The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	0	7017	5262516		Halovirus(100.0%)	5	NA	NA
AWS93755.1|436_1222_+	crotonobetainyl-CoA hydratase	NA	NA	NA	NA	NA
AWS93756.1|1282_1879_+	carnitine operon protein CaiE	NA	NA	NA	NA	NA
AWS93757.1|1955_2351_-	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
AWS93758.1|2625_5850_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
AWS93759.1|5868_7017_-	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	33.2	6.3e-49
>prophage 2
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	13192	23095	5262516	tRNA	Tupanvirus(25.0%)	8	NA	NA
AWS93767.1|13192_16009_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L9X8	Tupanvirus	26.0	2.3e-76
AWS93768.1|16046_16985_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
AWS93769.1|16992_17208_-	DUF2575 domain-containing protein	NA	NA	NA	NA	NA
AWS93770.1|17313_17577_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
AWS93771.1|17635_18535_-	transcriptional activator NhaR	NA	NA	NA	NA	NA
AWS93772.1|18573_19740_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.8	2.0e-90
AWS93773.1|19948_21085_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	37.1	8.5e-30
AWS93774.1|21172_23095_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.3	1.9e-146
>prophage 3
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	27509	28463	5262516		Synechococcus_phage(100.0%)	1	NA	NA
AWS93780.1|27509_28463_-	transaldolase	NA	A0A0E3G6C9	Synechococcus_phage	34.4	1.3e-10
>prophage 4
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	39660	41091	5262516		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
AWS93790.1|39660_41091_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.4	2.3e-08
>prophage 5
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	45030	50157	5262516		Bacillus_phage(33.33%)	4	NA	NA
AWS93797.1|45030_46968_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	38.0	4.7e-12
AWS93798.1|46873_47065_-	hypothetical protein	NA	NA	NA	NA	NA
AWS93799.1|47175_48843_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.6	1.1e-41
AWS93800.1|48924_50157_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.3	9.1e-86
>prophage 6
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	56684	58007	5262516		Geobacillus_virus(100.0%)	1	NA	NA
AWS93806.1|56684_58007_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.1	1.7e-77
>prophage 7
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	63574	66378	5262516		Salmonella_phage(50.0%)	3	NA	NA
AWS93812.1|63574_63754_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	66.0	1.8e-11
AWS93813.1|63863_64481_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
AWS93814.1|64788_66378_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.5	1.2e-29
>prophage 8
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	77602	78882	5262516		Salmonella_phage(50.0%)	2	NA	NA
AWS93827.1|77602_78142_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	60.6	1.1e-27
AWS93828.1|78144_78882_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	3.8e-63
>prophage 9
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	83022	84084	5262516		Tupanvirus(100.0%)	1	NA	NA
AWS93832.1|83022_84084_-	glucosamine--fructose-6-phosphate aminotransferase	NA	A0A2K9KZ81	Tupanvirus	24.8	4.7e-14
>prophage 10
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	91100	92123	5262516		Tupanvirus(100.0%)	1	NA	NA
AWS93838.1|91100_92123_-	galactonate oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	25.3	1.0e-10
>prophage 11
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	95358	97020	5262516		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AWS93842.1|95358_97020_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	72.3	6.0e-08
>prophage 12
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	102972	109266	5262516		Bodo_saltans_virus(50.0%)	3	NA	NA
AWS98474.1|102972_104592_+	DNA methyltransferase	NA	A0A2H4UVW8	Bodo_saltans_virus	22.0	4.2e-06
AWS93849.1|104581_105904_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AWS93850.1|105999_109266_+	type I restriction endonuclease	NA	A0A220A398	Liberibacter_phage	27.5	2.1e-49
>prophage 13
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	115352	117110	5262516	transposase	Sodalis_phage(50.0%)	2	NA	NA
AWS98475.1|115352_115859_-	hypothetical protein	NA	Q2A0A7	Sodalis_phage	45.6	2.0e-15
AWS93858.1|115836_117110_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.7	2.8e-146
>prophage 14
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	127218	131638	5262516		Enterobacteria_phage(50.0%)	4	NA	NA
AWS93867.1|127218_128226_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	49.3	9.1e-84
AWS93868.1|128414_128618_-	hypothetical protein	NA	NA	NA	NA	NA
AWS93869.1|129255_130029_-	FCD domain-containing protein	NA	NA	NA	NA	NA
AWS93870.1|130162_131638_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.8	2.0e-47
>prophage 15
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	148997	150290	5262516		Pseudomonas_phage(50.0%)	2	NA	NA
AWS93886.1|148997_149438_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	7.9e-16
AWS93887.1|149468_150290_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.3	2.6e-44
>prophage 16
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	172400	182412	5262516	integrase	Liberibacter_phage(50.0%)	6	178314:178330	184976:184992
AWS93913.1|172400_175784_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	25.8	3.7e-65
AWS93914.1|175840_176125_-	hypothetical protein	NA	NA	NA	NA	NA
AWS93915.1|176826_178962_-	type I restriction endonuclease subunit M	NA	A0A220A2U4	Liberibacter_phage	37.2	1.6e-85
178314:178330	attL	CGACCAGCATGCCGCCA	NA	NA	NA	NA
AWS93916.1|179139_179463_-	hypothetical protein	NA	NA	NA	NA	NA
AWS93917.1|179601_180879_-|integrase	integrase	integrase	B7SYF8	Stenotrophomonas_phage	42.4	1.1e-81
AWS93918.1|181392_182412_+	alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	32.0	2.4e-44
184976:184992	attR	TGGCGGCATGCTGGTCG	NA	NA	NA	NA
>prophage 17
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	187706	196652	5262516	tRNA	Klebsiella_phage(33.33%)	7	NA	NA
AWS98477.1|187706_189209_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	1.4e-83
AWS93924.1|189248_190331_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AWS93925.1|190330_191431_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AWS98478.1|191393_191588_+	hypothetical protein	NA	NA	NA	NA	NA
AWS93926.1|191697_193209_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.4	1.0e-46
AWS93927.1|193353_193797_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AWS93928.1|193796_196652_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.9	6.7e-140
>prophage 18
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	207580	208516	5262516		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AWS93942.1|207580_208516_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.2	2.5e-51
>prophage 19
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	212787	216832	5262516		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
AWS93948.1|212787_215496_-	magnesium-translocating P-type ATPase	NA	M1HM40	Paramecium_bursaria_Chlorella_virus	27.5	3.4e-45
AWS93949.1|215884_216832_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.2	3.9e-12
>prophage 20
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	220518	229626	5262516		Vibrio_phage(40.0%)	8	NA	NA
AWS93952.1|220518_222657_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.9	2.2e-268
AWS93953.1|222777_223242_+	anaerobic ribonucleotide reductase-activating protein	NA	K4F9T1	Cronobacter_phage	59.5	2.9e-53
AWS93954.1|223263_223785_-	hypothetical protein	NA	NA	NA	NA	NA
AWS93955.1|223784_225749_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.7	1.4e-43
AWS93956.1|225775_226057_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	60.2	5.2e-21
AWS93957.1|226046_226295_-	plasmid stabilization protein	NA	NA	NA	NA	NA
AWS93958.1|226442_227078_-	hypothetical protein	NA	NA	NA	NA	NA
AWS93959.1|227103_229626_-	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	32.7	4.0e-80
>prophage 21
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	277864	285632	5262516		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
AWS94001.1|277864_278863_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.4	2.8e-69
AWS94002.1|278974_280087_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.7	1.7e-14
AWS94003.1|280190_281192_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
AWS98482.1|281178_282204_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AWS94004.1|282214_283717_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.9	6.2e-12
AWS94005.1|283838_284795_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWS94006.1|285104_285632_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	3.2e-56
>prophage 22
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	301360	302932	5262516		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AWS94018.1|301360_302932_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.1	2.3e-09
>prophage 23
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	323598	328040	5262516		Lactococcus_phage(50.0%)	4	NA	NA
AWS94043.1|323598_326061_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.5	2.7e-65
AWS94044.1|326099_326525_-	HTH-type transcriptional repressor NsrR	NA	NA	NA	NA	NA
AWS94045.1|326505_326847_+	hypothetical protein	NA	NA	NA	NA	NA
AWS94046.1|326741_328040_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.6	2.9e-66
>prophage 24
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	333494	336689	5262516		Wolbachia_phage(50.0%)	2	NA	NA
AWS94053.1|333494_335348_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.0	9.9e-60
AWS94054.1|335357_336689_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	29.6	2.5e-17
>prophage 25
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	340755	341301	5262516		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AWS94058.1|340755_341301_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	5.0e-28
>prophage 26
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	348660	349638	5262516		Tupanvirus(100.0%)	1	NA	NA
AWS94063.1|348660_349638_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.1	8.1e-29
>prophage 27
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	355539	356073	5262516		Morganella_phage(100.0%)	1	NA	NA
AWS94070.1|355539_356073_+	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	54.8	7.2e-48
>prophage 28
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	361097	363081	5262516		Vibrio_phage(50.0%)	2	NA	NA
AWS94079.1|361097_362744_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.3	1.3e-188
AWS94080.1|362787_363081_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	1.2e-12
>prophage 29
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	371691	375324	5262516		Stx2-converting_phage(66.67%)	3	NA	NA
AWS94088.1|371691_372957_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	39.1	1.3e-79
AWS94089.1|374404_374980_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	37.0	1.5e-14
AWS94090.1|374976_375324_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	1.2e-43
>prophage 30
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	384444	386350	5262516	transposase	Escherichia_phage(50.0%)	3	NA	NA
AWS94097.1|384444_385149_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWS94098.1|385182_385611_-	cytochrome C	NA	NA	NA	NA	NA
AWS94099.1|385639_386350_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	3.7e-31
>prophage 31
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	391773	393851	5262516		Bacillus_phage(100.0%)	2	NA	NA
AWS94105.1|391773_393174_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.6	3.2e-18
AWS94106.1|393170_393851_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
>prophage 32
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	398945	402408	5262516		Listeria_phage(50.0%)	3	NA	NA
AWS94112.1|398945_399683_+	peptidase	NA	A8ATH6	Listeria_phage	41.0	1.0e-12
AWS94113.1|399716_399914_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AWS94114.1|399954_402408_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.9	7.6e-84
>prophage 33
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	409581	413768	5262516	transposase	Bacillus_phage(66.67%)	4	NA	NA
AWS94121.1|409581_410262_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.7	7.8e-31
AWS94122.1|410254_411730_+	Cu(+)/Ag(+) sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.7	1.8e-27
AWS94123.1|411980_412412_+	silver-binding protein SilE	NA	NA	NA	NA	NA
AWS94124.1|412620_413768_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.2	1.9e-146
>prophage 34
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	420511	422066	5262516		Yersinia_phage(50.0%)	3	NA	NA
AWS94131.1|420511_421330_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.4	1.2e-46
AWS94132.1|421329_421593_+	hypothetical protein	NA	NA	NA	NA	NA
AWS94133.1|421589_422066_+	restriction endonuclease	NA	A0A1S5R3R9	Pseudomonas_phage	31.1	2.6e-09
>prophage 35
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	447538	449041	5262516		Burkholderia_virus(100.0%)	1	NA	NA
AWS94149.1|447538_449041_-	proline/glycine betaine transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.7	1.2e-55
>prophage 36
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	455609	456398	5262516		Pithovirus(100.0%)	1	NA	NA
AWS94155.1|455609_456398_+	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.3	5.0e-13
>prophage 37
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	461979	471577	5262516		Escherichia_phage(40.0%)	12	NA	NA
AWS94163.1|461979_462738_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	27.8	3.0e-15
AWS94164.1|462845_463526_+	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	3.2e-08
AWS94165.1|463522_464659_+	alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase	NA	NA	NA	NA	NA
AWS94166.1|464661_465216_+	ribose 1,5-bisphosphokinase	NA	NA	NA	NA	NA
AWS94167.1|465202_465637_+	aminoalkylphosphonate N-acetyltransferase	NA	NA	NA	NA	NA
AWS94168.1|465645_466404_+	phosphonate metabolism protein PhnP	NA	NA	NA	NA	NA
AWS94169.1|466455_466797_-	addiction module antidote protein, HigA family	NA	A0A222YWD7	Escherichia_phage	81.8	6.2e-45
AWS94170.1|466817_467120_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	77.0	2.2e-41
AWS94171.1|467275_467605_-	hypothetical protein	NA	NA	NA	NA	NA
AWS94172.1|467674_469939_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
AWS94173.1|469940_470048_-	histidine kinase	NA	NA	NA	NA	NA
AWS94174.1|470053_471577_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	7.2e-16
>prophage 38
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	488876	490835	5262516		Staphylococcus_phage(100.0%)	1	NA	NA
AWS94191.1|488876_490835_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.3	4.6e-92
>prophage 39
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	497015	498365	5262516		Moraxella_phage(100.0%)	1	NA	NA
AWS94199.1|497015_498365_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.1	5.2e-159
>prophage 40
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	502330	511425	5262516		Enterobacteria_phage(25.0%)	7	NA	NA
AWS94204.1|502330_502855_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	94.7	2.7e-55
AWS94205.1|503106_505929_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.5	5.2e-312
AWS94206.1|506014_506371_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
AWS94207.1|506497_507211_-	class B acid phosphatase	NA	NA	NA	NA	NA
AWS94208.1|507456_508650_-	aromatic amino acid transaminase	NA	NA	NA	NA	NA
AWS94209.1|508784_509864_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.2	3.4e-28
AWS94210.1|510009_511425_-	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	77.9	1.8e-199
>prophage 41
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	517079	517688	5262516		Lactococcus_phage(100.0%)	1	NA	NA
AWS94217.1|517079_517688_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 42
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	524884	525994	5262516		Mycoplasma_phage(100.0%)	1	NA	NA
AWS94224.1|524884_525994_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
>prophage 43
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	544324	550313	5262516	transposase	uncultured_Caudovirales_phage(83.33%)	7	NA	NA
AWS94242.1|544324_544498_+	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	51.8	5.2e-08
AWS94243.1|545297_546570_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.7	2.8e-146
AWS94244.1|546718_547309_+	N-acetyltransferase	NA	NA	NA	NA	NA
AWS94245.1|547436_547862_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	71.4	2.1e-50
AWS94246.1|547874_549164_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.1	1.2e-168
AWS94247.1|549208_549529_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	45.7	2.9e-20
AWS94248.1|549614_550313_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.1	3.8e-89
>prophage 44
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	556004	562735	5262516		Brucella_phage(50.0%)	4	NA	NA
AWS94253.1|556004_556283_+	putative addiction module antidote protein	NA	A0A141GEX5	Brucella_phage	50.0	3.3e-12
AWS94254.1|556392_557082_+	dipeptidase PepE	NA	NA	NA	NA	NA
AWS94255.1|557209_558838_-	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
AWS94256.1|559051_562735_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	3.7e-26
>prophage 45
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	576230	577820	5262516		Prochlorococcus_phage(100.0%)	1	NA	NA
AWS94263.1|576230_577820_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/inosine monophosphate cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	48.1	2.9e-68
>prophage 46
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	583314	585078	5262516		Bacillus_phage(50.0%)	3	NA	NA
AWS94268.1|583314_583587_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	57.8	5.5e-20
AWS94269.1|583773_584364_-	DUF416 domain-containing protein	NA	NA	NA	NA	NA
AWS94270.1|584397_585078_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	29.2	9.6e-21
>prophage 47
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	590440	591199	5262516		Catovirus(100.0%)	1	NA	NA
AWS94276.1|590440_591199_+	molybdopterin biosynthesis protein MoeB	NA	A0A1V0SAV8	Catovirus	29.1	2.0e-11
>prophage 48
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	594842	610256	5262516		Vibrio_phage(20.0%)	11	NA	NA
AWS94282.1|594842_599066_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.5	7.7e-68
AWS94283.1|599142_603171_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.4	1.6e-22
AWS94284.1|603491_603857_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
AWS94285.1|603923_604421_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
AWS94286.1|604714_605422_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
AWS94287.1|605425_605854_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
AWS94288.1|606011_606557_-	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	29.6	1.1e-14
AWS94289.1|606558_606942_-	protein translocase subunit SecE	NA	NA	NA	NA	NA
AWS94290.1|607172_608357_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	7.5e-13
AWS94291.1|608957_609185_-	hypothetical protein	NA	NA	NA	NA	NA
AWS98493.1|609305_610256_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
>prophage 49
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	618996	620835	5262516		Acinetobacter_phage(100.0%)	1	NA	NA
AWS94295.1|618996_620835_-	vitamin B12/cobalamin outer membrane transporter	NA	A0A0P0I887	Acinetobacter_phage	31.4	3.1e-13
>prophage 50
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	636794	637457	5262516		Synechococcus_phage(100.0%)	1	NA	NA
AWS94308.1|636794_637457_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	1.7e-30
>prophage 51
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	658679	660011	5262516		Erwinia_phage(100.0%)	1	NA	NA
AWS94327.1|658679_660011_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.7	5.8e-46
>prophage 52
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	667306	668152	5262516		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AWS94335.1|667306_668152_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.7	1.2e-15
>prophage 53
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	682412	684481	5262516		Feldmannia_irregularis_virus(50.0%)	2	NA	NA
AWS94350.1|682412_683111_+	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	29.5	2.6e-05
AWS94351.1|683107_684481_+	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	5.0e-16
>prophage 54
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	690761	691382	5262516		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
AWS94356.1|690761_691382_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	57.4	7.8e-62
>prophage 55
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	712127	713036	5262516		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
AWS94380.1|712127_713036_+	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	31.1	1.9e-24
>prophage 56
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	716619	719416	5262516		Escherichia_phage(50.0%)	3	NA	NA
AWS94387.1|716619_717423_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.6	8.4e-24
AWS94388.1|717456_718353_-	sugar kinase	NA	NA	NA	NA	NA
AWS94389.1|718519_719416_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	93.8	1.0e-62
>prophage 57
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	731949	732999	5262516		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
AWS94398.1|731949_732999_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	4.5e-09
>prophage 58
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	738332	741119	5262516		Enterococcus_phage(100.0%)	1	NA	NA
AWS94402.1|738332_741119_-	DNA polymerase I	NA	A8E2B3	Enterococcus_phage	30.5	1.3e-47
>prophage 59
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	753258	753873	5262516		Streptococcus_phage(100.0%)	1	NA	NA
AWS94411.1|753258_753873_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	45.7	2.1e-19
>prophage 60
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	764858	768178	5262516		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
AWS94421.1|764858_765650_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.4	4.7e-27
AWS94422.1|765652_766201_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
AWS94423.1|766204_766459_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
AWS94424.1|766537_768178_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.5	9.7e-43
>prophage 61
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	780713	782543	5262516		Catovirus(100.0%)	1	NA	NA
AWS94437.1|780713_782543_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	38.3	8.2e-83
>prophage 62
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	786560	790430	5262516		Bacillus_phage(100.0%)	3	NA	NA
AWS94442.1|786560_788723_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.7	3.5e-117
AWS94443.1|788811_789528_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
AWS94444.1|789527_790430_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.5	2.1e-23
>prophage 63
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	806901	811100	5262516		uncultured_marine_virus(33.33%)	4	NA	NA
AWS94459.1|806901_808032_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	39.4	1.7e-17
AWS94460.1|808036_808714_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
AWS94461.1|808710_809973_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	26.5	7.7e-24
AWS94462.1|809969_811100_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	26.8	1.9e-26
>prophage 64
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	815145	821384	5262516		Indivirus(25.0%)	5	NA	NA
AWS94467.1|815145_815475_-	thiol reductase thioredoxin	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
AWS94468.1|815606_816875_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	8.3e-42
AWS94469.1|817008_818490_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
AWS94470.1|818527_820552_-	ATP-dependent DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.8	4.9e-113
