The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029738	Klebsiella pneumoniae strain AR_0087 chromosome, complete genome	5347404	678203	689091	5347404		Escherichia_phage(87.5%)	10	NA	NA
AWS72196.1|678203_681311_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
AWS72197.1|681365_682631_+	MFS transporter	NA	NA	NA	NA	NA
AWS72198.1|682661_683750_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	99.7	8.8e-210
AWS72199.1|683836_684097_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
AWS72200.1|684394_685255_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
AWS72201.1|685275_686037_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AWS72202.1|686027_686261_+	hypothetical protein	NA	NA	NA	NA	NA
AWS72203.1|686298_687201_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AWS72204.1|687212_688478_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	6.6e-233
AWS72205.1|688470_689091_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 2
CP029738	Klebsiella pneumoniae strain AR_0087 chromosome, complete genome	5347404	863733	952483	5347404	portal,protease,capsid,tRNA,terminase,tail,holin,plate,head	Klebsiella_phage(62.96%)	101	NA	NA
AWS72364.1|863733_864669_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.0	3.5e-138
AWS72365.1|864714_866088_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	8.6e-53
AWS72366.1|866102_866297_-	hypothetical protein	NA	NA	NA	NA	NA
AWS72367.1|866613_867597_-	zinc transporter ZntB	NA	NA	NA	NA	NA
AWS72368.1|867666_867858_+	hypothetical protein	NA	NA	NA	NA	NA
AWS76474.1|867876_868620_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.1	1.0e-15
AWS72369.1|868636_869701_+	oxidoreductase	NA	NA	NA	NA	NA
AWS72370.1|869937_870132_+	hypothetical protein	NA	NA	NA	NA	NA
AWS72371.1|870244_870991_-	hypothetical protein	NA	NA	NA	NA	NA
AWS72372.1|871281_871950_-	ABC transporter permease	NA	NA	NA	NA	NA
AWS72373.1|872963_873770_-	methionine-binding protein	NA	NA	NA	NA	NA
AWS72374.1|873990_875166_+	aspartate aminotransferase	NA	NA	NA	NA	NA
AWS72375.1|875210_876245_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
AWS72376.1|876333_876882_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AWS72377.1|876936_877848_-	NmrA/HSCARG family protein	NA	NA	NA	NA	NA
AWS72378.1|877840_878707_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AWS72379.1|878797_879721_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWS72380.1|879740_880646_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWS72381.1|880790_881720_+	aromatic alcohol reductase	NA	NA	NA	NA	NA
AWS72382.1|881745_881952_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AWS72383.1|882002_882881_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWS72384.1|883039_883795_+	KR domain-containing protein	NA	NA	NA	NA	NA
AWS72385.1|883799_884393_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AWS72386.1|884466_885180_+	oxidoreductase	NA	NA	NA	NA	NA
AWS72387.1|885246_885741_-	hypothetical protein	NA	NA	NA	NA	NA
AWS72388.1|885869_886412_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AWS72389.1|886389_887475_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AWS72390.1|887438_889193_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AWS72391.1|889271_890864_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AWS72392.1|890860_894310_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
AWS72393.1|894299_895481_-	hypothetical protein	NA	NA	NA	NA	NA
AWS72394.1|895429_895687_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
AWS72395.1|895729_898129_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
AWS72396.1|898116_898647_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AWS72397.1|898671_899448_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AWS72398.1|899451_901830_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.0	2.4e-18
AWS72399.1|901822_904477_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	7.7e-98
AWS72400.1|904741_905233_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AWS72401.1|905237_906944_-	OmpA family protein	NA	NA	NA	NA	NA
AWS72402.1|906940_907630_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AWS76475.1|907626_908967_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AWS72403.1|908979_910524_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AWS72404.1|910566_911058_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AWS72405.1|911903_912152_+	damage-inducible protein DinI	NA	S5MQI1	Escherichia_phage	70.4	1.0e-25
AWS72406.1|912559_912982_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
AWS72407.1|913059_913242_-	Hin recombinase	NA	A0A286S1P7	Klebsiella_phage	87.0	2.6e-18
AWS72408.1|913253_914054_-	hypothetical protein	NA	NA	NA	NA	NA
AWS72409.1|916103_919172_-	kinase	NA	A0A286S259	Klebsiella_phage	97.2	0.0e+00
AWS72410.1|919168_919549_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
AWS72411.1|919558_920041_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	98.8	6.0e-86
AWS72412.1|920027_920507_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	98.7	1.7e-93
AWS72413.1|920506_922954_-|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	66.5	5.9e-278
AWS72414.1|922998_923466_-	hypothetical protein	NA	NA	NA	NA	NA
AWS72415.1|923531_923795_-|tail	phage tail protein	tail	A0A286S1P2	Klebsiella_phage	98.8	5.9e-43
AWS72416.1|923827_924181_-|tail	phage tail protein	tail	A0A286S1N4	Klebsiella_phage	99.1	4.9e-61
AWS72417.1|924224_924716_-|tail	phage tail protein	tail	A0A286S1Q8	Klebsiella_phage	100.0	2.3e-88
AWS72418.1|924771_925137_-	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	92.6	3.9e-61
