The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029741	Escherichia coli strain AR_0085 chromosome, complete genome	5213052	115272	200023	5213052	holin,portal,capsid,lysis,integrase,tail,transposase,terminase,head	Enterobacteria_phage(40.68%)	106	168944:168959	200561:200576
AWS61560.1|115272_116481_-|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	93.5	1.4e-208
AWS61561.1|117549_117678_-	antitermination protein	NA	NA	NA	NA	NA
AWS61562.1|117892_118690_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWS61563.1|118699_119251_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AWS61564.1|119419_119752_-	multidrug SMR transporter	NA	NA	NA	NA	NA
AWS61565.1|120085_120400_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
AWS61566.1|120614_122273_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
AWS61567.1|122265_123261_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
AWS61568.1|123253_123940_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
AWS61569.1|123939_125313_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
AWS61570.1|125331_125775_+	flagellar protein FliJ	NA	NA	NA	NA	NA
AWS61571.1|125771_126899_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
AWS61572.1|127003_127468_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
AWS61573.1|127472_128477_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
AWS61574.1|128473_128887_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
AWS61575.1|128889_129255_+	flagellar protein FliO	NA	NA	NA	NA	NA
AWS61576.1|129254_129992_+	flagellar biosynthetic protein FliP	NA	NA	NA	NA	NA
AWS61577.1|130001_130271_+	flagellar biosynthetic protein FliQ	NA	NA	NA	NA	NA
AWS61578.1|130279_131065_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
AWS61579.1|131354_131978_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AWS61580.1|132021_132264_-	hypothetical protein	NA	NA	NA	NA	NA
AWS61581.1|132372_132600_+	DUF2525 domain-containing protein	NA	NA	NA	NA	NA
AWS61582.1|132897_133716_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
AWS61583.1|133712_135407_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
AWS61584.1|135327_135516_-	hypothetical protein	NA	NA	NA	NA	NA
AWS61585.1|135577_135760_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AWS61586.1|135838_136756_-	hypothetical protein	NA	NA	NA	NA	NA
AWS61587.1|136928_137849_+	EamA family transporter	NA	NA	NA	NA	NA
AWS61588.1|138288_139707_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.3	1.8e-101
AWS61589.1|139773_140469_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
AWS61590.1|140508_140874_-	permease	NA	NA	NA	NA	NA
AWS61591.1|141440_142499_+	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	49.3	1.1e-92
AWS61592.1|142579_142930_+	hypothetical protein	NA	NA	NA	NA	NA
AWS61593.1|143090_143942_+	protein deglycase HchA	NA	NA	NA	NA	NA
AWS61594.1|144049_145408_-	HAMP domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	8.7e-05
AWS66222.1|145407_146079_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.6	3.1e-32
AWS61595.1|146211_146625_+	5-hydroxyisourate hydrolase	NA	NA	NA	NA	NA
AWS61596.1|146733_147738_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
AWS61597.1|147738_148374_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
AWS61598.1|148630_149281_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
AWS61599.1|149623_150154_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
AWS61600.1|150176_150419_+	hypothetical protein	NA	NA	NA	NA	NA
AWS61601.1|151146_151476_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
AWS61602.1|151544_151742_+	hypothetical protein	NA	NA	NA	NA	NA
AWS61603.1|151841_152417_-	DUF4376 domain-containing protein	NA	Q9MCI9	Enterobacteria_phage	59.7	2.9e-63
AWS61604.1|152432_154166_-	hypothetical protein	NA	Q9LA62	Enterobacterial_phage	79.1	2.9e-45
AWS61605.1|154215_154338_-	copper resistance protein	NA	NA	NA	NA	NA
AWS61606.1|154299_154977_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AWS61607.1|154976_155324_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AWS61608.1|155343_156915_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.9	5.8e-170
AWS61609.1|157215_157878_-	hypothetical protein	NA	NA	NA	NA	NA
AWS61610.1|157877_158138_-	hypothetical protein	NA	NA	NA	NA	NA
AWS66223.1|158137_159292_-	DUF1983 domain-containing protein	NA	A5LH43	Enterobacteria_phage	81.8	2.3e-30
AWS61611.1|161914_162562_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	90.7	3.5e-105
AWS61612.1|162459_163203_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	7.3e-147
AWS61613.1|163207_163906_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	96.1	2.9e-129
AWS61614.1|163905_164235_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	99.1	1.1e-57
AWS61615.1|164231_166811_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	96.9	0.0e+00
AWS61616.1|166803_167238_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AWS61617.1|167219_167642_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	88.6	3.3e-64
AWS66224.1|167655_168408_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	90.8	9.7e-123
AWS61618.1|168415_168811_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	95.4	7.9e-68
AWS61619.1|168807_169383_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	60.2	2.6e-51
168944:168959	attL	TGAATGGGAAGACGAT	NA	NA	NA	NA
AWS66225.1|169394_169748_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	94.7	3.3e-57
AWS61620.1|169743_170106_-	DNA packaging protein	NA	NA	NA	NA	NA
AWS61621.1|170157_171186_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.0	6.6e-114
AWS61622.1|171243_171591_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	1.5e-22
AWS61623.1|171627_173133_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	53.0	4.3e-98
AWS61624.1|173122_174715_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	1.3e-182
AWS61625.1|174711_174918_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
AWS61626.1|174901_176830_-|terminase	terminase	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	8.8e-261
AWS61627.1|176801_177311_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
AWS61628.1|177734_177929_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	93.8	3.7e-26
AWS66226.1|178147_178267_+	sugar kinase	NA	Q6QLL3	Human_immunodeficiency_virus	97.2	2.8e-13
AWS61629.1|178304_179285_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
AWS61630.1|179422_179872_-	hypothetical protein	NA	I6RSN8	Salmonella_phage	84.6	6.9e-68
AWS61631.1|179995_180862_-	hypothetical protein	NA	A0A2I6TCU3	Escherichia_phage	93.9	2.1e-97
AWS61632.1|181277_181571_+	increased serum survival lipoprotein Iss	NA	C6ZCX3	Enterobacteria_phage	91.8	1.6e-44
AWS61633.1|181602_182064_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	96.1	4.3e-73
AWS61634.1|182060_182594_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	96.0	5.3e-99
AWS61635.1|182718_182958_+	hypothetical protein	NA	NA	NA	NA	NA
AWS61636.1|182954_183266_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	53.4	3.1e-19
AWS61637.1|183269_183485_-|holin	holin	holin	M1FN85	Enterobacteria_phage	91.5	1.3e-32
AWS61638.1|183552_184605_-	site-specific DNA-methyltransferase	NA	K7PKK9	Enterobacteria_phage	95.7	3.0e-199
AWS61639.1|184755_184953_-	TrmB family transcriptional regulator	NA	Q9MC00	Enterobacteria_phage	96.9	2.0e-27
AWS61640.1|185179_186001_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.7	1.7e-80
AWS61641.1|185997_186372_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	65.5	1.4e-37
AWS61642.1|186384_187431_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.8	5.9e-110
AWS61643.1|187432_187705_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	6.1e-11
AWS61644.1|187897_188290_-	hypothetical protein	NA	NA	NA	NA	NA
AWS61645.1|188433_188646_-	type I toxin-antitoxin system hok family toxin	NA	A0A0U2QV81	Escherichia_phage	91.4	2.0e-25
AWS61646.1|188825_189491_-	hypothetical protein	NA	NA	NA	NA	NA
AWS66227.1|189666_190092_-	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	93.3	8.3e-63
AWS66228.1|190107_190878_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.0	6.7e-87
AWS61647.1|190910_191576_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	97.4	4.6e-84
AWS61648.1|192445_192871_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AWS61649.1|192854_193136_-	Cro/Cl family transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
AWS61650.1|193237_193657_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	4.0e-25
AWS66229.1|193923_194079_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
AWS61651.1|194038_194209_+	hypothetical protein	NA	NA	NA	NA	NA
AWS61652.1|194238_194457_+	hypothetical protein	NA	NA	NA	NA	NA
AWS61653.1|195044_195896_+	transcriptional regulator	NA	A0A0P0ZE80	Stx2-converting_phage	61.8	1.8e-64
AWS61654.1|195941_196163_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	89.0	2.1e-33
AWS61655.1|196282_198736_+	exonuclease	NA	V5UQJ3	Shigella_phage	60.6	3.3e-172
AWS61656.1|198794_198998_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AWS61657.1|198997_200023_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	58.2	1.2e-102
200561:200576	attR	TGAATGGGAAGACGAT	NA	NA	NA	NA
>prophage 2
CP029741	Escherichia coli strain AR_0085 chromosome, complete genome	5213052	352433	361874	5213052		Enterobacteria_phage(85.71%)	10	NA	NA
AWS61775.1|352433_353570_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	4.2e-162
AWS61776.1|353566_355567_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
AWS61777.1|355691_356153_+	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AWS61778.1|356192_356663_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
AWS61779.1|356709_357429_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AWS61780.1|357425_359111_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AWS61781.1|359332_360064_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AWS61782.1|360123_360231_+	hypothetical protein	NA	NA	NA	NA	NA
AWS61783.1|360211_360943_-	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AWS61784.1|360947_361874_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 3
CP029741	Escherichia coli strain AR_0085 chromosome, complete genome	5213052	563028	621856	5213052	portal,capsid,integrase,tail,tRNA,transposase,plate,terminase	Enterobacteria_phage(75.61%)	66	578209:578228	615915:615934