AWS94471.1|820655_821384_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	33.5	7.1e-22
>prophage 65
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	832652	834299	5262516		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AWS94481.1|832652_834299_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	32.0	2.4e-65
>prophage 66
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	849617	853611	5262516		Tupanvirus(50.0%)	3	NA	NA
AWS98504.1|849617_851123_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	21.7	7.6e-18
AWS94491.1|851130_851550_-	D-ribose pyranase	NA	NA	NA	NA	NA
AWS94492.1|851742_853611_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.5	1.9e-66
>prophage 67
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	856885	857878	5262516		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
AWS94495.1|856885_857878_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	38.0	1.0e-50
>prophage 68
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	870165	880743	5262516		Chrysochromulina_ericina_virus(20.0%)	9	NA	NA
AWS94509.1|870165_871536_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	38.4	8.7e-37
AWS94510.1|871761_873591_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	41.4	1.4e-122
AWS94511.1|873925_874966_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	35.8	1.6e-46
AWS94512.1|875110_876070_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
AWS94513.1|876069_876960_+	phosphate ABC transporter permease PtsA	NA	NA	NA	NA	NA
AWS94514.1|877006_877780_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	30.6	3.4e-14
AWS94515.1|877794_878520_+	phosphate transport system regulator PhoU	NA	NA	NA	NA	NA
AWS94516.1|878572_879238_-	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
AWS94517.1|879405_880743_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.6	1.1e-63
>prophage 69
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	887722	895091	5262516		Staphylococcus_phage(33.33%)	7	NA	NA
AWS94524.1|887722_887980_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
AWS94525.1|887943_888303_-	ribonuclease P protein component	NA	NA	NA	NA	NA
AWS94526.1|888320_888461_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
AWS94527.1|889066_890470_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
AWS94528.1|890474_891575_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	1.1e-53
AWS94529.1|891574_892648_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
AWS94530.1|892676_895091_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.4	2.4e-114
>prophage 70
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	901565	902500	5262516		Cyanophage(50.0%)	2	NA	NA
AWS94536.1|901565_901979_+	heat-shock protein IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.8e-17
AWS94537.1|902071_902500_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	37.3	1.6e-13
>prophage 71
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	911568	916410	5262516		Salmonella_phage(50.0%)	5	NA	NA
AWS94545.1|911568_912753_-	multidrug transporter EmrD	NA	S4TR35	Salmonella_phage	24.8	4.3e-16
AWS94546.1|912946_913780_-	EamA family transporter	NA	NA	NA	NA	NA
AWS94547.1|913903_913993_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
AWS94548.1|914515_914614_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
AWS94549.1|914721_916410_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.9	1.2e-56
>prophage 72
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	928227	929610	5262516		Pandoravirus(100.0%)	1	NA	NA
AWS94561.1|928227_929610_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	27.4	3.4e-41
>prophage 73
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	938163	942844	5262516	transposase	Sodalis_phage(33.33%)	5	NA	NA
AWS94571.1|938163_939078_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	50.9	3.4e-69
AWS94572.1|939202_940021_+	lipoprotein NlpA	NA	NA	NA	NA	NA
AWS94573.1|940047_940950_-	EamA family transporter	NA	NA	NA	NA	NA
AWS94574.1|940975_941920_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	26.0	3.8e-15
AWS94575.1|942067_942844_+	SDR family NAD(P)-dependent oxidoreductase	NA	A0A0M4JSW6	Mollivirus	25.5	1.6e-11
>prophage 74
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	950795	953600	5262516		Escherichia_phage(100.0%)	1	NA	NA
AWS94583.1|950795_953600_+	intestinal colonization autotransporter adhesin MisL	NA	A0A2L1IV18	Escherichia_phage	48.7	7.8e-101
>prophage 75
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	974306	975698	5262516		environmental_Halophage(100.0%)	1	NA	NA
AWS94601.1|974306_975698_-	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	95.9	2.5e-68
>prophage 76
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	979950	984975	5262516		Bordetella_phage(33.33%)	5	NA	NA
AWS94605.1|979950_982062_-	guanosine-3',5'-bis(diphosphate) 3'-diphosphatase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
AWS94606.1|982080_982356_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AWS94607.1|982410_983034_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.0	1.1e-18
AWS94608.1|983099_983297_-	hypothetical protein	NA	NA	NA	NA	NA
AWS94609.1|983295_984975_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	23.5	4.2e-25
>prophage 77
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	988524	996952	5262516	holin,integrase	Morganella_phage(50.0%)	11	992158:992174	1001496:1001512
AWS94616.1|988524_991284_-	DNA primase	NA	A0A1W6JPG0	Morganella_phage	58.6	4.4e-298
AWS94617.1|991298_991925_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	34.7	1.7e-24
AWS94618.1|991921_992134_-	hypothetical protein	NA	NA	NA	NA	NA
AWS94619.1|992130_992394_-|holin	nicotinic acetylcholine receptor subunit beta	holin	NA	NA	NA	NA
992158:992174	attL	GGCCATATCGACAATCG	NA	NA	NA	NA
AWS94620.1|992390_992570_-	hypothetical protein	NA	NA	NA	NA	NA
AWS94621.1|993272_993446_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AWS94622.1|993438_994248_-	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	41.9	8.2e-27
AWS94623.1|994261_994450_-	hypothetical protein	NA	NA	NA	NA	NA
AWS94624.1|994449_994668_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AWS94625.1|994781_995579_-	hypothetical protein	NA	NA	NA	NA	NA
AWS94626.1|995692_996952_-|integrase	integrase	integrase	A0A1W6JPG6	Morganella_phage	79.9	2.1e-199
1001496:1001512	attR	GGCCATATCGACAATCG	NA	NA	NA	NA
>prophage 78
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1000366	1004939	5262516		Xanthomonas_phage(25.0%)	7	NA	NA
AWS98509.1|1000366_1000822_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	60.1	1.6e-48
AWS98510.1|1000802_1002023_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.1	1.2e-42
AWS94632.1|1002194_1002860_+	JAB domain-containing protein	NA	NA	NA	NA	NA
AWS94633.1|1003078_1003315_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
AWS94634.1|1003335_1003503_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
AWS94635.1|1003601_1004411_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	31.2	2.6e-25
AWS94636.1|1004459_1004939_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.2	6.3e-27
>prophage 79
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1017018	1026376	5262516		Prochlorococcus_phage(16.67%)	10	NA	NA
AWS94647.1|1017018_1017951_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.1	1.0e-36
AWS94648.1|1018165_1019362_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	28.9	2.1e-34
AWS94649.1|1019371_1020397_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	80.8	2.3e-18
AWS94650.1|1020590_1021628_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	32.2	1.9e-12
AWS94651.1|1021628_1022552_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AWS94652.1|1022555_1023839_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.8e-07
AWS94653.1|1023848_1025393_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
AWS94654.1|1025359_1025581_-	hypothetical protein	NA	NA	NA	NA	NA
AWS94655.1|1025640_1026072_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AWS94656.1|1026124_1026376_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	53.4	2.2e-15
>prophage 80
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1043933	1045781	5262516	tRNA	Tupanvirus(100.0%)	1	NA	NA
AWS94674.1|1043933_1045781_+|tRNA	selenocysteinyl-tRNA-specific translation elongation factor SelB	tRNA	A0A2K9KZ60	Tupanvirus	25.1	8.1e-14
>prophage 81
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1071430	1072426	5262516		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
AWS98512.1|1071430_1072426_-	O-acetyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.2	8.3e-13
>prophage 82
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1076779	1076992	5262516		Morganella_phage(100.0%)	1	NA	NA
AWS94703.1|1076779_1076992_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 83
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1084785	1087119	5262516		Escherichia_phage(100.0%)	1	NA	NA
AWS94712.1|1084785_1087119_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.1	9.8e-73
>prophage 84
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1097085	1099070	5262516		Planktothrix_phage(50.0%)	2	NA	NA
AWS94723.1|1097085_1098069_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	2.5e-14
AWS94724.1|1098065_1099070_+	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.4	7.3e-17
>prophage 85
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1135276	1137319	5262516		Indivirus(100.0%)	1	NA	NA
AWS94753.1|1135276_1137319_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.5	4.1e-43
>prophage 86
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1147592	1149065	5262516		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
AWS94764.1|1147592_1149065_-	fructuronate reductase	NA	E5EQS6	Micromonas_sp._RCC1109_virus	30.4	4.2e-45
>prophage 87
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1162990	1167215	5262516		Anomala_cuprea_entomopoxvirus(50.0%)	3	NA	NA
AWS94775.1|1162990_1165738_+	multidrug ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.0	3.9e-20
AWS94776.1|1165737_1166862_+	ABC transporter permease	NA	NA	NA	NA	NA
AWS94777.1|1166939_1167215_+	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	47.6	3.2e-15
>prophage 88
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1173275	1177331	5262516		Dickeya_phage(50.0%)	4	NA	NA
AWS94786.1|1173275_1173941_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	54.9	1.5e-58
AWS94787.1|1174109_1174355_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	4.7e-10
AWS94788.1|1174430_1176629_-	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	38.0	1.1e-118
AWS94789.1|1176704_1177331_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	60.2	1.8e-29
>prophage 89
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1180599	1183443	5262516		Staphylococcus_phage(50.0%)	3	NA	NA
AWS94794.1|1180599_1181268_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	1.1e-13
AWS98515.1|1181260_1182319_+	cell division protein FtsX	NA	NA	NA	NA	NA
AWS94795.1|1182588_1183443_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	42.3	5.4e-45
>prophage 90
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1189162	1190661	5262516		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
AWS94800.1|1189162_1189930_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.5	4.9e-13
AWS94801.1|1189947_1190661_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	1.8e-14
>prophage 91
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1194975	1196786	5262516		Planktothrix_phage(50.0%)	2	NA	NA
AWS94807.1|1194975_1196046_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.0	4.4e-20
AWS94808.1|1196042_1196786_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.3	3.7e-10
>prophage 92
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1216694	1219142	5262516		Dickeya_phage(100.0%)	1	NA	NA
AWS94827.1|1216694_1219142_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	82.1	3.6e-33
>prophage 93
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1226409	1228803	5262516		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
AWS94834.1|1226409_1228803_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	4.7e-14
>prophage 94
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1241609	1245375	5262516		Bacillus_phage(66.67%)	3	NA	NA
AWS94845.1|1241609_1242329_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
AWS94846.1|1242325_1243678_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.9	5.0e-13
AWS94847.1|1243752_1245375_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	53.1	5.3e-142
>prophage 95
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1260639	1261476	5262516		Vibrio_phage(100.0%)	1	NA	NA
AWS94861.1|1260639_1261476_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 96
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1272861	1276915	5262516		Acinetobacter_phage(50.0%)	3	NA	NA
AWS94874.1|1272861_1273425_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	57.9	3.2e-62
AWS94875.1|1273510_1274728_+	bifunctional succinylornithine transaminase/acetylornithine transaminase	NA	NA	NA	NA	NA
AWS94876.1|1274827_1276915_-	hypothetical protein	NA	H9YQA8	environmental_Halophage	89.1	6.5e-68
>prophage 97
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1280652	1283928	5262516		Bacillus_virus(33.33%)	3	NA	NA
AWS98519.1|1280652_1281372_-	NUDIX domain-containing protein	NA	G3MA14	Bacillus_virus	27.9	1.1e-19
AWS94882.1|1281562_1282423_+	ribose-phosphate pyrophosphokinase	NA	A0A2P1CBA5	Salmonella_phage	40.6	1.1e-48
AWS94883.1|1282437_1283928_+	nicotinate phosphoribosyltransferase	NA	A0A218KC49	Bacillus_phage	52.2	1.5e-143
>prophage 98
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1288709	1294127	5262516		Salmonella_phage(50.0%)	5	NA	NA
AWS94889.1|1288709_1289669_+	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	91.1	7.1e-54
AWS94890.1|1289672_1290293_+	phosphoribosyl-dephospho-CoA transferase	NA	NA	NA	NA	NA
AWS94891.1|1290289_1291186_+	malonate decarboxylase subunit epsilon	NA	NA	NA	NA	NA
AWS98520.1|1291276_1292209_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWS94892.1|1292225_1294127_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	34.1	3.8e-75
>prophage 99
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1299872	1305444	5262516		uncultured_Caudovirales_phage(33.33%)	7	NA	NA
AWS94900.1|1299872_1300259_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	3.3e-18
AWS94901.1|1300258_1300618_+	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
AWS94902.1|1300625_1300913_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
AWS94903.1|1301038_1301413_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
AWS94904.1|1301508_1301979_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
AWS94905.1|1302075_1304190_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.9	1.1e-57
AWS94906.1|1304259_1305444_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	7.5e-13
>prophage 100
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1317408	1319403	5262516		Vibrio_phage(100.0%)	1	NA	NA
AWS94919.1|1317408_1319403_-	type II secretion system protein GspD	NA	R9TEZ5	Vibrio_phage	34.9	2.3e-30
>prophage 101
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1340602	1342074	5262516	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
AWS94957.1|1340602_1341550_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	36.9	1.7e-07
AWS94958.1|1341564_1342074_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	1.8e-19
>prophage 102
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1352530	1356686	5262516		Bacillus_virus(50.0%)	4	NA	NA
AWS94966.1|1352530_1353289_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	3.1e-20
AWS94967.1|1353296_1354400_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWS94968.1|1354409_1355591_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWS94969.1|1355660_1356686_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	38.0	2.6e-70
>prophage 103
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1363282	1364167	5262516		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AWS94975.1|1363282_1364167_-	adenine-specific DNA-methyltransferase	NA	A0A0P0CJX0	Ostreococcus_lucimarinus_virus	31.1	3.1e-27
>prophage 104
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1376812	1377856	5262516		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AWS94988.1|1376812_1377856_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 105
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1395551	1396919	5262516	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AWS95003.1|1395551_1396919_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	2.5e-20
>prophage 106
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1400818	1401322	5262516	protease	Pseudomonas_phage(100.0%)	1	NA	NA
AWS95010.1|1400818_1401322_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	9.6e-26
>prophage 107
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1405033	1406524	5262516		Burkholderia_virus(100.0%)	1	NA	NA
AWS95014.1|1405033_1406524_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	23.5	4.1e-08
>prophage 108
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1417411	1431500	5262516		Staphylococcus_phage(25.0%)	16	NA	NA
AWS95020.1|1417411_1418341_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	32.8	5.2e-17
AWS95021.1|1418550_1420887_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.1	7.6e-41
AWS95022.1|1421116_1421770_+	isoprenoid biosynthesis protein ElbB	NA	NA	NA	NA	NA
AWS95023.1|1421766_1422486_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AWS95024.1|1422552_1422825_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AWS95025.1|1422821_1423676_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
AWS95026.1|1423721_1424213_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AWS95027.1|1424296_1424584_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	43.2	5.5e-10
AWS95028.1|1424606_1426040_-	RNA polymerase sigma-54 factor	NA	NA	NA	NA	NA
AWS95029.1|1426086_1426812_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
AWS95030.1|1426818_1427367_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
AWS95031.1|1427335_1427911_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AWS95032.1|1427907_1428474_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	76.3	4.2e-54
AWS95033.1|1428494_1429481_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.2	4.3e-38
AWS95034.1|1429494_1430472_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
AWS95035.1|1430687_1431500_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	30.7	2.2e-19
>prophage 109
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1435592	1437073	5262516		Vibrio_phage(50.0%)	2	NA	NA
AWS95041.1|1435592_1435877_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	65.7	4.6e-17
AWS98525.1|1436101_1437073_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	26.2	1.6e-08
>prophage 110
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1446145	1451520	5262516	protease	Micromonas_pusilla_virus(33.33%)	4	NA	NA
AWS95052.1|1446145_1448080_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	4.1e-117
AWS95053.1|1448179_1449028_+	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	31.2	1.3e-19
AWS95054.1|1449020_1450358_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AWS95055.1|1450803_1451520_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	Q8LTI3	Vibrio_virus	33.0	1.4e-14
>prophage 111
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1461799	1470598	5262516		Rhodococcus_phage(33.33%)	7	NA	NA
AWS95065.1|1461799_1463113_+	hypothetical protein	NA	G9FHH0	Rhodococcus_phage	33.7	1.2e-06
AWS95066.1|1463327_1463660_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
AWS95067.1|1463726_1463945_+	hypothetical protein	NA	NA	NA	NA	NA
AWS95068.1|1463952_1465296_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	93.7	4.8e-64
AWS95069.1|1465902_1466367_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
AWS95070.1|1466395_1467883_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
AWS95071.1|1467907_1470598_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	3.3e-24
>prophage 112
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1476214	1478191	5262516		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AWS95077.1|1476214_1478191_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	4.7e-52
>prophage 113
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1483975	1490668	5262516		Diadromus_pulchellus_ascovirus(25.0%)	9	NA	NA
AWS95084.1|1483975_1484275_-	GIY-YIG nuclease family protein	NA	F2NZ06	Diadromus_pulchellus_ascovirus	51.2	2.2e-14
AWS95085.1|1484327_1484771_+	hypothetical protein	NA	NA	NA	NA	NA
AWS95086.1|1484750_1485269_-	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.6	2.6e-10
AWS95087.1|1485397_1486033_+	hypothetical protein	NA	NA	NA	NA	NA
AWS95088.1|1486126_1486702_-	osmotically-inducible protein OsmY	NA	NA	NA	NA	NA
AWS95089.1|1486711_1487302_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.8	3.2e-12
AWS95090.1|1487336_1487732_-	YraN family protein	NA	NA	NA	NA	NA
AWS95091.1|1487689_1489741_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
AWS95092.1|1489804_1490668_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	5.6e-50
>prophage 114
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1504772	1505918	5262516		Streptococcus_phage(100.0%)	1	NA	NA
AWS95108.1|1504772_1505918_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	39.5	1.0e-46
>prophage 115
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1511743	1514038	5262516		Tetraselmis_virus(100.0%)	1	NA	NA
AWS95112.1|1511743_1514038_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	40.7	2.4e-156
>prophage 116
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1534918	1535887	5262516		Enterobacteria_phage(100.0%)	1	NA	NA
AWS95134.1|1534918_1535887_-	TerC family protein	NA	I7HPH5	Enterobacteria_phage	31.8	4.5e-32
>prophage 117
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1541238	1548376	5262516		Klosneuvirus(33.33%)	6	NA	NA
AWS95139.1|1541238_1542714_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.7	3.7e-33
AWS95140.1|1543048_1544569_+	PAS domain S-box protein	NA	A0A1B0V854	Salmonella_phage	49.3	2.2e-33
AWS95141.1|1544621_1545293_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AWS95142.1|1545532_1546306_+	siderophore-interacting protein	NA	NA	NA	NA	NA
AWS95143.1|1546306_1547155_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWS95144.1|1547221_1548376_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.8	6.1e-84
>prophage 118
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1570849	1576424	5262516	tRNA	Vibrio_phage(33.33%)	4	NA	NA
AWS95162.1|1570849_1572694_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
AWS95163.1|1572978_1574724_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.8	8.4e-77
AWS95164.1|1574958_1575174_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AWS95165.1|1575410_1576424_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.2e-109
>prophage 119
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1588055	1591427	5262516		Peridroma_alphabaculovirus(50.0%)	2	NA	NA
AWS95180.1|1588055_1590146_+	polysaccharide degrading enzyme	NA	A0A068LRB9	Peridroma_alphabaculovirus	26.2	1.2e-29
AWS95181.1|1590194_1591427_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	49.4	1.1e-94
>prophage 120
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1596601	1604293	5262516		uncultured_Mediterranean_phage(25.0%)	9	NA	NA
AWS95185.1|1596601_1598035_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	28.8	1.7e-38
AWS95186.1|1598401_1598608_+	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
AWS95187.1|1598641_1598998_-	hypothetical protein	NA	NA	NA	NA	NA
AWS95188.1|1599327_1599981_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.8	8.3e-46
AWS95189.1|1600412_1600589_+	DUF4051 domain-containing protein	NA	NA	NA	NA	NA
AWS95190.1|1600655_1601429_-	zinc transporter ZupT	NA	NA	NA	NA	NA
