	ABC transporter	NA	G9BWD6	Planktothrix_phage	33.9	5.8e-23
AWR90943.1|1417754_1418633_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWR90944.1|1418729_1419389_-	transcriptional regulator flp	NA	NA	NA	NA	NA
AWR90945.1|1419437_1420022_-	DNA-binding protein	NA	NA	NA	NA	NA
AWR90946.1|1420169_1420397_-	copper chaperone	NA	NA	NA	NA	NA
AWR90947.1|1420416_1422273_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.2	9.8e-68
AWR90948.1|1422309_1422495_+	hypothetical protein	NA	NA	NA	NA	NA
AWR90949.1|1422618_1422840_+	hypothetical protein	NA	NA	NA	NA	NA
AWR90950.1|1422905_1423559_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWR90951.1|1424179_1425433_+	CBS domain-containing protein	NA	Q6GZ03	Mycoplasma_phage	43.0	1.5e-14
AWR90952.1|1425435_1426065_+	ABC transporter permease	NA	NA	NA	NA	NA
AWR90953.1|1426076_1427006_+	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWR90954.1|1427005_1427668_+	ABC transporter permease	NA	NA	NA	NA	NA
AWR90955.1|1427881_1428142_+	hypothetical protein	NA	NA	NA	NA	NA
AWR90956.1|1428392_1428995_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWR90957.1|1428991_1432303_+	MMPL family transporter	NA	NA	NA	NA	NA
AWR90958.1|1432483_1432807_+	hypothetical protein	NA	NA	NA	NA	NA
AWR90959.1|1432984_1434358_+	MFS transporter	NA	NA	NA	NA	NA
AWR90960.1|1434772_1436293_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.3	4.1e-11
AWR92532.1|1436586_1437261_+	transcriptional regulator	NA	A0A1X9I6E0	Streptococcus_phage	26.6	1.8e-11
AWR90961.1|1437449_1437770_-	hypothetical protein	NA	NA	NA	NA	NA
AWR90962.1|1438467_1439160_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWR90963.1|1439557_1440208_+	bifunctional 2-keto-4-hydroxyglutarate aldolase/2-keto-3-deoxy-6-phosphogluconate aldolase	NA	NA	NA	NA	NA
AWR92533.1|1440553_1441429_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWR90964.1|1441431_1441536_-	hypothetical protein	NA	NA	NA	NA	NA
AWR90965.1|1441775_1441991_+	hypothetical protein	NA	NA	NA	NA	NA
AWR90966.1|1442343_1442634_+	hypothetical protein	NA	NA	NA	NA	NA
AWR90967.1|1442871_1443201_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
AWR90968.1|1443187_1443898_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWR90969.1|1444231_1444570_-	hypothetical protein	NA	NA	NA	NA	NA
AWR90970.1|1444767_1445241_-	hypothetical protein	NA	NA	NA	NA	NA
AWR90971.1|1445598_1446210_+	hypothetical protein	NA	NA	NA	NA	NA
AWR90972.1|1446341_1446530_-	hypothetical protein	NA	NA	NA	NA	NA
AWR90973.1|1446698_1447010_+	Gar-IM	NA	NA	NA	NA	NA
AWR90974.1|1447059_1447695_-	hypothetical protein	NA	NA	NA	NA	NA
AWR90975.1|1447889_1449332_-	dipeptidase	NA	NA	NA	NA	NA
AWR90976.1|1449572_1449932_+	hypothetical protein	NA	NA	NA	NA	NA
AWR90977.1|1450007_1450352_+	hypothetical protein	NA	NA	NA	NA	NA
AWR90978.1|1450608_1451853_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.0	7.4e-11
AWR90979.1|1452044_1453421_-	divalent metal cation transporter	NA	NA	NA	NA	NA
AWR90980.1|1453649_1454288_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AWR90981.1|1454336_1455230_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
AWR90982.1|1455394_1456072_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 4
CP029686	Lactobacillus paracasei strain Lpc10 chromosome, complete genome	3052122	1469917	1533792	3052122	tRNA,protease,tail,terminase,portal,head,capsid	Lactobacillus_phage(20.0%)	59	NA	NA
AWR90996.1|1469917_1470775_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWR90997.1|1471053_1471356_+	hypothetical protein	NA	NA	NA	NA	NA
AWR90998.1|1471568_1471964_+	hypothetical protein	NA	NA	NA	NA	NA
AWR90999.1|1472360_1472954_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
AWR92535.1|1473026_1473221_-	hypothetical protein	NA	NA	NA	NA	NA
AWR91000.1|1473247_1474267_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AWR91001.1|1474259_1475738_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AWR91002.1|1476179_1476416_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
AWR91003.1|1476502_1477099_-	single-stranded DNA-binding protein	NA	A0A2D1GPB7	Lactobacillus_phage	58.1	7.1e-52
AWR91004.1|1477129_1477426_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
AWR91005.1|1477553_1477985_-	single-stranded DNA-binding protein	NA	A0A2I2MUI5	uncultured_Caudovirales_phage	46.9	1.3e-26
AWR91006.1|1478167_1478872_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
AWR91007.1|1478976_1481598_-	DNA gyrase subunit A	NA	A0A172JHV7	Bacillus_phage	33.5	2.9e-113
AWR91008.1|1481659_1483621_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	46.6	4.3e-146
AWR91009.1|1483873_1484989_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
AWR91010.1|1484985_1485198_-	S4 domain-containing protein YaaA	NA	NA	NA	NA	NA
AWR91011.1|1485775_1486915_-	DNA polymerase III subunit beta	NA	D0R7I4	Paenibacillus_phage	33.1	5.0e-14