AWS61959.1|563028_563919_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	44.2	5.2e-67
AWS61960.1|564115_564889_-	histidine transport ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
AWS61961.1|564896_565613_-	histidine ABC transporter permease	NA	NA	NA	NA	NA
AWS61962.1|565609_566296_-	histidine ABC transporter permease	NA	NA	NA	NA	NA
AWS61963.1|566385_567168_-	histidine ABC transporter substrate-binding protein HisJ	NA	NA	NA	NA	NA
AWS61964.1|567388_568171_-	lysine/arginine/ornithine-binding periplasmic protein	NA	NA	NA	NA	NA
AWS61965.1|568436_569006_-	3-octaprenyl-4-hydroxybenzoate carboxy-lyase partner protein	NA	NA	NA	NA	NA
AWS61966.1|569100_570618_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
AWS61967.1|570654_571143_-	colicin V production protein	NA	NA	NA	NA	NA
AWS61968.1|571401_572064_-	protein DedD	NA	NA	NA	NA	NA
AWS61969.1|572053_573322_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AWS61970.1|573391_574306_-	acetyl-CoA carboxylase carboxyl transferase subunit beta	NA	NA	NA	NA	NA
AWS61971.1|574461_575121_-	protein DedA	NA	NA	NA	NA	NA
AWS61972.1|575203_576016_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AWS61973.1|576015_577029_-	USG-1 protein	NA	NA	NA	NA	NA
AWS61974.1|577094_578252_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	6.0e-23
578209:578228	attL	TTTTCATCAACAAGGATTTT	NA	NA	NA	NA
AWS61975.1|578410_579415_-|integrase	integrase	integrase	A0A0M4RTQ0	Salmonella_phage	56.0	1.5e-99
AWS66249.1|579511_580063_-	XRE family transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	43.2	4.1e-14
AWS61976.1|580211_580499_+	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	52.6	4.3e-23
AWS61977.1|580505_580712_+	hypothetical protein	NA	NA	NA	NA	NA
AWS61978.1|580964_581306_+	DUF4761 domain-containing protein	NA	A0A0A7NV42	Enterobacteria_phage	88.2	5.4e-49
AWS61979.1|581309_581564_+	hypothetical protein	NA	NA	NA	NA	NA
AWS61980.1|581584_581827_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.5e-37
AWS61981.1|582023_582227_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	88.1	1.0e-26
AWS61982.1|582223_582469_+	MarR family transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	98.8	3.3e-40
AWS61983.1|582465_582765_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	4.8e-41
AWS61984.1|582776_583394_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	46.7	5.3e-10
AWS61985.1|583390_583780_+	inositol monophosphatase	NA	NA	NA	NA	NA
AWS61986.1|583776_586617_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	87.6	0.0e+00
AWS61987.1|586693_587653_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	94.4	2.7e-170
AWS61988.1|587657_587969_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	1.6e-47
AWS66250.1|588347_589430_+	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	29.5	8.4e-19
AWS61989.1|589426_591631_+	peptidase S8	NA	NA	NA	NA	NA
AWS66251.1|591679_591868_-	hypothetical protein	NA	NA	NA	NA	NA
AWS61990.1|592083_593133_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	78.0	4.7e-160
AWS61991.1|593132_594875_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	72.2	2.0e-248
AWS61992.1|595026_595896_+|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	61.7	5.8e-87
AWS61993.1|595905_596967_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	65.0	3.1e-127
AWS61994.1|597016_597844_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	78.0	1.2e-97
AWS61995.1|597967_598462_+|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	65.2	2.4e-53
AWS61996.1|598461_598662_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	80.0	6.7e-23
AWS61997.1|598652_598946_+|tail	phage tail protein	tail	NA	NA	NA	NA
AWS61998.1|598932_599475_+	lysozyme	NA	A0A1S5Q8G1	Aeromonas_phage	39.3	8.4e-28
AWS61999.1|599471_599918_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	33.3	2.7e-08
AWS62000.1|600012_600495_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	58.7	2.5e-47
AWS62001.1|600475_601114_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	48.6	3.2e-50
AWS62002.1|601110_601692_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	73.6	2.5e-78
AWS62003.1|601688_602054_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	67.0	1.9e-39
AWS62004.1|602040_602937_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	72.1	1.4e-112
AWS62005.1|602929_603706_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	59.6	1.8e-55
AWS62006.1|603702_605490_+|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	51.7	1.8e-122
AWS62007.1|605486_605765_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	60.9	8.1e-27
AWS62008.1|605777_606071_+	hypothetical protein	NA	NA	NA	NA	NA
AWS62009.1|606905_607364_-	oxidoreductase	NA	A0A0A7NV65	Enterobacteria_phage	76.0	4.7e-64
AWS62010.1|611371_611530_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.8	8.7e-10
AWS62011.1|611535_611952_-|tail	phage tail protein	tail	B9A7B2	Serratia_phage	48.9	5.9e-13
AWS62012.1|611997_612513_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	65.3	6.3e-57
AWS62013.1|612513_613695_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	85.3	5.8e-191
AWS62014.1|613856_614990_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	72.3	2.6e-148
AWS62015.1|615040_615298_+	transcriptional regulator	NA	NA	NA	NA	NA
AWS62016.1|615514_615655_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
AWS62017.1|616035_617031_+	flagella biosynthesis regulator	NA	NA	NA	NA	NA
615915:615934	attR	TTTTCATCAACAAGGATTTT	NA	NA	NA	NA
AWS62018.1|617027_618206_-	MFS transporter	NA	NA	NA	NA	NA
AWS62019.1|618147_618369_+	hypothetical protein	NA	NA	NA	NA	NA
AWS62020.1|618470_619691_-	3-oxoacyl-ACP synthase I	NA	NA	NA	NA	NA
AWS62021.1|619849_621856_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
>prophage 4
CP029741	Escherichia coli strain AR_0085 chromosome, complete genome	5213052	788477	834265	5213052	holin,terminase,integrase,tail	Escherichia_phage(64.81%)	58	790316:790332	831151:831167
AWS62172.1|788477_788630_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
AWS62173.1|788647_788839_+	DUF2633 domain-containing protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
AWS62174.1|789151_789670_+	hypothetical protein	NA	G9L6F1	Escherichia_phage	100.0	1.3e-62
AWS62175.1|789685_790225_+	hypothetical protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
790316:790332	attL	AATCATTCCCACTCAAT	NA	NA	NA	NA
AWS62176.1|790419_790917_-	DUF2514 domain-containing protein	NA	A0A193GYU6	Enterobacter_phage	72.0	8.2e-54
AWS62177.1|790913_791543_-	endolysin	NA	G9L6E8	Escherichia_phage	97.1	4.0e-114
AWS62178.1|791532_791841_-|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	94.1	9.6e-45
AWS62179.1|791830_792232_-	hypothetical protein	NA	T1SA79	Salmonella_phage	91.0	3.3e-61
AWS62180.1|792647_795230_-	hypothetical protein	NA	G9L6E4	Escherichia_phage	67.1	1.7e-57
AWS62181.1|795426_795684_+	hypothetical protein	NA	G9L6E3	Escherichia_phage	98.8	4.9e-42
AWS62182.1|795865_795952_+	hypothetical protein	NA	NA	NA	NA	NA
AWS62183.1|795997_796690_+	BRO-like protein	NA	G9L6E2	Escherichia_phage	80.2	2.9e-97
AWS62184.1|796804_797014_+	hypothetical protein	NA	NA	NA	NA	NA
AWS62185.1|797016_797880_+	hypothetical protein	NA	I6PD67	Cronobacter_phage	35.2	2.1e-36
AWS62186.1|797972_798134_+	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
AWS62187.1|798207_799152_-	hypothetical protein	NA	G9L6D8	Escherichia_phage	94.6	4.4e-173
AWS62188.1|799224_799392_-	Arc family DNA binding domain-containing protein	NA	G9L6D7	Escherichia_phage	100.0	2.3e-24
AWS62189.1|799512_799944_+	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	100.0	1.6e-58
AWS62190.1|800034_800598_+	hypothetical protein	NA	G9L6D5	Escherichia_phage	98.9	3.6e-98
AWS62191.1|800609_803624_-	hypothetical protein	NA	G9L6D4	Escherichia_phage	99.4	0.0e+00
AWS62192.1|803623_806341_-	lytic transglycosylase	NA	G9L6D3	Escherichia_phage	99.1	0.0e+00
AWS62193.1|806340_806916_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	95.3	7.0e-81
AWS62194.1|806915_807380_-	hypothetical protein	NA	G9L6D1	Escherichia_phage	99.4	4.2e-84
AWS62195.1|807379_809851_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	98.9	0.0e+00
AWS62196.1|809850_810456_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	99.5	1.1e-111
AWS62197.1|810512_810848_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	100.0	7.7e-56
AWS62198.1|810858_811296_-	hypothetical protein	NA	G9L6C6	Escherichia_phage	97.9	6.9e-73
AWS62199.1|811347_812334_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	99.1	7.3e-187
AWS62200.1|812348_813044_-	peptidase	NA	G9L6C4	Escherichia_phage	99.1	3.9e-94
AWS62201.1|813046_813343_-	hypothetical protein	NA	G9L6C3	Escherichia_phage	99.0	3.7e-46
AWS62202.1|813339_815019_-|tail	phage tail protein	tail	G9L6C2	Escherichia_phage	99.5	3.6e-303
AWS62203.1|815033_815240_-	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
AWS62204.1|815942_816365_+	hypothetical protein	NA	NA	NA	NA	NA
AWS62205.1|816408_817884_-|terminase	terminase	terminase	A0A0F6TK57	Escherichia_coli_O157_typing_phage	99.2	2.2e-296
AWS62206.1|817880_818555_-|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	99.6	3.4e-119
AWS62207.1|818595_818934_-	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	94.6	4.3e-54
AWS62208.1|818926_819208_-	ASCH domain-containing protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	97.8	2.6e-49
AWS62209.1|819207_819468_-	eaa protein	NA	A0A077SLR0	Escherichia_phage	97.7	2.1e-40
AWS62210.1|819464_820154_-	hypothetical protein	NA	A0A077SK54	Escherichia_phage	46.5	1.1e-51
AWS62211.1|820308_820818_-	hypothetical protein	NA	A0A2D1GLY5	Escherichia_phage	74.3	1.5e-63
AWS62212.1|820814_821348_-	hypothetical protein	NA	G9L6B1	Escherichia_phage	65.5	4.1e-43
AWS62213.1|821409_821754_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	97.4	4.1e-60
AWS62214.1|821871_822657_-	replication protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	99.2	6.1e-152
AWS62215.1|822653_823445_-	primosomal protein	NA	Q286X4	Escherichia_phage	90.9	8.3e-117
AWS62216.1|823460_823661_-	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	98.5	6.0e-32
AWS62217.1|823811_824042_-	hypothetical protein	NA	G9L6A7	Escherichia_phage	98.7	1.0e-38