AWS95191.1|1601576_1602365_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
AWS98530.1|1602449_1603610_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	1.3e-86
AWS95192.1|1603615_1604293_-	DUF1190 domain-containing protein	NA	A0A173GEW8	Erwinia_phage	47.3	3.7e-41
>prophage 121
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1608632	1610525	5262516		Bacillus_virus(100.0%)	1	NA	NA
AWS95198.1|1608632_1610525_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	6.9e-93
>prophage 122
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1613817	1616590	5262516		Stx_converting_phage(50.0%)	2	NA	NA
AWS95203.1|1613817_1614213_+	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	47.2	1.8e-19
AWS95204.1|1614331_1616590_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.5	7.5e-86
>prophage 123
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1620696	1625893	5262516		Pseudomonas_phage(33.33%)	4	NA	NA
AWS95208.1|1620696_1622868_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	1.3e-103
AWS95209.1|1622923_1623379_-	HIT family protein	NA	Q5YEY9	Rock_bream_iridovirus	36.1	4.2e-20
AWS95210.1|1623422_1624877_-	anion permease	NA	NA	NA	NA	NA
AWS95211.1|1625065_1625893_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	42.3	1.0e-56
>prophage 124
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1634818	1636459	5262516		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AWS95223.1|1634818_1636459_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.4	7.0e-09
>prophage 125
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1651654	1710354	5262516	protease,tRNA,plate	Microcystis_phage(30.0%)	56	NA	NA
AWS95238.1|1651654_1652992_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AWS95239.1|1652997_1653639_+	type VI secretion system protein ImpK	NA	NA	NA	NA	NA
AWS95240.1|1653642_1655307_+	hypothetical protein	NA	NA	NA	NA	NA
AWS95241.1|1655324_1655816_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AWS95242.1|1655976_1658601_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.7	2.8e-92
AWS95243.1|1658593_1659286_+	hypothetical protein	NA	NA	NA	NA	NA
AWS95244.1|1659286_1659694_+	hypothetical protein	NA	NA	NA	NA	NA
AWS95245.1|1659747_1662258_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.2	3.9e-11
AWS98531.1|1663093_1664566_+	hypothetical protein	NA	NA	NA	NA	NA
AWS95246.1|1664580_1665462_+	sulfatase modifying factor 1	NA	A0A075BSL8	Microcystis_phage	31.8	3.5e-15
AWS95247.1|1665870_1666305_+	hypothetical protein	NA	NA	NA	NA	NA
AWS95248.1|1666301_1667054_+	hypothetical protein	NA	NA	NA	NA	NA
AWS98532.1|1667315_1667597_+	hypothetical protein	NA	NA	NA	NA	NA
AWS95249.1|1667611_1668493_+	sulfatase modifying factor 1	NA	A0A075BSL8	Microcystis_phage	31.6	2.3e-14
AWS95250.1|1668489_1669377_+	sulfatase modifying factor 1	NA	A0A7H6	Microcystis_virus	28.1	9.3e-16
AWS95251.1|1669373_1670261_+	sulfatase modifying factor 1	NA	A0A7H6	Microcystis_virus	31.0	7.6e-18
AWS95252.1|1670257_1671145_+	sulfatase modifying factor 1	NA	A0A075BSL8	Microcystis_phage	32.2	7.1e-16
AWS95253.1|1671333_1671600_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
AWS95254.1|1671718_1672789_+	hypothetical protein	NA	NA	NA	NA	NA
AWS98533.1|1673048_1676138_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
AWS95255.1|1676134_1677733_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AWS98534.1|1677755_1679522_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AWS95256.1|1679482_1680571_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AWS95257.1|1680545_1681079_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AWS95258.1|1681078_1681522_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AWS95259.1|1681523_1682864_+	ImpA domain-containing protein	NA	NA	NA	NA	NA
AWS95260.1|1683260_1683968_-	hypothetical protein	NA	NA	NA	NA	NA
AWS95261.1|1684059_1684245_-	hypothetical protein	NA	NA	NA	NA	NA
AWS95262.1|1684435_1686571_+	ornithine decarboxylase	NA	NA	NA	NA	NA
AWS95263.1|1686627_1687884_-	MFS transporter	NA	NA	NA	NA	NA
AWS95264.1|1688094_1689177_-	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	4.5e-12
AWS95265.1|1689266_1689536_-	oxidative damage protection protein	NA	NA	NA	NA	NA
AWS95266.1|1689563_1690616_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AWS95267.1|1690777_1691497_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AWS95268.1|1691496_1691823_+	DUF469 domain-containing protein	NA	NA	NA	NA	NA
AWS95269.1|1691872_1692592_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
AWS95270.1|1692780_1693827_+	L-asparaginase 2	NA	NA	NA	NA	NA
AWS95271.1|1693943_1695080_-	YggW family oxidoreductase	NA	NA	NA	NA	NA
AWS95272.1|1695072_1695666_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
AWS95273.1|1695673_1695964_-	YggU family protein	NA	NA	NA	NA	NA
AWS95274.1|1695960_1696527_-	YggT family protein	NA	NA	NA	NA	NA
AWS95275.1|1696545_1697250_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AWS95276.1|1697267_1698248_+	type IV pili twitching motility protein PilT	NA	NA	NA	NA	NA
AWS95277.1|1698244_1698661_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
AWS95278.1|1698660_1699224_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
AWS95279.1|1699335_1700283_-	glutathione synthase	NA	NA	NA	NA	NA
AWS95280.1|1700295_1701027_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AWS95281.1|1701101_1701809_-	deoxyribonuclease I	NA	NA	NA	NA	NA
AWS95282.1|1701903_1702401_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
AWS95283.1|1702479_1703874_-	MFS transporter	NA	O13311	Aichi_virus	25.2	2.4e-26
AWS95284.1|1704276_1705431_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.7	9.6e-130
AWS98535.1|1705758_1705950_-	hypothetical protein	NA	NA	NA	NA	NA
AWS98536.1|1706208_1706340_+	virulence promoting factor	NA	NA	NA	NA	NA
AWS95285.1|1706348_1708325_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AWS95286.1|1708489_1709410_+	agmatinase	NA	NA	NA	NA	NA
AWS95287.1|1709595_1710354_-|protease	metalloprotease	protease	NA	NA	NA	NA
>prophage 126
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1718662	1720987	5262516		Mimivirus(100.0%)	1	NA	NA
AWS95296.1|1718662_1720987_+	polysaccharide degrading enzyme	NA	A0A1X9VNM7	Mimivirus	28.5	9.2e-31
>prophage 127
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1736119	1737352	5262516		Catovirus(100.0%)	1	NA	NA
AWS95308.1|1736119_1737352_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.9	1.1e-102
>prophage 128
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1745582	1750805	5262516		Prochlorococcus_phage(50.0%)	3	NA	NA
AWS95317.1|1745582_1748456_+	glycine dehydrogenase (aminomethyl-transferring)	NA	M4QFZ1	Prochlorococcus_phage	50.4	7.6e-261
AWS95318.1|1748534_1749278_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AWS95319.1|1749371_1750805_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.3	3.7e-30
>prophage 129
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1755559	1761649	5262516	tRNA	Brevibacillus_phage(25.0%)	5	NA	NA
AWS95328.1|1755559_1756456_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	27.9	2.5e-29
AWS95329.1|1756479_1757193_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
AWS95330.1|1757198_1758932_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.3	9.2e-60
AWS95331.1|1759023_1760121_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
AWS95332.1|1760131_1761649_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	2.3e-86
>prophage 130
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1766352	1767087	5262516		Microcystis_virus(100.0%)	1	NA	NA
AWS98541.1|1766352_1767087_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A7K9	Microcystis_virus	38.1	1.1e-09
>prophage 131
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1790690	1791227	5262516		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AWS95355.1|1790690_1791227_-	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	34.2	6.6e-17
>prophage 132
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1800313	1800919	5262516		Canarypox_virus(100.0%)	1	NA	NA
AWS95362.1|1800313_1800919_+	hypothetical protein	NA	Q6VZ28	Canarypox_virus	26.4	2.0e-06
>prophage 133
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1815658	1818153	5262516		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
AWS95375.1|1815658_1816420_+	2-deoxy-D-gluconate 3-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	2.6e-19
AWS95376.1|1816734_1818153_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
>prophage 134
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1821817	1822828	5262516		Enterobacteria_phage(100.0%)	1	NA	NA
AWS95380.1|1821817_1822828_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	29.9	6.2e-32
>prophage 135
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1829408	1836232	5262516		Moraxella_phage(33.33%)	6	NA	NA
AWS95386.1|1829408_1830122_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	46.8	6.9e-46
AWS95387.1|1830197_1830893_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
AWS95388.1|1831577_1832108_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AWS95389.1|1832120_1834367_+	phosphoenolpyruvate-protein phosphotransferase PtsP	NA	A0A1V0SGR7	Hokovirus	24.6	3.9e-10
AWS95390.1|1834555_1835431_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AWS95391.1|1835437_1836232_+	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	62.3	1.1e-116
>prophage 136
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1841713	1857412	5262516	tRNA	Klosneuvirus(16.67%)	9	NA	NA
AWS95397.1|1841713_1844602_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.0	3.8e-66
AWS95398.1|1844594_1848140_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.6	8.0e-10
AWS95399.1|1848136_1849966_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	36.0	1.3e-03
AWS95400.1|1850010_1851342_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
AWS95401.1|1851576_1852830_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	28.4	2.7e-13
AWS95402.1|1853643_1854741_+	murein transglycosylase A	NA	NA	NA	NA	NA
AWS95403.1|1854875_1855682_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	1.4e-15
AWS95404.1|1855760_1856207_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
AWS98546.1|1856206_1857412_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.0	1.1e-70
>prophage 137
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1865622	1867122	5262516		Staphylococcus_phage(100.0%)	1	NA	NA
AWS95413.1|1865622_1867122_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.0	1.1e-21
>prophage 138
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1873879	1874635	5262516		Bacillus_phage(100.0%)	1	NA	NA
AWS95420.1|1873879_1874635_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	30.2	1.0e-07
>prophage 139
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1879504	1880353	5262516		Vibrio_phage(100.0%)	1	NA	NA
AWS95424.1|1879504_1880353_-	preQ(1) synthase	NA	A0A2I7SAX1	Vibrio_phage	37.6	9.4e-42
>prophage 140
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1884880	1892961	5262516		Oenococcus_phage(25.0%)	5	NA	NA
AWS95430.1|1884880_1886221_+	glucarate dehydratase	NA	Q6A202	Oenococcus_phage	22.6	5.0e-05
AWS95431.1|1886241_1887582_+	glucarate dehydratase	NA	NA	NA	NA	NA
AWS95432.1|1887664_1888807_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	40.9	2.8e-49
AWS95433.1|1888848_1891605_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.5	4.6e-53
AWS95434.1|1891662_1892961_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	28.5	4.1e-36
>prophage 141
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1896442	1899465	5262516		Only_Syngen_Nebraska_virus(50.0%)	2	NA	NA
AWS95436.1|1896442_1898080_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.7	3.9e-153
AWS95437.1|1898166_1899465_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	57.9	1.4e-129
>prophage 142
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1902828	1903500	5262516		Vibrio_phage(100.0%)	1	NA	NA
AWS95440.1|1902828_1903500_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	24.1	2.5e-13
>prophage 143
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1910932	1912965	5262516		Hokovirus(50.0%)	2	NA	NA
AWS95447.1|1910932_1912360_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	25.3	7.4e-31
AWS95448.1|1912359_1912965_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	37.1	1.6e-27
>prophage 144
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1916096	1919780	5262516		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
AWS95453.1|1916096_1916858_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	46.7	2.5e-57
AWS95454.1|1916851_1917478_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	50.6	2.0e-36
AWS95455.1|1917597_1918725_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	34.6	5.0e-06
AWS95456.1|1918787_1919780_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
>prophage 145
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1922800	1925362	5262516		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
AWS95461.1|1922800_1925362_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	21.0	4.1e-32
>prophage 146
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1929354	1931559	5262516		Bacillus_phage(100.0%)	1	NA	NA
AWS95466.1|1929354_1931559_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	26.9	7.2e-33
>prophage 147
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1947239	1964757	5262516		Bacillus_phage(40.0%)	14	NA	NA
AWS95473.1|1947239_1949432_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.5	6.9e-12
AWS95474.1|1950041_1952234_+	diguanylate cyclase	NA	NA	NA	NA	NA
AWS95475.1|1952294_1954385_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.0	6.4e-15
AWS95476.1|1954381_1955449_+	protein-glutamate methylesterase	NA	NA	NA	NA	NA
AWS95477.1|1955445_1956861_+	chemotaxis protein CheR	NA	NA	NA	NA	NA
AWS95478.1|1956869_1959002_+	hybrid sensor histidine kinase/response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	37.1	9.7e-11
AWS95479.1|1959024_1959387_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AWS98549.1|1959400_1961077_+	response regulator	NA	A0A127AWB9	Bacillus_phage	33.3	5.5e-17
AWS95480.1|1961088_1961613_+	chemotaxis protein	NA	NA	NA	NA	NA
AWS95481.1|1961596_1961956_+	hypothetical protein	NA	NA	NA	NA	NA
AWS95482.1|1962004_1962217_-	hypothetical protein	NA	NA	NA	NA	NA
AWS95483.1|1962233_1963085_-	metal ABC transporter permease	NA	NA	NA	NA	NA
AWS95484.1|1963081_1963939_-	metal ABC transporter permease	NA	NA	NA	NA	NA
AWS95485.1|1963941_1964757_-	manganese/iron ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	25.3	4.4e-12
>prophage 148
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1984020	1985034	5262516		Enterobacteria_phage(100.0%)	1	NA	NA
AWS95505.1|1984020_1985034_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.6	4.3e-25
>prophage 149
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1992484	1993450	5262516		Tetraselmis_virus(100.0%)	1	NA	NA
AWS95511.1|1992484_1993450_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	1.8e-36
>prophage 150
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	1998991	2004398	5262516	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
AWS95519.1|1998991_1999489_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	51.0	2.6e-31
AWS95520.1|1999581_2000646_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.8	4.0e-114
AWS95521.1|2000718_2001219_+	recombination regulator RecX	NA	NA	NA	NA	NA
AWS95522.1|2001346_2003974_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.8	8.4e-81
AWS95523.1|2004212_2004398_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 151
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2017384	2022681	5262516		Bacillus_virus(20.0%)	5	NA	NA
AWS95536.1|2017384_2018587_-	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.8	1.4e-27
AWS95537.1|2018941_2019901_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	70.2	8.0e-130
AWS95538.1|2019911_2022056_-	ribonucleotide-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	48.4	5.8e-197
AWS95539.1|2022028_2022439_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	42.6	1.7e-17
AWS95540.1|2022435_2022681_-	NrdH-redoxin	NA	A0A0M7REK7	Lactobacillus_phage	41.1	2.5e-11
>prophage 152
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2028304	2032323	5262516		Clostridium_phage(50.0%)	4	NA	NA
AWS95550.1|2028304_2028754_+	peptidoglycan-binding protein LysM	NA	A0A090DBR9	Clostridium_phage	39.5	5.2e-07
AWS95551.1|2028766_2029453_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
AWS95552.1|2029498_2030899_-	GABA permease	NA	NA	NA	NA	NA
AWS95553.1|2031039_2032323_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.3	9.6e-30
>prophage 153
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2036326	2037040	5262516		Bacillus_virus(100.0%)	1	NA	NA
AWS95557.1|2036326_2037040_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	37.1	1.4e-14
>prophage 154
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2059260	2064479	5262516		Tetraselmis_virus(50.0%)	5	NA	NA
AWS95575.1|2059260_2060472_+	glycosyltransferase family 1 protein	NA	A0A2P0VNG4	Tetraselmis_virus	31.6	3.2e-11
AWS95576.1|2060473_2061583_+	phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWS95577.1|2061585_2061993_+	hypothetical protein	NA	NA	NA	NA	NA
AWS98551.1|2062024_2063416_+	DUF4832 domain-containing protein	NA	NA	NA	NA	NA
AWS95578.1|2063462_2064479_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.5	7.2e-81
>prophage 155
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2075871	2082274	5262516	transposase	Ectocarpus_siliculosus_virus(50.0%)	5	NA	NA
AWS95587.1|2075871_2079114_+	histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	30.5	5.2e-32
AWS95588.1|2079190_2079820_-	hypothetical protein	NA	NA	NA	NA	NA
AWS95589.1|2080101_2080698_+	acid-resistance protein	NA	NA	NA	NA	NA
AWS98553.1|2080730_2081030_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWS95590.1|2081000_2082274_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.7	2.8e-146
>prophage 156
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2091626	2092175	5262516		Ochrobactrum_phage(100.0%)	1	NA	NA
AWS95599.1|2091626_2092175_-	ATPase	NA	A0A219VHB7	Ochrobactrum_phage	57.0	1.4e-22
>prophage 157
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2097150	2099337	5262516		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AWS95602.1|2097150_2099337_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	30.7	1.2e-16
>prophage 158
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2112616	2113099	5262516		Staphylococcus_phage(100.0%)	1	NA	NA
AWS98555.1|2112616_2113099_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	2.0e-28
>prophage 159
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2124439	2127993	5262516		Pseudomonas_phage(50.0%)	4	NA	NA
AWS95618.1|2124439_2125663_-	diguanylate cyclase	NA	A0A2K8I9Y5	Pseudomonas_phage	38.7	2.2e-07
AWS95619.1|2125655_2126174_-	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
AWS95620.1|2126332_2126707_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
AWS95621.1|2126922_2127993_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
>prophage 160
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2133894	2136468	5262516		Enterobacteria_phage(100.0%)	1	NA	NA
AWS95628.1|2133894_2136468_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	9.0e-128
>prophage 161
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2142161	2143460	5262516		Burkholderia_virus(100.0%)	1	NA	NA
AWS95629.1|2142161_2143460_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.6	5.3e-44
>prophage 162
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2148758	2154901	5262516	tRNA	Achromobacter_phage(25.0%)	7	NA	NA
AWS95633.1|2148758_2149178_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	36.5	8.3e-15
AWS95634.1|2149385_2150465_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AWS95635.1|2150498_2151188_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.1	9.3e-56
AWS95636.1|2151505_2151889_+	autonomous glycyl radical cofactor GrcA	NA	A0A1W5N098	Cronobacter_phage	70.9	3.6e-33
AWS95637.1|2151967_2152555_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
AWS95638.1|2152657_2153554_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWS95639.1|2153572_2154901_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	29.6	3.9e-42
>prophage 163
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2160749	2167634	5262516		Streptococcus_phage(33.33%)	9	NA	NA
AWS95646.1|2160749_2162549_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	1.4e-23
AWS95647.1|2162564_2163539_+	signal peptidase I	NA	NA	NA	NA	NA
AWS95648.1|2163553_2163865_-	hypothetical protein	NA	NA	NA	NA	NA
AWS95649.1|2163808_2164489_+	ribonuclease 3	NA	A0A2K9L5P0	Tupanvirus	31.8	1.6e-20
AWS95650.1|2164485_2165391_+	GTPase Era	NA	NA	NA	NA	NA
AWS98560.1|2165525_2166254_+	DNA repair protein RecO	NA	NA	NA	NA	NA
AWS95651.1|2166265_2166997_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AWS95652.1|2166996_2167377_+	holo-ACP synthase	NA	NA	NA	NA	NA
AWS95653.1|2167373_2167634_-	4Fe-4S dicluster domain-containing protein	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 164
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2173965	2185254	5262516		Bacillus_phage(50.0%)	7	NA	NA
AWS95660.1|2173965_2177853_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	1.1e-129
AWS95661.1|2178497_2179883_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	1.8e-13
AWS95662.1|2179905_2180649_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
AWS95663.1|2180645_2181983_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	34.1	1.4e-10
AWS95664.1|2182043_2182382_+	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
AWS95665.1|2182483_2183674_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
AWS95666.1|2184000_2185254_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.4	3.0e-100
>prophage 165
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2204839	2206348	5262516		Bacillus_virus(100.0%)	1	NA	NA
AWS95683.1|2204839_2206348_-	lipase	NA	G3M9Y6	Bacillus_virus	27.5	3.5e-15
>prophage 166
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2211997	2218319	5262516		Faustovirus(20.0%)	8	NA	NA
AWS95689.1|2211997_2213212_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	1.6e-34
AWS95690.1|2213238_2213625_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.7e-52
AWS95691.1|2213645_2213969_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	9.2e-22
AWS95692.1|2214043_2214559_+	co-chaperone HscB	NA	NA	NA	NA	NA
AWS95693.1|2214574_2216425_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	42.1	3.8e-104
AWS95694.1|2216426_2216762_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AWS95695.1|2216773_2216974_+	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AWS95696.1|2217035_2218319_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	36.0	4.5e-35
>prophage 167
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2228125	2228557	5262516		Powai_lake_megavirus(100.0%)	1	NA	NA
AWS95701.1|2228125_2228557_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.1	5.3e-17
>prophage 168
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2237428	2245600	5262516	integrase	Morganella_phage(60.0%)	9	2237308:2237329	2249315:2249336
2237308:2237329	attL	TGTTGTACACAAGGTTGTACCC	NA	NA	NA	NA
AWS95709.1|2237428_2238682_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	60.2	3.2e-147
AWS95710.1|2238801_2239614_+	hypothetical protein	NA	NA	NA	NA	NA
AWS95711.1|2239722_2239929_+	hypothetical protein	NA	NA	NA	NA	NA
AWS95712.1|2239925_2240360_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	54.3	6.1e-29
AWS95713.1|2240373_2241216_+	antA/AntB antirepressor family protein	NA	A0A0P0ZG08	Escherichia_phage	48.0	1.3e-22
AWS95714.1|2241208_2242042_+	Ash-like/host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
AWS95715.1|2242038_2242239_+	hypothetical protein	NA	NA	NA	NA	NA
AWS95716.1|2242235_2242826_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	37.2	5.6e-25