AWS72419.1|925133_925673_-	hypothetical protein	NA	A0A286S249	Klebsiella_phage	99.4	3.0e-94
AWS72420.1|925665_925998_-|head,tail	head-tail adaptor protein	head,tail	A0A286S2A2	Klebsiella_phage	98.2	1.0e-55
AWS72421.1|925999_926197_-	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	96.9	2.4e-25
AWS72422.1|926257_926584_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	99.1	9.8e-56
AWS72423.1|926810_927974_-|capsid	phage major capsid protein	capsid	A0A286S1R4	Klebsiella_phage	99.2	3.8e-211
AWS72424.1|927985_928666_-|head,protease	HK97 family phage prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	99.6	2.7e-124
AWS72425.1|928671_929949_-|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	100.0	6.2e-247
AWS72426.1|929951_931484_-|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	100.0	3.9e-296
AWS72427.1|931493_931928_-	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	100.0	6.2e-74
AWS72428.1|932049_932259_-	serine acetyltransferase	NA	A0A286N2R4	Klebsiella_phage	84.1	2.4e-23
AWS72429.1|932271_932562_-	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	94.8	2.9e-51
AWS72430.1|932632_932839_-	DUF551 domain-containing protein	NA	A0A286N2R2	Klebsiella_phage	97.1	1.1e-33
AWS72431.1|932919_933156_-	DUF2560 domain-containing protein	NA	A0A286N2R1	Klebsiella_phage	94.9	1.6e-31
AWS72432.1|933287_933548_+	hypothetical protein	NA	NA	NA	NA	NA
AWS72433.1|933480_933753_-	hypothetical protein	NA	NA	NA	NA	NA
AWS72434.1|933885_934170_+	hypothetical protein	NA	NA	NA	NA	NA
AWS72435.1|934260_934455_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	85.9	1.5e-24
AWS72436.1|934405_934681_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	41.6	9.9e-09
AWS72437.1|934688_935318_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	90.9	6.9e-106
AWS72438.1|935317_935599_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
AWS72439.1|935585_935981_-	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
AWS76476.1|936543_936990_+	hypothetical protein	NA	NA	NA	NA	NA
AWS76477.1|936895_937153_-	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	100.0	1.3e-42
AWS72440.1|937306_938089_-	antitermination protein	NA	F1C595	Cronobacter_phage	79.1	6.5e-114
AWS72441.1|938085_939048_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	98.8	3.1e-182
AWS72442.1|939049_940708_-	ATP-dependent helicase	NA	A0A286N2P9	Klebsiella_phage	97.5	0.0e+00
AWS72443.1|940749_941118_-	hypothetical protein	NA	A0A286S263	Klebsiella_phage	82.8	6.7e-53
AWS72444.1|941379_941664_-	hypothetical protein	NA	A0A1B5FPB9	Escherichia_phage	70.2	1.1e-31
AWS72445.1|941788_942022_-	Cro/Cl family transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	63.9	4.9e-17
AWS72446.1|942162_942837_+	helix-turn-helix transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	78.6	8.7e-99
AWS72447.1|943000_943414_+	hypothetical protein	NA	NA	NA	NA	NA
AWS72448.1|943596_943821_+	hypothetical protein	NA	NA	NA	NA	NA
AWS72449.1|943821_944187_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	97.5	5.8e-57
AWS72450.1|944179_944434_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	89.3	1.4e-36
AWS72451.1|944620_945061_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	80.8	7.5e-59
AWS72452.1|945101_945620_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	97.7	9.4e-93
AWS72453.1|945625_946351_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	99.6	1.4e-131
AWS72454.1|946340_946565_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	94.6	1.7e-30
AWS72455.1|946561_947446_+	hypothetical protein	NA	A0A2H4FNA9	Salmonella_phage	70.6	5.1e-06
AWS72456.1|947624_947867_+	AlpA family transcriptional regulator	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
AWS72457.1|947847_949029_-	DUF4102 domain-containing protein	NA	A0A0M4QX09	Salmonella_phage	84.2	1.3e-201
AWS72458.1|949225_949774_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
AWS72459.1|949972_951505_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.5e-21
AWS72460.1|951721_952483_-	KR domain-containing protein	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	3.1e-20
>prophage 3
CP029738	Klebsiella pneumoniae strain AR_0087 chromosome, complete genome	5347404	1108941	1155079	5347404	portal,capsid,tRNA,terminase,integrase,tail,plate	Enterobacteria_phage(54.55%)	55	1114169:1114186	1151345:1151362
AWS72606.1|1108941_1109442_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
AWS72607.1|1109558_1110005_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
AWS76481.1|1109988_1110780_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWS72608.1|1110881_1112066_+	cyanate MFS transporter	NA	NA	NA	NA	NA
AWS72609.1|1112097_1112790_-	hypothetical protein	NA	NA	NA	NA	NA
AWS72610.1|1112935_1113445_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
AWS72611.1|1113431_1113788_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AWS72612.1|1113777_1114017_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
1114169:1114186	attL	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
AWS72613.1|1114281_1114533_-	hypothetical protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
AWS72614.1|1114576_1115716_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	72.3	9.4e-146
AWS72615.1|1115870_1117043_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.7	5.0e-158
AWS72616.1|1117042_1117558_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	2.2e-57
AWS72617.1|1117603_1117921_+|tail	phage tail protein	tail	B9A7B2	Serratia_phage	54.8	1.0e-17
AWS76482.1|1117920_1118079_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	3.5e-11