AWS62218.1|824196_824781_+	XRE family transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
AWS62219.1|825091_826126_+	hypothetical protein	NA	A0A1B0VN89	Pseudomonas_phage	48.2	7.2e-36
AWS62220.1|826133_826433_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	97.0	3.8e-46
AWS62221.1|826429_827251_+	exodeoxyribonuclease VIII	NA	G9L6A3	Escherichia_phage	97.8	2.6e-161
AWS62222.1|827247_828165_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	49.7	1.2e-69
AWS62223.1|828214_828463_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
AWS66256.1|828620_828872_+	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	98.8	5.2e-41
AWS62224.1|828864_829515_+	adenine methylase	NA	A0A2R9YJG0	Escherichia_phage	97.7	3.6e-126
AWS62225.1|829511_829706_+	DUF1382 domain-containing protein	NA	A0A0F6R7M7	Escherichia_coli_O157_typing_phage	100.0	3.3e-27
AWS62226.1|829709_830960_-|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.3	8.0e-239
AWS62227.1|831152_832730_-	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
831151:831167	attR	AATCATTCCCACTCAAT	NA	NA	NA	NA
AWS62228.1|832798_834265_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
>prophage 5
CP029741	Escherichia coli strain AR_0085 chromosome, complete genome	5213052	1029626	1043392	5213052	transposase	Escherichia_phage(50.0%)	12	NA	NA
AWS62404.1|1029626_1032188_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	4.6e-31
AWS62405.1|1032293_1032950_+	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
AWS62406.1|1033000_1033768_-	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
AWS62407.1|1033963_1034872_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AWS62408.1|1034868_1036131_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
AWS62409.1|1036127_1036766_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AWS62410.1|1036770_1037547_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AWS62411.1|1037635_1039000_+	permease	NA	NA	NA	NA	NA
AWS62412.1|1039093_1039972_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	5.4e-32
AWS62413.1|1040044_1041253_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
AWS62414.1|1041486_1042626_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
AWS62415.1|1042765_1043392_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
>prophage 6
CP029741	Escherichia coli strain AR_0085 chromosome, complete genome	5213052	1271827	1314405	5213052	transposase,integrase,tRNA	Ralstonia_phage(15.38%)	48	1303255:1303270	1306320:1306335
AWS62614.1|1271827_1272547_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AWS62615.1|1272616_1272754_+	adenine glycosylase	NA	NA	NA	NA	NA
AWS62616.1|1272707_1273760_+	adenine DNA glycosylase	NA	NA	NA	NA	NA
AWS62617.1|1273787_1274063_+	Fe(2+)-trafficking protein	NA	NA	NA	NA	NA
AWS62618.1|1274127_1275207_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
AWS62619.1|1275408_1276665_+	nucleoside permease NupG	NA	NA	NA	NA	NA
AWS62620.1|1276710_1278846_-	ornithine decarboxylase	NA	NA	NA	NA	NA
AWS62621.1|1278925_1279129_-	hypothetical protein	NA	NA	NA	NA	NA
AWS62622.1|1279243_1279951_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
AWS62623.1|1280328_1281318_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AWS66271.1|1281371_1282973_-	helicase	NA	NA	NA	NA	NA
AWS62624.1|1282986_1284495_-	ATP-dependent helicase	NA	A0A2D1GN12	Pseudoalteromonas_phage	31.3	2.6e-42
AWS62625.1|1285021_1285240_+	DUF1187 domain-containing protein	NA	NA	NA	NA	NA
AWS66272.1|1285577_1286018_+	pilus assembly protein PilL	NA	NA	NA	NA	NA
AWS62626.1|1286020_1286458_+	protein PilM	NA	NA	NA	NA	NA
AWS62627.1|1286647_1288273_+	PilN family type IVB pilus formation outer membrane protein	NA	NA	NA	NA	NA
AWS62628.1|1288296_1289592_+	pilus assembly protein	NA	NA	NA	NA	NA
AWS62629.1|1289581_1290043_+	type IV pilus biogenesis protein PilP	NA	NA	NA	NA	NA
AWS62630.1|1290052_1291573_+	type II secretion protein E	NA	NA	NA	NA	NA
AWS62631.1|1291574_1292675_+	type II secretion protein F	NA	NA	NA	NA	NA
AWS62632.1|1292724_1293261_+	prepilin-type cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
AWS62633.1|1293319_1293796_+	lytic transglycosylase	NA	A0A0A8J856	Ralstonia_phage	37.0	1.7e-08
AWS62634.1|1293808_1294459_+	prepilin peptidase	NA	NA	NA	NA	NA
AWS62635.1|1294455_1295670_+	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	NA	NA	NA	NA
AWS66273.1|1295718_1296162_-	prepilin, shufflon protein A	NA	NA	NA	NA	NA
AWS66274.1|1296358_1296664_-	pilus assembly protein PilV	NA	NA	NA	NA	NA
AWS66275.1|1296932_1297124_-	pilus assembly protein PilV	NA	NA	NA	NA	NA
AWS62636.1|1297220_1298345_+|integrase	site-specific integrase	integrase	A0A1L7DQ84	Ralstonia_phage	38.8	9.9e-39
AWS62637.1|1298557_1299379_+	conjugal transfer protein TraE	NA	NA	NA	NA	NA
AWS62638.1|1299480_1300683_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
AWS62639.1|1300753_1300963_+	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	78.0	1.3e-13
AWS62640.1|1301120_1301402_+	hypothetical protein	NA	NA	NA	NA	NA
AWS66276.1|1302485_1302572_+	ABC transporter	NA	NA	NA	NA	NA
AWS62641.1|1302597_1303590_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	3.2e-182
1303255:1303270	attL	GAGCAGGTGGCGGAAA	NA	NA	NA	NA
AWS62642.1|1303994_1304234_+	DUF1819 domain-containing protein	NA	NA	NA	NA	NA
AWS62643.1|1304421_1304748_-|integrase	integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	52.0	2.1e-18
AWS62644.1|1304862_1305399_-|integrase	class 2 integron integrase IntI2	integrase	A0A1P8DJJ6	Virus_Rctr41k	34.4	6.9e-14
AWS62645.1|1305730_1306204_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	34.4	1.6e-19
AWS62646.1|1306298_1306823_+	streptothricin N-acetyltransferase Sat2	NA	E4ZFP7	Streptococcus_phage	38.9	4.2e-16
1306320:1306335	attR	GAGCAGGTGGCGGAAA	NA	NA	NA	NA
AWS62647.1|1306880_1307669_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AWS62648.1|1307744_1308242_+	hypothetical protein	NA	NA	NA	NA	NA
AWS62649.1|1308302_1308674_+	hypothetical protein	NA	NA	NA	NA	NA
AWS62650.1|1308706_1308997_+	hypothetical protein	NA	NA	NA	NA	NA
AWS62651.1|1308987_1310196_-|transposase	IS256-like element IS1414 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	9.6e-48
AWS62652.1|1310406_1310784_+	hypothetical protein	NA	NA	NA	NA	NA
AWS62653.1|1311994_1312414_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	95.9	2.2e-47
AWS62654.1|1312410_1312761_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	3.6e-40
AWS62655.1|1312791_1314405_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	62.4	1.1e-176
>prophage 7
CP029741	Escherichia coli strain AR_0085 chromosome, complete genome	5213052	2119275	2174809	5213052	transposase,holin,integrase,tRNA	Stx2-converting_phage(24.14%)	47	2112962:2112976	2176387:2176401
2112962:2112976	attL	CATGATTTATTTCCT	NA	NA	NA	NA
AWS63402.1|2119275_2120535_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	78.1	3.0e-193
AWS63403.1|2120630_2121596_+	hypothetical protein	NA	A0A1W6JPD1	Morganella_phage	51.2	3.0e-07
AWS63404.1|2121710_2121914_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AWS63405.1|2121913_2122345_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	48.6	1.1e-27
AWS63406.1|2122357_2123191_+	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	46.7	1.2e-20
AWS63407.1|2123183_2123366_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AWS63408.1|2123359_2124388_+	ash family protein	NA	NA	NA	NA	NA
AWS63409.1|2124380_2124575_+	hypothetical protein	NA	NA	NA	NA	NA
AWS63410.1|2124571_2124835_+|holin	nicotinic acetylcholine receptor subunit beta	holin	NA	NA	NA	NA
AWS63411.1|2124831_2125053_+	hypothetical protein	NA	NA	NA	NA	NA
AWS63412.1|2125045_2125648_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	36.3	5.7e-25
AWS63413.1|2125658_2126000_+	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	61.5	2.5e-33
AWS63414.1|2125992_2126364_+	hypothetical protein	NA	NA	NA	NA	NA
AWS63415.1|2126350_2129107_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.0	3.4e-298
AWS63416.1|2129173_2129425_+	hypothetical protein	NA	NA	NA	NA	NA
AWS63417.1|2129869_2130331_+	DUF2824 domain-containing protein	NA	Q2A0B3	Sodalis_phage	72.2	2.9e-61
AWS63418.1|2130324_2131002_+	DNA transfer protein	NA	Q2A0B2	Sodalis_phage	71.6	7.0e-56
AWS63419.1|2131001_2132321_+	DNA transfer protein p33	NA	B6SCW4	Bacteriophage	43.2	1.2e-35
AWS63420.1|2132317_2135038_+	lytic transglycosylase domain-containing protein	NA	A5VW64	Enterobacteria_phage	60.9	7.5e-149
AWS63421.1|2135188_2135887_+	hypothetical protein	NA	NA	NA	NA	NA
AWS63422.1|2136782_2137745_+	abortive phage infection protein	NA	A0A059NT88	Lactococcus_phage	29.4	4.2e-14
AWS63423.1|2137746_2138202_-	hypothetical protein	NA	A0A1W6JPI4	Morganella_phage	67.2	2.9e-45
AWS63424.1|2138461_2138749_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AWS63425.1|2139494_2140319_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	76.6	2.4e-90
AWS63426.1|2140608_2141226_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
AWS63427.1|2141222_2142905_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.1	1.5e-22
AWS63428.1|2143162_2143786_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
AWS63429.1|2143840_2144116_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AWS63430.1|2144134_2146243_+	bifunctional (p)ppGpp synthetase II/ guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
AWS63431.1|2146249_2146939_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
AWS63432.1|2146944_2149026_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
AWS63433.1|2149194_2150400_-	sodium/glutamate symport carrier protein	NA	NA	NA	NA	NA
AWS63434.1|2150679_2152071_+	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
AWS63435.1|2152191_2153901_+	AsmA family protein	NA	NA	NA	NA	NA
AWS63436.1|2154019_2156272_-	alpha-xylosidase	NA	NA	NA	NA	NA
AWS63437.1|2158349_2159534_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	69.7	1.7e-161
AWS63438.1|2160760_2161969_+|transposase	IS256-like element IS1414 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	7.4e-48
AWS63439.1|2162049_2165547_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	34.8	2.7e-98
AWS63440.1|2167759_2168185_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
AWS63441.1|2168181_2168532_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	1.2e-40
