The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP020820	Pantoea vagans strain FBS135 chromosome, complete genome	4023751	1089341	1135490	4023751	integrase,tail,holin,terminase	Escherichia_phage(36.59%)	58	1085231:1085246	1118863:1118878
1085231:1085246	attL	TGCTGGCGCTGGATGC	NA	NA	NA	NA
AWP31999.1|1089341_1090808_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	37.9	4.4e-87
AWP32000.1|1090876_1092457_+	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
AWP32001.1|1092673_1093933_+|integrase	integrase	integrase	T1S9J3	Salmonella_phage	72.6	1.2e-170
AWP32002.1|1093917_1094091_-	MFS transporter permease	NA	NA	NA	NA	NA
AWP32003.1|1094087_1094318_-	hypothetical protein	NA	A0A2H4J1E7	uncultured_Caudovirales_phage	86.2	7.7e-23
AWP32004.1|1094314_1095016_-	DNA methyltransferase	NA	A0A248SKY3	Klebsiella_phage	73.6	7.4e-93
AWP32005.1|1095012_1095372_-	hypothetical protein	NA	NA	NA	NA	NA
AWP32006.1|1095374_1095650_-	AlpA family transcriptional regulator	NA	A0A193GYW1	Enterobacter_phage	59.0	3.3e-12
AWP32007.1|1095710_1096718_-	single-stranded DNA-binding protein	NA	G9L6A2	Escherichia_phage	62.3	5.3e-84
AWP32008.1|1096714_1097569_-	exodeoxyribonuclease VIII	NA	E5AGE0	Erwinia_phage	70.6	1.2e-116
AWP32009.1|1097565_1097853_-	hypothetical protein	NA	NA	NA	NA	NA
AWP32010.1|1097860_1098937_-	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	72.3	8.0e-38
AWP32011.1|1098942_1099128_-	hypothetical protein	NA	NA	NA	NA	NA
AWP32012.1|1099100_1099292_-	hypothetical protein	NA	NA	NA	NA	NA
AWP32013.1|1099636_1100212_-	transcriptional regulator	NA	G9L6A6	Escherichia_phage	47.7	7.3e-38
AWP32014.1|1100370_1100598_+	hypothetical protein	NA	NA	NA	NA	NA
AWP32015.1|1100770_1100980_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	77.0	8.5e-21
AWP32016.1|1100979_1101987_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	60.9	6.3e-77
AWP32017.1|1101874_1102444_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	37.7	6.2e-21
AWP32018.1|1102633_1102981_+	DUF1064 domain-containing protein	NA	T1SA23	Salmonella_phage	64.1	3.9e-34
AWP32019.1|1103062_1103671_+	hypothetical protein	NA	NA	NA	NA	NA
AWP32020.1|1103670_1103949_+	hypothetical protein	NA	NA	NA	NA	NA
AWP32021.1|1103941_1104661_+	hypothetical protein	NA	O03965	Myxococcus_phage	42.9	4.4e-40
AWP32022.1|1104660_1105179_+	hypothetical protein	NA	V5URG6	Shigella_phage	72.7	1.5e-66
AWP32023.1|1105171_1105510_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	62.2	2.2e-34
AWP32024.1|1105514_1105793_+	hypothetical protein	NA	NA	NA	NA	NA
AWP32025.1|1105834_1106038_+	hypothetical protein	NA	NA	NA	NA	NA
AWP32026.1|1106132_1106372_+	hypothetical protein	NA	NA	NA	NA	NA
AWP32027.1|1106441_1107014_+|terminase	terminase small subunit	terminase	G9L6B7	Escherichia_phage	56.1	2.6e-51
AWP32028.1|1107006_1108479_+|terminase	terminase	terminase	A0A193GYS2	Enterobacter_phage	77.7	7.7e-233
AWP32029.1|1108475_1108688_-	hypothetical protein	NA	NA	NA	NA	NA
AWP32030.1|1108776_1109133_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	64.2	8.0e-35
AWP32031.1|1109661_1109868_+	hypothetical protein	NA	G9L6C1	Escherichia_phage	89.7	2.8e-08
AWP32032.1|1109885_1111547_+|tail	phage tail protein	tail	T1S9Z7	Salmonella_phage	69.4	1.6e-218
AWP32033.1|1111543_1111846_+	hypothetical protein	NA	Q2A090	Sodalis_phage	59.5	2.0e-18
AWP32034.1|1111842_1112556_+	peptidase	NA	G9L6C4	Escherichia_phage	62.4	8.7e-49
AWP32035.1|1112567_1113554_+	hypothetical protein	NA	G9L6C5	Escherichia_phage	87.2	5.2e-169
AWP32036.1|1113607_1114045_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	71.7	4.1e-49
AWP32037.1|1114056_1114464_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	43.9	2.2e-20
AWP32038.1|1114513_1114840_+	hypothetical protein	NA	G9L6C8	Escherichia_phage	50.0	2.8e-18
AWP32039.1|1114839_1115445_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	61.7	3.2e-68