AWS72618.1|1118065_1121041_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.4	2.0e-219
AWS72619.1|1121056_1121530_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	66.9	6.6e-53
AWS72620.1|1121993_1122656_-	hypothetical protein	NA	NA	NA	NA	NA
AWS72621.1|1122673_1123897_-	DUF262 domain-containing protein	NA	A0A1V0S9I8	Catovirus	27.5	7.8e-05
AWS72622.1|1124496_1125594_-|tail	phage tail protein	tail	G4KKN6	Yersinia_phage	47.8	5.2e-08
AWS72623.1|1125593_1125806_-	hypothetical protein	NA	NA	NA	NA	NA
AWS72624.1|1125802_1128829_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
AWS72625.1|1128818_1129742_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	43.6	7.6e-53
AWS72626.1|1129743_1130094_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	58.2	1.8e-23
AWS72627.1|1130090_1130678_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.5	6.9e-60
AWS72628.1|1130674_1131310_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.9	4.6e-57
AWS72629.1|1131306_1131774_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	58.8	4.5e-46
AWS76483.1|1131955_1132285_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
AWS72630.1|1132296_1132842_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	43.0	6.3e-31
AWS72631.1|1132838_1133123_-|tail	phage tail protein	tail	NA	NA	NA	NA
AWS72632.1|1133113_1133314_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
AWS72633.1|1133313_1133829_-|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	48.8	2.7e-39
AWS72634.1|1133941_1134799_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	61.3	9.8e-71
AWS72635.1|1134848_1135883_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	3.6e-96
AWS72636.1|1135892_1136732_-|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	66.3	4.3e-95
AWS72637.1|1136888_1138616_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	67.1	1.0e-228
AWS72638.1|1138609_1139671_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.1	9.1e-143
AWS72639.1|1140515_1141307_+	hypothetical protein	NA	NA	NA	NA	NA
AWS72640.1|1141306_1143577_+	DNA helicase UvrD	NA	NA	NA	NA	NA
AWS72641.1|1146466_1147423_-	DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	54.4	1.5e-83
AWS72642.1|1147419_1147647_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	41.0	2.5e-05
AWS72643.1|1147655_1148222_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.2	2.8e-13
AWS72644.1|1148218_1148443_-	hypothetical protein	NA	NA	NA	NA	NA
AWS72645.1|1148511_1148784_-	hypothetical protein	NA	NA	NA	NA	NA
AWS72646.1|1148799_1149177_-	hypothetical protein	NA	NA	NA	NA	NA
AWS72647.1|1149192_1149411_-	DUF4761 domain-containing protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
AWS72648.1|1149431_1149710_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
AWS72649.1|1149830_1150130_+	XRE family transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	6.5e-38
AWS72650.1|1150245_1151229_+|integrase	integrase	integrase	Q83VS6	Escherichia_phage	79.8	1.4e-150
AWS72651.1|1151493_1152507_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
1151345:1151362	attR	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
AWS72652.1|1152564_1152666_+	hypothetical protein	NA	NA	NA	NA	NA
AWS76484.1|1152623_1152740_+	hypothetical protein	NA	NA	NA	NA	NA
AWS72653.1|1152857_1152983_+	hypothetical protein	NA	NA	NA	NA	NA
AWS72654.1|1153042_1153306_-	DUF2534 domain-containing protein	NA	NA	NA	NA	NA
AWS72655.1|1153436_1154075_-	leucine efflux protein	NA	NA	NA	NA	NA
AWS72656.1|1154164_1155079_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
>prophage 4
CP029738	Klebsiella pneumoniae strain AR_0087 chromosome, complete genome	5347404	1417567	1427041	5347404	protease,tRNA	Brazilian_cedratvirus(16.67%)	9	NA	NA
AWS72884.1|1417567_1419289_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
AWS72885.1|1419333_1420035_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AWS72886.1|1420388_1420607_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AWS72887.1|1420737_1423017_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AWS72888.1|1423047_1423365_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AWS72889.1|1423690_1423912_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AWS72890.1|1423845_1424049_-	hypothetical protein	NA	NA	NA	NA	NA
AWS72891.1|1423988_1425929_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AWS72892.1|1425925_1427041_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 5
CP029738	Klebsiella pneumoniae strain AR_0087 chromosome, complete genome	5347404	1894002	1964413	5347404	coat,transposase,tRNA,terminase,integrase,tail,lysis,head	Cronobacter_phage(24.07%)	89	1910603:1910649	1961484:1961530
AWS73302.1|1894002_1895520_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	9.5e-85
AWS73303.1|1895851_1897327_-	dipeptide permease	NA	A0A0P0IY73	Acinetobacter_phage	29.0	5.3e-48
AWS73304.1|1897386_1899534_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
AWS73305.1|1900755_1901679_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
AWS73306.1|1902382_1903951_-	transcriptional regulator CadC	NA	NA	NA	NA	NA
AWS73307.1|1904244_1904517_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AWS73308.1|1904617_1905538_-	lipid A biosynthesis lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	40.1	5.4e-51
AWS73309.1|1906048_1906915_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWS73310.1|1906987_1908292_-	citrate synthase	NA	NA	NA	NA	NA
AWS73311.1|1908802_1908973_+	ATP-NAD kinase	NA	NA	NA	NA	NA
AWS73312.1|1909051_1909453_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
AWS73313.1|1909848_1910142_-	hypothetical protein	NA	NA	NA	NA	NA