AWR91012.1|1487087_1488437_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
AWR91013.1|1489357_1489498_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
AWR91014.1|1489631_1490183_+	ribonuclease P protein component	NA	NA	NA	NA	NA
AWR91015.1|1490327_1491164_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
AWR91016.1|1491181_1491946_+	protein jag	NA	NA	NA	NA	NA
AWR91017.1|1492458_1493847_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
AWR91018.1|1493888_1495790_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
AWR91019.1|1496052_1496262_+	hypothetical protein	NA	NA	NA	NA	NA
AWR91020.1|1496423_1497188_+	threonine/serine exporter	NA	NA	NA	NA	NA
AWR91021.1|1497189_1497678_+	threonine/serine exporter	NA	NA	NA	NA	NA
AWR91022.1|1497694_1498873_+	amidohydrolase	NA	NA	NA	NA	NA
AWR91023.1|1499016_1500102_-	oxidoreductase	NA	NA	NA	NA	NA
AWR92536.1|1500831_1506786_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
AWR91024.1|1506942_1508133_-	peptide ABC transporter permease	NA	NA	NA	NA	NA
AWR91025.1|1508119_1508809_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.3	2.6e-37
AWR91026.1|1508801_1509866_-	transporter	NA	NA	NA	NA	NA
AWR91027.1|1510436_1510613_-	hypothetical protein	NA	NA	NA	NA	NA
AWR91028.1|1510623_1510884_-	hypothetical protein	NA	NA	NA	NA	NA
AWR91029.1|1511226_1512012_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
AWR91030.1|1512038_1512359_+	hypothetical protein	NA	NA	NA	NA	NA
AWR92537.1|1512302_1513013_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
AWR91031.1|1513414_1515241_+	PTS mannitol transporter subunit IICBA	NA	NA	NA	NA	NA
AWR91032.1|1515277_1517335_+	HTH domain-containing protein	NA	NA	NA	NA	NA
AWR91033.1|1517306_1517783_+	PTS mannitol transporter subunit IIA	NA	NA	NA	NA	NA
AWR91034.1|1517786_1518941_+	mannitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
AWR91035.1|1519058_1520015_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWR91036.1|1520111_1521041_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWR91037.1|1521240_1522161_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	32.9	1.6e-42
AWR91038.1|1522845_1523214_+	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
AWR91039.1|1523325_1523574_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AWR91040.1|1523589_1523730_+	hypothetical protein	NA	NA	NA	NA	NA
AWR91041.1|1523836_1524037_+	hypothetical protein	NA	NA	NA	NA	NA
AWR91042.1|1524605_1524947_-|head,tail	head-tail adaptor protein	head,tail	I7AUE6	Enterococcus_phage	39.7	5.5e-09
AWR91043.1|1524930_1525221_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
AWR91044.1|1525282_1526824_-|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	25.5	2.1e-39
AWR91045.1|1526810_1527995_-|portal	phage portal protein	portal	A0A2H4J5A4	uncultured_Caudovirales_phage	35.0	1.5e-61
AWR91046.1|1527999_1528179_-	hypothetical protein	NA	NA	NA	NA	NA
AWR91047.1|1528144_1529848_-|terminase	terminase	terminase	E9LUI0	Lactobacillus_phage	39.9	2.5e-118
AWR91048.1|1529844_1530315_-|terminase	phage terminase small subunit P27 family	terminase	M1PKP2	Streptococcus_phage	29.3	1.9e-07
AWR91049.1|1530439_1530865_-	endonuclease	NA	D2JLE2	Staphylococcus_phage	38.8	3.0e-12
AWR91050.1|1531380_1532976_-	DNA primase	NA	A0A0M4RE09	Enterococcus_phage	31.3	2.6e-40
AWR91051.1|1532979_1533792_-	DNA replication protein	NA	Q854C1	Mycobacterium_phage	32.5	6.7e-13
>prophage 5
CP029686	Lactobacillus paracasei strain Lpc10 chromosome, complete genome	3052122	1983534	2056935	3052122	bacteriocin,transposase,protease	Staphylococcus_phage(18.18%)	81	NA	NA
AWR91478.1|1983534_1984779_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.4	2.0e-11
AWR91479.1|1984858_1985062_-	hypothetical protein	NA	NA	NA	NA	NA
AWR91480.1|1985374_1986325_+	peptide ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.4	1.3e-12
AWR91481.1|1986321_1987092_+	antibiotic ABC transporter permease	NA	NA	NA	NA	NA
AWR91482.1|1987095_1987875_+	ABC transporter permease	NA	NA	NA	NA	NA
AWR91483.1|1988169_1988985_+	ABC transporter permease	NA	NA	NA	NA	NA
AWR91484.1|1988981_1989683_+	sulfonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.8	9.6e-32
AWR91485.1|1989679_1990912_+	acyltransferase	NA	NA	NA	NA	NA
AWR91486.1|1990868_1992401_+	acyl-CoA synthetase	NA	A0A1V0SBX8	Catovirus	25.6	7.5e-13
AWR91487.1|1992390_1993365_+	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWR91488.1|1993444_1993666_+	hypothetical protein	NA	NA	NA	NA	NA
AWR91489.1|1993744_1994548_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
AWR91490.1|1994544_1995327_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
AWR91491.1|1995326_1996100_-	phosphonates import ATP-binding protein PhnC	NA	G9BWD6	Planktothrix_phage	38.3	1.6e-24
AWR91492.1|1997487_1999743_-	proton-efflux P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	23.1	1.5e-38