AWP32040.1|1115444_1117919_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	72.2	0.0e+00
AWP32041.1|1117918_1118398_+	hypothetical protein	NA	G9L6D1	Escherichia_phage	53.9	5.1e-45
AWP32042.1|1118382_1118961_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	49.0	3.2e-25
1118863:1118878	attR	GCATCCAGCGCCAGCA	NA	NA	NA	NA
AWP32043.1|1118973_1121484_+	hypothetical protein	NA	Q858G0	Salmonella_phage	54.0	1.1e-250
AWP32044.1|1121483_1123352_+	hypothetical protein	NA	Q858F9	Salmonella_phage	51.2	4.0e-162
AWP32045.1|1123351_1126117_+	hypothetical protein	NA	Q858F8	Salmonella_phage	75.4	0.0e+00
AWP32046.1|1126373_1126634_-	hypothetical protein	NA	T1SA06	Salmonella_phage	37.5	1.9e-09
AWP32047.1|1126759_1129408_+	hypothetical protein	NA	G9L6E4	Escherichia_phage	50.2	6.8e-62
AWP32048.1|1130696_1131149_-	hypothetical protein	NA	NA	NA	NA	NA
AWP32049.1|1131375_1131789_+	hypothetical protein	NA	G9L6E6	Escherichia_phage	41.5	5.6e-16
AWP32050.1|1131772_1132081_+|holin	holin	holin	A0A248XD85	Klebsiella_phage	42.2	2.4e-11
AWP32051.1|1132022_1132580_+	hypothetical protein	NA	A0A088FRS5	Escherichia_phage	54.4	5.6e-43
AWP32052.1|1132576_1133134_+	hypothetical protein	NA	A0A193GYI0	Enterobacter_phage	50.6	1.6e-29
AWP32053.1|1133548_1134322_+	hypothetical protein	NA	NA	NA	NA	NA
AWP32054.1|1134352_1134532_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AWP32055.1|1134726_1134972_+	hypothetical protein	NA	NA	NA	NA	NA
AWP32056.1|1134992_1135490_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	30.6	3.3e-10
>prophage 2
CP020820	Pantoea vagans strain FBS135 chromosome, complete genome	4023751	1210538	1315996	4023751	tRNA,head,capsid,lysis,portal,terminase,protease,integrase,tail	Enterobacteria_phage(22.73%)	117	1241172:1241196	1278594:1278618
AWP32124.1|1210538_1211954_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
AWP32125.1|1211989_1212343_-	hypothetical protein	NA	NA	NA	NA	NA
AWP32126.1|1212454_1213243_-	formate/nitrite transporter	NA	NA	NA	NA	NA
AWP32127.1|1214111_1215302_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
AWP32128.1|1215671_1216913_+	divalent metal cation transporter	NA	NA	NA	NA	NA
AWP32129.1|1216959_1217379_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWP32130.1|1217550_1218540_-	L-glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
AWP32131.1|1218759_1220412_+	indolepyruvate decarboxylase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	22.0	4.0e-12
AWP32132.1|1220572_1221538_+	glucokinase	NA	NA	NA	NA	NA
AWP32133.1|1221704_1222433_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AWP32134.1|1222429_1224100_-	sensor histidine kinase	NA	NA	NA	NA	NA
AWP32135.1|1224369_1224894_+	N-acetyltransferase	NA	NA	NA	NA	NA
AWP32136.1|1225011_1226244_+	alanine transaminase	NA	NA	NA	NA	NA
AWP32137.1|1226573_1227602_-	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AWP32138.1|1227604_1229203_-	EmrB/QacA family drug resistance transporter	NA	NA	NA	NA	NA
AWP32139.1|1229352_1230132_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AWP32140.1|1230145_1230598_+	universal stress protein	NA	NA	NA	NA	NA
AWP32141.1|1230607_1231414_+	hypothetical protein	NA	NA	NA	NA	NA
AWP32142.1|1231688_1231970_+	hypothetical protein	NA	NA	NA	NA	NA
AWP32143.1|1232482_1233358_+	gluconolactonase	NA	NA	NA	NA	NA
AWP32144.1|1233406_1234633_-	MFS transporter	NA	NA	NA	NA	NA
AWP32145.1|1234924_1235158_+	hypothetical protein	NA	NA	NA	NA	NA
AWP32146.1|1235194_1236094_-	EamA family transporter	NA	NA	NA	NA	NA
AWP32147.1|1236271_1237150_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWP32148.1|1237445_1237928_-	Hcp1 family type VI secretion system effector	NA	NA	NA	NA	NA
AWP32149.1|1238010_1238799_+	DUF4225 domain-containing protein	NA	NA	NA	NA	NA
AWP32150.1|1238800_1239148_-	hypothetical protein	NA	NA	NA	NA	NA
AWP32151.1|1239445_1240024_+	hypothetical protein	NA	NA	NA	NA	NA
AWP32152.1|1240257_1240476_-	hypothetical protein	NA	NA	NA	NA	NA