AWS95717.1|2242840_2245600_+	DNA primase	NA	A0A1W6JPG0	Morganella_phage	58.2	5.8e-298
2249315:2249336	attR	TGTTGTACACAAGGTTGTACCC	NA	NA	NA	NA
>prophage 169
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2249719	2257758	5262516	integrase	Acinetobacter_phage(25.0%)	6	2243972:2243985	2260589:2260602
2243972:2243985	attL	GACAAGGAAAGCGG	NA	NA	NA	NA
AWS95723.1|2249719_2251261_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	57.4	1.8e-160
AWS95724.1|2251400_2251616_+	hypothetical protein	NA	NA	NA	NA	NA
AWS95725.1|2251612_2252986_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	34.9	4.4e-41
AWS98563.1|2253146_2254613_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.3	1.7e-86
AWS95726.1|2254682_2256260_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
AWS95727.1|2256567_2257758_+|integrase	site-specific integrase	integrase	G9L697	Escherichia_phage	53.2	1.1e-117
2260589:2260602	attR	CCGCTTTCCTTGTC	NA	NA	NA	NA
>prophage 170
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2261528	2262386	5262516		Rhodoferax_phage(100.0%)	1	NA	NA
AWS95731.1|2261528_2262386_+	hypothetical protein	NA	A0A0E3GMB2	Rhodoferax_phage	26.7	1.8e-16
>prophage 171
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2278837	2279041	5262516		Escherichia_phage(100.0%)	1	NA	NA
AWS95739.1|2278837_2279041_-	DUF2633 domain-containing protein	NA	G9L6F2	Escherichia_phage	74.6	2.9e-18
>prophage 172
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2285430	2291028	5262516		Prochlorococcus_phage(33.33%)	5	NA	NA
AWS95743.1|2285430_2286072_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	40.0	2.6e-28
AWS95744.1|2286068_2287106_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	42.1	4.1e-71
AWS95745.1|2287401_2288832_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AWS95746.1|2289015_2289642_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AWS95747.1|2289738_2291028_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.2	1.5e-62
>prophage 173
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2300848	2301562	5262516		Cyanophage(100.0%)	1	NA	NA
AWS95759.1|2300848_2301562_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	2.0e-37
>prophage 174
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2337303	2340874	5262516		Paenibacillus_phage(50.0%)	5	NA	NA
AWS95791.1|2337303_2338173_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A0N9SGH1	Paenibacillus_phage	33.3	1.5e-18
AWS95792.1|2338384_2338810_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AWS95793.1|2338796_2339246_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
AWS95794.1|2339305_2339881_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
AWS95795.1|2339974_2340874_+	peroxidase	NA	S4VVJ7	Pandoravirus	32.4	1.1e-24
>prophage 175
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2364124	2372121	5262516		Organic_Lake_phycodnavirus(25.0%)	7	NA	NA
AWS98567.1|2364124_2366263_+	peptidase domain-containing ABC transporter	NA	F2Y2R6	Organic_Lake_phycodnavirus	26.6	2.4e-17
AWS95801.1|2366380_2367172_+	oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	8.9e-18
AWS95802.1|2367329_2368346_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWS95803.1|2368346_2369180_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
AWS95804.1|2369179_2370055_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
AWS95805.1|2370044_2371142_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	38.9	6.3e-30
AWS95806.1|2371209_2372121_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	41.8	5.9e-58
>prophage 176
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2376022	2385895	5262516		Hokovirus(25.0%)	9	NA	NA
AWS95812.1|2376022_2377750_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	7.4e-17
AWS95813.1|2377795_2378053_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AWS95814.1|2378436_2379408_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	3.3e-75
AWS95815.1|2379571_2380333_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
AWS95816.1|2380563_2381577_+	cell division protein ZipA	NA	NA	NA	NA	NA
AWS95817.1|2381648_2383664_+	DNA ligase	NA	A0A0K2QQN8	Ralstonia_phage	43.8	5.9e-151
AWS95818.1|2383665_2383884_+	hypothetical protein	NA	NA	NA	NA	NA
AWS95819.1|2383880_2384879_-	hypothetical protein	NA	NA	NA	NA	NA
AWS95820.1|2384968_2385895_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.2	2.2e-07
>prophage 177
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2410084	2410819	5262516		Clostridioides_phage(100.0%)	1	NA	NA
AWS95840.1|2410084_2410819_-	DNA-binding response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	25.8	1.6e-13
>prophage 178
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2415291	2416212	5262516		Morganella_phage(100.0%)	1	NA	NA
AWS95844.1|2415291_2416212_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	53.1	3.5e-74
>prophage 179
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2427051	2427702	5262516		Bacillus_virus(100.0%)	1	NA	NA
AWS95853.1|2427051_2427702_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	41.4	1.0e-19
>prophage 180
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2441647	2446551	5262516		uncultured_Caudovirales_phage(100.0%)	6	NA	NA
AWS95866.1|2441647_2442037_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	44.1	3.3e-18
AWS95867.1|2442083_2442614_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AWS95868.1|2442787_2443048_-	hypothetical protein	NA	NA	NA	NA	NA
AWS95869.1|2443138_2443732_-	hypothetical protein	NA	NA	NA	NA	NA
AWS95870.1|2443867_2444122_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AWS95871.1|2444652_2446551_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	26.2	2.4e-13
>prophage 181
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2462649	2462913	5262516		Rhizobium_phage(100.0%)	1	NA	NA
AWS95886.1|2462649_2462913_+	PAAR domain-containing protein	NA	R9U4D0	Rhizobium_phage	50.0	8.8e-07
>prophage 182
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2476175	2477108	5262516		Enterobacteria_phage(100.0%)	1	NA	NA
AWS98572.1|2476175_2477108_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	91.8	4.8e-148
>prophage 183
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2486252	2487338	5262516		Pandoravirus(100.0%)	1	NA	NA
AWS95900.1|2486252_2487338_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.3	3.8e-88
>prophage 184
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2496483	2497620	5262516		Brazilian_cedratvirus(100.0%)	1	NA	NA
AWS95910.1|2496483_2497620_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	26.9	1.0e-19
>prophage 185
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2503981	2505499	5262516		Mollivirus(100.0%)	1	NA	NA
AWS95918.1|2503981_2505499_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	1.1e-88
>prophage 186
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2509854	2510628	5262516		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AWS95924.1|2509854_2510628_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	27.7	1.1e-07
>prophage 187
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2524414	2525014	5262516		Salmonella_phage(100.0%)	1	NA	NA
AWS95938.1|2524414_2525014_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	5.3e-07
>prophage 188
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2545617	2546622	5262516		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
AWS95954.1|2545617_2546622_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	26.1	5.4e-28
>prophage 189
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2559291	2567228	5262516	transposase	Tupanvirus(50.0%)	7	NA	NA
AWS95969.1|2559291_2561274_-	bifunctional UDP-glucuronic acid oxidase/UDP-4-amino-4-deoxy-L-arabinose formyltransferase	NA	A0A2K9KZK0	Tupanvirus	25.6	6.3e-20
AWS95970.1|2561270_2562254_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	32.2	4.9e-34
AWS95971.1|2562256_2563396_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	28.8	3.6e-28
AWS95972.1|2563688_2564114_-	nucleoside triphosphatase NudI	NA	NA	NA	NA	NA
AWS95973.1|2564429_2564972_+	hypothetical protein	NA	NA	NA	NA	NA
AWS95974.1|2565051_2566248_+	competence/damage-inducible protein CinA	NA	NA	NA	NA	NA
AWS95975.1|2566286_2567228_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.5	4.5e-69
>prophage 190
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2573108	2584196	5262516		Pseudomonas_phage(40.0%)	8	NA	NA
AWS95980.1|2573108_2574176_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	50.9	2.3e-08
AWS95981.1|2574236_2575115_-	transcriptional regulator	NA	NA	NA	NA	NA
AWS95982.1|2575276_2576467_+	MFS transporter	NA	NA	NA	NA	NA
AWS95983.1|2576470_2576725_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	76.1	2.4e-25
AWS95984.1|2576724_2577855_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.1e-174
AWS95985.1|2577966_2580252_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	64.6	6.5e-287
AWS95986.1|2580672_2581401_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
AWS95987.1|2581559_2584196_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.7	1.8e-91
>prophage 191
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2588282	2594518	5262516		Feldmannia_species_virus(50.0%)	3	NA	NA
AWS95992.1|2588282_2589668_-	two-component system response regulator	NA	B5LWN0	Feldmannia_species_virus	32.3	6.8e-05
AWS98576.1|2589664_2591503_-	two-component system sensor histidine kinase AtoS	NA	NA	NA	NA	NA
AWS95993.1|2591671_2594518_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	25.4	1.4e-41
>prophage 192
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2598683	2607214	5262516		Enterobacteria_phage(20.0%)	8	NA	NA
AWS95996.1|2598683_2599784_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.7	1.7e-115
AWS98577.1|2599780_2599990_-	hypothetical protein	NA	NA	NA	NA	NA
AWS95997.1|2599899_2600952_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
AWS95998.1|2601031_2602096_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	52.2	7.0e-18
AWS95999.1|2602095_2602746_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	34.3	2.9e-06
AWS96000.1|2602821_2604465_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.6	1.3e-10
AWS96001.1|2604570_2606007_+	magnesium transporter	NA	NA	NA	NA	NA
AWS96002.1|2605969_2607214_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	49.0	6.4e-79
>prophage 193
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2616015	2616636	5262516		Staphylococcus_phage(100.0%)	1	NA	NA
AWS96011.1|2616015_2616636_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.6e-12
>prophage 194
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2624490	2625763	5262516	transposase	Shigella_phage(100.0%)	1	NA	NA
AWS96022.1|2624490_2625763_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.7	2.8e-146
>prophage 195
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2629251	2636884	5262516		Vibrio_phage(50.0%)	7	NA	NA
AWS96026.1|2629251_2630259_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.3	3.8e-82
AWS96027.1|2630377_2630662_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
AWS98580.1|2630786_2632547_-	ATP-dependent helicase	NA	M4Q3N1	Vibrio_phage	41.2	1.0e-98
AWS96028.1|2632698_2633406_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
AWS96029.1|2633421_2634612_+	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	22.9	1.4e-19
AWS96030.1|2634946_2635291_+	hypothetical protein	NA	NA	NA	NA	NA
AWS96031.1|2635294_2636884_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	31.5	1.2e-16
>prophage 196
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2642648	2646952	5262516		Bacillus_phage(50.0%)	4	NA	NA
AWS96036.1|2642648_2643218_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	S5MM68	Bacillus_phage	37.6	2.3e-12
AWS96037.1|2643631_2644345_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AWS96038.1|2644379_2645366_-	hypothetical protein	NA	NA	NA	NA	NA
AWS96039.1|2645485_2646952_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.7	2.6e-39
>prophage 197
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2669847	2670705	5262516		Catovirus(100.0%)	1	NA	NA
AWS96058.1|2669847_2670705_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	32.8	9.9e-23
>prophage 198
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2674680	2678769	5262516		Acinetobacter_phage(50.0%)	4	NA	NA
AWS96062.1|2674680_2676666_-	ligand-gated channel protein	NA	A0A0P0I887	Acinetobacter_phage	32.6	4.5e-10
AWS96063.1|2676944_2677781_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AWS98582.1|2677708_2677846_-	hypothetical protein	NA	NA	NA	NA	NA
AWS96064.1|2678100_2678769_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.8	4.1e-56
>prophage 199
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2682472	2683993	5262516		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AWS96068.1|2682472_2683993_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.8	3.4e-10
>prophage 200
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2698407	2699142	5262516		Streptococcus_phage(100.0%)	1	NA	NA
AWS96084.1|2698407_2699142_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	44.4	2.3e-52
>prophage 201
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2709847	2718268	5262516	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
AWS96093.1|2709847_2710795_+	ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.1	6.9e-09
AWS96094.1|2710778_2711510_+	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AWS96095.1|2711490_2711598_-	hypothetical protein	NA	NA	NA	NA	NA
AWS96096.1|2711649_2712381_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	92.0	1.2e-104
AWS96097.1|2712606_2714292_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.8	3.5e-282
AWS96098.1|2714288_2715008_+	two-component system response regulator YehT	NA	NA	NA	NA	NA
AWS98583.1|2715054_2715525_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	78.2	5.7e-65
AWS96099.1|2715569_2716028_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	68.6	1.3e-50
AWS96100.1|2716234_2718268_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	2.0e-53
>prophage 202
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2728423	2732150	5262516		Burkholderia_phage(66.67%)	3	NA	NA
AWS96109.1|2728423_2729149_+	hypothetical protein	NA	S5W9H2	Leptospira_phage	40.3	3.5e-05
AWS98585.1|2729482_2730691_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.4	5.1e-33
AWS96110.1|2730725_2732150_-	DNA (cytosine-5-)-methyltransferase	NA	E5E3X6	Burkholderia_phage	50.7	3.1e-106
>prophage 203
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2743279	2747784	5262516		Serratia_phage(50.0%)	4	NA	NA
AWS96119.1|2743279_2744284_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	27.0	4.9e-13
AWS96120.1|2744280_2745558_-	MFS transporter	NA	NA	NA	NA	NA
AWS96121.1|2745810_2746863_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
AWS96122.1|2746884_2747784_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	27.8	1.4e-11
>prophage 204
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2750963	2753838	5262516		Planktothrix_phage(50.0%)	4	NA	NA
AWS96127.1|2750963_2751692_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.0	1.1e-27
AWS96128.1|2752045_2752561_-	lipoprotein	NA	NA	NA	NA	NA
AWS96129.1|2752687_2753011_+	hypothetical protein	NA	NA	NA	NA	NA
AWS96130.1|2753007_2753838_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.1	1.8e-08
>prophage 205
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2757424	2759143	5262516		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
AWS96134.1|2757424_2759143_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	23.8	2.6e-30
>prophage 206
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2768568	2782172	5262516	protease	Bacillus_phage(25.0%)	10	NA	NA
AWS96143.1|2768568_2770515_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.8	1.4e-40
AWS96144.1|2770435_2770636_-	hypothetical protein	NA	NA	NA	NA	NA
AWS96145.1|2770589_2770814_-	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
AWS96146.1|2771137_2771458_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
AWS96147.1|2771488_2773765_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	6.2e-165
AWS96148.1|2774033_2775395_-	U32 family peptidase	NA	Q6DW11	Phage_TP	93.4	2.8e-205
AWS96149.1|2775560_2776283_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	9.2e-30
AWS96150.1|2776279_2777683_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.9	2.7e-33
AWS96151.1|2777682_2779095_-	multidrug transporter subunit MdtD	NA	NA	NA	NA	NA
AWS96152.1|2779091_2782172_-	multidrug transporter subunit MdtC	NA	S5VTK5	Leptospira_phage	22.7	3.8e-64
>prophage 207
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2792952	2803594	5262516		Catovirus(20.0%)	9	NA	NA
AWS96156.1|2792952_2793594_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.3	2.2e-35
AWS96157.1|2793685_2794267_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	43.2	4.2e-33
AWS96158.1|2794292_2796146_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
AWS96159.1|2796190_2797774_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.8	8.2e-39
AWS96160.1|2798429_2799569_+	polysaccharide export protein Wza	NA	NA	NA	NA	NA
AWS96161.1|2799574_2800024_+	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
AWS96162.1|2800020_2802183_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	1.9e-17
AWS96163.1|2802260_2803103_+	colanic acid biosynthesis glycosyltransferase WcaA	NA	NA	NA	NA	NA
AWS96164.1|2803105_2803594_+	colanic acid biosynthesis acetyltransferase WcaB	NA	A0A191KBJ5	Streptococcus_virus	41.0	4.6e-09
>prophage 208
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2807340	2814072	5262516		Synechococcus_phage(25.0%)	6	NA	NA
AWS96169.1|2807340_2808462_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.2e-132
AWS96170.1|2808464_2809430_+	GDP-L-fucose synthase	NA	M1I5W5	Acanthocystis_turfacea_Chlorella_virus	50.9	5.8e-88
AWS96171.1|2809432_2809912_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
AWS96172.1|2809908_2811135_+	colanic acid biosynthesis glycosyltransferase WcaI	NA	NA	NA	NA	NA
AWS96173.1|2811134_2812571_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	31.6	1.5e-52
AWS96174.1|2812701_2814072_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	26.9	7.1e-31
>prophage 209
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2819532	2825806	5262516		Enterobacteria_phage(66.67%)	6	NA	NA
AWS96179.1|2819532_2820927_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	35.4	6.1e-22
AWS96180.1|2821092_2821986_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	39.7	7.4e-45
AWS96181.1|2822355_2823441_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	3.7e-99
AWS96182.1|2823440_2824340_+	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	35.3	3.6e-31
AWS96183.1|2824390_2825269_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	63.4	1.9e-106
AWS96184.1|2825272_2825806_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	59.9	8.5e-49
>prophage 210
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2828987	2843004	5262516		Catovirus(14.29%)	12	NA	NA
AWS96188.1|2828987_2830022_+	UDP-N-acetylglucosamine 4,6-dehydratase/5-epimerase	NA	A0A1V0SAI8	Catovirus	35.2	2.0e-41
AWS96189.1|2830023_2831136_+	capsular biosynthesis protein	NA	NA	NA	NA	NA
AWS96190.1|2831139_2832270_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	51.1	8.3e-110
AWS96191.1|2832319_2833534_+	glycosyltransferase WbuB	NA	NA	NA	NA	NA
AWS96192.1|2833535_2834138_+	sugar transferase	NA	NA	NA	NA	NA
AWS96193.1|2834394_2835570_+	aminotransferase	NA	A0A2K9L470	Tupanvirus	49.7	1.4e-104
AWS98589.1|2835653_2837570_+	polysaccharide biosynthesis protein	NA	K7Y9E1	Megavirus	28.0	7.1e-21
AWS96194.1|2837677_2839084_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.5	2.3e-37
AWS96195.1|2839281_2840448_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	55.5	1.0e-115
AWS96196.1|2840717_2841371_+	acetyltransferase	NA	NA	NA	NA	NA
AWS96197.1|2841374_2841800_+	acyl dehydratase	NA	NA	NA	NA	NA
AWS96198.1|2841999_2843004_-	protein CapI	NA	A0A0K0KW07	Prochlorococcus_phage	31.3	5.6e-17
>prophage 211
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2850597	2851497	5262516		Cellulophaga_phage(100.0%)	1	NA	NA
AWS96207.1|2850597_2851497_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	97.4	4.8e-12
>prophage 212
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2859453	2862108	5262516		Escherichia_phage(50.0%)	3	NA	NA
AWS96213.1|2859453_2860032_+	thiosulfate reductase electron transport protein PhsB	NA	A0A077SL61	Escherichia_phage	38.0	3.7e-21
AWS96214.1|2860028_2860796_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
AWS96215.1|2860935_2862108_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	86.9	1.3e-198
>prophage 213
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2897367	2898183	5262516		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
AWS96258.1|2897367_2898183_+	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	24.2	1.9e-07
>prophage 214
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2903151	2903835	5262516		Bacillus_virus(100.0%)	1	NA	NA
AWS96264.1|2903151_2903835_-	ABC transporter	NA	G3M9Y6	Bacillus_virus	34.1	4.8e-28
>prophage 215
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2911565	2912651	5262516		Wolbachia_phage(100.0%)	1	NA	NA
AWS96271.1|2911565_2912651_+	patatin	NA	A0A1B2LRS3	Wolbachia_phage	31.5	3.4e-20
>prophage 216
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2920319	2926353	5262516	transposase	Shigella_phage(50.0%)	3	NA	NA
AWS96277.1|2920319_2921592_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.7	2.8e-146
AWS96278.1|2922065_2922845_+	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
AWS96279.1|2922828_2926353_+	DEAD/DEAH box helicase	NA	M1IHE6	Paramecium_bursaria_Chlorella_virus	25.5	8.8e-17
>prophage 217
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2942953	2943139	5262516		Vibrio_phage(100.0%)	1	NA	NA
AWS96302.1|2942953_2943139_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	42.1	5.6e-08
>prophage 218
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	2950707	2986282	5262516		Bacillus_phage(25.0%)	20	NA	NA
AWS96308.1|2950707_2960199_-	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
AWS96309.1|2960286_2966394_-	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9KZV5	Tupanvirus	27.4	2.3e-33
AWS96310.1|2966584_2967544_-	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
AWS96311.1|2967710_2969513_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.6	1.1e-31
AWS96312.1|2969499_2971302_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.6	2.7e-22
AWS96313.1|2971294_2972575_+	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
AWS96314.1|2972602_2973907_+	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
AWS96315.1|2974100_2975363_-	DUF4102 domain-containing protein	NA	A0A1B0VMI6	Pseudomonas_phage	39.0	4.8e-74
AWS96316.1|2975699_2976497_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
AWS96317.1|2977086_2977776_+	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	29.1	2.2e-12
AWS96318.1|2977846_2978593_+	NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	30.7	3.0e-07
AWS96319.1|2978776_2979676_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	25.9	1.0e-17
AWS96320.1|2979895_2980075_+	hypothetical protein	NA	NA	NA	NA	NA
AWS96321.1|2980092_2980932_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AWS96322.1|2981141_2981501_+	hypothetical protein	NA	NA	NA	NA	NA
AWS96323.1|2981580_2981913_+	multidrug SMR transporter	NA	NA	NA	NA	NA
AWS96324.1|2982018_2983194_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.9	9.5e-109
AWS96325.1|2983634_2984327_+	phosphohydrolase	NA	S4W232	Pandoravirus	27.6	2.0e-05
AWS96326.1|2984403_2985834_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.2	3.3e-103
AWS96327.1|2985814_2986282_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	5.7e-33
>prophage 219
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3013366	3014119	5262516		Bacillus_virus(100.0%)	1	NA	NA
AWS96361.1|3013366_3014119_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.4	6.4e-26