AWR91493.1|2001087_2001384_+|transposase	transposase	transposase	NA	NA	NA	NA
AWR91494.1|2001380_2002244_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.1	1.2e-23
AWR91495.1|2002671_2002959_+	hypothetical protein	NA	NA	NA	NA	NA
AWR91496.1|2003549_2003960_+	CrcB family protein	NA	NA	NA	NA	NA
AWR91497.1|2003953_2004310_+	CrcB family protein	NA	NA	NA	NA	NA
AWR91498.1|2004692_2004857_-	hypothetical protein	NA	NA	NA	NA	NA
AWR92555.1|2005463_2005772_+|transposase	transposase	transposase	NA	NA	NA	NA
AWR91499.1|2006054_2007242_+	hypothetical protein	NA	NA	NA	NA	NA
AWR91500.1|2007416_2009795_+	cell surface protein	NA	NA	NA	NA	NA
AWR91501.1|2009975_2010137_+	hypothetical protein	NA	NA	NA	NA	NA
AWR91502.1|2010399_2010549_-	hypothetical protein	NA	NA	NA	NA	NA
AWR91503.1|2010790_2011693_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWR91504.1|2011691_2011850_+	hypothetical protein	NA	NA	NA	NA	NA
AWR91505.1|2011843_2013679_-	hypothetical protein	NA	NA	NA	NA	NA
AWR91506.1|2013941_2014466_+	hypothetical protein	NA	NA	NA	NA	NA
AWR91507.1|2014622_2015255_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AWR91508.1|2015372_2016014_-	NAD-dependent dehydratase	NA	NA	NA	NA	NA
AWR91509.1|2016253_2017171_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWR91510.1|2017371_2017491_+	hypothetical protein	NA	NA	NA	NA	NA
AWR91511.1|2017579_2017849_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
AWR91512.1|2018049_2019516_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AWR91513.1|2019791_2020535_+	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.9	1.1e-12
AWR91514.1|2020531_2021428_+	metal ABC transporter permease	NA	NA	NA	NA	NA
AWR91515.1|2021424_2022366_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWR91516.1|2022486_2022819_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AWR91517.1|2022839_2023478_-	cation transporter	NA	NA	NA	NA	NA
AWR91518.1|2023606_2023798_-	hypothetical protein	NA	NA	NA	NA	NA
AWR91519.1|2023862_2024042_-	hypothetical protein	NA	NA	NA	NA	NA
AWR91520.1|2024043_2025573_+	copper oxidase	NA	NA	NA	NA	NA
AWR91521.1|2025612_2026986_+	MFS transporter	NA	NA	NA	NA	NA
AWR91522.1|2027139_2027505_-	hypothetical protein	NA	NA	NA	NA	NA
AWR91523.1|2027804_2030522_-	cation-transporting ATPase	NA	M1HJQ2	Paramecium_bursaria_Chlorella_virus	28.7	4.1e-62
AWR91524.1|2030909_2032517_+	divalent metal cation transporter	NA	NA	NA	NA	NA
AWR91525.1|2032500_2032644_+	hypothetical protein	NA	NA	NA	NA	NA
AWR91526.1|2032808_2033567_+	hypothetical protein	NA	NA	NA	NA	NA
AWR91527.1|2033699_2035076_+	class II fumarate hydratase	NA	NA	NA	NA	NA
AWR91528.1|2035337_2036501_-	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
AWR91529.1|2036526_2037261_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AWR91530.1|2037465_2038419_+	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	24.6	6.3e-10
AWR91531.1|2038690_2038924_+|bacteriocin	class IIb bacteriocin	bacteriocin	NA	NA	NA	NA
AWR91532.1|2038920_2039136_+|bacteriocin	class IIb bacteriocin	bacteriocin	NA	NA	NA	NA
AWR91533.1|2039271_2039580_+	hypothetical protein	NA	NA	NA	NA	NA
AWR91534.1|2039569_2039758_-	hypothetical protein	NA	NA	NA	NA	NA
AWR91535.1|2039850_2040447_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
AWR91536.1|2040565_2040901_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AWR91537.1|2041213_2041405_+	hypothetical protein	NA	NA	NA	NA	NA
AWR91538.1|2041656_2041989_+	hypothetical protein	NA	NA	NA	NA	NA
AWR91539.1|2042500_2043358_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWR91540.1|2043468_2043738_+	hypothetical protein	NA	NA	NA	NA	NA
AWR91541.1|2043956_2044127_+	hypothetical protein	NA	NA	NA	NA	NA
AWR91542.1|2044158_2044383_-	hypothetical protein	NA	NA	NA	NA	NA
AWR91543.1|2044704_2044893_+|bacteriocin	ComC/BlpC family peptide pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
AWR91544.1|2044918_2045101_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
AWR91545.1|2045360_2045600_-	hypothetical protein	NA	NA	NA	NA	NA
AWR91546.1|2046146_2046344_+	hypothetical protein	NA	NA	NA	NA	NA
AWR91547.1|2046705_2047512_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AWR91548.1|2047516_2048815_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
AWR91549.1|2049004_2049142_+|bacteriocin	bacteriocin prepeptide or inducing factor for bacteriocin synthesis	bacteriocin	NA	NA	NA	NA
AWR91550.1|2049607_2051800_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	26.7	8.1e-37
AWR91551.1|2051810_2053190_+|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
AWR91552.1|2053363_2053714_+	hypothetical protein	NA	NA	NA	NA	NA
AWR92556.1|2053804_2054098_+	hypothetical protein	NA	NA	NA	NA	NA
AWR91553.1|2054403_2055759_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