1241172:1241196	attL	TTATATCCATTTAACTAAGAGGACA	NA	NA	NA	NA
AWP32153.1|1241388_1242567_+|integrase	integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	82.7	1.3e-193
AWP32154.1|1242621_1243641_+	hypothetical protein	NA	NA	NA	NA	NA
AWP32155.1|1243757_1243952_-	hypothetical protein	NA	A0A2R2Z2X2	Escherichia_phage	61.4	6.5e-15
AWP32156.1|1244236_1244401_-	DUF1317 domain-containing protein	NA	NA	NA	NA	NA
AWP32157.1|1245078_1245723_-	DNA-binding protein	NA	A0A1I9KG86	Aeromonas_phage	40.7	2.5e-39
AWP32158.1|1245822_1246032_+	cell division protein	NA	NA	NA	NA	NA
AWP32159.1|1246060_1246609_+	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	61.5	8.2e-55
AWP32160.1|1246795_1246990_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	62.3	2.4e-09
AWP32161.1|1246967_1247861_+	transcriptional regulator	NA	H2DE83	Erwinia_phage	63.9	3.9e-38
AWP32162.1|1247874_1248309_+	hypothetical protein	NA	NA	NA	NA	NA
AWP32163.1|1248424_1249765_+	chromosome partitioning protein ParB	NA	A0A2H4J902	uncultured_Caudovirales_phage	70.0	7.3e-81
AWP32164.1|1250344_1251028_+	hypothetical protein	NA	NA	NA	NA	NA
AWP32165.1|1251024_1251792_+	hypothetical protein	NA	A0A1X9I669	Streptococcus_phage	35.0	4.1e-36
AWP32166.1|1251825_1252182_+	hypothetical protein	NA	NA	NA	NA	NA
AWP32167.1|1252178_1253201_+	hypothetical protein	NA	A0A1C9IHZ5	Salmonella_phage	52.4	3.3e-97
AWP32168.1|1253222_1253651_+	antitermination protein Q	NA	U5P0A5	Shigella_phage	69.2	3.9e-44
AWP32169.1|1253998_1254241_+|lysis	lysis protein	lysis	A0A2H4JCI1	uncultured_Caudovirales_phage	97.5	9.9e-37
AWP32170.1|1254244_1254754_+	lysozyme	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	90.5	2.0e-87
AWP32171.1|1254737_1255208_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	81.4	1.6e-62
AWP32172.1|1255210_1255456_+	hypothetical protein	NA	NA	NA	NA	NA
AWP32173.1|1255575_1255851_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	56.4	2.4e-15
AWP32174.1|1256013_1256697_+	hypothetical protein	NA	Q7Y4L7	Streptococcus_phage	53.6	1.4e-35
AWP32175.1|1256727_1257018_+	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	89.6	3.5e-49
AWP32176.1|1257030_1257240_+	serine acetyltransferase	NA	A0A220NRN5	Escherichia_phage	57.8	1.4e-07
AWP32177.1|1257420_1257855_+	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	90.3	1.9e-67
AWP32178.1|1257867_1259400_+|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	92.2	4.6e-273
AWP32179.1|1259401_1260679_+|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	92.9	1.5e-229
AWP32180.1|1260696_1261365_+|head,protease	prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	80.5	3.1e-96
AWP32181.1|1261376_1262543_+|capsid	phage major capsid protein	capsid	A0A286S1R4	Klebsiella_phage	92.5	2.0e-199
AWP32182.1|1262562_1262796_+	hypothetical protein	NA	NA	NA	NA	NA
AWP32183.1|1262761_1263088_+	hypothetical protein	NA	A0A286S294	Klebsiella_phage	67.6	4.6e-37
AWP32184.1|1263148_1263367_+	hypothetical protein	NA	NA	NA	NA	NA
AWP32185.1|1263369_1263702_+|head,tail	head-tail adaptor protein	head,tail	A0A286S2A2	Klebsiella_phage	73.6	8.2e-42
AWP34582.1|1263694_1264180_+	hypothetical protein	NA	A0A0U3TGT7	Pseudomonas_phage	60.0	4.5e-49
AWP32186.1|1264176_1264542_+	hypothetical protein	NA	K7PHI9	Enterobacteria_phage	73.6	4.2e-47
AWP32187.1|1264596_1265100_+|tail	phage tail protein	tail	Q9MCU9	Escherichia_phage	90.7	9.7e-79
AWP32188.1|1265143_1265629_+|tail	phage tail protein	tail	K7PJU9	Enterobacteria_phage	87.0	2.5e-55
AWP32189.1|1265826_1268301_+|tail	phage tail tape measure protein	tail	K7PM62	Enterobacteria_phage	55.5	9.3e-223
AWP32190.1|1268316_1268658_+|tail	phage tail protein	tail	E4WL34	Enterobacteria_phage	55.5	3.9e-31
AWP32191.1|1268710_1269448_+|tail	phage minor tail protein L	tail	M9NYX1	Enterobacteria_phage	80.4	6.8e-121
AWP32192.1|1269450_1270170_+	peptidase P60	NA	M9NZD8	Enterobacteria_phage	68.8	2.2e-100