>prophage 220
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3021240	3022266	5262516		Wolbachia_phage(100.0%)	1	NA	NA
AWS96370.1|3021240_3022266_-	patatin	NA	A0A1B2LRS3	Wolbachia_phage	33.7	1.8e-42
>prophage 221
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3033918	3035433	5262516		Staphylococcus_phage(100.0%)	1	NA	NA
AWS96385.1|3033918_3035433_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	26.6	6.2e-12
>prophage 222
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3047231	3052884	5262516		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
AWS96396.1|3047231_3048893_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.8	3.4e-11
AWS96397.1|3048936_3050538_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.9	1.2e-10
AWS96398.1|3050557_3051430_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
AWS96399.1|3051426_3052476_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.0	1.8e-05
AWS96400.1|3052494_3052884_+	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	32.2	2.6e-07
>prophage 223
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3067801	3239731	5262516	capsid,coat,transposase,holin,terminase,integrase,tRNA,tail,head,plate,portal	Enterobacteria_phage(28.57%)	213	3157930:3157989	3207419:3208761
AWS96410.1|3067801_3069535_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.9	1.2e-86
AWS96411.1|3069773_3070340_+	VOC family protein	NA	NA	NA	NA	NA
AWS96412.1|3070342_3071089_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AWS96413.1|3071253_3072222_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AWS96414.1|3072218_3072962_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	2.7e-24
AWS96415.1|3073002_3073398_-	hypothetical protein	NA	NA	NA	NA	NA
AWS96416.1|3073449_3074223_-	hypothetical protein	NA	Q859D1	Escherichia_coli_phage	80.3	1.0e-55
AWS96417.1|3074201_3075515_-|integrase	integrase	integrase	Q8W658	Enterobacteria_phage	89.7	4.3e-235
AWS96418.1|3075573_3075810_-	excisionase	NA	Q8W657	Enterobacteria_phage	93.6	1.6e-39
AWS96419.1|3075853_3076423_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	80.8	9.6e-83
AWS96420.1|3077190_3077499_-	hypothetical protein	NA	NA	NA	NA	NA
AWS96421.1|3077500_3078040_-	hypothetical protein	NA	Q9MCT8	Escherichia_phage	76.6	6.6e-73
AWS96422.1|3078036_3078291_-	hypothetical protein	NA	NA	NA	NA	NA
AWS96423.1|3078451_3078991_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	79.9	4.7e-79
AWS96424.1|3079119_3079947_-	hypothetical protein	NA	Q8HAA2	Salmonella_phage	90.9	1.5e-140
AWS96425.1|3080004_3080376_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	89.4	7.7e-57
AWS96426.1|3080992_3081685_-	transcriptional regulator	NA	Q8HAA0	Salmonella_phage	71.3	5.4e-88
AWS96427.1|3081782_3082046_+	XRE family transcriptional regulator	NA	A0A0P0ZCZ7	Stx2-converting_phage	54.0	4.5e-19
AWS96428.1|3082038_3082590_+	hypothetical protein	NA	A0A0P0ZE62	Stx2-converting_phage	53.8	4.1e-46
AWS96429.1|3082762_3082942_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	3.0e-14
AWS96430.1|3082931_3083789_+	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	87.9	1.3e-70
AWS96431.1|3083785_3085105_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	52.3	3.7e-117
AWS96432.1|3085101_3085488_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	89.1	4.1e-61
AWS96433.1|3085501_3086188_+	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	53.3	2.2e-57
AWS96434.1|3086184_3087180_+	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	69.3	1.5e-142
AWS96435.1|3087196_3088027_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	43.8	7.8e-57
AWS96436.1|3088213_3088456_+	hypothetical protein	NA	NA	NA	NA	NA
AWS96437.1|3088623_3088959_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	57.0	1.6e-29
AWS96438.1|3088968_3089586_+	endolysin	NA	Q8HA86	Salmonella_phage	80.4	2.9e-93
AWS96439.1|3089582_3090128_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	33.1	1.2e-08
AWS96440.1|3090401_3090821_-	hypothetical protein	NA	NA	NA	NA	NA
AWS96441.1|3090953_3091148_+	hypothetical protein	NA	NA	NA	NA	NA
AWS96442.1|3091249_3091453_+	hypothetical protein	NA	A0A1W6JPG4	Morganella_phage	62.9	2.0e-06
AWS96443.1|3091764_3092310_+|terminase	terminase small subunit	terminase	E4WL18	Enterobacteria_phage	100.0	1.2e-95
AWS96444.1|3092284_3094207_+|terminase	terminase	terminase	E4WL19	Enterobacteria_phage	98.0	0.0e+00
AWS96445.1|3094206_3094413_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	95.5	3.2e-28
AWS96446.1|3094409_3096002_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	92.1	9.7e-290
AWS96447.1|3095982_3097320_+|capsid	capsid assembly protein	capsid	O64320	Escherichia_phage	83.7	3.6e-189
AWS96448.1|3097329_3097662_+|head	head decoration protein	head	E4WL24	Enterobacteria_phage	82.7	2.9e-47
AWS96449.1|3097729_3098755_+|capsid	minor capsid protein E	capsid	K7PGW9	Enterobacteria_phage	92.7	1.9e-182
AWS96450.1|3098800_3099205_+	DNA-packaging protein	NA	K7P7M3	Enterobacteria_phage	54.3	2.1e-23
AWS96451.1|3099216_3099570_+|tail	phage tail protein	tail	K7P6U9	Enterobacteria_phage	76.1	9.0e-47
AWS96452.1|3099579_3100134_+|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	92.0	7.2e-75
AWS96453.1|3100130_3100529_+|tail	phage tail protein	tail	K7P7G5	Enterobacteria_phage	82.6	7.2e-61
AWS96454.1|3100536_3101274_+|tail	phage tail protein	tail	O64327	Escherichia_phage	66.9	9.9e-88
AWS96455.1|3101310_3101718_+|tail	phage minor tail protein G	tail	K7PM17	Enterobacteria_phage	57.9	2.5e-24
AWS96456.1|3101726_3102047_+|tail	phage tail assembly protein T	tail	K7PHE1	Enterobacteria_phage	69.8	1.6e-34
AWS96457.1|3102024_3104541_+|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	70.7	0.0e+00
AWS96458.1|3104544_3104892_+|tail	phage tail protein	tail	K7PJT2	Enterobacteria_phage	70.4	1.4e-39
AWS96459.1|3104888_3105644_+|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	86.9	1.9e-131
AWS96460.1|3105645_3106356_+	peptidase P60	NA	K7PGR2	Enterobacteria_phage	91.1	6.1e-135
AWS96461.1|3106386_3106821_-	Rha family transcriptional regulator	NA	G9L6D6	Escherichia_phage	55.8	6.5e-31
AWS96462.1|3106939_3107107_+	Arc family DNA binding domain-containing protein	NA	G9L6D7	Escherichia_phage	70.9	1.5e-15
AWS96463.1|3107180_3107762_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	37.9	1.7e-26
AWS96464.1|3107838_3108582_+	hypothetical protein	NA	A0A0P0ZDC0	Stx2-converting_phage	52.9	8.2e-58
AWS96465.1|3108695_3109106_+	hypothetical protein	NA	G8C7Q7	Escherichia_phage	66.4	5.4e-51
AWS96466.1|3109165_3109735_+|tail	phage tail protein	tail	K7PHE5	Enterobacteria_phage	76.0	3.1e-73
AWS96467.1|3109788_3113373_+	host specificity protein	NA	O64335	Escherichia_phage	89.4	0.0e+00
AWS96468.1|3113422_3114796_+|tail	phage tail protein	tail	A0A1V0E5M2	Salmonella_phage	53.0	2.0e-113
AWS96469.1|3114930_3115173_-	DNA-damage-inducible protein I	NA	Q6UAW0	Klebsiella_phage	74.0	4.9e-28
AWS96470.1|3115251_3115584_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	54.2	2.3e-20
AWS96471.1|3115775_3116186_+	hemerythrin	NA	NA	NA	NA	NA
AWS96472.1|3116271_3116511_-	DinI family protein	NA	K7PKR6	Enterobacteria_phage	100.0	7.4e-37
AWS98597.1|3116666_3116783_+	preprotein translocase subunit SecY	NA	NA	NA	NA	NA
AWS96473.1|3116864_3117431_-	hydrolase	NA	NA	NA	NA	NA
AWS96474.1|3117387_3117624_-	hypothetical protein	NA	NA	NA	NA	NA
AWS96475.1|3117697_3119470_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AWS96476.1|3119471_3119915_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
AWS96477.1|3119943_3120687_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AWS96478.1|3120721_3121243_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
AWS96479.1|3121323_3121935_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AWS96480.1|3121943_3122954_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.4	1.6e-08
AWS96481.1|3123032_3123818_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
AWS96482.1|3123814_3124570_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	29.4	1.1e-17
AWS96483.1|3124633_3125593_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
AWS96484.1|3125608_3126928_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	36.8	1.5e-14
AWS96485.1|3127047_3128019_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
AWS96486.1|3128063_3129506_-	pyruvate kinase	NA	NA	NA	NA	NA
AWS98598.1|3129624_3130494_-	transcriptional regulator HexR	NA	NA	NA	NA	NA
AWS96487.1|3130572_3130887_-	hypothetical protein	NA	NA	NA	NA	NA
AWS96488.1|3130859_3132335_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.1	8.3e-78
AWS96489.1|3132568_3134380_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
AWS96490.1|3134414_3135056_+	keto-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
AWS96491.1|3135124_3136303_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
AWS96492.1|3136435_3136726_+	damage-inducible protein YebG	NA	NA	NA	NA	NA
AWS96493.1|3136847_3137201_+	hypothetical protein	NA	NA	NA	NA	NA
AWS96494.1|3137295_3137955_+	DUF533 domain-containing protein	NA	NA	NA	NA	NA
AWS96495.1|3138017_3140117_+	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	36.3	2.2e-31
AWS96496.1|3140098_3140761_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	39.3	3.5e-07
AWS96497.1|3140783_3141440_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
AWS96498.1|3141546_3141777_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	58.8	1.3e-14
AWS96499.1|3141920_3142295_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AWS96500.1|3142298_3143171_+	hypothetical protein	NA	NA	NA	NA	NA
AWS96501.1|3143191_3143530_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AWS96502.1|3143866_3144952_-|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	68.7	4.8e-147
AWS96503.1|3144920_3145193_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	64.4	1.9e-28
AWS96504.1|3145256_3145499_-	DUF4060 domain-containing protein	NA	K7PHF4	Enterobacteria_phage	91.1	1.0e-33
AWS96505.1|3145485_3145689_-	hypothetical protein	NA	A0A1B0VN94	Pseudomonas_phage	66.7	1.7e-10
AWS96506.1|3145681_3146026_-	hypothetical protein	NA	NA	NA	NA	NA
AWS96507.1|3146060_3147152_-	enterohemolysin	NA	K7PKR8	Enterobacteria_phage	59.2	2.2e-115
AWS96508.1|3147164_3149993_-	exodeoxyribonuclease VIII	NA	K7P6V4	Enterobacteria_phage	60.4	1.2e-290
AWS96509.1|3150305_3150512_-	cell division inhibitor protein	NA	K7PM31	Enterobacteria_phage	100.0	1.5e-33
AWS96510.1|3150861_3152016_-	type I restriction endonuclease subunit R	NA	A0A1S5SAB0	Streptococcus_phage	27.8	1.9e-32
AWS98599.1|3152037_3152706_-	phage repressor protein C	NA	A0A2D1GM27	Escherichia_phage	68.3	1.3e-91
AWS96511.1|3152848_3153058_+	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	81.2	8.8e-26
AWS96512.1|3153097_3153637_+	regulator	NA	K7PJT7	Enterobacteria_phage	86.0	1.5e-80
AWS98600.1|3154080_3155073_+	replication protein	NA	A5VW95	Enterobacteria_phage	74.2	7.9e-48
AWS96513.1|3155056_3155749_+	phage replication protein	NA	G8C7U6	Escherichia_phage	60.9	1.9e-77
AWS96514.1|3155760_3156513_+	hypothetical protein	NA	NA	NA	NA	NA
AWS96515.1|3156515_3156827_+	hypothetical protein	NA	NA	NA	NA	NA
AWS96516.1|3156823_3157375_+	hypothetical protein	NA	K7P7C5	Enterobacteria_phage	55.9	8.3e-23
AWS96517.1|3157371_3157584_+	hypothetical protein	NA	NA	NA	NA	NA
AWS96518.1|3157580_3157955_+	hypothetical protein	NA	A0A193GYX5	Enterobacter_phage	82.9	1.1e-07
3157930:3157989	attL	CTGGCATTGGCGTGAAGGGGGAGTGAGATGGATAAATTAATCAAACCTACCACAAAAGGT	NA	NA	NA	NA
AWS96519.1|3157956_3158265_+	hypothetical protein	NA	NA	NA	NA	NA
AWS96520.1|3159359_3159962_+	hypothetical protein	NA	S4TTI0	Salmonella_phage	86.5	3.9e-98
AWS96521.1|3159961_3160168_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	69.1	9.0e-23
AWS96522.1|3160170_3160779_+	protein NinG	NA	A0A0M4RU10	Salmonella_phage	51.2	2.9e-45
AWS96523.1|3160775_3160916_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	95.7	1.2e-18
AWS96524.1|3160912_3161743_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	98.6	2.4e-154
AWS96525.1|3162122_3162905_-|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	96.5	6.1e-136
AWS96526.1|3162901_3163924_-|transposase	IS21 family transposase ISSen3	transposase	A0A2L1IVA1	Escherichia_phage	85.3	1.9e-174
AWS96527.1|3164766_3165798_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
AWS98601.1|3165987_3166320_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	89.0	1.3e-50
AWS96528.1|3166303_3166792_+	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	71.3	1.4e-66
AWS96529.1|3166788_3167352_+	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	72.5	9.9e-56
AWS96530.1|3167408_3167780_+	hypothetical protein	NA	Q76H27	Enterobacteria_phage	65.6	5.4e-42
AWS96531.1|3167783_3168422_+	hypothetical protein	NA	I6S676	Salmonella_phage	87.7	1.4e-109
AWS96532.1|3168453_3168942_+	hypothetical protein	NA	H9C190	Pectobacterium_phage	79.5	8.3e-51
AWS96533.1|3168938_3170510_+|terminase	terminase	terminase	G8C7P3	Escherichia_phage	92.7	3.0e-307
AWS96534.1|3170514_3171918_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	89.2	7.3e-241
AWS98602.1|3173710_3174094_+	hypothetical protein	NA	G8C7P5	Escherichia_phage	90.7	1.0e-43
AWS96535.1|3174097_3174307_+	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	51.5	1.7e-13
AWS96536.1|3174413_3175166_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	93.2	1.3e-124
AWS96537.1|3175183_3176323_+|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	84.0	4.8e-174
AWS96538.1|3176362_3176680_+	hypothetical protein	NA	G8C7P8	Escherichia_phage	89.7	2.0e-13
AWS96539.1|3176682_3177165_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	86.9	1.8e-77
AWS96540.1|3177166_3177520_+	hypothetical protein	NA	G8C7Q0	Escherichia_phage	87.1	2.7e-51
AWS96541.1|3177521_3178121_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	86.9	9.5e-97
AWS96542.1|3178110_3178560_+	hypothetical protein	NA	G8C7Q2	Escherichia_phage	88.6	3.0e-71
AWS96543.1|3178606_3179539_+|tail	phage tail protein	tail	G8C7Q3	Escherichia_phage	91.9	1.4e-155
AWS96544.1|3179604_3179943_+	hypothetical protein	NA	G8C7Q5	Escherichia_phage	93.8	5.6e-54
AWS96545.1|3179960_3180248_+	hypothetical protein	NA	I6PD79	Cronobacter_phage	61.5	1.2e-17
AWS96546.1|3180247_3183403_+|tail	phage tail tape measure protein	tail	G8C7Q6	Escherichia_phage	71.1	0.0e+00
AWS96547.1|3183453_3183846_+	hypothetical protein	NA	NA	NA	NA	NA
AWS96548.1|3183931_3184282_+	hypothetical protein	NA	G8C7R0	Escherichia_phage	92.2	8.9e-55
AWS96549.1|3184290_3185064_+|tail	phage minor tail protein L	tail	G8C7R1	Escherichia_phage	87.8	1.2e-131
AWS96550.1|3185076_3185808_+	peptidase P60	NA	G8C7R2	Escherichia_phage	92.6	2.8e-143
AWS96551.1|3185795_3186389_+|tail	tail assembly protein	tail	G8C7R3	Escherichia_phage	79.9	2.3e-79
AWS96552.1|3186444_3190101_+	host specificity protein	NA	G8C7R4	Escherichia_phage	69.1	0.0e+00
AWS96553.1|3190162_3191536_+|tail	phage tail protein	tail	A0A1V0E5M2	Salmonella_phage	50.1	1.9e-108
AWS96554.1|3191667_3191910_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	76.6	3.4e-29
AWS96555.1|3191988_3192378_+	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	72.9	1.7e-51
AWS96556.1|3193341_3194013_-	DUF159 family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.1	1.7e-78
AWS96557.1|3194419_3195505_-|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	68.7	4.8e-147
AWS96558.1|3195473_3195746_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	64.4	1.9e-28
AWS96559.1|3195809_3196052_-	DUF4060 domain-containing protein	NA	K7PHF4	Enterobacteria_phage	91.1	1.0e-33
AWS96560.1|3196038_3196242_-	hypothetical protein	NA	A0A1B0VN94	Pseudomonas_phage	66.7	1.7e-10
AWS96561.1|3196234_3196579_-	hypothetical protein	NA	NA	NA	NA	NA
AWS96562.1|3196613_3197705_-	enterohemolysin	NA	K7PKR8	Enterobacteria_phage	59.2	2.2e-115
AWS96563.1|3197717_3200546_-	exodeoxyribonuclease VIII	NA	K7P6V4	Enterobacteria_phage	60.5	3.5e-290
AWS96564.1|3200854_3201052_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWS96565.1|3201051_3201252_-	hypothetical protein	NA	NA	NA	NA	NA
AWS96566.1|3201248_3201338_-	hypothetical protein	NA	NA	NA	NA	NA
AWS96567.1|3202531_3202759_-	hypothetical protein	NA	NA	NA	NA	NA
AWS96568.1|3202906_3203374_-	transcriptional regulator	NA	K7PHG0	Enterobacteria_phage	94.2	1.4e-74
AWS96569.1|3203387_3203612_+	Rha family transcriptional regulator	NA	K7PKS2	Enterobacteria_phage	100.0	9.1e-37
AWS96570.1|3203614_3204154_+	regulator	NA	K7PJT7	Enterobacteria_phage	93.9	2.9e-89
AWS96571.1|3204303_3205176_+	DNA-binding protein	NA	V5URT9	Shigella_phage	51.7	9.3e-85
AWS96572.1|3205178_3205928_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	87.6	3.3e-123
AWS96573.1|3205946_3206258_+	hypothetical protein	NA	NA	NA	NA	NA
AWS96574.1|3206254_3206896_+	hypothetical protein	NA	NA	NA	NA	NA
AWS96575.1|3207005_3207203_-	hypothetical protein	NA	Q7Y2N5	Escherichia_phage	75.0	4.1e-09
AWS96576.1|3207247_3207433_+	hypothetical protein	NA	Q7Y2N7	Escherichia_phage	79.5	2.5e-08
AWS96577.1|3207445_3207754_+	hypothetical protein	NA	NA	NA	NA	NA
AWS96578.1|3209129_3209729_+	hypothetical protein	NA	K7PKS6	Enterobacteria_phage	97.0	6.5e-106
3207419:3208761	attR	CTGGCATTGGCGTGAAGGGGGAGTGAGATGGATAAATTAATCAAACCTACCACAAAAGGTAAACATGACGGTTCATGTGATTATCTTTGCTCGGAAGATGCGCGATTCATCGTTATGCGCGGCGATTATACGGAAGCGGAAATAATTCAGGCTTCTGTGTCCCAAGATGTAATCGACTCGGATGGTGCGGCTGATTTTGCAAGTAGCGCCCGCTATTATCAGTGCTGGTACAAAGTTAGCCCAATAGGTGGTCAGGATGGCTATTCAGGCTGGCATCATCCTCGTGACTCGCCGTGTCGCGGTGCATATTTCGCATCAGTTTTGCAATGGGATTAAGGAGGACTAACCCATGACAACTAACAACCACCCGGCGCACGGTCCTGTATCACTCGATCGCCTGCACCAGATACGCGAAATACTCAGCAAAGCAGCAGCACAAAGCGACGGCGGTAATCTCGGCTACGCAATAGCTGATGCTGTGAAGGTGATTGATGAGGCTATTGCAGCGTTTGGTGCTGAGCCTGCACCAGTAGATATTGAAATGCTGGCCACTGTACTGAGAAACGCTCCGTTAGCGCCGTCAGATAGCCAGGGCAAGCCGAGAGCGCCGGTAGTGCCGGATGAAGATCCGCGAGATGCATTCGAGCGAACATTCAAAATGCCGAAGCATGTCACCCGCTGCGGTACCGGATATGCAGTAACGGCATATTCCGCATGGTTAGCCCATGATTTCGTTAGGATGTGGGAGGGCTGGAACGCTTGCCGCGCCGCCATGCTTCAGGGTGCCGAACCTGCAAGTAATTGCGATGAATTACCGCTGGACTACCTGCAAGGGCACAAAGACGGGCTGGAATGGGCAGCACAACTGGCAAAAGCAAATCATCCGGAAACTGGCGACTGGCTTTACGATGACCCTATCGAATTGTCAAAGGCGATACGCAAGGGGCCGGATATGCCATTATCCGATGGCAACTCTCCGGTGATTCAGGATGGCTGGATTAAGTGCAGCGAGCGGATGCCGGAAGACGAGCAGGAGGTTCTAACCAGGAACAGGATGGGGCATTGCTTTGTATCGTTCTTTGATGAGCATTCAGGGCTGTTTTTCGACAGAGTAGATGTGGCCGCCGCATGCTGTATAGAGCACATATTGGTAACCCATTGGATGCCACTGCCAGCAGCACCGCAGCAGGAGGCTGAGAACAGAATTCAGATTGGCAAATCCGAAGCCAAGGAAGAGTGGGATATGGGGGCGCGTCTGACAAAGCACAGATTCAAACCATAGCTACCATACAAGCGATATGTGAATTCCCATATCGACAATATAACCCGCTACGGCGGGTTTT	NA	NA	NA	NA
AWS96579.1|3209728_3209935_+	hypothetical protein	NA	K7PJT9	Enterobacteria_phage	77.3	1.1e-25
AWS96580.1|3209937_3210546_+	protein NinG	NA	A0A0M4RU10	Salmonella_phage	64.7	6.3e-48
AWS96581.1|3210542_3210680_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	88.4	9.2e-16
AWS96582.1|3210676_3211366_+	antiterminator	NA	I6PDF8	Cronobacter_phage	54.0	3.5e-63
AWS96583.1|3211481_3211664_+	hypothetical protein	NA	NA	NA	NA	NA
AWS96584.1|3211660_3211942_-	DUF2622 domain-containing protein	NA	A9YWZ2	Burkholderia_phage	42.2	2.2e-11
AWS96585.1|3212207_3212414_+|holin	holin	holin	B6SD15	Bacteriophage	56.4	8.4e-13
AWS96586.1|3212391_3212880_+	lysozyme	NA	A0A2H4FND7	Salmonella_phage	84.6	1.3e-75
AWS96587.1|3213087_3213411_+	Rz1 lytic protein	NA	Q8SBD8	Shigella_phage	78.3	7.5e-40
AWS96588.1|3214191_3214539_+	hypothetical protein	NA	NA	NA	NA	NA
AWS96589.1|3214682_3214880_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
AWS96590.1|3214838_3215108_-	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
AWS96591.1|3215285_3215924_+	hypothetical protein	NA	NA	NA	NA	NA
AWS96592.1|3215934_3216438_-	hypothetical protein	NA	NA	NA	NA	NA
AWS96593.1|3216728_3217298_+	hypothetical protein	NA	NA	NA	NA	NA
AWS96594.1|3217239_3219363_+|terminase	terminase	terminase	A0A0C5ABH4	Bacteriophage	35.6	1.8e-97
AWS96595.1|3219371_3219635_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
AWS96596.1|3219634_3221272_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.2	3.3e-91
AWS96597.1|3221268_3222135_+	S49 family peptidase	NA	A0A2D1GN02	Marinobacter_phage	37.9	4.8e-49
AWS96598.1|3222136_3222727_+	hypothetical protein	NA	NA	NA	NA	NA
AWS96599.1|3222726_3223131_+|head	head decoration protein	head	NA	NA	NA	NA
AWS96600.1|3223228_3224278_+|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	33.7	1.6e-51
AWS96601.1|3224249_3224660_+	hypothetical protein	NA	NA	NA	NA	NA
AWS96602.1|3224664_3225024_+	hypothetical protein	NA	NA	NA	NA	NA
AWS96603.1|3225020_3225566_+	ATP-binding protein	NA	NA	NA	NA	NA
AWS96604.1|3225569_3225767_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
AWS96605.1|3225763_3227266_+|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	42.4	1.9e-101
AWS96606.1|3227269_3227641_+|tail	phage tail protein	tail	NA	NA	NA	NA
AWS96607.1|3227642_3227921_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AWS96608.1|3228062_3229922_+	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	30.7	2.9e-19
AWS96609.1|3230265_3231669_+	hypothetical protein	NA	NA	NA	NA	NA
AWS96610.1|3231665_3232751_+|tail	phage tail protein	tail	M1PVV2	Vibrio_phage	31.5	7.6e-44
AWS96611.1|3232789_3233332_+|plate	baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	30.8	5.9e-05
AWS96612.1|3233328_3233766_+	hypothetical protein	NA	B5TK74	Pseudomonas_phage	45.8	4.0e-12
AWS96613.1|3233767_3234910_+|plate	phage baseplate protein	plate	A0A0A8WEY6	Clostridium_phage	34.8	4.7e-12
AWS96614.1|3234906_3235500_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
AWS96615.1|3236537_3237119_+|tail	phage tail protein	tail	K7PMC4	Enterobacterial_phage	47.2	2.0e-43
AWS96616.1|3239089_3239731_+	protein-serine/threonine phosphatase	NA	Q71TJ1	Escherichia_phage	49.8	2.5e-55
>prophage 224
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3247177	3249226	5262516		Moraxella_phage(100.0%)	1	NA	NA
AWS96624.1|3247177_3249226_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.4	1.2e-85
>prophage 225
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3254498	3254708	5262516		Morganella_phage(100.0%)	1	NA	NA
AWS96632.1|3254498_3254708_+	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 226
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3262205	3263765	5262516		Moraxella_phage(100.0%)	1	NA	NA
AWS96641.1|3262205_3263765_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.4	5.1e-41
>prophage 227
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3275075	3282426	5262516	tRNA	Pandoravirus(33.33%)	7	NA	NA
AWS96653.1|3275075_3276437_-	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	41.0	3.4e-41
AWS96654.1|3276520_3276700_+	YoaH family protein	NA	NA	NA	NA	NA
AWS96655.1|3276706_3277051_-	RidA family protein	NA	NA	NA	NA	NA
AWS96656.1|3277191_3279102_+	ATP-dependent helicase	NA	A0A127AW80	Bacillus_phage	33.0	4.5e-92
AWS96657.1|3279160_3279856_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AWS96658.1|3279951_3280536_+	hypothetical protein	NA	NA	NA	NA	NA
AWS96659.1|3280674_3282426_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	25.1	2.3e-34
>prophage 228
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3321717	3322449	5262516		Enterobacteria_phage(100.0%)	1	NA	NA
AWS96693.1|3321717_3322449_-	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	49.2	4.2e-54
>prophage 229
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3338235	3343947	5262516		Klosneuvirus(33.33%)	4	NA	NA
AWS96709.1|3338235_3339621_+	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.2	7.4e-28
AWS96710.1|3339636_3341100_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AWS96711.1|3341192_3342875_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	22.3	8.2e-21
AWS98609.1|3342999_3343947_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	8.6e-44
>prophage 230
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3347192	3351200	5262516		Pseudomonas_phage(50.0%)	5	NA	NA
AWS96715.1|3347192_3348275_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	38.8	4.3e-07
AWS96716.1|3348274_3349108_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AWS96717.1|3349104_3349497_+	hypothetical protein	NA	NA	NA	NA	NA