AWR91554.1|2055860_2056157_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AWR91555.1|2056348_2056633_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AWR91556.1|2056656_2056935_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 6
CP029686	Lactobacillus paracasei strain Lpc10 chromosome, complete genome	3052122	2479307	2540968	3052122	holin,tail,transposase,terminase,portal,integrase,head,capsid	Lactobacillus_phage(73.08%)	80	2467267:2467326	2533492:2534953
2467267:2467326	attL	GGGTCTACACTTTCTGGTGTTGAGAAATAATCAACACTGAACGTGTAGGCCCTTTTTGGA	NA	NA	NA	NA
AWR91920.1|2479307_2479769_-|tail	phage tail protein	tail	NA	NA	NA	NA
AWR91921.1|2479826_2480732_-	prolyl aminopeptidase	NA	NA	NA	NA	NA
AWR91922.1|2480787_2482617_-	potassium transporter	NA	NA	NA	NA	NA
AWR91923.1|2482688_2482883_+	Tat pathway signal protein	NA	NA	NA	NA	NA
AWR91924.1|2483906_2486198_+	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
AWR91925.1|2486202_2486679_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AWR91926.1|2487010_2488420_+	dipeptidase	NA	NA	NA	NA	NA
AWR91927.1|2488483_2488774_-	hypothetical protein	NA	NA	NA	NA	NA
AWR91928.1|2488820_2489183_-	hypothetical protein	NA	NA	NA	NA	NA
AWR91929.1|2489338_2490265_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.9	4.1e-30
AWR91930.1|2490437_2491991_+	GMP synthase (glutamine-hydrolyzing)	NA	A0A1V0SH76	Hokovirus	28.4	1.8e-14
AWR91931.1|2492155_2493319_-|integrase	integrase	integrase	A0A1X9I5C3	Streptococcus_phage	31.5	5.6e-45
AWR91932.1|2493696_2494959_-	hypothetical protein	NA	A0A141E0C6	Streptococcus_phage	24.6	3.5e-16
AWR91933.1|2495020_2495224_-	hypothetical protein	NA	A0A0P0IQK8	Lactobacillus_phage	85.1	3.5e-27
AWR91934.1|2495248_2495674_-	pyridoxamine 5'-phosphate oxidase family protein	NA	A0A0P0I7K6	Lactobacillus_phage	84.4	6.6e-60
AWR91935.1|2495736_2496270_-	BioY family transporter	NA	NA	NA	NA	NA
AWR91936.1|2496421_2497123_-	phage immunity protein	NA	A9D9J1	Lactobacillus_prophage	38.7	3.3e-24
AWR91937.1|2497215_2497566_-	hypothetical protein	NA	A0A1B0Y4P2	Lactobacillus_phage	94.0	5.8e-54
AWR91938.1|2497650_2498334_-	hypothetical protein	NA	NA	NA	NA	NA
AWR91939.1|2498390_2498813_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0P0IJN5	Lactobacillus_phage	91.3	1.3e-71
AWR91940.1|2498802_2499141_-	XRE family transcriptional regulator	NA	A0A0P0IZG9	Lactobacillus_phage	98.2	1.3e-55
AWR91941.1|2499274_2499517_+	XRE family transcriptional regulator	NA	A0A0P0HRP5	Lactobacillus_phage	93.8	2.3e-33
AWR91942.1|2499513_2499672_+	hypothetical protein	NA	NA	NA	NA	NA
AWR91943.1|2499729_2500236_+	hypothetical protein	NA	NA	NA	NA	NA
AWR91944.1|2500241_2500451_+	hypothetical protein	NA	NA	NA	NA	NA
AWR91945.1|2500463_2500595_+	hypothetical protein	NA	A0A0P0IQL2	Lactobacillus_phage	93.0	4.8e-14
AWR92573.1|2500694_2501102_+	hypothetical protein	NA	A0A0P0IXE5	Lactobacillus_phage	95.6	5.5e-72
AWR91946.1|2501114_2501774_+	ERF superfamily protein	NA	A0A0S2MYH3	Enterococcus_phage	33.7	4.6e-12
AWR91947.1|2501770_2502202_+	single-stranded DNA-binding protein	NA	A0A2D1GPB7	Lactobacillus_phage	66.2	6.9e-49
AWR91948.1|2503307_2503532_-	hypothetical protein	NA	NA	NA	NA	NA
AWR91949.1|2503647_2503863_+	XRE family transcriptional regulator	NA	A0A0P0IJY1	Lactobacillus_phage	100.0	1.3e-32
AWR91950.1|2503859_2504309_+	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	93.9	2.8e-69
AWR91951.1|2504311_2504695_+	hypothetical protein	NA	A0A0P0IJU5	Lactobacillus_phage	95.3	2.1e-65
AWR91952.1|2504706_2505417_+	methylase	NA	A8YQM7	Lactobacillus_phage	96.5	6.3e-124
AWR91953.1|2505403_2506327_+|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	42.4	2.4e-67
AWR91954.1|2506337_2506910_+	hypothetical protein	NA	NA	NA	NA	NA
AWR92574.1|2506939_2507050_+	acetyltransferase	NA	A0A2D1GP93	Lactobacillus_phage	91.7	2.4e-11
AWR91955.1|2507046_2507550_+	hypothetical protein	NA	Q8LTB6	Lactobacillus_phage	68.0	4.9e-54
AWR91956.1|2507539_2507752_+	hypothetical protein	NA	NA	NA	NA	NA
AWR91957.1|2507744_2508017_+	hypothetical protein	NA	A0A2D1GPA3	Lactobacillus_phage	77.8	4.4e-33
AWR91958.1|2508019_2508220_+	hypothetical protein	NA	NA	NA	NA	NA
AWR91959.1|2508212_2508419_+	hypothetical protein	NA	B4XYT6	Lactobacillus_phage	98.5	1.5e-33
AWR91960.1|2508415_2508814_+	hypothetical protein	NA	C1KFT5	Lactobacillus_virus	44.9	2.1e-20
AWR91961.1|2508810_2509227_+	hypothetical protein	NA	C1KFT7	Lactobacillus_virus	56.5	4.5e-37
AWR91962.1|2509219_2509507_+	hypothetical protein	NA	Q8LTA8	Lactobacillus_phage	95.8	3.7e-51
AWR92575.1|2509503_2509575_+	hypothetical protein	NA	NA	NA	NA	NA
AWR91963.1|2509576_2509849_+	hypothetical protein	NA	NA	NA	NA	NA
AWR92576.1|2510166_2510622_+	hypothetical protein	NA	NA	NA	NA	NA
AWR91964.1|2511265_2511916_+	hypothetical protein	NA	NA	NA	NA	NA
AWR91965.1|2512023_2513172_+	hypothetical protein	NA	A0A0P0I3G0	Lactobacillus_phage	95.5	9.6e-215