AWP32193.1|1270162_1270786_+|tail	tail assembly protein	tail	K7PH59	Enterobacterial_phage	59.4	6.0e-62
AWP32194.1|1270842_1274052_+	host specificity protein	NA	E4WL39	Enterobacteria_phage	65.0	0.0e+00
AWP32195.1|1274051_1274354_+	hypothetical protein	NA	NA	NA	NA	NA
AWP32196.1|1274415_1275036_+	hypothetical protein	NA	K7PGX6	Enterobacteria_phage	37.4	1.6e-14
AWP32197.1|1275124_1275349_+	cor protein	NA	E4WL42	Enterobacteria_phage	48.7	1.4e-13
AWP32198.1|1276214_1276646_+|tail	phage tail protein	tail	A0A2P1JUG3	Erwinia_phage	39.5	2.1e-13
AWP32199.1|1276875_1277115_+	DNA polymerase V	NA	A0A2H4J1N5	uncultured_Caudovirales_phage	68.4	8.5e-25
AWP32200.1|1277116_1277443_+	phage repressor protein	NA	A0A2H4J4R6	uncultured_Caudovirales_phage	64.2	1.5e-35
AWP32201.1|1277544_1278051_-	hypothetical protein	NA	NA	NA	NA	NA
AWP32202.1|1278053_1278359_-	hypothetical protein	NA	NA	NA	NA	NA
AWP32203.1|1278856_1279792_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	77.2	2.6e-117
1278594:1278618	attR	TTATATCCATTTAACTAAGAGGACA	NA	NA	NA	NA
AWP32204.1|1280034_1280652_+	heme ABC exporter ATP-binding protein CcmA	NA	W5SAS9	Pithovirus	28.6	5.3e-10
AWP32205.1|1280651_1281311_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
AWP32206.1|1281378_1282119_+	heme ABC transporter permease	NA	NA	NA	NA	NA
AWP32207.1|1282115_1282349_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
AWP32208.1|1282345_1282831_+	cytochrome c biogenesis protein CcmE	NA	NA	NA	NA	NA
AWP32209.1|1282827_1284786_+	c-type cytochrome biogenesis protein CcmF	NA	NA	NA	NA	NA
AWP32210.1|1284782_1285340_+	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AWP34583.1|1285333_1285789_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
AWP32211.1|1285788_1287000_+	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
AWP32212.1|1287150_1287915_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AWP32213.1|1288232_1289516_-	long-chain fatty acid transporter	NA	NA	NA	NA	NA
AWP32214.1|1289874_1290171_+	hypothetical protein	NA	NA	NA	NA	NA
AWP32215.1|1290329_1291640_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AWP32216.1|1291639_1293736_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
AWP32217.1|1293960_1294443_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
AWP32218.1|1294472_1295021_-	endonuclease SmrB	NA	NA	NA	NA	NA
AWP32219.1|1295180_1296113_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AWP32220.1|1296158_1297244_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.2	5.3e-90
AWP32221.1|1297248_1298073_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AWP32222.1|1298081_1298885_+	hypothetical protein	NA	NA	NA	NA	NA
AWP32223.1|1298904_1299450_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AWP32224.1|1299482_1299767_+	hypothetical protein	NA	NA	NA	NA	NA
AWP32225.1|1299803_1301810_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AWP32226.1|1301964_1303185_+	beta-ketoacyl-[acyl-carrier-protein] synthase I	NA	NA	NA	NA	NA
AWP32227.1|1303263_1304688_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
AWP32228.1|1304775_1305219_+	rhodanese	NA	NA	NA	NA	NA
AWP32229.1|1305220_1306267_-	flagella biosynthesis regulator	NA	NA	NA	NA	NA
AWP32230.1|1306380_1307886_-	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
AWP32231.1|1307896_1308328_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
AWP34584.1|1308340_1309321_-	tricarboxylic transporter	NA	NA	NA	NA	NA
AWP32232.1|1309441_1310113_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AWP32233.1|1310103_1311492_+	histidine kinase	NA	NA	NA	NA	NA
AWP32234.1|1311472_1312372_-	EamA family transporter	NA	NA	NA	NA	NA
AWP32235.1|1312744_1313878_+	erythronate-4-phosphate dehydrogenase	NA	A0A285PXZ1	Cedratvirus	27.3	2.2e-17
AWP32236.1|1314182_1315190_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AWP32237.1|1315192_1315996_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 3