AWS63442.1|2168562_2170155_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.2	1.3e-180
AWS63443.1|2170250_2170598_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	4.8e-61
AWS66306.1|2170594_2170975_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
AWS63444.1|2172097_2172232_-	copper resistance protein	NA	NA	NA	NA	NA
AWS63445.1|2172193_2172871_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AWS63446.1|2172870_2173218_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AWS63447.1|2173237_2174809_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.9	5.8e-170
2176387:2176401	attR	CATGATTTATTTCCT	NA	NA	NA	NA
>prophage 8
CP029741	Escherichia coli strain AR_0085 chromosome, complete genome	5213052	2637510	2694484	5213052	lysis,integrase,tail,tRNA,terminase	Enterobacteria_phage(56.6%)	71	2685702:2685716	2698426:2698440
AWS63839.1|2637510_2637633_+|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
AWS66330.1|2637895_2638441_+	DUF4065 domain-containing protein	NA	NA	NA	NA	NA
AWS63840.1|2638437_2638857_+	hypothetical protein	NA	NA	NA	NA	NA
AWS63841.1|2639117_2639399_-	pyocin activator protein PrtN	NA	K7PGU0	Enterobacteria_phage	96.8	2.8e-43
AWS63842.1|2639435_2640008_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	100.0	2.4e-110
AWS63843.1|2640007_2640820_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	47.1	2.7e-54
AWS63844.1|2640829_2641018_-	hypothetical protein	NA	NA	NA	NA	NA
AWS63845.1|2641014_2641497_-	dTDP-6-deoxy-D-glucose-3,5-epimerase	NA	Q08J60	Stx2-converting_phage	63.0	1.7e-35
AWS63846.1|2641496_2641859_-	hypothetical protein	NA	K7PH61	Enterobacteria_phage	97.4	1.7e-64
AWS63847.1|2641849_2642386_-	HD family hydrolase	NA	A5LH62	Enterobacteria_phage	99.4	2.8e-100
AWS63848.1|2642513_2643338_-	DUF2303 domain-containing protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
AWS63849.1|2643403_2643766_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
AWS63850.1|2643963_2644218_+	hypothetical protein	NA	U5P0J5	Shigella_phage	94.0	3.1e-41
AWS63851.1|2644227_2644731_+	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	47.6	1.2e-31
AWS63852.1|2645098_2645725_-	helix-turn-helix domain-containing protein	NA	K7PM82	Enterobacteria_phage	48.8	3.2e-47
AWS63853.1|2645822_2646023_+	cell division protein	NA	NA	NA	NA	NA
AWS66331.1|2646060_2646645_+	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	60.9	5.5e-57
AWS63854.1|2646820_2647033_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	5.4e-15
AWS63855.1|2646989_2647982_+	hypothetical protein	NA	U5P0A0	Shigella_phage	98.2	9.5e-94
AWS63856.1|2647978_2648473_+	hypothetical protein	NA	U5P0U0	Shigella_phage	97.6	1.9e-87
AWS63857.1|2648439_2648799_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	1.5e-52
AWS63858.1|2648795_2649185_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	99.2	3.5e-68
AWS63859.1|2649204_2650014_+	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	99.6	1.8e-151
AWS63860.1|2650021_2651011_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	4.3e-195
AWS63861.1|2651024_2651777_+	antitermination protein	NA	A0A291AWZ5	Escherichia_phage	100.0	1.3e-138
AWS63862.1|2652057_2652483_+	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	100.0	3.6e-74
AWS63863.1|2652706_2652910_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	97.0	3.0e-31
AWS63864.1|2653060_2654113_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.7	8.0e-208
AWS63865.1|2654179_2654395_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AWS63866.1|2654394_2654892_+	lysozyme	NA	A5LH83	Enterobacteria_phage	100.0	1.3e-91
AWS63867.1|2654888_2655356_+|lysis	lysis protein	lysis	A5LH84	Enterobacteria_phage	100.0	1.6e-75
AWS63868.1|2655377_2655740_+	DNA-binding protein	NA	A5LH85	Enterobacteria_phage	99.2	8.9e-66
AWS63869.1|2656191_2656731_+	DUF1441 domain-containing protein	NA	A5LH26	Enterobacteria_phage	98.9	4.4e-93
AWS63870.1|2656739_2658839_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	98.7	0.0e+00
AWS63871.1|2658835_2659048_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
AWS63872.1|2660404_2662528_+	peptidase S14	NA	A5LH30	Enterobacteria_phage	99.7	0.0e+00
AWS63873.1|2662569_2662938_+	DUF2190 domain-containing protein	NA	K7PLV6	Enterobacteria_phage	100.0	9.7e-52
AWS63874.1|2662930_2663206_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
AWS63875.1|2663217_2663808_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.1	7.2e-81
AWS63876.1|2663804_2664206_+|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	99.2	2.4e-72
AWS63877.1|2664216_2664960_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	99.6	1.0e-132
AWS66332.1|2665020_2665407_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
AWS63878.1|2665415_2665745_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
AWS63879.1|2665716_2668782_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.4	0.0e+00
AWS63880.1|2668781_2669111_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
AWS63881.1|2669120_2669819_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	5.6e-133
AWS63882.1|2669824_2670568_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	99.2	5.7e-152
AWS63883.1|2670465_2671113_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	4.3e-111
AWS63884.1|2671172_2674652_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.5	0.0e+00
AWS63885.1|2674719_2675319_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	90.5	7.0e-100
AWS63886.1|2675383_2677741_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	50.1	1.7e-117
AWS63887.1|2677740_2678010_+	hypothetical protein	NA	NA	NA	NA	NA
AWS63888.1|2678022_2679063_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.3	9.3e-124
AWS66333.1|2679105_2679393_+	hypothetical protein	NA	NA	NA	NA	NA
AWS63889.1|2679510_2679759_-	damage-inducible protein DinI	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
AWS63890.1|2679820_2680918_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.2	6.2e-211
AWS63891.1|2681006_2682044_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AWS63892.1|2682177_2682420_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
AWS63893.1|2682585_2683569_-	quinone oxidoreductase	NA	NA	NA	NA	NA
AWS63894.1|2683651_2685067_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
AWS63895.1|2685119_2686199_+	alanine racemase biosynthetic	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
2685702:2685716	attL	GGTGGCATTCTGCTG	NA	NA	NA	NA
AWS63896.1|2686451_2687645_+	aromatic amino acid transaminase	NA	NA	NA	NA	NA
AWS63897.1|2688146_2688350_-	hypothetical protein	NA	NA	NA	NA	NA
AWS63898.1|2688751_2689465_+	class B acid phosphatase	NA	NA	NA	NA	NA
AWS63899.1|2689575_2689992_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
AWS63900.1|2689995_2690352_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
AWS63901.1|2690386_2693209_-	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
AWS63902.1|2693159_2693342_+	hypothetical protein	NA	NA	NA	NA	NA
AWS63903.1|2693462_2693999_+	ssDNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
AWS63904.1|2694097_2694379_-	hypothetical protein	NA	NA	NA	NA	NA
AWS63905.1|2694337_2694484_+|integrase	integrase	integrase	NA	NA	NA	NA
2698426:2698440	attR	GGTGGCATTCTGCTG	NA	NA	NA	NA
>prophage 9
CP029741	Escherichia coli strain AR_0085 chromosome, complete genome	5213052	2947221	2956618	5213052	transposase	Stx2-converting_phage(83.33%)	7	NA	NA
AWS64118.1|2947221_2951097_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA54	Enterobacteria_phage	32.2	9.3e-169
AWS64119.1|2951816_2953388_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.9	5.8e-170
AWS64120.1|2953407_2953755_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AWS64121.1|2953754_2954432_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AWS64122.1|2954393_2954627_+	hypothetical protein	NA	NA	NA	NA	NA
AWS64123.1|2954623_2954974_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
AWS64124.1|2955004_2956618_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.4	3.0e-182
>prophage 10
CP029741	Escherichia coli strain AR_0085 chromosome, complete genome	5213052	3003060	3066785	5213052	transposase,tRNA,protease	Vibrio_phage(15.38%)	56	NA	NA
AWS64172.1|3003060_3004065_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
AWS64173.1|3004067_3005327_-|protease	protease modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
AWS64174.1|3005412_3006693_-	GTPase HflX	NA	NA	NA	NA	NA
AWS64175.1|3006768_3007077_-	RNA-binding protein Hfq	NA	NA	NA	NA	NA
AWS64176.1|3007162_3008113_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AWS64177.1|3008105_3009953_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	2.6e-60
AWS64178.1|3009962_3011300_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
AWS64179.1|3011318_3011780_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
AWS64180.1|3011751_3013299_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
AWS64181.1|3013297_3014437_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
AWS66356.1|3014419_3014473_-	hypothetical protein	NA	NA	NA	NA	NA
AWS64182.1|3015215_3015761_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
AWS64183.1|3015855_3016908_+	ribosome small subunit-dependent GTPase	NA	NA	NA	NA	NA
AWS64184.1|3017004_3017973_+	phosphatidylserine decarboxylase proenzyme	NA	NA	NA	NA	NA
AWS64185.1|3017994_3021318_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
AWS64186.1|3021467_3022970_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
AWS64187.1|3023188_3024166_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	1.2e-27
AWS64188.1|3024490_3026299_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
AWS64189.1|3026291_3027026_+	fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
AWS64190.1|3027036_3027432_+	fumarate reductase subunit C	NA	NA	NA	NA	NA
AWS64191.1|3027442_3027802_+	fumarate reductase subunit D	NA	NA	NA	NA	NA
AWS64192.1|3027864_3028998_+	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
AWS64193.1|3029086_3029620_+	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
AWS64194.1|3029616_3029934_-	quaternary ammonium compound-resistance protein SugE	NA	NA	NA	NA	NA
AWS64195.1|3030108_3030255_-	entericidin B	NA	NA	NA	NA	NA
AWS64196.1|3030365_3030491_-	entericidin A	NA	NA	NA	NA	NA
AWS64197.1|3030542_3031109_-	elongation factor P	NA	NA	NA	NA	NA