AWS96718.1|3349500_3350310_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
AWS96719.1|3350345_3351200_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	38.8	2.4e-45
>prophage 231
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3355773	3356004	5262516		Mythimna_unipuncta_granulovirus(100.0%)	1	NA	NA
AWS96724.1|3355773_3356004_+	putative cation transport regulator ChaB	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	45.3	2.7e-07
>prophage 232
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3367852	3378262	5262516		Escherichia_phage(25.0%)	10	NA	NA
AWS96733.1|3367852_3369391_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.5	1.8e-19
AWS96734.1|3369387_3370098_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
AWS96735.1|3370097_3370775_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
AWS96736.1|3371869_3372712_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	48.8	9.8e-15
AWS96737.1|3372767_3373223_-	hypothetical protein	NA	NA	NA	NA	NA
AWS96738.1|3373334_3374246_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
AWS96739.1|3374335_3375349_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
AWS96740.1|3375553_3376462_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	1.8e-59
AWS96741.1|3376600_3377014_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
AWS96742.1|3377644_3378262_+	thymidine kinase	NA	A0A0A0Q2F0	Pectobacterium_bacteriophage	52.7	1.9e-52
>prophage 233
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3386809	3389707	5262516		Planktothrix_phage(33.33%)	3	NA	NA
AWS96748.1|3386809_3387823_+	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	29.4	4.5e-14
AWS96749.1|3387819_3388824_+	oligopeptide ABC transporter ATP-binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	6.8e-15
AWS96750.1|3388870_3389707_+	transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	41.2	2.3e-08
>prophage 234
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3399018	3405491	5262516		Acinetobacter_phage(66.67%)	5	NA	NA
AWS96759.1|3399018_3400491_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	29.8	1.8e-16
AWS96760.1|3400523_3401330_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AWS96761.1|3401329_3402523_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AWS98613.1|3402533_3403892_-	bifunctional indole-3-glycerol phosphate synthase/phosphoribosylanthranilate isomerase	NA	A0A0P0IR83	Acinetobacter_phage	41.2	5.4e-39
AWS96762.1|3403895_3405491_-	bifunctional glutamine amidotransferase/anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	39.5	8.5e-52
>prophage 235
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3410469	3415856	5262516	protease	Chrysochromulina_ericina_virus(50.0%)	4	NA	NA
AWS96768.1|3410469_3411231_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	2.6e-06
AWS96769.1|3411453_3412500_+|protease	protease SohB	protease	NA	NA	NA	NA
AWS96770.1|3412608_3412860_-	DUF2498 domain-containing protein	NA	NA	NA	NA	NA
AWS96771.1|3413258_3415856_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	35.4	7.0e-88
>prophage 236
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3420688	3421372	5262516		Staphylococcus_phage(100.0%)	1	NA	NA
AWS96775.1|3420688_3421372_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.4	1.2e-42
>prophage 237
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3429162	3431097	5262516		Bodo_saltans_virus(100.0%)	1	NA	NA
AWS96784.1|3429162_3431097_-	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	23.9	1.6e-07
>prophage 238
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3434502	3436303	5262516		Bacillus_virus(50.0%)	2	NA	NA
AWS96788.1|3434502_3435309_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	1.3e-13
AWS96789.1|3435310_3436303_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	24.7	4.7e-08
>prophage 239
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3442300	3443209	5262516		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AWS96797.1|3442300_3443209_+	NAD(P)-dependent dehydrogenase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	53.0	6.3e-76
>prophage 240
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3457532	3458615	5262516		Planktothrix_phage(100.0%)	1	NA	NA
AWS96811.1|3457532_3458615_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	7.3e-23
>prophage 241
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3465678	3468171	5262516		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AWS96817.1|3465678_3468171_+	lysozyme	NA	M1HAV4	Paramecium_bursaria_Chlorella_virus	30.7	2.8e-33
>prophage 242
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3472690	3478073	5262516		Staphylococcus_phage(33.33%)	8	NA	NA
AWS96822.1|3472690_3473560_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.9	1.1e-50
AWS96823.1|3473645_3474209_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWS96824.1|3474325_3474556_+	thioredoxin family protein	NA	NA	NA	NA	NA
AWS96825.1|3474622_3474892_+	transcriptional antiterminator	NA	NA	NA	NA	NA
AWS96826.1|3474918_3475689_-	decarboxylase	NA	A0A077SK06	Escherichia_phage	28.7	7.8e-19
AWS96827.1|3475806_3476190_+	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
AWS96828.1|3476361_3476991_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AWS96829.1|3477020_3478073_+	hydroxyacid dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	46.4	9.2e-87
>prophage 243
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3481744	3492312	5262516	tRNA	Streptococcus_phage(14.29%)	12	NA	NA
AWS96834.1|3481744_3482260_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.5	1.6e-23
AWS96835.1|3482473_3483037_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
AWS96836.1|3483049_3484282_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.2	1.2e-16
AWS96837.1|3484410_3484632_-	hypothetical protein	NA	NA	NA	NA	NA
AWS98619.1|3484994_3486104_+	chemoreceptor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	22.2	4.3e-10
AWS96838.1|3486258_3487242_+	zinc transporter ZntB	NA	NA	NA	NA	NA
AWS96839.1|3487516_3487699_+	hypothetical protein	NA	NA	NA	NA	NA
AWS96840.1|3487727_3489101_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.7	8.6e-53
AWS96841.1|3489149_3490085_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.4	2.4e-139
AWS96842.1|3490282_3490717_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	7.2e-30
AWS96843.1|3490798_3491011_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
AWS96844.1|3491157_3492312_-	porin	NA	Q1MVN1	Enterobacteria_phage	57.0	6.0e-116
>prophage 244
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3497289	3498279	5262516		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AWS96847.1|3497289_3498279_-	2-hydroxyacid dehydrogenase	NA	M1HMI7	Paramecium_bursaria_Chlorella_virus	43.1	8.6e-71
>prophage 245
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3503246	3507149	5262516		Klosneuvirus(100.0%)	1	NA	NA
AWS96854.1|3503246_3507149_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.7	2.6e-54
>prophage 246
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3510943	3513405	5262516		Escherichia_phage(33.33%)	3	NA	NA
AWS96858.1|3510943_3511474_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	43.9	7.0e-19
AWS96859.1|3511717_3512137_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.7	1.8e-33
AWS96860.1|3512139_3513405_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	73.2	2.2e-183
>prophage 247
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3519600	3522577	5262516		Synechococcus_phage(50.0%)	2	NA	NA
AWS96867.1|3519600_3520719_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.6	3.6e-33
AWS96868.1|3520888_3522577_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.9	3.5e-19
>prophage 248
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3533671	3538373	5262516	protease	Bordetella_phage(50.0%)	4	NA	NA
AWS96881.1|3533671_3534541_+	AraC family transcriptional regulator	NA	A0A291LAM3	Bordetella_phage	46.1	1.2e-12
AWS96882.1|3534523_3535750_-	benzoate transporter	NA	NA	NA	NA	NA
AWS96883.1|3535795_3536332_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWS96884.1|3536411_3538373_+|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	27.8	2.1e-23
>prophage 249
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3541794	3546242	5262516		Cronobacter_phage(50.0%)	4	NA	NA
AWS96890.1|3541794_3542232_+	antitoxin	NA	F1C593	Cronobacter_phage	55.6	3.3e-30
AWS96891.1|3542324_3543734_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
AWS96892.1|3544063_3545209_+	spermidine/putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWS96893.1|3545225_3546242_+	polyamine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	58.9	2.5e-25
>prophage 250
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3549627	3550752	5262516		Salmonella_phage(100.0%)	1	NA	NA
AWS96897.1|3549627_3550752_-	MFS transporter	NA	S4TR35	Salmonella_phage	23.1	4.3e-10
>prophage 251
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3563584	3565705	5262516		Salmonella_phage(100.0%)	1	NA	NA
AWS96909.1|3563584_3565705_-	TonB-dependent siderophore receptor	NA	A0A1B0VCF0	Salmonella_phage	67.1	1.6e-138
>prophage 252
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3569151	3570693	5262516		Salmonella_phage(100.0%)	1	NA	NA
AWS96913.1|3569151_3570693_-	hypothetical protein	NA	A0A1B0V854	Salmonella_phage	55.4	3.7e-36
>prophage 253
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3577044	3577818	5262516		Bacillus_virus(100.0%)	1	NA	NA
AWS96920.1|3577044_3577818_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.6	1.0e-18
>prophage 254
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3582557	3584534	5262516		Tetraselmis_virus(100.0%)	1	NA	NA
AWS96926.1|3582557_3584534_-	hypothetical protein	NA	A0A2P0VMX1	Tetraselmis_virus	45.5	1.1e-160
>prophage 255
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3588745	3590290	5262516		Escherichia_phage(100.0%)	1	NA	NA
AWS96932.1|3588745_3590290_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.5	1.1e-19
>prophage 256
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3598417	3600457	5262516	transposase	Enterobacteria_phage(50.0%)	2	NA	NA
AWS98622.1|3598417_3599434_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	75.3	4.6e-144
AWS96937.1|3599476_3600457_+|transposase	IS5 family transposase ISKpn26	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 257
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3605851	3608249	5262516		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
AWS96943.1|3605851_3606451_+	inorganic diphosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	39.9	1.5e-22
AWS96944.1|3606533_3608249_-	ABC transporter ATP-binding protein	NA	A0A1B0RXA0	Streptococcus_phage	26.0	7.0e-36
>prophage 258
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3619122	3621043	5262516		Planktothrix_phage(100.0%)	2	NA	NA
AWS96956.1|3619122_3620064_-	peptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.6	1.6e-13
AWS96957.1|3620056_3621043_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.8	7.2e-17
>prophage 259
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3626930	3628874	5262516		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AWS96964.1|3626930_3628874_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.9	6.4e-09
>prophage 260
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3638580	3639375	5262516		Enterobacteria_phage(100.0%)	1	NA	NA
AWS96976.1|3638580_3639375_-	hypothetical protein	NA	D0U174	Enterobacteria_phage	55.8	1.8e-74
>prophage 261
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3650984	3655530	5262516		Streptococcus_phage(33.33%)	6	NA	NA
AWS96989.1|3650984_3651419_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.1e-09
AWS96990.1|3651446_3651665_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
AWS96991.1|3651698_3652598_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
AWS96992.1|3652796_3653984_+	transporter	NA	NA	NA	NA	NA
AWS96993.1|3654024_3654723_-	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	2.9e-12
AWS96994.1|3654732_3655530_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A1M7XV31	Cedratvirus	25.2	5.2e-10
>prophage 262
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3660356	3661283	5262516		Bacillus_phage(100.0%)	1	NA	NA
AWS96999.1|3660356_3661283_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.9	7.2e-19
>prophage 263
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3665340	3678319	5262516		Escherichia_phage(37.5%)	14	NA	NA
AWS97003.1|3665340_3665544_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	2.2e-13
AWS97004.1|3665619_3667086_-	D-mannonate oxidoreductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.2	4.2e-45
AWS97005.1|3667250_3668630_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.8	3.9e-29
AWS97006.1|3668683_3669703_-	Zn-dependent oxidoreductase	NA	NA	NA	NA	NA
AWS97007.1|3669716_3670931_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	29.2	7.4e-48
AWS97008.1|3671038_3671365_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	53.9	1.7e-23
AWS97009.1|3671517_3671859_+	DUF1283 domain-containing protein	NA	NA	NA	NA	NA
AWS97010.1|3671896_3672457_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AWS98625.1|3672463_3673174_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
AWS97011.1|3673277_3673586_+	hypothetical protein	NA	NA	NA	NA	NA
AWS97012.1|3673739_3676178_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.5	2.0e-214
AWS97013.1|3676188_3676806_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.6	4.7e-75
AWS97014.1|3676807_3677662_+	dimethylsulfoxide reductase	NA	NA	NA	NA	NA
AWS97015.1|3677704_3678319_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	38.1	3.3e-28
>prophage 264
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3684900	3687101	5262516		Hokovirus(50.0%)	2	NA	NA
AWS97022.1|3684900_3686382_-	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	28.8	1.1e-13
AWS97023.1|3686378_3687101_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.6	8.6e-36
>prophage 265
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3695731	3696583	5262516		Indivirus(100.0%)	1	NA	NA
AWS97033.1|3695731_3696583_+	2,5-diketo-D-gluconic acid reductase	NA	A0A1V0SDE7	Indivirus	30.5	2.7e-28
>prophage 266
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3708841	3710143	5262516		Bacillus_phage(100.0%)	1	NA	NA
AWS97045.1|3708841_3710143_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.1	7.5e-14
>prophage 267
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3740744	3742019	5262516	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
AWS97075.1|3740744_3742019_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.6	8.5e-87
>prophage 268
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3748935	3749460	5262516		Salmonella_phage(100.0%)	1	NA	NA
AWS97084.1|3748935_3749460_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	57.5	1.6e-47
>prophage 269
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3754561	3766092	5262516		Streptomyces_phage(16.67%)	11	NA	NA
AWS97092.1|3754561_3755392_+	endopeptidase	NA	A0A2H5BM69	Streptomyces_phage	41.6	2.4e-18
AWS97093.1|3755519_3756101_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	3.4e-43
AWS97094.1|3756140_3757310_-	MFS transporter	NA	NA	NA	NA	NA
AWS97095.1|3757485_3757575_-	YnhF family membrane protein	NA	NA	NA	NA	NA
AWS97096.1|3757872_3758898_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.3	1.8e-31
AWS97097.1|3758894_3759827_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWS97098.1|3759940_3761146_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
AWS97099.1|3761436_3762585_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.1	4.2e-85
AWS97100.1|3762632_3763274_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	37.3	1.5e-23
AWS97101.1|3763491_3764865_+	multidrug transporter MdtK	NA	NA	NA	NA	NA
AWS97102.1|3765393_3766092_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	32.1	8.7e-09
>prophage 270
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3774053	3775838	5262516		Bacillus_phage(100.0%)	1	NA	NA
AWS97111.1|3774053_3775838_+	hypothetical protein	NA	A0A127AWB9	Bacillus_phage	33.3	4.0e-18
>prophage 271
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3780158	3785975	5262516		Tupanvirus(33.33%)	5	NA	NA
AWS97115.1|3780158_3780911_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	30.8	3.0e-07
AWS97116.1|3780907_3781912_-	iron ABC transporter permease	NA	NA	NA	NA	NA
AWS97117.1|3781898_3782954_-	hypothetical protein	NA	NA	NA	NA	NA
AWS97118.1|3783130_3784393_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	24.5	3.4e-19
AWS97119.1|3784499_3785975_+	decarboxylase	NA	A0A1X9I5H2	Streptococcus_phage	25.1	1.3e-17
>prophage 272
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3796856	3801403	5262516		Planktothrix_phage(33.33%)	6	NA	NA
AWS97130.1|3796856_3797675_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.1	2.4e-34
AWS97131.1|3797674_3798460_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWS97132.1|3798449_3799127_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWS97133.1|3799136_3799949_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	33.8	1.0e-05
AWS97134.1|3799952_3800738_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
AWS97135.1|3800734_3801403_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	39.7	3.7e-25
>prophage 273
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3808286	3815698	5262516		Escherichia_phage(66.67%)	6	NA	NA
AWS97141.1|3808286_3809021_+	tetrathionate reductase subunit TtrB	NA	A0A077SL61	Escherichia_phage	37.4	4.2e-22
AWS97142.1|3809021_3810044_+	tetrathionate reductase subunit TtrC	NA	NA	NA	NA	NA
AWS97143.1|3810036_3813102_+	tetrathionate reductase subunit TtrA	NA	A0A077SK27	Escherichia_phage	25.9	7.2e-07
AWS97144.1|3813180_3813993_-	methionine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWS97145.1|3814014_3814683_-	ABC transporter permease	NA	NA	NA	NA	NA
AWS97146.1|3814675_3815698_-	methionine ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.3	2.2e-13
>prophage 274
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3819859	3824950	5262516		environmental_halophage(33.33%)	5	NA	NA
AWS97151.1|3819859_3821080_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	43.1	5.6e-96
AWS97152.1|3821076_3822348_-	signal peptide peptidase SppA	NA	NA	NA	NA	NA
AWS97153.1|3822322_3823069_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	25.0	1.7e-07
AWS97154.1|3823085_3824573_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
AWS97155.1|3824581_3824950_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	3.3e-15
>prophage 275
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3846966	3853385	5262516		Staphylococcus_phage(33.33%)	4	NA	NA
AWS97177.1|3846966_3848604_+	cyclohexanecarboxylate-CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	28.6	5.0e-31
AWS97178.1|3848671_3851050_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.2	1.5e-169
AWS97179.1|3851378_3852212_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
AWS97180.1|3852338_3853385_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B5IW14	Pandoravirus	47.1	6.7e-82
>prophage 276
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3858685	3872316	5262516	tRNA	Brazilian_cedratvirus(22.22%)	15	NA	NA
AWS97186.1|3858685_3859465_+	heme ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.1	8.7e-10
AWS97187.1|3859461_3860904_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.8	2.0e-52
AWS97188.1|3860965_3861679_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AWS97189.1|3861997_3862462_-	endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.2	3.5e-14
AWS97190.1|3862539_3863289_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	1.6e-08
AWS97191.1|3863288_3863840_-	glutathione peroxidase	NA	NA	NA	NA	NA
AWS97192.1|3863900_3864881_-	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	25.1	6.7e-15
AWS97193.1|3865036_3865336_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AWS97194.1|3865340_3867728_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AWS97195.1|3867743_3868727_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
AWS98628.1|3868967_3869012_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
AWS97196.1|3869136_3869493_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AWS97197.1|3869547_3869745_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AWS97198.1|3869841_3870384_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	8.2e-15
AWS97199.1|3870387_3872316_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	1.1e-127
>prophage 277
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3877565	3883316	5262516		Trichoplusia_ni_ascovirus(33.33%)	5	NA	NA
AWS97206.1|3877565_3878327_+	2-deoxy-D-gluconate 3-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.7	1.7e-21
AWS97207.1|3878410_3879010_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	34.3	3.5e-06
AWS97208.1|3879145_3880537_+	L-cystine transporter	NA	NA	NA	NA	NA
AWS97209.1|3880601_3880865_-	cell division activator CedA	NA	NA	NA	NA	NA
AWS97210.1|3881057_3883316_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.2	1.7e-143
>prophage 278
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3889465	3890296	5262516		Bacillus_virus(100.0%)	1	NA	NA
AWS97218.1|3889465_3890296_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	55.7	2.0e-73
>prophage 279
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3897779	3899000	5262516		Klosneuvirus(100.0%)	1	NA	NA
AWS97226.1|3897779_3899000_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.5	8.5e-28
>prophage 280
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3904546	3905179	5262516		Bacillus_phage(100.0%)	1	NA	NA
AWS97233.1|3904546_3905179_+	sulfate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.8	3.1e-13
>prophage 281
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3910202	3912149	5262516		Streptococcus_phage(100.0%)	1	NA	NA
AWS97239.1|3910202_3912149_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.4	1.2e-39
>prophage 282
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3916978	3921037	5262516		Tupanvirus(50.0%)	4	NA	NA
AWS97244.1|3916978_3917623_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	36.0	4.0e-16
AWS97245.1|3917660_3919019_-	MFS transporter	NA	NA	NA	NA	NA
AWS97246.1|3919159_3919918_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AWS97247.1|3920053_3921037_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	24.4	8.7e-07
>prophage 283
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3926694	3927948	5262516		Plodia_interpunctella_granulovirus(100.0%)	1	NA	NA
AWS97253.1|3926694_3927948_+	chitinase	NA	A0A1L5JGH0	Plodia_interpunctella_granulovirus	26.8	2.0e-24
>prophage 284
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3937047	3939976	5262516		Bacillus_phage(100.0%)	2	NA	NA
AWS97264.1|3937047_3938331_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	26.6	3.2e-09
AWS97265.1|3938485_3939976_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	28.3	6.8e-11
>prophage 285
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3944905	3945931	5262516		Bacillus_virus(100.0%)	1	NA	NA
AWS97273.1|3944905_3945931_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	26.1	5.5e-12
>prophage 286
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3959689	3963966	5262516	transposase	Enterobacteria_phage(33.33%)	6	NA	NA
AWS98633.1|3959689_3959980_+	lipoprotein bor	NA	C6ZCX3	Enterobacteria_phage	52.6	1.8e-21
AWS97286.1|3960108_3960315_-	hypothetical protein	NA	NA	NA	NA	NA
AWS97287.1|3961236_3961515_+	hypothetical protein	NA	NA	NA	NA	NA
AWS97288.1|3961659_3962199_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	73.1	1.6e-39
AWS97289.1|3962407_3963628_-|transposase	ISL3 family transposase ISKox3	transposase	NA	NA	NA	NA
AWS97290.1|3963723_3963966_+	DNA-damage-inducible protein I	NA	Q6UAW0	Klebsiella_phage	74.0	5.4e-27
>prophage 287
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3972194	3974466	5262516		Enterobacteria_phage(50.0%)	2	NA	NA