1910603:1910649	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AWS73314.1|1910804_1911011_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	49.2	3.3e-09
AWS73315.1|1911120_1911360_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	51.9	4.2e-16
AWS73316.1|1911438_1912923_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AWS73317.1|1913374_1914175_-	hypothetical protein	NA	NA	NA	NA	NA
AWS73318.1|1916260_1918738_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	45.3	1.4e-197
AWS73319.1|1918724_1919120_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.8	4.7e-36
AWS73320.1|1919116_1919587_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	40.4	1.2e-27
AWS76523.1|1919586_1920006_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	47.8	1.8e-30
AWS73321.1|1920176_1920590_+	hypothetical protein	NA	G0ZNE8	Cronobacter_phage	89.8	5.0e-65
AWS73322.1|1920609_1920789_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
AWS73323.1|1920829_1924270_-	hypothetical protein	NA	Q5G8W8	Enterobacteria_phage	40.5	7.3e-133
AWS73324.1|1924364_1924868_-	hypothetical protein	NA	NA	NA	NA	NA
AWS76524.1|1924970_1925198_-	hypothetical protein	NA	NA	NA	NA	NA
AWS73325.1|1925421_1925610_+	hypothetical protein	NA	NA	NA	NA	NA
AWS76525.1|1925661_1925982_-	hypothetical protein	NA	NA	NA	NA	NA
AWS73326.1|1925989_1926328_-	hypothetical protein	NA	NA	NA	NA	NA
AWS73327.1|1926464_1926938_+	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	40.6	2.1e-14
AWS73328.1|1926974_1927406_-	hypothetical protein	NA	NA	NA	NA	NA
AWS73329.1|1927778_1928084_-	hypothetical protein	NA	NA	NA	NA	NA
AWS73330.1|1928388_1929072_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	59.7	2.3e-75
AWS73331.1|1929124_1929877_-	DNA breaking-rejoining protein	NA	G0ZNE6	Cronobacter_phage	41.8	1.7e-42
AWS73332.1|1929945_1930338_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	51.9	2.0e-34
AWS73333.1|1930334_1930760_-	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
AWS73334.1|1930762_1931125_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	49.2	3.3e-20
AWS73335.1|1931124_1931298_-	50S ribosomal protein L13	NA	Q5G8X7	Enterobacteria_phage	51.8	1.2e-12
AWS73336.1|1931297_1931678_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	56.1	1.8e-29
AWS73337.1|1931680_1931956_-	hypothetical protein	NA	NA	NA	NA	NA
AWS73338.1|1931966_1933061_-|coat	phage coat protein	coat	F1C5E1	Cronobacter_phage	62.8	2.2e-123
AWS73339.1|1933072_1933501_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	8.1e-42
AWS73340.1|1933504_1934890_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	59.7	1.5e-153
AWS73341.1|1935412_1936426_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	67.5	1.5e-110
AWS73342.1|1936358_1937822_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.1	4.0e-149
AWS73343.1|1937834_1939133_-|terminase	PBSX family phage terminase large subunit	terminase	Q5G8Y7	Enterobacteria_phage	94.3	3.0e-241
AWS73344.1|1939116_1939584_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	73.8	1.5e-57
AWS73345.1|1939614_1940241_-	hypothetical protein	NA	I6S676	Salmonella_phage	84.9	8.4e-104
AWS73346.1|1940357_1940969_+	hypothetical protein	NA	NA	NA	NA	NA
AWS76526.1|1941090_1941549_+	hypothetical protein	NA	NA	NA	NA	NA
AWS73347.1|1941649_1941844_-	hypothetical protein	NA	NA	NA	NA	NA
AWS73348.1|1942122_1942590_-|lysis	lysis protein	lysis	A0A192Y689	Salmonella_phage	71.6	1.0e-53
AWS73349.1|1942586_1943117_-	lysozyme	NA	G9L6J6	Escherichia_phage	79.7	5.4e-80
AWS73350.1|1943119_1943368_-|lysis	lysis protein	lysis	NA	NA	NA	NA
AWS73351.1|1943795_1944320_+	hypothetical protein	NA	NA	NA	NA	NA
AWS73352.1|1944664_1945354_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.5	1.9e-56
AWS73353.1|1945350_1945491_-	YlcG family protein	NA	NA	NA	NA	NA
AWS73354.1|1945487_1946123_-	NinG family protein	NA	M9NYX8	Enterobacteria_phage	76.5	1.5e-79
AWS73355.1|1946115_1946286_-	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	5.7e-15
AWS73356.1|1946266_1946734_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	46.5	1.5e-33
AWS73357.1|1946924_1947182_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	74.0	6.4e-26
AWS73358.1|1947510_1947708_-	hypothetical protein	NA	NA	NA	NA	NA
AWS73359.1|1947700_1947967_-	eaa protein	NA	A0A077SLR0	Escherichia_phage	69.8	4.6e-27
AWS73360.1|1948978_1949497_-	hypothetical protein	NA	G9L6B3	Escherichia_phage	92.7	1.8e-91
AWS73361.1|1949999_1950197_-	hypothetical protein	NA	NA	NA	NA	NA
AWS73362.1|1950189_1950453_-	DUF4752 domain-containing protein	NA	T1S9K2	Salmonella_phage	75.6	1.3e-29
AWS73363.1|1950449_1950872_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	39.9	1.5e-11
AWS73364.1|1950868_1951171_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWS73365.1|1951167_1951905_-	Replication protein P	NA	A0A0K2FIT1	Enterobacteria_phage	55.2	6.9e-65
AWS76527.1|1951901_1952867_-	replication protein	NA	K7PGZ0	Enterobacteria_phage	78.9	5.1e-60
AWS73366.1|1952926_1953724_-	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	67.9	2.8e-88
AWS73367.1|1953809_1954031_-	transcriptional regulator	NA	NA	NA	NA	NA
AWS73368.1|1954070_1954304_-	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	70.4	3.0e-22
AWS73369.1|1954408_1955098_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	70.6	1.0e-86
AWS76528.1|1955120_1955240_+	hypothetical protein	NA	NA	NA	NA	NA
AWS73370.1|1955438_1956155_+	hypothetical protein	NA	NA	NA	NA	NA
AWS73371.1|1956145_1956691_+	PIN domain-containing protein	NA	NA	NA	NA	NA
AWS73372.1|1956739_1956943_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	1.0e-18
AWS73373.1|1957370_1957565_+	hypothetical protein	NA	NA	NA	NA	NA