AWS64198.1|3031150_3032179_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
AWS64199.1|3032573_3033443_+	hypothetical protein	NA	NA	NA	NA	NA
AWS64200.1|3033635_3033989_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
AWS64201.1|3034126_3035773_-	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
AWS64202.1|3035816_3036110_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
AWS66357.1|3036385_3037642_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
AWS64203.1|3037657_3038134_-	membrane protein FxsA	NA	NA	NA	NA	NA
AWS64204.1|3038470_3039907_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
AWS64205.1|3040024_3041326_+	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
AWS64206.1|3041441_3041780_+	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
AWS64207.1|3041755_3043453_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
AWS64208.1|3043489_3044065_+	transcriptional regulator	NA	NA	NA	NA	NA
AWS66358.1|3044444_3045707_+	DUF4102 domain-containing protein	NA	A0A1B0VMI6	Pseudomonas_phage	42.6	8.4e-79
AWS64209.1|3045806_3045998_-	hypothetical protein	NA	NA	NA	NA	NA
AWS64210.1|3045972_3047246_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	1.2e-170
AWS64211.1|3047494_3051010_+	DNA helicase	NA	NA	NA	NA	NA
AWS64212.1|3051118_3052618_-	DUF1705 domain-containing protein	NA	NA	NA	NA	NA
AWS64213.1|3052831_3054040_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
AWS64214.1|3054556_3055876_-	gluconate permease	NA	NA	NA	NA	NA
AWS64215.1|3055938_3056703_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
AWS64216.1|3056726_3057758_-	L-idonate 5-dehydrogenase	NA	NA	NA	NA	NA
AWS64217.1|3057974_3058538_+	thermosensitive gluconokinase	NA	NA	NA	NA	NA
AWS64218.1|3058541_3059561_-	aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.4e-44
AWS64219.1|3059878_3060073_+	hypothetical protein	NA	NA	NA	NA	NA
AWS64220.1|3060978_3062187_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
AWS64221.1|3064141_3064372_-	hypothetical protein	NA	NA	NA	NA	NA
AWS64222.1|3064387_3064582_+	hypothetical protein	NA	NA	NA	NA	NA
AWS64223.1|3065285_3065429_+	hypothetical protein	NA	NA	NA	NA	NA
AWS64224.1|3065456_3066785_-|transposase	IS4 family transposase IS4	transposase	NA	NA	NA	NA
>prophage 11
CP029741	Escherichia coli strain AR_0085 chromosome, complete genome	5213052	3788196	3869993	5213052	capsid,lysis,integrase,tail,tRNA,transposase,terminase,protease,head	Enterobacteria_phage(48.48%)	95	3818714:3818760	3836414:3836460
AWS64866.1|3788196_3789426_+|integrase	integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	1.3e-132
AWS64867.1|3789800_3789989_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	4.5e-13
AWS64868.1|3790041_3791142_+	icd-like protein	NA	NA	NA	NA	NA
AWS64869.1|3791134_3791503_+	hypothetical protein	NA	NA	NA	NA	NA
AWS64870.1|3791492_3791945_+	hypothetical protein	NA	NA	NA	NA	NA
AWS64871.1|3791946_3792180_+	hypothetical protein	NA	NA	NA	NA	NA
AWS64872.1|3792185_3792485_+	hypothetical protein	NA	NA	NA	NA	NA
AWS64873.1|3792481_3793888_+	DNA primase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	55.6	5.6e-108
AWS66386.1|3793871_3794093_+	hypothetical protein	NA	NA	NA	NA	NA
AWS64874.1|3794089_3794458_+	hypothetical protein	NA	NA	NA	NA	NA
AWS64875.1|3794461_3794704_+	hypothetical protein	NA	NA	NA	NA	NA
AWS64876.1|3794700_3795111_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AWS64877.1|3795121_3795394_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AWS64878.1|3795634_3795841_+	hypothetical protein	NA	NA	NA	NA	NA
AWS64879.1|3795840_3796896_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.9	1.0e-69
AWS64880.1|3796907_3797243_+|head	head decoration protein	head	NA	NA	NA	NA
AWS64881.1|3797255_3797669_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
AWS64882.1|3797831_3798272_+	hypothetical protein	NA	NA	NA	NA	NA
AWS64883.1|3798565_3798847_+	hypothetical protein	NA	NA	NA	NA	NA
AWS64884.1|3799280_3800516_-	allantoate amidohydrolase	NA	NA	NA	NA	NA
AWS64885.1|3800537_3801587_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
AWS64886.1|3803579_3804395_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
AWS64887.1|3804391_3805285_+	carbamate kinase	NA	NA	NA	NA	NA
AWS64888.1|3805479_3806547_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AWS64889.1|3806543_3807053_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
AWS64890.1|3807170_3807893_-	UDP-2,3-diacylglucosamine hydrolase	NA	NA	NA	NA	NA
AWS64891.1|3807895_3808390_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
AWS64892.1|3808563_3809949_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
AWS64893.1|3809984_3810506_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AWS64894.1|3810613_3810826_-	hypothetical protein	NA	NA	NA	NA	NA
AWS64895.1|3810827_3811694_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
AWS64896.1|3812164_3812707_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
AWS64897.1|3812926_3813619_+	molecular chaperone FimC	NA	NA	NA	NA	NA
AWS64898.1|3813649_3816259_+	outer membrane usher protein	NA	NA	NA	NA	NA
AWS64899.1|3816237_3817278_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
AWS64900.1|3817288_3817804_+	fimbriae assembly protein	NA	NA	NA	NA	NA
AWS64901.1|3817806_3818439_-	DNA-binding response regulator	NA	NA	NA	NA	NA
3818714:3818760	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
AWS64902.1|3818773_3819937_-|integrase	integrase	integrase	A0A088CD23	Shigella_phage	86.3	1.2e-199
AWS64903.1|3819792_3820164_-	DNA-binding protein	NA	M1FJ59	Enterobacteria_phage	81.0	1.2e-46
AWS64904.1|3820135_3820414_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	98.9	1.7e-48
AWS64905.1|3820461_3820680_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
AWS64906.1|3820778_3821060_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
AWS64907.1|3821127_3821766_+	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.0	1.6e-110
AWS64908.1|3821762_3822053_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
AWS64909.1|3822108_3822567_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.3e-81
AWS64910.1|3822563_3823091_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
AWS64911.1|3823087_3823264_+	NinE family protein	NA	K7PHE6	Enterobacteria_phage	98.3	1.4e-27
AWS64912.1|3823224_3823608_+	DUF2591 domain-containing protein	NA	Q76H72	Enterobacteria_phage	95.7	4.8e-62
AWS64913.1|3823600_3823795_+	protein ninF	NA	NA	NA	NA	NA
AWS64914.1|3823814_3824177_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	9.5e-60
AWS64915.1|3824173_3824314_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	65.1	3.6e-07
AWS64916.1|3824399_3824783_+	antitermination protein Q	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
AWS64917.1|3824972_3825950_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	77.8	1.1e-147
AWS64918.1|3825946_3827155_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
AWS64919.1|3827981_3828197_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AWS64920.1|3828196_3828694_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
AWS64921.1|3828690_3829152_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	98.0	2.7e-75
AWS64922.1|3829183_3829477_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
AWS64923.1|3829836_3830031_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
AWS64924.1|3830178_3830280_+	hypothetical protein	NA	NA	NA	NA	NA
AWS64925.1|3830419_3830965_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	97.8	8.9e-94
AWS64926.1|3831375_3832068_+|terminase	terminase	terminase	A0A0E3M194	Enterobacteria_phage	41.8	1.1e-40
AWS64927.1|3832064_3832346_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	4.1e-18
AWS64928.1|3833069_3833363_+	hypothetical protein	NA	NA	NA	NA	NA
AWS64929.1|3834038_3834788_+	transcriptional regulator	NA	NA	NA	NA	NA
AWS64930.1|3835036_3835990_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
AWS64931.1|3836393_3836510_-	hypothetical protein	NA	NA	NA	NA	NA
3836414:3836460	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
AWS64932.1|3836503_3837265_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWS64933.1|3837321_3837534_+	hypothetical protein	NA	NA	NA	NA	NA
AWS64934.1|3837447_3838338_-	DUF4434 domain-containing protein	NA	NA	NA	NA	NA
AWS64935.1|3838338_3841311_-	phage receptor	NA	NA	NA	NA	NA
AWS64936.1|3841423_3843535_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
AWS64937.1|3843805_3844942_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
AWS66387.1|3845140_3845473_-	hypothetical protein	NA	NA	NA	NA	NA
AWS64938.1|3845418_3845616_-	hypothetical protein	NA	NA	NA	NA	NA
AWS66388.1|3845906_3846068_-	rhs core protein	NA	NA	NA	NA	NA
AWS64939.1|3846193_3846454_-	hypothetical protein	NA	NA	NA	NA	NA
AWS64940.1|3851023_3851485_-	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
AWS64941.1|3851512_3853414_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.5	1.2e-25
AWS64942.1|3854150_3855599_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
AWS64943.1|3855588_3856272_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
AWS64944.1|3856318_3856474_+	copper transporter	NA	NA	NA	NA	NA
AWS64945.1|3856428_3857802_+	cation efflux system protein CusC	NA	NA	NA	NA	NA
AWS64946.1|3857959_3858292_+	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone	NA	NA	NA	NA	NA
AWS64947.1|3858307_3859531_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
AWS64948.1|3859542_3862686_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
AWS64949.1|3862787_3864164_+	aromatic amino acid transporter AroP	NA	NA	NA	NA	NA
AWS64950.1|3864231_3865479_-	miniconductance mechanosensitive channel YbdG	NA	NA	NA	NA	NA
AWS64951.1|3865586_3866240_-	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
AWS64952.1|3866333_3866702_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
AWS64953.1|3866766_3867015_-	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
AWS64954.1|3867080_3868199_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AWS64955.1|3868210_3868360_+	hypothetical protein	NA	NA	NA	NA	NA
AWS64956.1|3868651_3868804_+	protein HokE	NA	NA	NA	NA	NA
AWS64957.1|3868880_3869993_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
>prophage 12