CP020820	Pantoea vagans strain FBS135 chromosome, complete genome	4023751	1794570	1849499	4023751	tRNA,lysis,terminase,tail,holin	uncultured_Caudovirales_phage(21.05%)	55	NA	NA
AWP34597.1|1794570_1796301_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L2F0	Tupanvirus	34.7	4.1e-92
AWP32623.1|1796919_1797510_+	VOC family protein	NA	NA	NA	NA	NA
AWP32624.1|1797506_1798652_-	aspartate aminotransferase	NA	NA	NA	NA	NA
AWP32625.1|1798737_1799490_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AWP32626.1|1799780_1800626_+	hypothetical protein	NA	NA	NA	NA	NA
AWP32627.1|1800656_1801754_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
AWP34598.1|1801891_1802515_+	LysE family translocator	NA	NA	NA	NA	NA
AWP32628.1|1802518_1803487_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AWP32629.1|1803483_1804212_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	NA	NA	NA	NA
AWP32630.1|1804293_1804689_-	hypothetical protein	NA	NA	NA	NA	NA
AWP32631.1|1804758_1805580_-	hypothetical protein	NA	Q859D1	Escherichia_coli_phage	70.9	2.7e-49
AWP32632.1|1805791_1807570_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	26.4	2.8e-11
AWP32633.1|1807569_1808001_+	NUDIX pyrophosphatase	NA	NA	NA	NA	NA
AWP32634.1|1808286_1809030_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AWP32635.1|1809064_1809592_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	32.4	3.8e-09
AWP32636.1|1809688_1810303_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AWP32637.1|1810311_1811316_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.9	1.8e-07
AWP32638.1|1811316_1812102_-	zinc ABC transporter permease	NA	NA	NA	NA	NA
AWP32639.1|1812098_1812854_-	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.5	5.7e-14
AWP32640.1|1812931_1813879_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWP32641.1|1813892_1815224_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	4.8e-16
AWP32642.1|1815349_1816324_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
AWP32643.1|1816449_1817682_-	multidrug transporter MdfA	NA	NA	NA	NA	NA
AWP32644.1|1817766_1819209_-	pyruvate kinase	NA	NA	NA	NA	NA
AWP34599.1|1819316_1820189_-	transcriptional regulator HexR	NA	NA	NA	NA	NA
AWP32645.1|1820558_1822034_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.1	9.2e-77
AWP32646.1|1822248_1822887_+	keto-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
AWP32647.1|1822921_1824100_-	phosphoribosylglycinamide formyltransferase 2	NA	NA	NA	NA	NA
AWP32648.1|1824265_1824922_+	DUF533 domain-containing protein	NA	NA	NA	NA	NA
AWP32649.1|1825047_1827111_+	oligopeptidase B	NA	NA	NA	NA	NA
AWP34600.1|1827104_1827773_-	exodeoxyribonuclease X	NA	NA	NA	NA	NA
AWP32650.1|1827772_1828006_-	DNA polymerase III subunit theta	NA	A0A077SLL5	Escherichia_phage	65.2	9.2e-16
AWP32651.1|1828156_1828534_+	hypothetical protein	NA	NA	NA	NA	NA
AWP32652.1|1828538_1829414_+	copper resistance protein CopD	NA	NA	NA	NA	NA
AWP32653.1|1829442_1829790_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AWP32654.1|1830098_1830398_-	hypothetical protein	NA	A0A2H4IYC8	uncultured_Caudovirales_phage	95.9	2.6e-47
AWP32655.1|1831041_1831284_+|lysis	lysis protein	lysis	A0A2H4JCI1	uncultured_Caudovirales_phage	100.0	4.0e-38
AWP32656.1|1831781_1832252_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	82.1	2.9e-61
AWP32657.1|1832288_1833194_-	hypothetical protein	NA	NA	NA	NA	NA
AWP32658.1|1833190_1833442_-	hypothetical protein	NA	NA	NA	NA	NA
AWP32659.1|1833456_1833903_+|terminase	terminase small subunit	terminase	A0A1W6JNT5	Morganella_phage	84.5	6.9e-68
AWP32660.1|1833994_1835212_+|terminase	terminase	terminase	A0A2H4J196	uncultured_Caudovirales_phage	98.8	4.1e-240
AWP32661.1|1836630_1836930_-	DUF1493 domain-containing protein	NA	NA	NA	NA	NA
AWP32662.1|1836923_1837382_-	hypothetical protein	NA	A0A218M4J4	Erwinia_phage	37.1	1.5e-17
AWP34601.1|1840299_1840473_-	hypothetical protein	NA	NA	NA	NA	NA