AWR91966.1|2513318_2513969_+|terminase	terminase	terminase	A0A1S5SAA7	Streptococcus_phage	48.9	4.5e-44
AWR91967.1|2513946_2515302_+|terminase	PBSX family phage terminase large subunit	terminase	A4L7R3	Lactococcus_phage	58.6	1.4e-148
AWR91968.1|2515306_2516734_+|portal	phage portal protein	portal	A0A0P0IQQ3	Lactobacillus_phage	92.4	4.7e-251
AWR91969.1|2516699_2517692_+|head	phage head morphogenesis protein	head	A0A0P0ID43	Lactobacillus_phage	91.2	3.3e-171
AWR91970.1|2517816_2518455_+	DUF4355 domain-containing protein	NA	A0A0P0ID10	Lactobacillus_phage	96.2	4.7e-86
AWR91971.1|2518467_2518782_+	hypothetical protein	NA	A0A0P0IJQ8	Lactobacillus_phage	93.3	4.7e-47
AWR91972.1|2518795_2519815_+|capsid	minor capsid protein E	capsid	A0A0P0IZJ7	Lactobacillus_phage	99.1	1.2e-189
AWR91973.1|2520042_2520417_+	hypothetical protein	NA	A0A0P0IZF6	Lactobacillus_phage	91.9	1.4e-58
AWR91974.1|2520421_2520724_+	hypothetical protein	NA	A0A0P0HRN0	Lactobacillus_phage	89.0	2.0e-47
AWR91975.1|2520720_2521086_+|tail	phage tail protein	tail	A0A0P0IUZ3	Lactobacillus_phage	96.7	1.2e-57
AWR91976.1|2521086_2521491_+	DUF3168 domain-containing protein	NA	A0A0P0I3C8	Lactobacillus_phage	99.3	7.8e-71
AWR91977.1|2521502_2522102_+|tail	phage tail protein	tail	A0A0P0ID88	Lactobacillus_phage	93.9	3.4e-102
AWR91978.1|2522188_2522524_+	hypothetical protein	NA	A0A0P0IJV9	Lactobacillus_phage	99.1	1.6e-53
AWR91979.1|2522622_2522976_+	hypothetical protein	NA	A0A0P0ID51	Lactobacillus_phage	94.0	9.0e-55
AWR91980.1|2522968_2526298_+|tail	phage tail tape measure protein	tail	A0A0P0IQK3	Lactobacillus_phage	75.5	3.6e-238
AWR91981.1|2526298_2528365_+|tail	phage tail protein	tail	Q3L0S3	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	58.2	1.7e-209
AWR91982.1|2528365_2530801_+|tail	phage tail protein	tail	Q6J1X1	Lactobacillus_phage	73.2	0.0e+00
AWR91983.1|2530802_2531087_+	hypothetical protein	NA	Q3L0S1	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	53.2	1.1e-21
AWR91984.1|2531083_2531215_+	XkdX family protein	NA	A0A0P0HRS7	Lactobacillus_phage	97.7	8.5e-19
AWR91985.1|2531245_2531644_+	hypothetical protein	NA	U5U712	Lactobacillus_phage	99.2	4.4e-66
AWR91986.1|2531612_2531819_+	hypothetical protein	NA	A8YQK5	Lactobacillus_phage	92.3	3.2e-12
AWR91987.1|2531815_2532262_+|holin	phage holin	holin	A8YQK6	Lactobacillus_phage	95.9	1.7e-66
AWR91988.1|2532272_2533448_+	endolysin	NA	A0A0P0HRN9	Lactobacillus_phage	50.5	6.4e-89
AWR91989.1|2533630_2534875_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.4	2.0e-11
AWR91990.1|2535079_2535574_-	hypothetical protein	NA	NA	NA	NA	NA
2533492:2534953	attR	GGGTCTACACTTTCTGGTGTTGAGAAATAATCAACACTGAACGTGTAGGCCCTTTTTGGATAACGCAAAAAGACACCTACTCAGTGTCCATGCTATGCTTGTTAGCGTCGAAACCAAAAGCAAGCGAGGTTATGAGTAAATGTCCCAATACGATCCTACACTGTCCGTCCTTGGAATACCAGACCATAATATCAAAGTTGCCTTTGTTCGTCATGAATATCGCGGCAACGGGGTACGTCGCCGCCAGTATCATGTGATTGATGCCGAGCTGACTTACCGGTTAACCCGGTGCCCACTGTGTGGCTTTGAGGCCTTGCACCCTAACGGGTTTTACACGGCCCACGTGCGCGTCCTCAACGGGGTTGAAATGCCGACAGTCATTGACTTGCACAAGCAACGATGGCGCTGTCATAACTGTTACCACACAGTCAGTGCCAAGACGCCACTCGTGCAACCCAACCACACGATCGCCGCTCACATGACAGAGCGAATCATGAAGTTAGCGCATGAACGGTTGCCAGTCAAAACCATCGCCCGTATTATCGGAATCTCAGCCTCCTCGGTTCAACGGATCATTGACCAAAATCTCAAACTCCGACCGGCTCGCCGGCTACCCACGCGACTCTGCTTTGATGAGTTCCGTTCCACTCATGGCATGATGTCGTTTATCTGTCTTGATGCCGATTCACATCGTCTGATTGCCTTGCTTGGTGATCGATTCAACCGCACGATTAAAAATTTTTTCATCGCTCATTATTCACTCGCTGACCGCACTCGGGTCCAGACGGTCACCATGGACATGAATGCAGCTTATCAAACGATTATTCATGAGGTTTTCCCCAAGGCCCAAGTCGTCATTGATCGGTTCCATATCATTCAACTTGCGGCTCGTGCCCTTGATCAGGTACGCGTCCAAGCGCTCAAACAGCTTGATGACAAACACAGCCGTCCTTATAAGATCATGAAGACAAACTGGCGGCTTTTTCATCAAACCGCGCCTGACGCTAAACACAAACAGTTCCTGTTTGGTTTGAATGAATACGTCACGCAACAGGAGGCCATCGATATCGCACTTGATACTGAGCCCAAGCTCAAGCAAACCTACGAGACCTACTTAGCACTTCATGATGCTTTGATGGTGAAGAAACATCCCGCGGAACTGGCAAACCTGTTAGCTACTTACGAGCCAAACGGTACGGCAATGGACATGACGATCGCGACGCTTAAGCGACACAAAGTCGCTGTTCTCGCCGCTGTCACCAGCCCTTATTCCAACGGTCCGATCGAAGGCGTTAACCGCCTCATCAAGTCACTCAAACGATCCTGTTTTGGCTTCAAGAATCAGCTGAACTTCTTCAAACGAATCTACCAAATCACGGCATAACATGACAAAGACGGCTCCCCAAATGGAGAACCGCCTCAAATGATAAATTTATTCTTCAACACCAGTTGACGCAGAGCC	NA	NA	NA	NA
AWR91991.1|2535570_2536680_-	DNA-binding protein	NA	NA	NA	NA	NA
AWR91992.1|2536853_2537225_-	acetyl-CoA carboxyl transferase	NA	NA	NA	NA	NA
AWR91993.1|2537952_2539368_+	hypothetical protein	NA	NA	NA	NA	NA
AWR91994.1|2539805_2540030_-|transposase	transposase	transposase	NA	NA	NA	NA
AWR91995.1|2540491_2540968_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
CP029686	Lactobacillus paracasei strain Lpc10 chromosome, complete genome	3052122	2846715	2936116	3052122	holin,tRNA,protease,tail,terminase,portal,integrase,head,capsid	Lactobacillus_phage(71.43%)	102	2855662:2855681	2896314:2896333
AWR92282.1|2846715_2847483_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AWR92283.1|2847619_2847967_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AWR92284.1|2848193_2848370_+	hypothetical protein	NA	NA	NA	NA	NA