AWS73374.1|1957654_1957939_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	81.9	1.7e-40
AWS73375.1|1957955_1958702_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	67.7	7.0e-65
AWS73376.1|1958698_1959322_+	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	59.2	5.8e-57
AWS73377.1|1959350_1959878_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.0	1.1e-56
AWS73378.1|1959874_1960093_+	conjugal transfer protein TraR	NA	A0A0N7C211	Escherichia_phage	52.2	4.4e-12
AWS76529.1|1960094_1960430_+	DNA-binding protein	NA	NA	NA	NA	NA
AWS76530.1|1960426_1961470_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	85.9	2.2e-178
AWS73379.1|1961539_1961863_-	hypothetical protein	NA	NA	NA	NA	NA
1961484:1961530	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AWS73380.1|1961901_1962768_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
AWS73381.1|1962769_1962982_+	hypothetical protein	NA	NA	NA	NA	NA
AWS73382.1|1963027_1964413_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 6
CP029738	Klebsiella pneumoniae strain AR_0087 chromosome, complete genome	5347404	4324638	4362308	5347404	transposase	Escherichia_phage(100.0%)	42	NA	NA
AWS75523.1|4324638_4325343_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWS75524.1|4326976_4327879_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AWS75525.1|4327916_4328150_-	hypothetical protein	NA	NA	NA	NA	NA
AWS75526.1|4328140_4328902_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AWS75527.1|4328922_4329783_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AWS75528.1|4329746_4329929_-	hypothetical protein	NA	NA	NA	NA	NA
AWS75529.1|4329919_4330624_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWS75530.1|4332257_4333160_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AWS75531.1|4333197_4333431_-	hypothetical protein	NA	NA	NA	NA	NA
AWS75532.1|4333421_4334183_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AWS75533.1|4334203_4335064_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AWS75534.1|4335027_4335210_-	hypothetical protein	NA	NA	NA	NA	NA
AWS75535.1|4335200_4335905_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWS75536.1|4338477_4338711_-	hypothetical protein	NA	NA	NA	NA	NA
AWS75537.1|4338701_4339463_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AWS75538.1|4339483_4340344_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AWS75539.1|4340307_4340490_-	hypothetical protein	NA	NA	NA	NA	NA
AWS75540.1|4340480_4341185_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWS75541.1|4342817_4343720_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AWS75542.1|4343757_4343991_-	hypothetical protein	NA	NA	NA	NA	NA
AWS75543.1|4343981_4344743_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AWS75544.1|4344763_4345624_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AWS75545.1|4345587_4345770_-	hypothetical protein	NA	NA	NA	NA	NA
AWS75546.1|4345760_4346465_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWS75547.1|4348098_4349001_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AWS75548.1|4349038_4349272_-	hypothetical protein	NA	NA	NA	NA	NA
AWS75549.1|4349262_4350024_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AWS75550.1|4350044_4350905_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AWS75551.1|4350868_4351051_-	hypothetical protein	NA	NA	NA	NA	NA
AWS75552.1|4351041_4351746_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWS75553.1|4353379_4354282_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AWS75554.1|4354319_4354553_-	hypothetical protein	NA	NA	NA	NA	NA
AWS75555.1|4354543_4355305_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AWS75556.1|4355325_4356186_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AWS75557.1|4356149_4356332_-	hypothetical protein	NA	NA	NA	NA	NA
AWS75558.1|4356322_4357027_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWS75559.1|4358660_4359563_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AWS75560.1|4359600_4359834_-	hypothetical protein	NA	NA	NA	NA	NA
AWS75561.1|4359824_4360586_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AWS75562.1|4360606_4361467_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AWS75563.1|4361430_4361613_-	hypothetical protein	NA	NA	NA	NA	NA
AWS75564.1|4361603_4362308_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 7
CP029738	Klebsiella pneumoniae strain AR_0087 chromosome, complete genome	5347404	5004804	5011707	5347404		Planktothrix_phage(33.33%)	6	NA	NA
AWS76653.1|5004804_5005668_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	7.4e-10
AWS76126.1|5005678_5006452_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
AWS76654.1|5006692_5007586_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
AWS76127.1|5007831_5009193_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
AWS76128.1|5009509_5010232_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AWS76129.1|5010228_5011707_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 8
CP029738	Klebsiella pneumoniae strain AR_0087 chromosome, complete genome	5347404	5052271	5060650	5347404		Enterobacteria_phage(28.57%)	7	NA	NA
AWS76156.1|5052271_5053678_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
AWS76157.1|5053901_5054966_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	2.6e-105
AWS76158.1|5054992_5055862_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	67.0	7.5e-111
AWS76159.1|5055893_5056784_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	3.7e-28
AWS76160.1|5056798_5057353_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
AWS76161.1|5057532_5058699_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