AWP32663.1|1840809_1841250_+	hypothetical protein	NA	NA	NA	NA	NA
AWP32664.1|1841303_1841630_-|tail	phage tail protein	tail	Q9MCR5	Enterobacteria_phage	40.2	1.9e-14
AWP32665.1|1842291_1842468_+	hypothetical protein	NA	NA	NA	NA	NA
AWP32666.1|1842894_1843134_-	hypothetical protein	NA	NA	NA	NA	NA
AWP32667.1|1843507_1844530_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	2.8e-24
AWP32668.1|1844956_1845142_-	hypothetical protein	NA	NA	NA	NA	NA
AWP32669.1|1845372_1846515_-	acyltransferase	NA	Q6QI96	Burkholderia_phage	31.6	8.0e-36
AWP32670.1|1846714_1847044_-	multidrug transporter subunit MdtI	NA	NA	NA	NA	NA
AWP32671.1|1847030_1847381_-	multidrug transporter subunit MdtJ	NA	NA	NA	NA	NA
AWP32672.1|1847816_1849499_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	7.1e-57
>prophage 4
CP020820	Pantoea vagans strain FBS135 chromosome, complete genome	4023751	2326939	2340788	4023751	tRNA	Pandoravirus(11.11%)	14	NA	NA
AWP33102.1|2326939_2327986_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	50.3	3.8e-85
AWP33103.1|2327993_2329445_-	SELO family protein	NA	NA	NA	NA	NA
AWP33104.1|2329524_2330271_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AWP33105.1|2330565_2331024_-	endopeptidase	NA	A0A217EQL1	Bacillus_phage	38.4	5.5e-12
AWP33106.1|2331092_2331842_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	W5SAS9	Pithovirus	26.1	1.8e-07
AWP33107.1|2331842_2332388_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	35.8	5.9e-13
AWP33108.1|2332437_2333421_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
AWP33109.1|2333599_2333902_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.3e-13
AWP33110.1|2333906_2336294_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	32.0	4.1e-10
AWP33111.1|2336308_2337292_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	37.6	2.9e-34
AWP33112.1|2337606_2337963_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AWP33113.1|2338007_2338205_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AWP33114.1|2338304_2338856_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	1.7e-15
AWP33115.1|2338859_2340788_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.8	6.3e-126
>prophage 5
CP020820	Pantoea vagans strain FBS135 chromosome, complete genome	4023751	3110361	3118087	4023751	tRNA	uncultured_Mediterranean_phage(50.0%)	9	NA	NA
AWP33796.1|3110361_3110832_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.3	5.4e-31
AWP33797.1|3110922_3112023_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase	NA	A0A1V0SE20	Indivirus	33.7	7.4e-47
AWP33798.1|3112026_3112476_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AWP33799.1|3112662_3113100_+	peptidoglycan-binding protein LysM	NA	G3MBQ1	Bacillus_virus	50.0	7.3e-06
AWP33800.1|3113116_3113695_+	hypothetical protein	NA	NA	NA	NA	NA
AWP33801.1|3113754_3114723_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	39.9	3.6e-45
AWP33802.1|3114733_3116581_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
AWP33803.1|3116606_3116939_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	37.4	5.7e-11
AWP33804.1|3116938_3118087_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.4	4.3e-90
>prophage 6
CP020820	Pantoea vagans strain FBS135 chromosome, complete genome	4023751	3176571	3185935	4023751		Streptococcus_phage(25.0%)	10	NA	NA
AWP33856.1|3176571_3176784_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	71.4	9.3e-23
AWP33857.1|3177161_3178916_-	amylovoran biosynthesis protein AmsF	NA	A0A1S6L3G8	Erwinia_phage	46.5	1.9e-153
AWP33858.1|3179119_3179413_-	hypothetical protein	NA	NA	NA	NA	NA
AWP33859.1|3179409_3179757_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	46.5	8.3e-21
AWP33860.1|3179753_3180221_-	lysozyme	NA	H9C148	Vibrio_phage	43.3	1.5e-25
AWP33861.1|3180423_3180702_-	hypothetical protein	NA	NA	NA	NA	NA
AWP33862.1|3181124_3181856_-	chromophore lyase	NA	A0A2I6PIE7	Escherichia_phage	37.5	5.4e-46