AWR92285.1|2848402_2848648_+	DUF896 family protein	NA	NA	NA	NA	NA
AWR92286.1|2848708_2848930_+	YneF family protein	NA	NA	NA	NA	NA
AWR92287.1|2849071_2850829_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.5	3.0e-50
AWR92288.1|2850818_2852612_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.4	6.4e-40
AWR92289.1|2852709_2853501_-	DUF1003 domain-containing protein	NA	NA	NA	NA	NA
AWR92290.1|2853531_2854926_-	amino acid permease	NA	NA	NA	NA	NA
AWR92291.1|2854982_2855633_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
2855662:2855681	attL	TGTGGTAAATTATACCATTG	NA	NA	NA	NA
AWR92292.1|2855804_2857025_-|integrase	site-specific integrase	integrase	B4XYR4	Lactobacillus_phage	48.5	1.8e-102
AWR92293.1|2857083_2857347_-	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	40.2	3.2e-09
AWR92294.1|2857462_2858188_-	hypothetical protein	NA	U5U717	Lactobacillus_phage	30.5	1.0e-20
AWR92295.1|2858202_2858424_+	hypothetical protein	NA	U5U783	Lactobacillus_phage	70.4	4.8e-22
AWR92296.1|2858683_2859361_-	transcriptional regulator	NA	O64371	Lactobacillus_phage	92.0	4.8e-81
AWR92297.1|2859425_2859848_-	hypothetical protein	NA	A0A1B0Y2S4	Lactobacillus_phage	39.6	8.3e-23
AWR92298.1|2859840_2860182_-	XRE family transcriptional regulator	NA	A0A1B0Y3N1	Lactobacillus_phage	43.1	5.5e-17
AWR92299.1|2860440_2860686_+	hypothetical protein	NA	A0A0P0ID24	Lactobacillus_phage	95.1	1.2e-37
AWR92300.1|2860686_2861427_+	hypothetical protein	NA	A0A1B0YEA7	Lactobacillus_phage	51.7	5.7e-43
AWR92301.1|2861427_2861643_+	hypothetical protein	NA	A0A182BQC3	Lactococcus_phage	52.1	1.4e-13
AWR92302.1|2861605_2862100_-	hypothetical protein	NA	NA	NA	NA	NA
AWR92303.1|2862164_2862521_+	DUF771 domain-containing protein	NA	U5U4L9	Lactobacillus_phage	98.3	2.0e-62
AWR92304.1|2862520_2862613_+	hypothetical protein	NA	A0A0P0IZE0	Lactobacillus_phage	100.0	1.6e-11
AWR92305.1|2862605_2862827_+	hypothetical protein	NA	NA	NA	NA	NA
AWR92306.1|2862893_2863208_+	hypothetical protein	NA	NA	NA	NA	NA
AWR92307.1|2863200_2863950_+	DNA replication protein DnaD	NA	A0A0N7IRA7	Lactobacillus_phage	57.7	2.3e-36
AWR92308.1|2863964_2864789_+	DNA replication protein	NA	A0A0P0I3L9	Lactobacillus_phage	75.5	3.0e-117
AWR92309.1|2864788_2865307_+	DNA polymerase III subunit epsilon	NA	NA	NA	NA	NA
AWR92310.1|2865353_2865776_+	replication terminator protein	NA	NA	NA	NA	NA
AWR92311.1|2865777_2866515_+	hypothetical protein	NA	A0A097BY87	Enterococcus_phage	43.0	7.7e-48
AWR92312.1|2866526_2866814_+	hypothetical protein	NA	Q8LTA8	Lactobacillus_phage	94.7	1.6e-49
AWR92592.1|2866810_2866882_+	hypothetical protein	NA	NA	NA	NA	NA
AWR92313.1|2866883_2867216_+	hypothetical protein	NA	NA	NA	NA	NA
AWR92593.1|2867692_2868148_+	hypothetical protein	NA	NA	NA	NA	NA
AWR92314.1|2868134_2868332_-	hypothetical protein	NA	NA	NA	NA	NA
AWR92315.1|2868948_2869728_+	hypothetical protein	NA	Q8LTA5	Lactobacillus_phage	80.4	5.0e-13
AWR92316.1|2869826_2870033_+	hypothetical protein	NA	NA	NA	NA	NA
AWR92317.1|2870022_2870970_-	hypothetical protein	NA	NA	NA	NA	NA
AWR92318.1|2871679_2872897_+	hypothetical protein	NA	A8YQN3	Lactobacillus_phage	97.3	2.1e-236
AWR92319.1|2872883_2873213_+	ribonucleoside-diphosphate reductase	NA	A0A0N7IRA2	Lactobacillus_phage	92.4	8.7e-52
AWR92594.1|2873476_2873800_+	hypothetical protein	NA	U5U409	Lactobacillus_phage	87.2	5.0e-36
AWR92320.1|2873971_2874766_+	HNH endonuclease	NA	U5U440	Lactobacillus_phage	97.7	1.2e-147
AWR92321.1|2874966_2875422_+|terminase	terminase	terminase	U5U3Z1	Lactobacillus_phage	98.7	1.0e-79
AWR92322.1|2875443_2877156_+	amino acid transporter	NA	Q8LTC3	Lactobacillus_phage	98.9	0.0e+00
AWR92323.1|2877167_2877362_+	hypothetical protein	NA	U5U6Z9	Lactobacillus_phage	79.7	7.2e-22
AWR92324.1|2877367_2878621_+|portal	phage portal protein	portal	Q8LTC2	Lactobacillus_phage	98.8	4.8e-236
AWR92325.1|2878574_2879204_+|head,protease	HK97 family phage prohead protease	head,protease	U5U3W0	Lactobacillus_phage	99.0	3.0e-117
AWR92326.1|2879245_2880448_+|capsid	phage major capsid protein	capsid	B4XYP6	Lactobacillus_phage	96.0	2.8e-209
AWR92327.1|2880465_2880705_+	hypothetical protein	NA	A0A2D1GPN4	Lactobacillus_phage	96.2	1.6e-31
AWR92328.1|2880715_2881075_+	DNA-packaging protein	NA	U5U4K5	Lactobacillus_phage	95.8	1.4e-58
AWR92329.1|2881064_2881394_+|head,tail	head-tail adaptor protein	head,tail	A0A2D1GPN9	Lactobacillus_phage	98.2	8.9e-57
AWR92330.1|2881393_2881780_+	hypothetical protein	NA	U5U769	Lactobacillus_phage	95.3	6.1e-65
AWR92331.1|2881779_2882166_+|tail	phage tail protein	tail	U5U3W4	Lactobacillus_phage	97.7	6.3e-70
AWR92332.1|2882199_2882808_+|tail	phage tail protein	tail	A0A2D1GPC8	Lactobacillus_phage	96.0	2.1e-107
AWR92333.1|2882834_2883050_+	DNA-binding protein	NA	A0A2D1GPF6	Lactobacillus_phage	91.5	3.7e-19