CP029741	Escherichia coli strain AR_0085 chromosome, complete genome	5213052	4066836	4081828	5213052	lysis,tail	Enterobacteria_phage(60.0%)	19	NA	NA
AWS65131.1|4066836_4067475_-	hypothetical protein	NA	A0A0P0ZBR6	Stx2-converting_phage	98.4	2.7e-65
AWS65132.1|4067429_4067699_-	host cell division inhibitory peptide Kil	NA	M1FN78	Enterobacteria_phage	100.0	1.7e-42
AWS65133.1|4067778_4068147_-	lambda prophage-derived protein ea10	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
AWS65134.1|4068407_4068989_+	superinfection exclusion protein B	NA	Q9EYA9	Enterobacteria_phage	100.0	4.0e-100
AWS65135.1|4069005_4069278_-	hypothetical protein	NA	K7PH69	Enterobacterial_phage	96.7	4.0e-26
AWS65136.1|4069590_4070241_-	helix-turn-helix domain-containing protein	NA	K7PM82	Enterobacteria_phage	98.6	4.1e-122
AWS65137.1|4070503_4070881_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
AWS65138.1|4071036_4071561_-	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
AWS65139.1|4071753_4072713_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
AWS65140.1|4073055_4073796_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWS65141.1|4073983_4074199_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AWS65142.1|4074198_4074696_+	lysozyme	NA	A0A1B5FP97	Escherichia_phage	97.0	9.3e-90
AWS65143.1|4074912_4075098_+	Spanin from lambdoid prophage Rac, outer membrane subunit	NA	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
AWS65144.1|4075294_4076752_+	potassium transporter TrkG	NA	NA	NA	NA	NA
AWS65145.1|4076690_4076972_+	hypothetical protein	NA	NA	NA	NA	NA
AWS65146.1|4076889_4078722_+	host specificity protein	NA	A5LH43	Enterobacteria_phage	98.1	1.6e-275
AWS65147.1|4079029_4079992_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	91.1	4.0e-174
AWS66396.1|4080096_4080291_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.3	2.3e-28
AWS65148.1|4080496_4081828_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	2.5e-20
>prophage 13
CP029741	Escherichia coli strain AR_0085 chromosome, complete genome	5213052	4163204	4275851	5213052	portal,capsid,integrase,tail,tRNA,plate,protease,head	Salmonella_phage(36.26%)	138	4163989:4164005	4223736:4223752
AWS65222.1|4163204_4164257_-|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
4163989:4164005	attL	ACCATCAACAGCAATTT	NA	NA	NA	NA
AWS65223.1|4164339_4166016_-	DUF4041 domain-containing protein	NA	A0A142LP25	Marinitoga_camini_virus	66.8	9.8e-83
AWS65224.1|4166036_4166633_-	hypothetical protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	1.4e-39
AWS65225.1|4166728_4166950_+	regulator	NA	NA	NA	NA	NA
AWS65226.1|4166982_4167492_+	hypothetical protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
AWS65227.1|4167499_4167796_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
AWS65228.1|4167913_4168255_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AWS65229.1|4168322_4168556_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	96.1	5.4e-32
AWS65230.1|4168555_4168783_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	7.8e-36
AWS65231.1|4168779_4169637_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.8	9.5e-159
AWS65232.1|4169633_4172048_+	endonuclease	NA	E5G6L9	Salmonella_phage	98.3	0.0e+00
AWS65233.1|4172201_4172390_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
AWS65234.1|4172328_4172634_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AWS65235.1|4172793_4173219_-	hypothetical protein	NA	NA	NA	NA	NA
AWS66400.1|4173862_4174429_+	hypothetical protein	NA	NA	NA	NA	NA
AWS65236.1|4174422_4174923_+	hypothetical protein	NA	NA	NA	NA	NA
AWS65237.1|4174909_4176814_+	AAA family ATPase	NA	NA	NA	NA	NA
AWS65238.1|4176879_4177905_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.4	1.9e-169
AWS65239.1|4177904_4179671_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
AWS65240.1|4179813_4180647_+|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	84.1	7.7e-121
AWS65241.1|4180663_4181722_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	3.8e-181
AWS65242.1|4181725_4182376_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	95.4	3.3e-111
AWS65243.1|4182471_4182936_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	87.7	2.1e-75
AWS65244.1|4182935_4183139_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AWS65245.1|4183142_4183358_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AWS65246.1|4183338_4183854_+	lysozyme	NA	E5G6N1	Salmonella_phage	93.0	5.6e-90
AWS65247.1|4183850_4184279_+	hypothetical protein	NA	E5G6N2	Salmonella_phage	88.7	6.8e-57
AWS65248.1|4184433_4185006_-	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	3.6e-85
AWS65249.1|4185077_4185539_+|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	50.6	1.4e-34
AWS65250.1|4185545_4186160_-|tail	tail assembly chaperone	tail	Q9MCR5	Enterobacteria_phage	61.0	2.9e-61
AWS65251.1|4186159_4187923_-	short-chain fatty acid transporter	NA	M1TAS6	Escherichia_phage	41.9	1.9e-36
AWS65252.1|4187925_4188504_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
AWS65253.1|4188496_4189600_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	55.2	8.3e-107
AWS65254.1|4189590_4189938_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
AWS65255.1|4189992_4190589_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.7	3.2e-36
AWS65256.1|4190585_4191740_-	phage protein D	NA	Q6QIA2	Burkholderia_phage	47.8	1.9e-85
AWS65257.1|4191727_4191943_-	hypothetical protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
AWS65258.1|4191939_4192824_-	hypothetical protein	NA	A4JWL1	Burkholderia_virus	48.4	1.0e-51
AWS65259.1|4192823_4195775_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.8	3.7e-85
AWS65260.1|4195850_4196009_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AWS65261.1|4195932_4196268_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AWS65262.1|4196365_4196647_-	hypothetical protein	NA	NA	NA	NA	NA
AWS65263.1|4196649_4197171_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
AWS65264.1|4197170_4198598_-|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	76.1	1.0e-213
AWS65265.1|4198587_4198842_-	hypothetical protein	NA	NA	NA	NA	NA
AWS65266.1|4198838_4199303_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	8.2e-40
AWS65267.1|4199302_4199749_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	51.7	1.3e-34
AWS65268.1|4199750_4200086_-	DUF2190 domain-containing protein	NA	NA	NA	NA	NA
AWS65269.1|4200096_4201050_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	40.8	1.9e-59
AWS65270.1|4201059_4202175_-	peptidase	NA	A4JWJ9	Burkholderia_virus	51.6	5.5e-98
AWS65271.1|4202389_4202848_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	9.9e-30
AWS65272.1|4202850_4203672_-|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	60.1	7.1e-95
AWS65273.1|4203652_4205149_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.8	6.1e-169
AWS65274.1|4205148_4206672_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.5	1.4e-184
AWS65275.1|4206668_4207211_-	DUF3486 domain-containing protein	NA	A4JWJ3	Burkholderia_virus	50.8	7.1e-43
AWS65276.1|4207213_4207525_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	60.6	3.0e-30
AWS65277.1|4207524_4207851_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
AWS65278.1|4207847_4208498_-	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.5	9.5e-10
AWS65279.1|4208481_4209222_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.9	2.2e-63
AWS65280.1|4209224_4209575_-	hypothetical protein	NA	A4JWP3	Burkholderia_virus	59.8	1.3e-21
AWS65281.1|4209707_4210451_+	hypothetical protein	NA	NA	NA	NA	NA
AWS65282.1|4210504_4210720_+	hypothetical protein	NA	NA	NA	NA	NA
AWS65283.1|4210911_4211676_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
AWS65284.1|4211792_4212140_-	transcriptional regulator	NA	Q5ZQZ8	Pseudomonas_phage	50.6	1.2e-16
AWS65285.1|4212233_4212422_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	1.8e-17
AWS65286.1|4212475_4212784_+	IclR family transcriptional regulator	NA	Q5ZR02	Pseudomonas_phage	55.9	3.5e-23
AWS65287.1|4212794_4213712_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	56.0	6.3e-76
AWS65288.1|4213711_4214029_+	hypothetical protein	NA	NA	NA	NA	NA
AWS65289.1|4214044_4215814_+|integrase	integrase	integrase	A4JWN2	Burkholderia_virus	69.6	4.0e-228
AWS65290.1|4215824_4216991_+	hypothetical protein	NA	A4JWN1	Burkholderia_virus	59.7	1.7e-121
AWS65291.1|4216993_4217263_+	hypothetical protein	NA	NA	NA	NA	NA
AWS65292.1|4217290_4217821_+	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
AWS65293.1|4217831_4218053_-	hypothetical protein	NA	NA	NA	NA	NA
AWS65294.1|4218109_4218382_+	hypothetical protein	NA	NA	NA	NA	NA
AWS65295.1|4218391_4218688_+	hypothetical protein	NA	NA	NA	NA	NA
AWS65296.1|4218702_4218918_+	hypothetical protein	NA	NA	NA	NA	NA
AWS65297.1|4218914_4219598_+	DUF2786 domain-containing protein	NA	L7P7W8	Pseudomonas_phage	36.7	1.0e-25
AWS65298.1|4219594_4219825_+	hypothetical protein	NA	NA	NA	NA	NA
AWS65299.1|4219814_4220030_+	hypothetical protein	NA	NA	NA	NA	NA
AWS65300.1|4220019_4220472_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	2.8e-24
AWS65301.1|4220443_4220842_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	55.9	3.9e-30
AWS65302.1|4220956_4221589_+	hypothetical protein	NA	NA	NA	NA	NA
AWS65303.1|4221975_4222407_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	4.4e-72
AWS65304.1|4222399_4222846_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	5.1e-63
AWS65305.1|4222914_4223493_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.2e-94
AWS65306.1|4223489_4223849_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
4223736:4223752	attR	ACCATCAACAGCAATTT	NA	NA	NA	NA
AWS65307.1|4223835_4224744_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	7.8e-143
AWS65308.1|4224736_4225342_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	93.0	1.8e-111
AWS65309.1|4225338_4226697_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	79.3	8.9e-151
AWS65310.1|4226698_4227139_+|tail	phage tail protein	tail	A0A0F7LDZ0	Escherichia_phage	59.9	8.9e-44
AWS65311.1|4227110_4227713_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	92.5	2.4e-100
AWS65312.1|4227712_4228252_-|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	64.1	4.6e-58
AWS65313.1|4228282_4228849_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