AWP33863.1|3182216_3183470_-	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	44.1	1.3e-92
AWP33864.1|3183480_3184584_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	1.0e-59
AWP33865.1|3184822_3185935_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.2	2.1e-110
>prophage 1
CP022518	Pantoea vagans strain FBS135 plasmid pPant2, complete sequence	196103	2405	56918	196103	transposase,integrase	Burkholderia_phage(17.65%)	48	20990:21006	52563:52579
AWP35193.1|2405_3552_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	90.7	6.4e-142
AWP35194.1|4106_6305_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	25.4	9.7e-06
AWP35195.1|6301_7618_-	ATP-binding protein	NA	NA	NA	NA	NA
AWP35196.1|7618_9934_-	ATPase	NA	NA	NA	NA	NA
AWP35197.1|10347_10557_-	hypothetical protein	NA	NA	NA	NA	NA
AWP35198.1|10540_12022_-	lysine transporter	NA	NA	NA	NA	NA
AWP35199.1|12130_12622_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWP35334.1|12742_13690_+	oxidoreductase	NA	NA	NA	NA	NA
AWP35200.1|14486_14900_-	glyoxalase	NA	NA	NA	NA	NA
AWP35201.1|14909_15626_+	transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	30.3	5.0e-12
AWP35202.1|15855_16329_-	hypothetical protein	NA	NA	NA	NA	NA
AWP35203.1|16441_17131_-	NYN domain-containing protein	NA	NA	NA	NA	NA
AWP35204.1|17740_18637_-	permease	NA	NA	NA	NA	NA
AWP35205.1|18690_19290_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWP35206.1|20639_20897_+	type II toxin-antitoxin system antitoxin, RelB/DinJ family	NA	NA	NA	NA	NA
AWP35207.1|20896_21172_+	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
20990:21006	attL	ACGCTGCTGGTCAAAGA	NA	NA	NA	NA
AWP35208.1|22097_22295_-	hypothetical protein	NA	NA	NA	NA	NA
AWP35209.1|22407_22944_-	hypothetical protein	NA	C7BGE8	Burkholderia_phage	33.3	4.0e-14
AWP35210.1|23014_23320_-	hypothetical protein	NA	NA	NA	NA	NA
AWP35211.1|23807_24599_+|integrase	integrase	integrase	I3WFA4	Macacine_betaherpesvirus	48.5	3.6e-19
AWP35212.1|24931_25588_+	chromosome partitioning protein ParA	NA	E5FFJ3	Burkholderia_phage	45.8	1.4e-45
AWP35213.1|25632_25902_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AWP35214.1|25997_26246_+	hypothetical protein	NA	NA	NA	NA	NA
AWP35335.1|26301_26493_+	hypothetical protein	NA	NA	NA	NA	NA
AWP35215.1|27888_29034_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.4	3.9e-22
AWP35216.1|29058_29886_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AWP35217.1|29878_30739_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AWP35218.1|30806_32075_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWP35219.1|32104_33118_-	oxidoreductase	NA	NA	NA	NA	NA
AWP35220.1|33451_34150_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
AWP35221.1|34146_35016_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
AWP35222.1|35027_35795_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWP35223.1|36153_37273_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.3	5.1e-43
AWP35224.1|37798_38821_+	alpha/beta hydrolase	NA	A0A2L2DMU8	Acanthamoeba_polyphaga_mimivirus	38.9	2.2e-61
AWP35225.1|41165_41888_-	hypothetical protein	NA	NA	NA	NA	NA
AWP35226.1|41880_42246_-	hypothetical protein	NA	NA	NA	NA	NA
AWP35227.1|43100_43970_+	hypothetical protein	NA	NA	NA	NA	NA
AWP35228.1|43986_44955_+	O-acetylhomoserine aminocarboxypropyltransferase	NA	A0A2I2L687	Orpheovirus	26.3	1.6e-08
AWP35229.1|44982_45679_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	48.9	4.7e-63
AWP35230.1|45651_45957_-	hypothetical protein	NA	NA	NA	NA	NA
AWP35231.1|46325_46529_+	hypothetical protein	NA	NA	NA	NA	NA
AWP35232.1|46914_47781_+	protein RepA	NA	Q71TL8	Escherichia_phage	72.7	8.2e-118
AWP35233.1|48992_50201_+	chromosome partitioning protein ParA	NA	Q1MVJ3	Enterobacteria_phage	74.8	1.3e-172
AWP35234.1|50197_51175_+	chromosome partitioning protein ParB	NA	Q1MVJ4	Enterobacteria_phage	56.2	2.6e-88
AWP35235.1|53134_54254_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.3	5.1e-43