AWS76162.1|5059645_5060650_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.2	6.1e-32
>prophage 9
CP029738	Klebsiella pneumoniae strain AR_0087 chromosome, complete genome	5347404	5282359	5332782	5347404	tail,lysis,terminase,head	uncultured_Caudovirales_phage(26.67%)	71	NA	NA
AWS76364.1|5282359_5284003_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
AWS76365.1|5284052_5284529_-	N-acetyltransferase	NA	NA	NA	NA	NA
AWS76366.1|5284627_5285554_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWS76670.1|5285857_5287153_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	9.6e-62
AWS76367.1|5287167_5287974_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWS76368.1|5288214_5289477_-	DUF3596 domain-containing protein	NA	A0A286S1S8	Klebsiella_phage	95.0	1.7e-233
AWS76369.1|5289519_5289765_-	excisionase	NA	A0A286S2A4	Klebsiella_phage	92.1	1.9e-35
AWS76370.1|5289768_5289987_-	conjugal transfer protein TraR	NA	A0A0N7C211	Escherichia_phage	52.2	4.4e-12
AWS76371.1|5289983_5290511_-	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	62.2	1.3e-57
AWS76372.1|5290507_5290666_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	58.8	6.7e-10
AWS76373.1|5290662_5291349_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	90.6	4.8e-113
AWS76374.1|5291341_5291728_-	hypothetical protein	NA	A0A221SAP1	Ralstonia_phage	52.8	1.4e-16
AWS76375.1|5291958_5292804_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	58.8	2.6e-68
AWS76376.1|5292819_5293104_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	78.7	4.3e-39
AWS76377.1|5293193_5293388_-	hypothetical protein	NA	NA	NA	NA	NA
AWS76378.1|5293832_5294465_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	40.0	9.2e-34
AWS76379.1|5294564_5294780_+	XRE family transcriptional regulator	NA	Q716D6	Shigella_phage	60.9	4.2e-15
AWS76380.1|5294829_5295150_+	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	69.8	7.7e-37
AWS76381.1|5295236_5296034_+	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	67.9	2.8e-88
AWS76671.1|5296093_5297059_+	replication protein	NA	K7PGZ0	Enterobacteria_phage	78.9	5.1e-60
AWS76382.1|5297055_5297793_+	Replication protein P	NA	A0A0K2FIT1	Enterobacteria_phage	55.2	6.9e-65
AWS76383.1|5297789_5298092_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWS76384.1|5298088_5298511_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	39.9	1.5e-11
AWS76385.1|5298507_5298768_+	DUF4752 domain-containing protein	NA	T1S9K2	Salmonella_phage	75.6	1.6e-29
AWS76386.1|5299299_5299512_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
AWS76387.1|5299508_5299799_+	hypothetical protein	NA	F1C5B5	Cronobacter_phage	50.9	5.7e-07
AWS76672.1|5300140_5300554_+	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	34.6	1.1e-11
AWS76388.1|5300553_5300802_+	hypothetical protein	NA	NA	NA	NA	NA
AWS76389.1|5301054_5301510_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	68.2	4.0e-55
AWS76390.1|5301509_5301680_+	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.7e-14
AWS76391.1|5301672_5302311_+	hypothetical protein	NA	H6WRY9	Salmonella_phage	68.4	1.2e-73
AWS76392.1|5302307_5302448_+	YlcG family protein	NA	NA	NA	NA	NA
AWS76393.1|5302444_5303254_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	75.1	1.9e-116
AWS76394.1|5304439_5304754_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	6.3e-44
AWS76395.1|5304756_5305260_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	78.4	5.0e-75
AWS76396.1|5305256_5305724_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.5	7.5e-57
AWS76397.1|5305932_5306709_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	64.2	4.2e-12
AWS76398.1|5306659_5308060_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.2	7.2e-188
AWS76399.1|5308297_5309749_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.4	7.2e-191
AWS76673.1|5309804_5310353_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.9	1.0e-49
AWS76400.1|5310398_5310593_+	hypothetical protein	NA	NA	NA	NA	NA
AWS76401.1|5310602_5311805_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	52.8	5.3e-107
AWS76402.1|5311808_5312303_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	61.5	2.1e-49
AWS76403.1|5312314_5313256_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.4	7.8e-138
AWS76404.1|5313295_5313577_+	hypothetical protein	NA	NA	NA	NA	NA
AWS76405.1|5313545_5313965_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	61.5	1.1e-40
AWS76406.1|5313961_5314468_+	hypothetical protein	NA	A0A2H4J488	uncultured_Caudovirales_phage	37.2	2.4e-16
AWS76407.1|5314467_5314854_+|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	79.0	2.8e-49
AWS76408.1|5314948_5315389_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
AWS76409.1|5315392_5316538_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	77.2	6.3e-166
AWS76410.1|5316547_5316991_+	DUF3277 domain-containing protein	NA	A0A0M5M1K6	Salmonella_phage	80.0	2.1e-61
AWS76411.1|5316994_5317414_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	8.8e-41
AWS76674.1|5317455_5317608_+	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	84.0	1.4e-17
AWS76412.1|5317597_5319601_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.2	5.9e-244
AWS76413.1|5319600_5320200_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	58.1	9.9e-54
AWS76414.1|5320200_5320503_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.2	5.2e-27
AWS76415.1|5320505_5321528_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.0	3.5e-99
AWS76416.1|5321527_5321869_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	5.1e-23
AWS76417.1|5321911_5322130_-	Arc family DNA-binding protein	NA	A0A0M5M1J2	Salmonella_phage	41.8	3.6e-06