AWS97301.1|3972194_3972923_-	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	44.8	3.9e-44
AWS97302.1|3973215_3974466_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	9.4e-22
>prophage 288
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3977601	3981541	5262516	transposase	Bodo_saltans_virus(50.0%)	3	NA	NA
AWS97306.1|3977601_3978972_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.6	3.6e-107
AWS98635.1|3979339_3979966_+	methyltransferase	NA	NA	NA	NA	NA
AWS97307.1|3980268_3981541_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.7	2.8e-146
>prophage 289
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3988585	3988822	5262516		Enterobacteria_phage(100.0%)	1	NA	NA
AWS97316.1|3988585_3988822_+	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	64.0	1.5e-18
>prophage 290
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	3995410	4003051	5262516		Mycoplasma_phage(50.0%)	8	NA	NA
AWS97321.1|3995410_3996547_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	41.4	5.5e-29
AWS97322.1|3996530_3997388_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	25.4	4.3e-10
AWS97323.1|3997384_3998164_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
AWS98637.1|3998191_3999238_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
AWS97324.1|3999338_4000160_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	1.9e-23
AWS97325.1|4000175_4001087_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AWS97326.1|4001105_4002350_-	lipoprotein-releasing system transmembrane subunit LolE	NA	NA	NA	NA	NA
AWS97327.1|4002349_4003051_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	4.1e-35
>prophage 291
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4010322	4010580	5262516		Erwinia_phage(100.0%)	1	NA	NA
AWS98638.1|4010322_4010580_-	DUF1471 domain-containing protein	NA	A0A1B2IFR9	Erwinia_phage	35.7	3.6e-05
>prophage 292
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4037016	4038795	5262516		Acinetobacter_phage(100.0%)	1	NA	NA
AWS97354.1|4037016_4038795_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	34.9	7.4e-81
>prophage 293
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4042509	4043151	5262516		Pseudomonas_phage(100.0%)	1	NA	NA
AWS97358.1|4042509_4043151_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	38.2	1.3e-27
>prophage 294
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4046438	4047565	5262516		Ralstonia_phage(50.0%)	2	NA	NA
AWS97362.1|4046438_4046675_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
AWS97363.1|4046830_4047565_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	7.7e-16
>prophage 295
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4062156	4063107	5262516		Brevibacillus_phage(100.0%)	1	NA	NA
AWS97375.1|4062156_4063107_-	peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	30.9	1.3e-10
>prophage 296
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4078340	4078586	5262516		Enterobacteria_phage(100.0%)	1	NA	NA
AWS97394.1|4078340_4078586_+	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	50.0	8.2e-15
>prophage 297
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4083305	4086998	5262516		Morganella_phage(50.0%)	3	NA	NA
AWS97401.1|4083305_4084226_+	lipid A biosynthesis lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	41.6	1.7e-57
AWS97402.1|4084381_4085602_+	multidrug transporter MdtG	NA	NA	NA	NA	NA
AWS98641.1|4085666_4086998_-	hypothetical protein	NA	A0A127AWB9	Bacillus_phage	34.8	1.3e-18
>prophage 298
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4095300	4095843	5262516		Scale_drop_disease_virus(100.0%)	1	NA	NA
AWS97407.1|4095300_4095843_-	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	42.4	3.2e-27
>prophage 299
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4100024	4107369	5262516		Pelagibacter_phage(33.33%)	6	NA	NA
AWS97415.1|4100024_4100858_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	39.7	3.0e-40
AWS97416.1|4100904_4101435_-	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
AWS97417.1|4101488_4102043_-	molecular chaperone	NA	NA	NA	NA	NA
AWS97418.1|4102066_4102804_-	phosphatase	NA	NA	NA	NA	NA
AWS97419.1|4102890_4103829_-	glyoxylate/hydroxypyruvate reductase GhrA	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	28.8	1.9e-06
AWS97420.1|4104849_4107369_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	31.0	2.9e-86
>prophage 300
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4114721	4116971	5262516		Brazilian_cedratvirus(50.0%)	3	NA	NA
AWS97430.1|4114721_4115345_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	28.8	2.7e-09
AWS97431.1|4115719_4116013_+	hypothetical protein	NA	NA	NA	NA	NA
AWS97432.1|4116062_4116971_-	phosphate starvation-inducible protein PhoH	NA	A0A1B2ICF6	Erwinia_phage	70.4	6.9e-91
>prophage 301
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4129748	4129922	5262516		Enterobacteria_phage(100.0%)	1	NA	NA
AWS97442.1|4129748_4129922_-	stress-induced protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
>prophage 302
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4138851	4139772	5262516		Klosneuvirus(100.0%)	1	NA	NA
AWS97452.1|4138851_4139772_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	40.0	4.2e-11
>prophage 303
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4144005	4148381	5262516	integrase	Shigella_phage(50.0%)	4	4144391:4144403	4149490:4149502
AWS97458.1|4144005_4144368_+	GtrA family protein	NA	U5P0S6	Shigella_phage	55.0	1.3e-32
AWS97459.1|4144364_4145288_+	glycosyltransferase	NA	S5FKN0	Shigella_phage	82.0	3.1e-147
4144391:4144403	attL	GTTCAATGAAGAA	NA	NA	NA	NA
AWS97460.1|4145289_4146732_+	hypothetical protein	NA	A0A192Y7W8	Salmonella_phage	22.3	6.4e-14
AWS97461.1|4147154_4148381_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.2	3.7e-79
4149490:4149502	attR	GTTCAATGAAGAA	NA	NA	NA	NA
>prophage 304
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4154038	4154920	5262516		Enterococcus_phage(100.0%)	1	NA	NA
AWS97466.1|4154038_4154920_+	toll/interleukin-1 receptor domain-containing protein	NA	A0A097BYB4	Enterococcus_phage	41.9	6.2e-28
>prophage 305
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4170377	4171127	5262516		Cellulophaga_phage(100.0%)	1	NA	NA
AWS97483.1|4170377_4171127_+	DNA-binding protein	NA	M1Q742	Cellulophaga_phage	46.5	7.6e-27
>prophage 306
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4177093	4271299	5262516	protease,holin,terminase,integrase,plate,tail	Escherichia_phage(40.24%)	121	4220043:4220102	4261538:4261704
AWS97495.1|4177093_4177306_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	40.6	5.8e-09
AWS97496.1|4177475_4178318_-	hypothetical protein	NA	NA	NA	NA	NA
AWS97497.1|4178904_4179168_+	hypothetical protein	NA	A0A0M3ULK3	Salmonella_phage	81.2	2.0e-30
AWS97498.1|4179164_4179731_-	DNA-invertase	NA	K7PJT4	Enterobacteria_phage	91.8	1.2e-90
AWS97499.1|4179806_4180388_-|tail	phage tail protein	tail	K7PMC4	Enterobacterial_phage	46.7	1.3e-42
AWS97500.1|4181654_4182119_-	hypothetical protein	NA	NA	NA	NA	NA
AWS97501.1|4182162_4182867_-	hypothetical protein	NA	NA	NA	NA	NA
AWS97502.1|4182868_4184287_-|plate	baseplate J-like family protein	plate	A0A0U2RJZ0	Escherichia_phage	45.3	1.2e-54
AWS97503.1|4184283_4184616_-	hypothetical protein	NA	NA	NA	NA	NA
AWS97504.1|4184612_4185329_-	hypothetical protein	NA	A0A0U2JTX5	Escherichia_phage	30.8	7.0e-22
AWS97505.1|4185325_4186366_-	hypothetical protein	NA	NA	NA	NA	NA
AWS97506.1|4186365_4186641_-	hypothetical protein	NA	NA	NA	NA	NA
AWS97507.1|4186637_4187348_-	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	38.1	6.9e-30
AWS97508.1|4187347_4189174_-	hypothetical protein	NA	A0A2R3UAN6	Myoviridae_environmental_samples	41.9	4.9e-19
AWS97509.1|4189297_4189873_-	hypothetical protein	NA	NA	NA	NA	NA
AWS97510.1|4189875_4190313_-	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	38.9	1.2e-24
AWS97511.1|4190314_4191709_-	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	38.1	1.9e-71
AWS97512.1|4191714_4192653_-	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	39.2	2.2e-52
AWS97513.1|4192636_4193068_-	hypothetical protein	NA	NA	NA	NA	NA
AWS97514.1|4193064_4193490_-	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	43.3	3.6e-26
AWS97515.1|4193498_4193987_-	hypothetical protein	NA	NA	NA	NA	NA
AWS97516.1|4194052_4195084_-	DUF2184 domain-containing protein	NA	A0A0U2QQI2	Escherichia_phage	46.8	1.8e-74
AWS97517.1|4195101_4195974_-	hypothetical protein	NA	NA	NA	NA	NA
AWS97518.1|4195994_4197569_-	NUDIX hydrolase	NA	Q6UJ14	Burkholderia_virus	49.5	1.7e-20
AWS97519.1|4197569_4198445_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	43.9	1.1e-53
AWS97520.1|4198416_4199856_-	hypothetical protein	NA	A0A0U2S5X9	Escherichia_phage	38.0	7.6e-92
AWS97521.1|4199855_4201127_-	hypothetical protein	NA	A0A0U2JTW9	Escherichia_phage	38.6	1.0e-84
AWS97522.1|4201116_4202088_-|terminase	terminase small subunit	terminase	I6NV32	Burkholderia_virus	33.2	1.0e-23
AWS97523.1|4202149_4202560_-	hypothetical protein	NA	NA	NA	NA	NA
AWS97524.1|4202549_4203095_-	DUF2514 domain-containing protein	NA	A0A291AXG6	Shigella_phage	28.2	7.0e-06
AWS97525.1|4203097_4203514_-	structural protein	NA	A0A0E3GMJ2	Enterobacteria_phage	58.6	1.4e-43
AWS98647.1|4203516_4203864_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	90.7	1.3e-53
AWS97526.1|4204315_4204894_-	hypothetical protein	NA	A0A0U2S606	Escherichia_phage	51.4	9.0e-44
AWS97527.1|4204890_4205184_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	65.3	1.6e-33
AWS97528.1|4205180_4205777_-	hypothetical protein	NA	H9C173	Pectobacterium_phage	74.7	1.0e-82
AWS98648.1|4205844_4206036_-	hypothetical protein	NA	NA	NA	NA	NA
AWS97529.1|4206225_4206564_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	84.8	1.2e-48
AWS97530.1|4206649_4207027_-	hypothetical protein	NA	C6ZR26	Salmonella_phage	93.5	3.4e-36
AWS97531.1|4207026_4207449_-	hypothetical protein	NA	A5LH60	Enterobacteria_phage	43.7	1.3e-20
AWS97532.1|4207452_4207635_-	hypothetical protein	NA	Q9G079	Enterobacteria_phage	66.1	9.7e-13
AWS97533.1|4207636_4207936_-	hypothetical protein	NA	NA	NA	NA	NA
AWS97534.1|4207932_4208145_-	hypothetical protein	NA	NA	NA	NA	NA
AWS97535.1|4208141_4208684_-	hypothetical protein	NA	G9L663	Escherichia_phage	43.7	5.3e-14
AWS97536.1|4208683_4209283_-	adenine methylase	NA	A0A2R9YJG0	Escherichia_phage	86.8	6.1e-96
AWS97537.1|4211630_4212683_-	replication protein RepO	NA	A0A2H4JAA4	uncultured_Caudovirales_phage	47.2	2.4e-34
AWS97538.1|4212679_4213042_-	HNH endonuclease	NA	K4PAA9	Pseudomonas_phage	38.2	4.6e-14
AWS97539.1|4213044_4213269_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	46.1	4.7e-09
AWS97540.1|4213291_4213738_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	51.1	3.2e-25
AWS97541.1|4213802_4214036_-	XRE family transcriptional regulator	NA	A0A0U2S629	Escherichia_phage	44.4	2.9e-09
AWS97542.1|4214135_4214600_+	transcriptional regulator	NA	A0A0U2QW76	Escherichia_phage	50.3	1.5e-33
AWS97543.1|4215203_4215527_+	hypothetical protein	NA	NA	NA	NA	NA
AWS97544.1|4215572_4217846_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.5	2.8e-101
AWS97545.1|4217845_4218400_+	hypothetical protein	NA	H9C156	Pectobacterium_phage	61.0	2.3e-49
AWS97546.1|4218402_4218585_+	hypothetical protein	NA	H9C155	Pectobacterium_phage	51.7	2.2e-09
AWS97547.1|4218634_4218841_+	hypothetical protein	NA	H9C154	Pectobacterium_phage	58.8	7.9e-11
AWS97548.1|4218797_4219022_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AWS97549.1|4219022_4220042_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	54.1	7.5e-94
4220043:4220102	attL	TTTTTTATGCAATTGTGAGGGAGGGGATATTCTTTTCGAATATTCTTTCTTTATTCTTCT	NA	NA	NA	NA
AWS97550.1|4220398_4220662_+	hypothetical protein	NA	A0A0M3ULK3	Salmonella_phage	81.2	2.0e-30
AWS97551.1|4220658_4221225_-	DNA-invertase	NA	K7PJT4	Enterobacteria_phage	91.8	1.2e-90
AWS97552.1|4221300_4221882_-|tail	phage tail protein	tail	K7PMC4	Enterobacterial_phage	46.7	1.3e-42
AWS97553.1|4223148_4223613_-	hypothetical protein	NA	NA	NA	NA	NA
AWS97554.1|4223656_4224361_-	hypothetical protein	NA	NA	NA	NA	NA
AWS97555.1|4224362_4225781_-|plate	baseplate J-like family protein	plate	A0A0U2RJZ0	Escherichia_phage	45.3	1.2e-54
AWS97556.1|4225777_4226110_-	hypothetical protein	NA	NA	NA	NA	NA
AWS97557.1|4226106_4226823_-	hypothetical protein	NA	A0A0U2JTX5	Escherichia_phage	30.8	7.0e-22
AWS97558.1|4226819_4227860_-	hypothetical protein	NA	NA	NA	NA	NA
AWS97559.1|4227859_4228135_-	hypothetical protein	NA	NA	NA	NA	NA
AWS97560.1|4228131_4228842_-	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	38.1	6.9e-30
AWS97561.1|4228841_4230668_-	hypothetical protein	NA	A0A2R3UAN6	Myoviridae_environmental_samples	41.9	4.9e-19
AWS97562.1|4230791_4231367_-	hypothetical protein	NA	NA	NA	NA	NA
AWS97563.1|4231369_4231807_-	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	38.9	1.2e-24
AWS97564.1|4231808_4233203_-	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	38.3	4.9e-72
AWS97565.1|4233208_4234147_-	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	39.2	2.2e-52
AWS97566.1|4234991_4235480_-	hypothetical protein	NA	NA	NA	NA	NA
AWS97567.1|4235545_4236577_-	DUF2184 domain-containing protein	NA	A0A0U2QQI2	Escherichia_phage	46.8	1.8e-74
AWS97568.1|4236594_4237467_-	hypothetical protein	NA	NA	NA	NA	NA
AWS97569.1|4237487_4239062_-	NUDIX hydrolase	NA	Q6UJ14	Burkholderia_virus	49.5	1.7e-20
AWS97570.1|4239062_4239938_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	43.9	1.1e-53
AWS97571.1|4239909_4241349_-	hypothetical protein	NA	A0A0U2S5X9	Escherichia_phage	38.0	7.6e-92
AWS97572.1|4241348_4242620_-	hypothetical protein	NA	A0A0U2JTW9	Escherichia_phage	38.6	1.0e-84
AWS97573.1|4242609_4243581_-|terminase	terminase small subunit	terminase	I6NV32	Burkholderia_virus	33.2	1.0e-23
AWS97574.1|4243642_4244053_-	hypothetical protein	NA	NA	NA	NA	NA
AWS97575.1|4244042_4244588_-	DUF2514 domain-containing protein	NA	A0A291AXG6	Shigella_phage	28.2	7.0e-06
AWS97576.1|4244590_4245007_-	structural protein	NA	A0A0E3GMJ2	Enterobacteria_phage	58.6	1.4e-43
AWS98649.1|4245009_4245357_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	90.7	1.3e-53
AWS97577.1|4245808_4246387_-	hypothetical protein	NA	A0A0U2S606	Escherichia_phage	51.4	9.0e-44
AWS97578.1|4246383_4246677_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	65.3	1.6e-33
AWS97579.1|4246673_4247270_-	hypothetical protein	NA	H9C173	Pectobacterium_phage	74.7	1.0e-82
AWS98650.1|4247337_4247529_-	hypothetical protein	NA	NA	NA	NA	NA
AWS97580.1|4247718_4248057_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	84.8	1.2e-48
AWS97581.1|4248142_4248520_-	hypothetical protein	NA	C6ZR26	Salmonella_phage	93.5	3.4e-36
AWS97582.1|4248519_4248942_-	hypothetical protein	NA	A5LH60	Enterobacteria_phage	43.7	1.3e-20
AWS97583.1|4248945_4249128_-	hypothetical protein	NA	Q9G079	Enterobacteria_phage	66.1	9.7e-13
AWS97584.1|4249129_4249429_-	hypothetical protein	NA	NA	NA	NA	NA
AWS97585.1|4249425_4249638_-	hypothetical protein	NA	NA	NA	NA	NA
AWS97586.1|4249634_4250177_-	hypothetical protein	NA	G9L663	Escherichia_phage	43.7	5.3e-14
AWS97587.1|4250176_4250776_-	adenine methylase	NA	A0A2R9YJG0	Escherichia_phage	86.8	6.1e-96
AWS97588.1|4250768_4251017_-	hypothetical protein	NA	NA	NA	NA	NA
AWS97589.1|4251020_4251701_-	hypothetical protein	NA	NA	NA	NA	NA
AWS97590.1|4251740_4253129_-	replicative DNA helicase	NA	Q8HA30	Enterobacteria_phage	47.3	1.5e-108
AWS97591.1|4253125_4254178_-	replication protein RepO	NA	A0A2H4JAA4	uncultured_Caudovirales_phage	47.2	2.4e-34
AWS97592.1|4254174_4254537_-	HNH endonuclease	NA	K4PAA9	Pseudomonas_phage	38.2	4.6e-14
AWS97593.1|4254539_4254764_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	46.1	4.7e-09
AWS97594.1|4254786_4255233_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	51.1	3.2e-25
AWS97595.1|4255297_4255531_-	XRE family transcriptional regulator	NA	A0A0U2S629	Escherichia_phage	44.4	2.9e-09
AWS97596.1|4255630_4256095_+	transcriptional regulator	NA	A0A0U2QW76	Escherichia_phage	50.3	1.5e-33
AWS97597.1|4256698_4257022_+	hypothetical protein	NA	NA	NA	NA	NA
AWS97598.1|4257067_4259341_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.5	2.8e-101
AWS97599.1|4259340_4259895_+	hypothetical protein	NA	H9C156	Pectobacterium_phage	61.0	2.3e-49
AWS97600.1|4259897_4260080_+	hypothetical protein	NA	H9C155	Pectobacterium_phage	51.7	2.2e-09
AWS97601.1|4260129_4260336_+	hypothetical protein	NA	H9C154	Pectobacterium_phage	58.8	7.9e-11
AWS97602.1|4260292_4260517_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AWS97603.1|4260517_4261537_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	54.1	7.5e-94
AWS97604.1|4261874_4263503_-	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
4261538:4261704	attR	TTTTTTATGCAATTGTGAGGGAGGGGATATTCTTTTCGAATATTCTTTCTTTATTCTTCTGCTCAAAAAACAAAGGGGTCAGCATTTAGCTAACCCCTTGTTAAATTTGGCGGAAGCGTAGAGATTCGAACTCTAGAACCCTTTCGGGTCGCCGGTTTTCAAGACCG	NA	NA	NA	NA
AWS97605.1|4263772_4264432_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	8.9e-48
AWS97606.1|4264488_4264965_-	hypothetical protein	NA	NA	NA	NA	NA
AWS97607.1|4264961_4265717_-	transcriptional regulator	NA	NA	NA	NA	NA
AWS97608.1|4266019_4266769_+	fimbrial protein	NA	NA	NA	NA	NA
AWS97609.1|4266843_4267350_+	fimbrial protein	NA	NA	NA	NA	NA
AWS97610.1|4267422_4270140_+	fimbrial protein	NA	NA	NA	NA	NA
AWS97611.1|4270141_4271299_+|tail	phage tail protein	tail	NA	NA	NA	NA
>prophage 307
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4277675	4279730	5262516		Bacillus_phage(100.0%)	1	NA	NA
AWS97621.1|4277675_4279730_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	1.9e-19
>prophage 308
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4292303	4294211	5262516		Tupanvirus(100.0%)	1	NA	NA
AWS97632.1|4292303_4294211_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	3.5e-52
>prophage 309
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4302978	4309465	5262516	tRNA	Bacillus_virus(33.33%)	4	NA	NA
AWS97641.1|4302978_4303746_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	3.4e-30
AWS97642.1|4303817_4306430_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	21.6	2.0e-18
AWS97643.1|4306696_4307899_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AWS97644.1|4308064_4309465_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.5	2.2e-80
>prophage 310
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4313244	4313793	5262516		Rhodobacter_phage(100.0%)	1	NA	NA
AWS97647.1|4313244_4313793_-	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	32.6	3.5e-05
>prophage 311
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4328522	4333062	5262516		Bacillus_phage(100.0%)	3	NA	NA
AWS97659.1|4328522_4330271_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.7	1.9e-60
AWS97660.1|4330307_4332572_-	ComEC family protein	NA	NA	NA	NA	NA
AWS97661.1|4332777_4333062_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	39.1	9.2e-10
>prophage 312
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4337215	4338304	5262516		Streptococcus_phage(100.0%)	1	NA	NA
AWS97665.1|4337215_4338304_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.5	3.5e-81
>prophage 313
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4342427	4345636	5262516		Tetraselmis_virus(100.0%)	2	NA	NA
AWS97668.1|4342427_4344710_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	3.2e-161
AWS97669.1|4344895_4345636_+	pyruvate formate lyase-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	1.0e-20
>prophage 314
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4348893	4365359	5262516	tRNA	Escherichia_phage(25.0%)	10	NA	NA
AWS97673.1|4348893_4349511_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	5.6e-76
AWS97674.1|4349521_4351966_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.6	6.6e-221
AWS97675.1|4352172_4353465_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.1	2.5e-94
AWS97676.1|4353556_4354900_-	recombination factor protein RarA	NA	G3MBE0	Bacillus_virus	41.3	1.1e-81
AWS97677.1|4354910_4355522_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AWS98655.1|4355633_4359611_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.2	2.8e-88
AWS97678.1|4359745_4360240_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AWS97679.1|4360787_4361756_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.3	1.9e-62
AWS97680.1|4361870_4363637_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	25.3	1.6e-22
AWS97681.1|4363637_4365359_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	24.0	9.6e-17
>prophage 315
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4369829	4379273	5262516		Streptococcus_phage(25.0%)	11	NA	NA
AWS97687.1|4369829_4370957_-	23S rRNA (uracil(747)-C(5))-methyltransferase	NA	A0A1X9I6F4	Streptococcus_phage	27.1	2.3e-27
AWS97688.1|4371141_4371630_-	DUF2593 domain-containing protein	NA	NA	NA	NA	NA
AWS97689.1|4371689_4372535_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AWS97690.1|4372531_4373485_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
AWS97691.1|4373494_4374628_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
AWS97692.1|4374766_4375879_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AWS97693.1|4376312_4376789_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
AWS97694.1|4376879_4377782_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.0	8.2e-36
AWS97695.1|4377839_4378562_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
AWS97696.1|4378545_4378836_-	hypothetical protein	NA	NA	NA	NA	NA
AWS97697.1|4379009_4379273_+	glutaredoxin, GrxA family	NA	A0A2I7SAE2	Vibrio_phage	67.9	5.0e-26
>prophage 316
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4389934	4391944	5262516		Escherichia_phage(50.0%)	2	NA	NA
AWS97708.1|4389934_4390693_+	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	28.8	2.6e-14
AWS98657.1|4390741_4391944_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.1	1.7e-97
>prophage 317
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4399577	4401449	5262516		Planktothrix_phage(100.0%)	1	NA	NA
AWS97716.1|4399577_4401449_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	27.2	2.8e-14
>prophage 318
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4405587	4410836	5262516	transposase	Sodalis_phage(33.33%)	4	NA	NA
AWS97720.1|4405587_4406529_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	52.4	1.1e-64
AWS97721.1|4406703_4407366_-	fructose-6-phosphate aldolase	NA	A0A1D8KKK9	Synechococcus_phage	31.3	8.5e-22
AWS97722.1|4407498_4408398_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
AWS97723.1|4408403_4410836_+	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A076YHZ7	Citrobacter_phage	50.9	2.3e-08
>prophage 319
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4418511	4420107	5262516		Tupanvirus(100.0%)	1	NA	NA
AWS97729.1|4418511_4420107_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.5	1.1e-59
>prophage 320
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4425175	4430413	5262516		Enterobacteria_phage(33.33%)	6	NA	NA
AWS97734.1|4425175_4425691_-	outer membrane protein OmpX	NA	A5LH44	Enterobacteria_phage	33.7	1.9e-16
AWS97735.1|4426090_4426978_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
AWS97736.1|4427281_4427785_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	28.1	4.2e-05
AWS97737.1|4428150_4428897_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
AWS97738.1|4429034_4429694_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
AWS97739.1|4429690_4430413_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.1	2.8e-34
>prophage 321
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4434306	4444686	5262516		Yersinia_phage(25.0%)	9	NA	NA
AWS97744.1|4434306_4434573_+	DksA/TraR family C4-type zinc finger protein	NA	A0A2C9CZU7	Yersinia_phage	52.3	4.7e-16
AWS97745.1|4434874_4435135_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AWS97746.1|4435187_4436318_-	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
AWS97747.1|4436481_4437450_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
AWS97748.1|4437478_4439629_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	27.2	3.7e-42