AWS65314.1|4228991_4230164_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	2.1e-204
AWS65315.1|4230173_4230689_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
AWS65316.1|4230743_4231046_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
AWS65317.1|4231060_4231180_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AWS65318.1|4231172_4234250_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	69.2	0.0e+00
AWS65319.1|4234246_4234732_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	1.7e-67
AWS65320.1|4234728_4235829_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	1.9e-175
AWS65321.1|4235919_4236138_+	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AWS65322.1|4236373_4238059_-	transporter	NA	NA	NA	NA	NA
AWS65323.1|4238328_4238706_+	hypothetical protein	NA	NA	NA	NA	NA
AWS65324.1|4238735_4238993_-	glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
AWS65325.1|4239152_4239440_+	DUF1418 domain-containing protein	NA	NA	NA	NA	NA
AWS65326.1|4240205_4241108_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
AWS65327.1|4241195_4241672_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
AWS65328.1|4242022_4243135_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AWS65329.1|4243229_4244363_+	putrescine transport ATP-binding protein PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
AWS65330.1|4244372_4245326_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
AWS65331.1|4245322_4246168_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AWS65332.1|4246227_4246716_+	DUF2593 domain-containing protein	NA	NA	NA	NA	NA
AWS65333.1|4246756_4247884_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.0	6.0e-28
AWS65334.1|4248082_4248814_-	ABC transporter arginine-binding protein 1	NA	NA	NA	NA	NA
AWS65335.1|4249104_4249773_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
AWS65336.1|4249772_4250489_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
AWS65337.1|4250495_4251227_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWS65338.1|4251244_4251973_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
AWS65339.1|4252190_4252706_-	lipoprotein	NA	NA	NA	NA	NA
AWS65340.1|4252831_4253155_+	hypothetical protein	NA	NA	NA	NA	NA
AWS65341.1|4253151_4253982_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
AWS66401.1|4253978_4254992_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AWS65342.1|4255090_4256521_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AWS65343.1|4256531_4257533_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AWS65344.1|4257569_4259288_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
AWS65345.1|4259420_4260389_-	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AWS65346.1|4260400_4262053_-	hydroxylamine reductase	NA	NA	NA	NA	NA
AWS65347.1|4262196_4263096_-	transporter	NA	NA	NA	NA	NA
AWS65348.1|4263590_4264286_-	aquaporin	NA	NA	NA	NA	NA
AWS65349.1|4264711_4266370_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AWS65350.1|4266366_4267359_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
AWS65351.1|4267473_4268589_+	MacA family efflux pump subunit	NA	NA	NA	NA	NA
AWS65352.1|4268585_4270532_+	macrolide ABC transporter permease/ATP-binding protein MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
AWS65353.1|4270604_4270829_-	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
AWS65354.1|4271151_4271472_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
AWS65355.1|4271502_4273779_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.1e-166
AWS65356.1|4274643_4274862_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AWS65357.1|4275146_4275851_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
>prophage 14
CP029741	Escherichia coli strain AR_0085 chromosome, complete genome	5213052	4790613	4829908	5213052	transposase,protease	Escherichia_phage(20.0%)	39	NA	NA
AWS65821.1|4790613_4791120_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.1	8.7e-43
AWS65822.1|4791127_4792336_+|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	93.5	1.4e-208
AWS65823.1|4792375_4793590_-	BenE family transporter YdcO	NA	NA	NA	NA	NA
AWS65824.1|4793642_4794179_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWS65825.1|4794251_4796213_+|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	28.3	3.5e-23
AWS65826.1|4796304_4796535_-	DUF2554 domain-containing protein	NA	NA	NA	NA	NA
AWS65827.1|4796756_4796933_+	mRNA interferase HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
AWS65828.1|4796978_4797395_+	antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
AWS65829.1|4797473_4798880_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
AWS65830.1|4799124_4800270_+	spermidine/putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWS65831.1|4800287_4801301_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	55.4	1.1e-25
AWS65832.1|4801301_4802243_+	ABC transporter permease	NA	NA	NA	NA	NA
AWS65833.1|4802232_4803027_+	ABC transporter permease	NA	NA	NA	NA	NA
AWS65834.1|4803048_4804473_+	gamma-aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
AWS65835.1|4804569_4804665_-	stress response membrane protein YncL	NA	NA	NA	NA	NA
AWS65836.1|4804661_4804841_-	hypothetical protein	NA	NA	NA	NA	NA
AWS65837.1|4804811_4805033_+	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
AWS65838.1|4805118_4805352_+	DUF2526 domain-containing protein	NA	NA	NA	NA	NA
AWS65839.1|4805352_4805802_-	hypothetical protein	NA	NA	NA	NA	NA
AWS66429.1|4805798_4806317_-	L-amino acid N-acyltransferase MnaT	NA	NA	NA	NA	NA
AWS65840.1|4806496_4807534_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
AWS65841.1|4807731_4808397_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWS65842.1|4808432_4810535_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.3	5.3e-134
AWS66430.1|4810449_4810629_+	hypothetical protein	NA	NA	NA	NA	NA
AWS65843.1|4810568_4810694_-	tonB-dependent receptor yncD	NA	NA	NA	NA	NA
AWS65844.1|4810776_4811838_+	YncE family protein	NA	NA	NA	NA	NA
AWS65845.1|4811950_4813450_-	L-asparagine permease	NA	NA	NA	NA	NA
AWS65846.1|4814025_4815187_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AWS65847.1|4816340_4817477_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
AWS65848.1|4817576_4817810_+	tautomerase PptA	NA	NA	NA	NA	NA
AWS65849.1|4817806_4818376_-	flavin reductase family protein	NA	NA	NA	NA	NA
AWS65850.1|4818548_4819394_+	N-hydroxyarylamine O-acetyltransferase	NA	NA	NA	NA	NA
AWS65851.1|4819489_4820383_-	PhzF family isomerase	NA	NA	NA	NA	NA
AWS65852.1|4820461_4821142_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
AWS65853.1|4821138_4821834_-	nitrate reductase molybdenum cofactor assembly chaperone NarW	NA	NA	NA	NA	NA
AWS65854.1|4821833_4823378_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
AWS65855.1|4823374_4827115_-	nitrate reductase subunit alpha	NA	NA	NA	NA	NA
AWS65856.1|4827196_4828585_-	nitrate/nitrite transporter	NA	NA	NA	NA	NA
AWS65857.1|4828984_4829908_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	3.0e-166
>prophage 15
CP029741	Escherichia coli strain AR_0085 chromosome, complete genome	5213052	4919427	4936421	5213052	tail	Enterobacteria_phage(36.36%)	18	NA	NA
AWS65932.1|4919427_4920888_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.5e-42
AWS65933.1|4920976_4922260_-	MFS transporter	NA	NA	NA	NA	NA
AWS65934.1|4923045_4923279_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AWS65935.1|4923596_4924187_+	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AWS65936.1|4924284_4924860_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	95.3	8.5e-103
AWS65937.1|4924859_4925804_-	short-chain fatty acid transporter	NA	K7PHC9	Enterobacteria_phage	71.4	1.9e-38
AWS65938.1|4927124_4927319_+	DNA-binding protein	NA	Q859D3	Escherichia_coli_phage	53.7	8.2e-10
AWS65939.1|4927338_4928634_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.6	1.0e-156
AWS65940.1|4928635_4928764_-	transporter	NA	NA	NA	NA	NA
AWS65941.1|4928821_4929841_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	2.8e-16
AWS65942.1|4929852_4931067_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AWS65943.1|4931047_4931236_-	hypothetical protein	NA	NA	NA	NA	NA
AWS65944.1|4931272_4931599_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AWS65945.1|4931733_4932075_+	DUF1283 domain-containing protein	NA	NA	NA	NA	NA
AWS65946.1|4932109_4932670_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AWS66435.1|4932672_4933383_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
AWS65947.1|4933490_4933796_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AWS65948.1|4933994_4936421_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
>prophage 1
CP029742	Escherichia coli strain AR_0085 plasmid unnamed1, complete sequence	139740	56029	109190	139740	integrase,transposase,tRNA	Pseudomonas_phage(16.67%)	56	51630:51644	68860:68874
51630:51644	attL	GGTCTGCCGCTGTTC	NA	NA	NA	NA
AWS66504.1|56029_57199_-|integrase	site-specific integrase	integrase	B5WZU7	Pseudomonas_phage	44.0	1.1e-48
AWS66505.1|57253_57526_+	shufflon protein B	NA	NA	NA	NA	NA
AWS66506.1|57535_58813_-	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	NA	NA	NA	NA
AWS66591.1|58809_59460_-	prepilin peptidase	NA	NA	NA	NA	NA
AWS66507.1|59476_59953_-	lytic transglycosylase	NA	A0A0A8J856	Ralstonia_phage	37.0	1.3e-08
AWS66508.1|60011_60548_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
AWS66509.1|60597_61698_-	type II secretion protein F	NA	NA	NA	NA	NA
AWS66510.1|61699_63208_-	type II secretion protein E	NA	NA	NA	NA	NA
AWS66511.1|63304_63901_-	hypothetical protein	NA	NA	NA	NA	NA
AWS66512.1|63996_64551_-	hypothetical protein	NA	NA	NA	NA	NA
AWS66513.1|64599_65052_-	type IV pilus biogenesis protein PilP	NA	NA	NA	NA	NA
AWS66514.1|65041_66337_-	pilus assembly protein	NA	NA	NA	NA	NA
AWS66515.1|66357_67977_-	PilN family type IVB pilus formation outer membrane protein	NA	NA	NA	NA	NA
AWS66516.1|68007_68445_-	pilM	NA	NA	NA	NA	NA
AWS66517.1|68449_69520_-	pilus assembly protein	NA	NA	NA	NA	NA
68860:68874	attR	GGTCTGCCGCTGTTC	NA	NA	NA	NA
AWS66518.1|69731_70163_-	hypothetical protein	NA	NA	NA	NA	NA
AWS66519.1|70233_70551_-	pilus assembly protein PilI	NA	NA	NA	NA	NA
AWS66520.1|70556_72251_-	flotillin	NA	NA	NA	NA	NA
AWS66521.1|72714_73988_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	2.6e-176