AWS76418.1|5322211_5322391_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
AWS76675.1|5322490_5323057_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	40.6	1.1e-30
AWS76419.1|5323129_5323882_+	hypothetical protein	NA	A0A0P0ZD96	Stx2-converting_phage	55.6	4.7e-61
AWS76420.1|5323969_5324623_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	7.7e-60
AWS76421.1|5324624_5324978_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	79.5	1.8e-50
AWS76422.1|5324977_5326177_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	75.3	1.3e-161
AWS76423.1|5326173_5326947_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	51.0	1.8e-68
AWS76424.1|5326946_5327720_+	hypothetical protein	NA	A0A248SL44	Klebsiella_phage	49.7	3.0e-26
AWS76425.1|5327738_5329718_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	28.0	6.9e-27
AWS76426.1|5329727_5330528_+	hypothetical protein	NA	NA	NA	NA	NA
AWS76427.1|5330979_5332464_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AWS76428.1|5332542_5332782_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	54.4	1.1e-16
>prophage 1
CP029739	Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence	175746	2774	76133	175746	transposase	Enterobacteria_phage(30.43%)	57	NA	NA
AWS76679.1|2774_3800_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWS76680.1|5674_6837_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	43.0	7.3e-53
AWS76681.1|7245_7650_-	DUF2251 domain-containing protein	NA	NA	NA	NA	NA
AWS76682.1|8331_8610_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AWS76683.1|8703_8916_-	hypothetical protein	NA	NA	NA	NA	NA
AWS76684.1|9807_10248_-	hypothetical protein	NA	NA	NA	NA	NA
AWS76802.1|11348_12272_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.7	6.2e-172
AWS76685.1|14392_15358_-	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AWS76686.1|15354_16173_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	8.8e-29
AWS76687.1|16177_16840_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWS76688.1|16836_17508_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWS76689.1|17531_18380_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWS76690.1|18536_19490_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.0	1.7e-10
AWS76691.1|19576_20788_+	creatininase	NA	NA	NA	NA	NA
AWS76692.1|21126_22050_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.4	6.9e-171
AWS76693.1|22112_22469_-	hypothetical protein	NA	A0A1B0VFY5	Salmonella_phage	91.6	2.7e-51
AWS76694.1|22534_23005_-	RES domain-containing protein	NA	NA	NA	NA	NA
AWS76695.1|23001_23445_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
AWS76696.1|24739_26968_-	hypothetical protein	NA	NA	NA	NA	NA
AWS76697.1|26964_28146_-	metallohydrolase	NA	NA	NA	NA	NA
AWS76698.1|28282_29137_+	WYL domain-containing protein	NA	NA	NA	NA	NA
AWS76699.1|29149_29668_+	hypothetical protein	NA	NA	NA	NA	NA
AWS76700.1|30566_31649_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	98.3	2.2e-189
AWS76701.1|31770_34845_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.1	0.0e+00
AWS76702.1|34896_36150_+	MFS transporter	NA	NA	NA	NA	NA
AWS76703.1|36206_36377_+	galactoside O-acetyltransferase	NA	NA	NA	NA	NA
AWS76704.1|36891_37815_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.2	1.0e-166
AWS76705.1|37818_38106_+	hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	3.2e-34
AWS76706.1|39493_39928_-	copper-binding protein	NA	NA	NA	NA	NA
AWS76707.1|40143_41544_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
AWS76708.1|41540_42221_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
AWS76709.1|42275_43205_-	copper resistance protein CopD	NA	NA	NA	NA	NA
AWS76710.1|43209_43590_-	copper resistance system chaperone PcoC	NA	NA	NA	NA	NA
AWS76711.1|43629_44526_-	copper resistance protein B	NA	NA	NA	NA	NA
AWS76712.1|44525_46343_-	multicopper oxidase PcoA	NA	NA	NA	NA	NA
AWS76713.1|46577_47027_+	copper resistance protein	NA	NA	NA	NA	NA
AWS76714.1|47315_48053_+	peptidase M23	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
AWS76715.1|48086_48284_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AWS76716.1|48324_50766_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.9	4.9e-83
AWS76717.1|50893_51334_-	hypothetical protein	NA	NA	NA	NA	NA
AWS76718.1|51420_54567_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.6	8.0e-62
AWS76719.1|54577_55870_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AWS76720.1|55983_56337_-	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWS76721.1|56365_57751_-	Cu(I)/Ag(I) efflux RND transporter outer membrane protein	NA	NA	NA	NA	NA
AWS76722.1|57940_58621_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
AWS76723.1|58613_60089_+	Cu(+)/Ag(+) sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
AWS76724.1|60339_60771_+	silver-binding protein SilE	NA	NA	NA	NA	NA
AWS76725.1|60914_61265_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	53.3	4.2e-20
AWS76803.1|61652_62561_-	HNH endonuclease	NA	NA	NA	NA	NA
AWS76726.1|63045_64071_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWS76727.1|64410_65334_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.7	6.2e-172
AWS76728.1|65429_65909_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.2	6.7e-69
AWS76729.1|66700_67624_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.4	9.6e-173
AWS76730.1|68763_69861_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	42.9	1.5e-60
AWS76731.1|71439_72456_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWS76732.1|73706_74243_+	plasmid transfer protein	NA	NA	NA	NA	NA