AWR92334.1|2883120_2883534_+	hypothetical protein	NA	U5U4K9	Lactobacillus_phage	99.3	2.4e-51
AWR92335.1|2883656_2888519_+|tail	phage tail tape measure protein	tail	A0A2D1GPD5	Lactobacillus_phage	94.3	0.0e+00
AWR92336.1|2888519_2890514_+|tail	phage tail protein	tail	Q3L0S3	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	59.8	6.1e-217
AWR92337.1|2890514_2892950_+|tail	phage tail protein	tail	Q6J1X1	Lactobacillus_phage	72.3	0.0e+00
AWR92338.1|2892951_2893242_+	hypothetical protein	NA	Q3L0S1	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	55.2	1.5e-23
AWR92339.1|2893234_2893366_+	XkdX family protein	NA	A0A0P0HRS7	Lactobacillus_phage	95.3	5.5e-18
AWR92340.1|2893396_2893783_+	hypothetical protein	NA	U5U712	Lactobacillus_phage	98.4	2.1e-65
AWR92341.1|2893763_2893973_+	hypothetical protein	NA	A0A2D1GPJ3	Lactobacillus_phage	100.0	1.5e-12
AWR92342.1|2893965_2894412_+|holin	phage holin	holin	A8YQK6	Lactobacillus_phage	97.3	1.9e-65
AWR92343.1|2894422_2895721_+	1,4-beta-N-acetylmuramidase	NA	B4XYQ9	Lactobacillus_phage	89.8	2.8e-218
AWR92344.1|2896069_2896276_+	hypothetical protein	NA	NA	NA	NA	NA
AWR92595.1|2896366_2897101_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
2896314:2896333	attR	TGTGGTAAATTATACCATTG	NA	NA	NA	NA
AWR92345.1|2897090_2897360_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
AWR92346.1|2897755_2898544_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
AWR92347.1|2898628_2899510_+	elongation factor Ts	NA	NA	NA	NA	NA
AWR92348.1|2899745_2900465_+	UMP kinase	NA	NA	NA	NA	NA
AWR92349.1|2900464_2901022_+	ribosome-recycling factor	NA	NA	NA	NA	NA
AWR92350.1|2901551_2902304_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.2	2.1e-21
AWR92351.1|2902339_2903128_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
AWR92352.1|2903144_2904386_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
AWR92353.1|2904410_2906138_+|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	29.9	1.8e-07
AWR92354.1|2906204_2910539_+	PolC-type DNA polymerase III	NA	A0A0A7RWA3	Clostridium_phage	36.0	1.5e-18
AWR92355.1|2910793_2911273_+	ribosome maturation factor	NA	NA	NA	NA	NA
AWR92356.1|2911289_2912543_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
AWR92357.1|2912554_2912848_+	YlxR family protein	NA	NA	NA	NA	NA
AWR92358.1|2912844_2913150_+	YlxQ-related RNA-binding protein	NA	NA	NA	NA	NA
AWR92359.1|2913170_2916002_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	40.0	5.8e-19
AWR92360.1|2916062_2916416_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
AWR92361.1|2916722_2917514_+	DUF475 domain-containing protein	NA	S5MAL1	Bacillus_phage	44.7	1.8e-34
AWR92362.1|2917525_2918431_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
AWR92363.1|2918437_2919385_+	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
AWR92364.1|2919386_2920532_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AWR92365.1|2920694_2921741_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
AWR92366.1|2921917_2922508_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AWR92367.1|2922537_2924412_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.0	2.6e-140
AWR92368.1|2924423_2924510_+	hypothetical protein	NA	NA	NA	NA	NA
AWR92369.1|2924524_2925688_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.2	1.4e-24
AWR92596.1|2925705_2925819_-	hypothetical protein	NA	NA	NA	NA	NA
AWR92370.1|2927790_2928699_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWR92371.1|2928855_2930694_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.9	2.0e-20
AWR92372.1|2930785_2931019_-	hypothetical protein	NA	NA	NA	NA	NA
AWR92373.1|2931024_2931501_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
AWR92374.1|2931824_2932196_-	hypothetical protein	NA	NA	NA	NA	NA
AWR92375.1|2932470_2934765_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.6	5.1e-74
AWR92376.1|2934761_2935289_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	41.4	6.5e-25
AWR92377.1|2935338_2935551_-	alpha-galactosidase	NA	NA	NA	NA	NA
AWR92378.1|2935612_2936116_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
>prophage 8
CP029686	Lactobacillus paracasei strain Lpc10 chromosome, complete genome	3052122	2948712	3001332	3052122	holin,tRNA,tail,transposase,terminase,portal,head	Lactobacillus_rhamnosus_Lc-Nu-like_prophage(39.29%)	59	NA	NA
AWR92395.1|2948712_2949159_+|tRNA	D-aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
AWR92396.1|2949158_2949785_+	HAD family hydrolase	NA	NA	NA	NA	NA
AWR92397.1|2949857_2951180_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N6W8I1	Bacillus_phage	32.2	8.4e-13
AWR92398.1|2951318_2951759_-	hypothetical protein	NA	NA	NA	NA	NA
AWR92399.1|2952004_2952880_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.5	1.0e-22
AWR92400.1|2952876_2954382_+	ABC transporter permease	NA	NA	NA	NA	NA