52563:52579	attR	ACGCTGCTGGTCAAAGA	NA	NA	NA	NA
AWP35236.1|54574_55201_+	cobyrinic acid ac-diamide synthase	NA	E5FFJ3	Burkholderia_phage	30.1	1.3e-16
AWP35237.1|55197_55503_+	hypothetical protein	NA	NA	NA	NA	NA
AWP35238.1|56015_56918_+|transposase	IS5/IS1182 family transposase	transposase	Q1MVF0	Enterobacteria_phage	80.3	5.0e-142
>prophage 2
CP022518	Pantoea vagans strain FBS135 plasmid pPant2, complete sequence	196103	119032	172766	196103	coat,transposase	Stx2-converting_phage(27.27%)	46	NA	NA
AWP35278.1|119032_120108_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.9	8.0e-46
AWP35279.1|120154_120589_+	hypothetical protein	NA	NA	NA	NA	NA
AWP35280.1|120614_121442_-	RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AWP35281.1|121616_123176_+	PTS glucose transporter subunit IIB	NA	A0A2I7SAJ6	Vibrio_phage	44.9	3.9e-09
AWP35282.1|123172_123871_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
AWP35339.1|124499_124736_-	impB/mucB/samB family protein	NA	F1C5A5	Cronobacter_phage	67.1	8.4e-25
AWP35283.1|125799_126327_-	hypothetical protein	NA	NA	NA	NA	NA
AWP35284.1|126323_126635_-	transcriptional regulator	NA	NA	NA	NA	NA
AWP35285.1|126777_126900_-	impB/mucB/samB family protein	NA	I6RSM4	Salmonella_phage	82.4	3.0e-10
AWP35286.1|127297_128209_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWP35287.1|128196_128970_+	sulfate ABC transporter permease	NA	NA	NA	NA	NA
AWP35288.1|129166_130314_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	90.7	6.4e-142
AWP35289.1|131276_131747_+	hypothetical protein	NA	NA	NA	NA	NA
AWP35290.1|132720_133155_+	hypothetical protein	NA	NA	NA	NA	NA
AWP35291.1|133592_133853_+	hypothetical protein	NA	NA	NA	NA	NA
AWP35292.1|134118_134382_-	hypothetical protein	NA	NA	NA	NA	NA
AWP35293.1|134458_134722_+	hypothetical protein	NA	NA	NA	NA	NA
AWP35294.1|135050_135164_-	hypothetical protein	NA	NA	NA	NA	NA
AWP35295.1|135425_136457_+	recombinase Cre	NA	Q5XLQ5	Enterobacteria_phage	39.0	2.8e-64
AWP35296.1|136592_137366_+	nucleotidyltransferase	NA	NA	NA	NA	NA
AWP35297.1|138082_139202_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.3	5.1e-43
AWP35298.1|139580_140399_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWP35299.1|140369_141008_-	lysine transporter LysE	NA	NA	NA	NA	NA
AWP35300.1|144159_145485_-	nucleobase:cation symporter	NA	NA	NA	NA	NA
AWP35301.1|145541_146666_-	aryl sulfotransferase	NA	NA	NA	NA	NA
AWP35302.1|146869_147880_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	24.9	1.9e-09
AWP35303.1|149231_149963_-	peptidase	NA	NA	NA	NA	NA
AWP35304.1|150305_151601_-	D-amino-acid oxidase	NA	NA	NA	NA	NA
AWP35305.1|151617_152040_-	hypothetical protein	NA	NA	NA	NA	NA
AWP35306.1|152065_153205_-	ornithine cyclodeaminase	NA	NA	NA	NA	NA
AWP35307.1|153359_154196_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWP35308.1|154337_155726_+	amino acid permease	NA	NA	NA	NA	NA
AWP35309.1|157038_157587_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWP35310.1|157937_158801_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWP35311.1|160927_161275_-|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	70.4	1.5e-41
AWP35340.1|161271_161745_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	42.2	1.8e-18
AWP35312.1|162435_163062_-	hypothetical protein	NA	NA	NA	NA	NA
AWP35313.1|163646_163934_+	hypothetical protein	NA	NA	NA	NA	NA
AWP35341.1|164000_164894_+	DNA-binding protein	NA	NA	NA	NA	NA
AWP35314.1|165912_166380_+	N-acetyltransferase	NA	NA	NA	NA	NA
AWP35342.1|166650_167163_-	CpmK protein	NA	NA	NA	NA	NA
AWP35315.1|167192_167741_-	CpmJ protein	NA	NA	NA	NA	NA
AWP35316.1|167737_168601_-|coat	spore coat protein CotH	coat	NA	NA	NA	NA
AWP35317.1|170973_171636_-	hypothetical protein	NA	NA	NA	NA	NA
AWP35318.1|171685_172159_-	hypothetical protein	NA	NA	NA	NA	NA
AWP35319.1|172418_172766_+|transposase	transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	68.2	6.1e-40