AWS66522.1|74387_74537_-	conjugal transfer protein TraC	NA	NA	NA	NA	NA
AWS66523.1|74500_75166_-	traC	NA	NA	NA	NA	NA
AWS66524.1|75306_75948_-	transcription termination factor NusG	NA	NA	NA	NA	NA
AWS66525.1|76560_76656_+	positive regulator for repZ translation	NA	NA	NA	NA	NA
AWS66592.1|76652_77516_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
AWS66593.1|77565_77838_+	hypothetical protein	NA	NA	NA	NA	NA
AWS66526.1|78076_78265_-	hypothetical protein	NA	NA	NA	NA	NA
AWS66527.1|78460_78712_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AWS66528.1|78708_78996_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	48.4	3.8e-19
AWS66529.1|79289_79550_+	hypothetical protein	NA	NA	NA	NA	NA
AWS66530.1|79922_80159_+	hypothetical protein	NA	NA	NA	NA	NA
AWS66594.1|80452_80899_+	serine acetyltransferase	NA	NA	NA	NA	NA
AWS66531.1|81178_81772_-	proQ/FINO family protein	NA	NA	NA	NA	NA
AWS66532.1|82116_82353_+	hypothetical protein	NA	NA	NA	NA	NA
AWS66533.1|82625_83813_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AWS66534.1|83812_84178_-|transposase	transposase	transposase	NA	NA	NA	NA
AWS66535.1|84587_85151_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
AWS66536.1|86560_87774_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	95.9	2.0e-162
AWS66537.1|88335_88752_-	PIN domain-containing protein	NA	NA	NA	NA	NA
AWS66538.1|88748_88979_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AWS66539.1|91109_91778_+	cysteine hydrolase	NA	NA	NA	NA	NA
AWS66540.1|91783_92644_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
AWS66541.1|92738_94298_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
AWS66542.1|94294_95719_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
AWS66543.1|95711_96668_+	carbamate kinase	NA	NA	NA	NA	NA
AWS66544.1|96684_97074_+|tRNA	glutamyl-tRNA amidotransferase	tRNA	NA	NA	NA	NA
AWS66545.1|97096_98320_+	cytosine permease	NA	NA	NA	NA	NA
AWS66546.1|98397_99288_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWS66547.1|99721_100111_+	cytochrome B562	NA	NA	NA	NA	NA
AWS66548.1|101220_102084_+	endonuclease	NA	NA	NA	NA	NA
AWS66549.1|102184_102304_-	arylsulfatase	NA	NA	NA	NA	NA
AWS66550.1|102343_102523_-	Hin recombinase	NA	NA	NA	NA	NA
AWS66551.1|103559_104792_-	MFS transporter	NA	NA	NA	NA	NA
AWS66552.1|104803_105565_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.2	8.8e-15
AWS66553.1|105564_106602_-	iron ABC transporter permease	NA	NA	NA	NA	NA
AWS66554.1|106601_107600_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWS66555.1|108185_109190_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP029742	Escherichia coli strain AR_0085 plasmid unnamed1, complete sequence	139740	127792	132895	139740	integrase	Escherichia_phage(33.33%)	8	127707:127719	130022:130034
127707:127719	attL	GCTGTGTTTTCTC	NA	NA	NA	NA
AWS66598.1|127792_128290_+|integrase	integrase	integrase	I3WFA4	Macacine_betaherpesvirus	94.6	4.1e-53
AWS66572.1|128426_128702_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AWS66573.1|128695_129340_-	chromosome partitioning protein ParA	NA	A0A222YXS3	Escherichia_phage	43.5	8.8e-40
AWS66574.1|129568_130540_+	plasmid segregation protein parM	NA	A0A222YXF2	Escherichia_phage	42.9	1.3e-66
130022:130034	attR	GCTGTGTTTTCTC	NA	NA	NA	NA
AWS66575.1|130508_130937_+	plasmid stability protein	NA	NA	NA	NA	NA
AWS66576.1|130941_132213_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	60.5	1.4e-142
AWS66577.1|132212_132650_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
AWS66578.1|132646_132895_-	protein ImpC	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
>prophage 1
CP029743	Escherichia coli strain AR_0085 plasmid unnamed2, complete sequence	104555	6152	46877	104555	integrase,transposase	Salmonella_phage(15.38%)	43	958:978	43015:43035
958:978	attL	AACTTTCACATGTGAAAGTTT	NA	NA	NA	NA
AWS66609.1|6152_7415_+|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AWS66610.1|7738_8884_+	class C beta-lactamase CMY-2	NA	NA	NA	NA	NA
AWS66611.1|8977_9511_+	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	54.1	6.1e-47
AWS66612.1|9507_9825_-	quaternary ammonium compound-resistance protein SugE	NA	NA	NA	NA	NA
AWS66613.1|9938_10358_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	95.9	2.2e-47
AWS66614.1|10354_10705_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	3.6e-40
AWS66615.1|10735_12349_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	62.4	1.1e-176
AWS66616.1|12615_13053_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AWS66617.1|13099_13804_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AWS66618.1|14188_16327_-	AAA family ATPase	NA	NA	NA	NA	NA
AWS66619.1|16680_16938_+	hypothetical protein	NA	NA	NA	NA	NA
AWS66620.1|16937_17528_+	hypothetical protein	NA	NA	NA	NA	NA
AWS66621.1|17790_19347_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
AWS66622.1|19537_20155_+	proQ/FINO family protein	NA	NA	NA	NA	NA
AWS66623.1|20447_21485_-	hypothetical protein	NA	NA	NA	NA	NA
AWS66624.1|21589_21913_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AWS66625.1|22013_22724_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.5	3.1e-94
AWS66626.1|22732_23278_+	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
AWS66627.1|23353_23716_+	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AWS66628.1|23736_25494_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AWS66629.1|25567_25936_-	ModE family transcriptional regulator	NA	NA	NA	NA	NA
AWS66630.1|25998_26811_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
AWS66631.1|27022_27559_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWS66632.1|27625_28330_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AWS66633.1|28545_28866_+	hypothetical protein	NA	NA	NA	NA	NA
AWS66634.1|28884_29172_+	hypothetical protein	NA	NA	NA	NA	NA
AWS66635.1|29164_29701_+	hypothetical protein	NA	NA	NA	NA	NA
AWS66636.1|29703_30714_+|integrase	integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
AWS66637.1|30718_31588_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	35.1	3.5e-23
AWS66638.1|31584_32076_+	hypothetical protein	NA	NA	NA	NA	NA
AWS66639.1|32402_33278_+	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
AWS66640.1|33439_34480_+	KfrA protein	NA	NA	NA	NA	NA
AWS66641.1|34479_34758_+	hypothetical protein	NA	NA	NA	NA	NA
AWS66726.1|34766_36278_+	DNA helicase	NA	A0A2D1GN12	Pseudoalteromonas_phage	30.7	3.6e-44
AWS66642.1|36388_37429_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
AWS66643.1|37430_38864_+	conjugal transfer protein TraH	NA	NA	NA	NA	NA
AWS66644.1|38876_42491_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AWS66645.1|42528_42891_-	permease	NA	NA	NA	NA	NA
AWS66646.1|43606_43879_+	nucleotide excision repair protein	NA	A0A2H4J3B6	uncultured_Caudovirales_phage	41.0	1.3e-08
43015:43035	attR	AAACTTTCACATGTGAAAGTT	NA	NA	NA	NA
AWS66647.1|43878_44412_+	transglycosylase	NA	NA	NA	NA	NA
AWS66648.1|44422_45031_+	transcriptional regulator	NA	NA	NA	NA	NA
AWS66727.1|45027_45579_+	regulator	NA	NA	NA	NA	NA
AWS66649.1|45668_46877_+|transposase	IS256-like element IS1414 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	9.6e-48
>prophage 1
CP029744	Escherichia coli strain AR_0085 plasmid unnamed3, complete sequence	117192	36603	86266	117192	protease,transposase	Escherichia_phage(30.77%)	39	NA	NA
AWS66785.1|36603_37575_+|transposase	IS110 family transposase ISEc32	transposase	Q75QL1	Wolbachia_phage	32.1	1.1e-25
AWS66786.1|39886_40858_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	96.6	8.8e-169
AWS66787.1|40857_42024_-	protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	99.7	1.6e-228
AWS66788.1|43176_44679_-	hypothetical protein	NA	NA	NA	NA	NA
AWS66789.1|45298_45748_-	hypothetical protein	NA	A0A222YWI5	Escherichia_phage	67.1	5.0e-42
AWS66790.1|45865_46345_+	peptidase M14	NA	NA	NA	NA	NA
AWS66791.1|46420_46615_-	hypothetical protein	NA	NA	NA	NA	NA
AWS66792.1|47628_48486_-	metal ABC transporter permease	NA	NA	NA	NA	NA
AWS66793.1|48482_49340_-	metal ABC transporter permease	NA	NA	NA	NA	NA
AWS66794.1|49336_50164_-	manganese/iron ABC transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	27.0	3.6e-14
AWS66795.1|50163_51078_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWS66796.1|51200_51392_-	prephenate dehydratase	NA	NA	NA	NA	NA
AWS66797.1|53354_53651_+	hypothetical protein	NA	NA	NA	NA	NA
AWS66798.1|54059_55037_+	repFIB replication protein A	NA	J9Q7H0	Salmonella_phage	63.9	4.6e-101
AWS66799.1|55321_56062_-	recombinase	NA	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
AWS66800.1|56182_56371_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
AWS66801.1|56744_57653_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
AWS66802.1|57715_58825_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
AWS66803.1|58883_59168_+	hypothetical protein	NA	NA	NA	NA	NA
AWS66804.1|59257_60211_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
AWS66805.1|60314_60704_+|protease	outer membrane protease	protease	NA	NA	NA	NA
AWS66806.1|61070_61334_-	hypothetical protein	NA	NA	NA	NA	NA
AWS66807.1|61483_61666_-	hypothetical protein	NA	NA	NA	NA	NA
AWS66808.1|62557_62929_-	hypothetical protein	NA	NA	NA	NA	NA
AWS66809.1|63222_64746_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AWS66855.1|67119_67383_+	hypothetical protein	NA	NA	NA	NA	NA
AWS66810.1|67581_68697_+	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
AWS66811.1|68710_72496_+	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	30.0	1.3e-45
AWS66812.1|72599_73829_+	catecholate siderophore esterase IroD	NA	NA	NA	NA	NA
AWS66813.1|73913_74870_+	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
AWS66814.1|74914_77092_-	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	31.8	9.6e-06
AWS66815.1|77825_78026_-	phospho-2-dehydro-3-deoxyheptonate aldolase	NA	NA	NA	NA	NA
AWS66816.1|78882_79899_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
AWS66817.1|80832_81144_-	colicin V	NA	NA	NA	NA	NA
AWS66818.1|81576_82281_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AWS66819.1|82611_83817_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
AWS66820.1|84260_84581_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AWS66821.1|84573_84960_+	amino acid-binding protein	NA	NA	NA	NA	NA
AWS66822.1|85249_86266_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