AWR92401.1|2954510_2954837_-	inorganic pyrophosphatase	NA	NA	NA	NA	NA
AWR92402.1|2955108_2955312_-	hypothetical protein	NA	NA	NA	NA	NA
AWR92403.1|2955357_2956641_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
AWR92404.1|2956642_2958448_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	34.4	8.0e-06
AWR92405.1|2958535_2958988_+	peptide-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
AWR92406.1|2959079_2960000_+	YitT family protein	NA	NA	NA	NA	NA
AWR92407.1|2960135_2961023_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	28.5	2.1e-23
AWR92408.1|2961019_2961850_-	pyruvate, phosphate dikinase regulatory protein	NA	NA	NA	NA	NA
AWR92409.1|2962153_2962330_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AWR92410.1|2962349_2962793_+	GatB/YqeY domain-containing protein	NA	NA	NA	NA	NA
AWR92411.1|2963241_2964228_+	PhoH family protein	NA	H6X2N1	Pseudomonas_phage	46.5	1.9e-49
AWR92412.1|2964231_2964690_+	endoribonuclease YbeY	NA	NA	NA	NA	NA
AWR92413.1|2964673_2965072_+	diacylglycerol kinase	NA	NA	NA	NA	NA
AWR92414.1|2965073_2965463_+	cytidine deaminase	NA	NA	NA	NA	NA
AWR92415.1|2965459_2966362_+	GTPase Era	NA	NA	NA	NA	NA
AWR92416.1|2966361_2967141_+	DNA repair protein RecO	NA	NA	NA	NA	NA
AWR92417.1|2967391_2967703_+	hypothetical protein	NA	NA	NA	NA	NA
AWR92418.1|2967847_2968156_+	hypothetical protein	NA	NA	NA	NA	NA
AWR92419.1|2968185_2968410_-	hypothetical protein	NA	NA	NA	NA	NA
AWR92420.1|2968990_2969857_+	hypothetical protein	NA	NA	NA	NA	NA
AWR92598.1|2970088_2970856_+	hypothetical protein	NA	NA	NA	NA	NA
AWR92421.1|2972248_2973484_+	hypothetical protein	NA	NA	NA	NA	NA
AWR92422.1|2973487_2974096_+	hypothetical protein	NA	A0A0A7DMX6	Lactobacillus_phage	32.2	8.3e-16
AWR92423.1|2974149_2974377_+	hypothetical protein	NA	NA	NA	NA	NA
AWR92424.1|2974369_2975227_+	hypothetical protein	NA	NA	NA	NA	NA
AWR92425.1|2975183_2975597_+	single-stranded DNA-binding protein	NA	M4W9P8	Bacillus_phage	33.6	6.3e-07
AWR92426.1|2975695_2976133_+	DNA primase	NA	B8R694	Lactobacillus_phage	54.9	2.0e-24
AWR92427.1|2976125_2976404_+	hypothetical protein	NA	NA	NA	NA	NA
AWR92428.1|2976413_2976929_+	hypothetical protein	NA	NA	NA	NA	NA
AWR92429.1|2977209_2977506_+|transposase	transposase	transposase	NA	NA	NA	NA
AWR92430.1|2977502_2978366_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.5	3.1e-24
AWR92431.1|2979776_2980244_+|terminase	phage terminase small subunit P27 family	terminase	B8R648	Lactobacillus_phage	38.5	1.0e-21
AWR92432.1|2980237_2982130_+|terminase	terminase large subunit	terminase	A0A0M7RDK9	Lactobacillus_phage	44.7	9.8e-156
AWR92433.1|2982290_2982587_+|transposase	transposase	transposase	NA	NA	NA	NA
AWR92434.1|2982583_2983447_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.5	3.1e-24
AWR92599.1|2983603_2984608_+|portal	phage portal protein	portal	Q9AZM4	Lactococcus_phage	42.1	1.7e-69
AWR92435.1|2986208_2986505_+|transposase	transposase	transposase	NA	NA	NA	NA
AWR92436.1|2986501_2987365_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.5	3.1e-24
AWR92437.1|2988001_2988289_+	hypothetical protein	NA	NA	NA	NA	NA
AWR92438.1|2988278_2988623_+|tail	phage tail protein	tail	Q6J1Y0	Lactobacillus_phage	79.8	2.8e-45
AWR92439.1|2988625_2989045_+|head,tail	head-tail connector protein	head,tail	Q3L0S9	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	92.8	1.9e-67
AWR92440.1|2989041_2989422_+|tail	phage tail protein	tail	Q3L0S8	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	94.4	9.7e-63
AWR92441.1|2989422_2990034_+|tail	phage tail protein	tail	Q3L0S7	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	90.1	6.7e-98
AWR92442.1|2990196_2990547_+|tail	phage tail protein	tail	Q3L0S6	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	79.3	7.8e-43
AWR92443.1|2990509_2990755_+	hypothetical protein	NA	Q3L0S5	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	94.7	5.0e-36
AWR92600.1|2990784_2994678_+|tail	phage tail protein	tail	Q6J1X5	Lactobacillus_phage	69.4	2.5e-254
AWR92444.1|2994678_2996691_+|tail	phage tail protein	tail	Q3L0S3	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	76.5	1.6e-297
AWR92445.1|2996691_2999145_+|tail	phage tail protein	tail	Q3L0S2	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	68.6	0.0e+00
AWR92446.1|2999154_2999445_+	hypothetical protein	NA	Q3L0S1	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	82.3	7.4e-39
AWR92447.1|2999437_2999569_+	XkdX family protein	NA	Q3L0S0	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	86.0	1.4e-16
AWR92448.1|2999593_2999827_+	DNA primase	NA	Q3L0R9	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	96.1	5.8e-34
AWR92449.1|2999839_3000172_+|holin	phage holin	holin	Q3L0R7	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	97.6	2.2e-31
AWR92450.1|3000174_3001332_+	endolysin	NA	Q6J1W8	Lactobacillus_phage	64.9	1.2e-143