AWS76733.1|74561_76133_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
>prophage 2
CP029739	Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence	175746	79259	121808	175746	transposase	Enterobacteria_phage(21.43%)	37	NA	NA
AWS76737.1|79259_80270_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	53.5	1.1e-86
AWS76738.1|80299_80581_+	hypothetical protein	NA	NA	NA	NA	NA
AWS76739.1|80795_81044_-	hypothetical protein	NA	NA	NA	NA	NA
AWS76740.1|80999_82166_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	96.9	2.2e-222
AWS76741.1|82165_83137_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	7.0e-150
AWS76742.1|84512_84695_-	DUF4113 domain-containing protein	NA	A0A1W6JNT0	Morganella_phage	57.1	9.1e-11
AWS76743.1|84891_85332_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	2.6e-19
AWS76744.1|85328_85679_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
AWS76745.1|85709_87302_+|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.4	6.1e-175
AWS76746.1|87395_87851_+	hypothetical protein	NA	NA	NA	NA	NA
AWS76747.1|87910_88414_-	hypothetical protein	NA	NA	NA	NA	NA
AWS76748.1|88449_90018_-	hypothetical protein	NA	NA	NA	NA	NA
AWS76749.1|90068_91283_-	ABC transporter permease	NA	NA	NA	NA	NA
AWS76750.1|91272_91998_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.8	3.1e-17
AWS76751.1|91997_93965_-	VWA domain-containing protein	NA	NA	NA	NA	NA
AWS76804.1|93961_94927_-	hypothetical protein	NA	NA	NA	NA	NA
AWS76752.1|94974_97689_-	hypothetical protein	NA	NA	NA	NA	NA
AWS76753.1|97688_100757_-	virulence factor SrfB	NA	NA	NA	NA	NA
AWS76754.1|100774_102133_-	hypothetical protein	NA	NA	NA	NA	NA
AWS76805.1|102272_103385_-	tellurite resistance domain protein	NA	NA	NA	NA	NA
AWS76755.1|103466_103949_-	hypothetical protein	NA	NA	NA	NA	NA
AWS76756.1|104028_104766_-	hypothetical protein	NA	NA	NA	NA	NA
AWS76757.1|106129_107098_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	7.3e-14
AWS76758.1|108361_108805_+	hypothetical protein	NA	NA	NA	NA	NA
AWS76759.1|108814_109222_+	hypothetical protein	NA	NA	NA	NA	NA
AWS76760.1|109264_110224_+	DNA replication protein	NA	NA	NA	NA	NA
AWS76761.1|110358_111282_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
AWS76762.1|111377_112364_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.1	2.3e-172
AWS76763.1|112505_112829_+	hypothetical protein	NA	NA	NA	NA	NA
AWS76764.1|112980_113298_+	hypothetical protein	NA	NA	NA	NA	NA
AWS76765.1|113363_114500_-	recombinase	NA	NA	NA	NA	NA
AWS76766.1|114677_114932_+	hypothetical protein	NA	NA	NA	NA	NA
AWS76767.1|115300_116224_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	98.4	1.7e-174
AWS76768.1|116906_118430_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.7	8.1e-44
AWS76769.1|118723_119134_+	hypothetical protein	NA	NA	NA	NA	NA
AWS76770.1|119954_120353_-	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
AWS76771.1|120884_121808_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	97.4	5.1e-174
>prophage 1
CP029740	Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence	103250	23235	34765	103250	transposase	Stx2-converting_phage(37.5%)	17	NA	NA
AWS76842.1|23235_24057_-	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.1	1.2e-44
AWS76843.1|24876_25710_-	SAM-dependent DNA methyltransferase	NA	A0A2K9V411	Faecalibacterium_phage	33.5	1.8e-21
AWS76844.1|25760_25907_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
AWS76845.1|26001_26349_-	hypothetical protein	NA	NA	NA	NA	NA
AWS76846.1|26405_26759_-	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	64.2	5.0e-29
AWS76847.1|26760_26880_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AWS76848.1|27207_28779_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
AWS76849.1|28798_29146_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AWS76850.1|29145_29823_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AWS76851.1|29799_29898_+	copper resistance protein	NA	NA	NA	NA	NA
AWS76852.1|30095_30446_-	hypothetical protein	NA	NA	NA	NA	NA
AWS76853.1|30442_30715_-	hypothetical protein	NA	NA	NA	NA	NA
AWS76854.1|30762_31122_-	hypothetical protein	NA	NA	NA	NA	NA
AWS76855.1|31232_31556_-	theronine dehydrogenase	NA	I3UM57	Rhodobacter_phage	34.2	2.3e-09
AWS76856.1|31559_32282_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
AWS76857.1|32278_32710_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
AWS76858.1|32755_34765_-	hypothetical protein	NA	G8DH78	Emiliania_huxleyi_virus	27.4	1.5e-24
>prophage 2
CP029740	Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence	103250	43972	54997	103250	integrase	Escherichia_phage(37.5%)	12	49870:49882	56590:56602
AWS76873.1|43972_44674_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	1.6e-26
AWS76874.1|45110_45341_-	hypothetical protein	NA	NA	NA	NA	NA
AWS76875.1|45403_46075_-	Mediator of plasmid stability	NA	NA	NA	NA	NA
AWS76876.1|46077_47049_-	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
AWS76877.1|47297_48782_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AWS76878.1|48781_49033_-	hypothetical protein	NA	NA	NA	NA	NA
AWS76879.1|49191_49623_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
AWS76880.1|49622_50894_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.0	5.2e-153
49870:49882	attL	TGATGAACTGCCT	NA	NA	NA	NA
AWS76881.1|51305_52181_+	replication initiation protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
AWS76928.1|52821_53448_+	cobyrinic acid ac-diamide synthase	NA	A0A222YXS3	Escherichia_phage	43.6	2.9e-40
AWS76882.1|53567_53747_+	Par-like protein	NA	NA	NA	NA	NA
AWS76883.1|54202_54997_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
56590:56602	attR	AGGCAGTTCATCA	NA	NA	NA	NA