AWS97749.1|4439725_4441066_-	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.0	4.9e-53
AWS97750.1|4441287_4441965_+	transcriptional regulator	NA	NA	NA	NA	NA
AWS97751.1|4441961_4442957_+	secretion protein HlyD	NA	NA	NA	NA	NA
AWS97752.1|4442949_4444686_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.2	5.1e-18
>prophage 322
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4454315	4455224	5262516		Streptococcus_phage(100.0%)	1	NA	NA
AWS97766.1|4454315_4455224_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	30.7	3.5e-26
>prophage 323
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4461665	4465105	5262516		Klosneuvirus(50.0%)	3	NA	NA
AWS97772.1|4461665_4462955_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.0	5.3e-20
AWS97773.1|4463012_4463489_+	kinase inhibitor	NA	NA	NA	NA	NA
AWS97774.1|4463584_4465105_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	40.0	1.1e-80
>prophage 324
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4473467	4480032	5262516		Planktothrix_phage(33.33%)	8	NA	NA
AWS97781.1|4473467_4474526_-	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.8	2.0e-20
AWS97782.1|4474528_4475218_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
AWS97783.1|4475217_4475991_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWS97784.1|4476071_4476251_-	hypothetical protein	NA	NA	NA	NA	NA
AWS97785.1|4476189_4476339_-	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
AWS97786.1|4476469_4477258_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
AWS97787.1|4477325_4478798_+	molybdate ABC transporter ATP-binding protein ModF	NA	W5SAS9	Pithovirus	27.5	7.9e-12
AWS97788.1|4479015_4480032_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.1	1.3e-77
>prophage 325
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4484364	4487879	5262516		Pandoravirus(33.33%)	4	NA	NA
AWS97793.1|4484364_4485417_-	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	48.7	7.5e-81
AWS97794.1|4485733_4486108_+	hypothetical protein	NA	NA	NA	NA	NA
AWS97795.1|4486221_4487163_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.0	3.7e-23
AWS97796.1|4487159_4487879_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	33.6	8.9e-25
>prophage 326
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4527782	4528574	5262516		Kaumoebavirus(100.0%)	1	NA	NA
AWS97832.1|4527782_4528574_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	29.6	9.8e-09
>prophage 327
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4534363	4538378	5262516	transposase	Acinetobacter_phage(33.33%)	3	NA	NA
AWS97840.1|4534363_4535845_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	27.2	4.6e-44
AWS97841.1|4535895_4536798_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	45.9	3.4e-66
AWS97842.1|4536959_4538378_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	33.6	6.6e-64
>prophage 328
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4541743	4543792	5262516		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AWS97847.1|4541743_4543792_+	K(+)-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	24.3	2.4e-30
>prophage 329
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4547058	4563943	5262516	tRNA	Bacillus_phage(16.67%)	16	NA	NA
AWS97850.1|4547058_4547736_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	32.0	2.6e-26
AWS97851.1|4547831_4549472_-	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	NA	NA	NA	NA
AWS97852.1|4549496_4550039_-	replication initiation negative regulator SeqA	NA	NA	NA	NA	NA
AWS97853.1|4550232_4551006_+	esterase	NA	W0LK50	Mycobacterium_phage	34.3	4.9e-05
AWS98663.1|4551134_4551422_+	LexA regulated protein	NA	NA	NA	NA	NA
AWS97854.1|4551532_4552108_+	flavodoxin FldA	NA	NA	NA	NA	NA
AWS97855.1|4552318_4552405_+	ryhB-regulated fur leader peptide	NA	NA	NA	NA	NA
AWS97856.1|4552397_4552844_+	transcriptional repressor	NA	NA	NA	NA	NA
AWS97857.1|4552971_4553898_+	tricarballylate utilization LysR family transcriptional regulator TcuR	NA	NA	NA	NA	NA
AWS97858.1|4553995_4555399_+	FAD-dependent tricarballylate dehydrogenase TcuA	NA	A0A2P0ZL82	Lactobacillus_phage	25.8	8.7e-08
AWS97859.1|4555385_4556525_+	tricarballylate utilization 4Fe-4S protein TcuB	NA	NA	NA	NA	NA
AWS97860.1|4556578_4557874_+	citrate-proton symporter	NA	Q6JIH2	Burkholderia_virus	34.7	1.2e-59
AWS97861.1|4557918_4558251_-	hypothetical protein	NA	NA	NA	NA	NA
AWS97862.1|4558300_4559707_-	chitoporin	NA	NA	NA	NA	NA
AWS97863.1|4560139_4561807_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	94.4	0.0e+00
AWS97864.1|4561993_4563943_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	48.6	1.4e-08
>prophage 330
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4568585	4570250	5262516		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AWS97870.1|4568585_4570250_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.9	1.6e-85
>prophage 331
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4574151	4575237	5262516		Pseudomonas_phage(100.0%)	1	NA	NA
AWS97872.1|4574151_4575237_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	3.3e-47
>prophage 332
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4581079	4586254	5262516	tRNA	Planktothrix_phage(50.0%)	4	NA	NA
AWS97879.1|4581079_4581805_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.1	1.9e-30
AWS97880.1|4581921_4582857_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
AWS97881.1|4582953_4583436_-	zinc ribbon-containing protein	NA	NA	NA	NA	NA
AWS97882.1|4583671_4586254_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.7	1.2e-185
>prophage 333
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4594413	4596862	5262516		Synechococcus_phage(50.0%)	2	NA	NA
AWS97890.1|4594413_4595508_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	4.7e-09
AWS97891.1|4595650_4596862_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.9	1.3e-100
>prophage 334
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4600467	4601143	5262516		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AWS97897.1|4600467_4600851_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.6	3.4e-23
AWS97898.1|4600903_4601143_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	71.4	1.8e-22
>prophage 335
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4614963	4618768	5262516		Mycobacterium_phage(33.33%)	4	NA	NA
AWS97912.1|4614963_4615794_-	alpha/beta hydrolase	NA	W8EHU1	Mycobacterium_phage	31.2	6.0e-17
AWS97913.1|4616070_4616481_+	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
AWS97914.1|4616669_4617098_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	2.8e-18
AWS97915.1|4617202_4618768_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	33.7	3.2e-43
>prophage 336
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4621886	4623712	5262516		Streptococcus_phage(50.0%)	2	NA	NA
AWS97919.1|4621886_4623110_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	33.3	1.2e-58
AWS97920.1|4623094_4623712_+	hypothetical protein	NA	A0A0F7L444	uncultured_marine_virus	54.8	4.6e-54
>prophage 337
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4636107	4644196	5262516		uncultured_Caudovirales_phage(33.33%)	5	NA	NA
AWS97931.1|4636107_4637115_+	Fe(3+)-siderophore ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	25.6	1.2e-14
AWS98668.1|4637114_4638104_+	iron-enterobactin ABC transporter permease	NA	NA	NA	NA	NA
AWS97932.1|4638100_4638898_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.5	1.9e-07
AWS97933.1|4638943_4640077_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
AWS97934.1|4640305_4644196_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.0	1.6e-59
>prophage 338
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4655697	4657077	5262516		Mycobacterium_phage(100.0%)	1	NA	NA
AWS97947.1|4655697_4657077_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	30.8	6.1e-30
>prophage 339
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4662700	4672039	5262516		Escherichia_phage(100.0%)	1	NA	NA
AWS97952.1|4662700_4672039_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	23.6	3.0e-11
>prophage 340
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4675888	4681500	5262516		Erysipelothrix_phage(50.0%)	3	NA	NA
AWS97958.1|4675888_4677214_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	46.0	1.5e-102
AWS97959.1|4677449_4678304_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWS97960.1|4678356_4681500_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.2	2.0e-57
>prophage 341
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4684838	4688772	5262516		Bacillus_phage(33.33%)	5	NA	NA
AWS97964.1|4684838_4685522_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.0	6.0e-31
AWS97965.1|4685511_4686963_+	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.7	5.6e-10
AWS97966.1|4687083_4687293_+	copper-binding protein	NA	NA	NA	NA	NA
AWS97967.1|4687376_4688180_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AWS97968.1|4688343_4688772_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	47.9	1.3e-26
>prophage 342
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4698937	4702142	5262516	tRNA	Enterococcus_phage(50.0%)	4	NA	NA
AWS97977.1|4698937_4699804_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.5	1.2e-28
AWS97978.1|4699805_4700018_+	hypothetical protein	NA	NA	NA	NA	NA
AWS97979.1|4700142_4700667_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AWS97980.1|4700756_4702142_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	1.6e-46
>prophage 343
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4713541	4714690	5262516		Streptococcus_phage(100.0%)	1	NA	NA
AWS97993.1|4713541_4714690_-	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.4	1.0e-46
>prophage 344
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4722145	4723927	5262516		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AWS98000.1|4722145_4723927_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.2	6.4e-40
>prophage 345
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4728361	4729378	5262516		Planktothrix_phage(100.0%)	1	NA	NA
AWS98006.1|4728361_4729378_-	virulence-associated ABC transporter ATP-binding protein SfbB	NA	G9BWD6	Planktothrix_phage	39.1	5.1e-34
>prophage 346
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4734249	4734936	5262516		Planktothrix_phage(100.0%)	1	NA	NA
AWS98010.1|4734249_4734936_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	7.9e-31
>prophage 347
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4738212	4738890	5262516		Bacillus_virus(100.0%)	1	NA	NA
AWS98014.1|4738212_4738890_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.0	8.9e-27
>prophage 348
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4744032	4746534	5262516		uncultured_virus(100.0%)	1	NA	NA
AWS98020.1|4744032_4746534_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	2.0e-116
>prophage 349
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4754702	4765597	5262516	transposase	Acanthamoeba_polyphaga_mimivirus(20.0%)	13	NA	NA
AWS98027.1|4754702_4755662_+	acetyl esterase	NA	A0A2L2DMU8	Acanthamoeba_polyphaga_mimivirus	27.5	1.3e-15
AWS98028.1|4755658_4756621_-	ferrochelatase	NA	NA	NA	NA	NA
AWS98029.1|4756802_4757447_-	adenylate kinase	NA	NA	NA	NA	NA
AWS98673.1|4757363_4757579_+	hypothetical protein	NA	NA	NA	NA	NA
AWS98030.1|4757678_4759553_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.6	6.4e-115
AWS98031.1|4759663_4760269_-	recombination protein RecR	NA	NA	NA	NA	NA
AWS98032.1|4760268_4760598_-	nucleoid-associated protein, YbaB/EbfC family	NA	NA	NA	NA	NA
AWS98033.1|4760655_4762584_-	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	41.5	3.0e-43
AWS98034.1|4762701_4763253_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.2e-30
AWS98674.1|4763447_4763825_-	DUF454 domain-containing protein	NA	NA	NA	NA	NA
AWS98035.1|4763894_4764422_+	primosomal replication protein N''	NA	NA	NA	NA	NA
AWS98036.1|4764436_4764604_+	DUF2496 domain-containing protein	NA	NA	NA	NA	NA
AWS98037.1|4764673_4765597_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.0	9.2e-67
>prophage 350
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4771137	4774287	5262516		Leptospira_phage(100.0%)	1	NA	NA
AWS98041.1|4771137_4774287_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.5	1.4e-53
>prophage 351
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4786421	4789965	5262516		Bacillus_phage(100.0%)	2	NA	NA
AWS98059.1|4786421_4788200_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	3.2e-39
AWS98060.1|4788192_4789965_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.9	1.2e-46
>prophage 352
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4794417	4795113	5262516		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AWS98065.1|4794417_4795113_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.4	8.4e-89
>prophage 353
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4798337	4803383	5262516	protease	Bacillus_phage(25.0%)	4	NA	NA
AWS98069.1|4798337_4798610_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.5e-20
AWS98070.1|4798819_4801174_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.5	9.4e-225
AWS98071.1|4801358_4802633_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	1.9e-131
AWS98072.1|4802759_4803383_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.4	4.9e-64
>prophage 354
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4819314	4819833	5262516		Escherichia_phage(100.0%)	1	NA	NA
AWS98675.1|4819314_4819833_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	38.3	7.8e-31
>prophage 355
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4830866	4840485	5262516	tRNA	uncultured_Mediterranean_phage(50.0%)	11	NA	NA
AWS98100.1|4830866_4831337_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	7.8e-30
AWS98101.1|4831427_4832531_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.8	1.5e-52
AWS98102.1|4832534_4832984_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AWS98103.1|4833138_4833678_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
AWS98104.1|4833976_4834840_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
AWS98105.1|4834885_4835578_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	29.0	6.6e-17
AWS98106.1|4835601_4835967_-	VOC family protein	NA	NA	NA	NA	NA
AWS98107.1|4836145_4837117_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.8	1.4e-44
AWS98108.1|4837127_4838975_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
AWS98109.1|4839002_4839335_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
AWS98110.1|4839357_4840485_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.3	1.6e-89
>prophage 356
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4856803	4866630	5262516		Bacillus_phage(60.0%)	7	NA	NA
AWS98124.1|4856803_4858099_-	two-component system sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	29.2	1.7e-26
AWS98125.1|4858149_4858839_-	phosphate regulon transcriptional regulatory protein PhoB	NA	W8CYM9	Bacillus_phage	39.4	3.0e-38
AWS98126.1|4859029_4860232_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	37.6	3.7e-07
AWS98127.1|4860228_4863378_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	22.1	1.6e-06
AWS98676.1|4863542_4864712_+	MFS transporter AraJ	NA	NA	NA	NA	NA
AWS98128.1|4864718_4865627_-	fructokinase	NA	NA	NA	NA	NA
AWS98129.1|4865718_4866630_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	64.3	2.7e-103
>prophage 357
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4870466	4871582	5262516		Bacillus_phage(100.0%)	1	NA	NA
AWS98136.1|4870466_4871582_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	35.5	9.6e-18
>prophage 358
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4888175	4888943	5262516		Planktothrix_phage(100.0%)	1	NA	NA
AWS98151.1|4888175_4888943_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	39.1	5.6e-25
>prophage 359
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4896998	4904123	5262516		Micromonas_sp._RCC1109_virus(50.0%)	7	NA	NA
AWS98159.1|4896998_4898045_+	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.2	3.1e-34
AWS98160.1|4898159_4899086_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
AWS98678.1|4899200_4900412_-	3-(3-hydroxy-phenyl)propionate transporter MhpT	NA	NA	NA	NA	NA
AWS98161.1|4900480_4901494_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	30.8	2.7e-43
AWS98162.1|4901490_4902441_-	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.7	9.6e-35
AWS98163.1|4902437_4903247_-	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
AWS98164.1|4903256_4904123_-	2-hydroxy-6-oxo-6-phenylhexa-2,4-dienoate hydrolase	NA	A0A2K9L3Q7	Tupanvirus	23.5	6.3e-09
>prophage 360
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4913704	4921658	5262516		Enterobacteria_phage(33.33%)	5	NA	NA
AWS98174.1|4913704_4914787_+	lac repressor	NA	C6ZCU4	Enterobacteria_phage	82.0	1.4e-159
AWS98175.1|4914908_4917986_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	80.9	0.0e+00
AWS98176.1|4918043_4919297_+	MFS transporter	NA	NA	NA	NA	NA
AWS98177.1|4919452_4919725_+	YceK/YidQ family lipoprotein	NA	NA	NA	NA	NA
AWS98178.1|4919771_4921658_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	1.4e-53
>prophage 361
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4935412	4936996	5262516		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AWS98189.1|4935412_4936996_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	26.6	2.7e-05
>prophage 362
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	4992181	4995892	5262516		Streptococcus_phage(66.67%)	3	NA	NA
AWS98233.1|4992181_4993432_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.7	2.6e-96
AWS98234.1|4993443_4994547_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.6	4.5e-60
AWS98235.1|4994836_4995892_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	59.2	8.0e-115
>prophage 363
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	5024162	5027832	5262516		Catovirus(100.0%)	2	NA	NA
AWS98264.1|5024162_5026724_+	glycosyl transferase	NA	A0A1V0SAN7	Catovirus	37.3	2.3e-30
AWS98265.1|5026755_5027832_+	hypothetical protein	NA	A0A1V0SAH6	Catovirus	38.8	1.2e-14
>prophage 364
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	5031430	5031826	5262516		Hokovirus(100.0%)	1	NA	NA
AWS98269.1|5031430_5031826_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	47.8	5.6e-29
>prophage 365
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	5045268	5048551	5262516		Clostridioides_phage(50.0%)	4	NA	NA
AWS98284.1|5045268_5046030_-	peptidoglycan endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	39.2	7.0e-20
AWS98285.1|5046379_5047120_+	transpeptidase	NA	NA	NA	NA	NA
AWS98286.1|5047090_5047858_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
AWS98287.1|5047969_5048551_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	30.8	7.4e-14
>prophage 366
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	5064871	5069070	5262516		Bradyrhizobium_phage(33.33%)	5	NA	NA
AWS98687.1|5064871_5065600_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	41.1	1.1e-41
AWS98303.1|5065664_5066132_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	59.7	8.5e-53
AWS98304.1|5066128_5066851_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWS98305.1|5066884_5067640_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AWS98306.1|5067711_5069070_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	9.9e-09
>prophage 367
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	5073116	5073920	5262516		Indivirus(100.0%)	1	NA	NA
AWS98311.1|5073116_5073920_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.0	6.0e-38
>prophage 368
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	5080364	5081396	5262516		Planktothrix_phage(100.0%)	1	NA	NA
AWS98313.1|5080364_5081396_+	D-methionine ABC transporter, ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.2	5.5e-36
>prophage 369
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	5093435	5097539	5262516		Saccharomonospora_phage(50.0%)	2	NA	NA
AWS98327.1|5093435_5096918_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	7.0e-208
AWS98328.1|5096942_5097539_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.3	4.6e-27
>prophage 370
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	5106349	5107108	5262516		Flavobacterium_phage(100.0%)	1	NA	NA
AWS98337.1|5106349_5107108_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	41.5	9.4e-25
>prophage 371
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	5118643	5120077	5262516	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AWS98348.1|5118643_5120077_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.8	2.1e-25
>prophage 372
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	5124079	5124424	5262516		Lake_Baikal_phage(100.0%)	1	NA	NA
AWS98353.1|5124079_5124424_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	7.7e-27
>prophage 373
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	5130359	5131157	5262516		Planktothrix_phage(100.0%)	1	NA	NA
AWS98358.1|5130359_5131157_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	9.2e-15
>prophage 374
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	5136360	5143180	5262516	tRNA	Niemeyer_virus(50.0%)	6	NA	NA
AWS98361.1|5136360_5138790_-	ATP-dependent helicase HrpB	NA	A0A0U2UIE6	Niemeyer_virus	30.2	9.0e-37
AWS98362.1|5138863_5139394_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
AWS98363.1|5139409_5140114_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
AWS98364.1|5140291_5140747_+	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
AWS98365.1|5140817_5141714_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AWS98366.1|5141764_5143180_+	polynucleotide adenylyltransferase	NA	G3MAR3	Bacillus_virus	35.9	5.4e-26
>prophage 375
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	5148648	5156545	5262516		Anomala_cuprea_entomopoxvirus(25.0%)	7	NA	NA
AWS98374.1|5148648_5149575_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.7	2.4e-22
AWS98375.1|5149683_5150346_+	carbonate dehydratase	NA	NA	NA	NA	NA
AWS98376.1|5150439_5150976_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	3.0e-17
AWS98689.1|5151179_5153570_+	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family	NA	NA	NA	NA	NA
AWS98377.1|5153655_5155266_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	54.3	3.6e-18
AWS98378.1|5155419_5155767_+	hypothetical protein	NA	NA	NA	NA	NA
AWS98379.1|5155777_5156545_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	36.6	4.7e-32
>prophage 376
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	5167476	5168901	5262516		Erysipelothrix_phage(100.0%)	1	NA	NA
AWS98390.1|5167476_5168901_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	4.6e-41
>prophage 377
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	5179969	5180533	5262516		Sphingobium_phage(100.0%)	1	NA	NA
AWS98398.1|5179969_5180533_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.0	2.8e-10
>prophage 378
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	5184802	5185846	5262516		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AWS98403.1|5184802_5185846_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	55.3	1.2e-102
>prophage 379
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	5211939	5213664	5262516		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AWS98428.1|5211939_5213664_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	25.7	2.3e-34
>prophage 380
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	5226518	5227226	5262516		Bacillus_virus(100.0%)	1	NA	NA
AWS98440.1|5226518_5227226_+	thiamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.8	2.2e-23
>prophage 381
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	5234376	5239811	5262516		Lymphocystis_disease_virus(50.0%)	2	NA	NA
AWS98447.1|5234376_5236728_+	DNA polymerase II	NA	A0A1B2RW58	Lymphocystis_disease_virus	25.1	2.5e-15
AWS98448.1|5236904_5239811_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	1.7e-21
>prophage 382
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	5247539	5248958	5262516		Pseudomonas_phage(50.0%)	2	NA	NA
AWS98456.1|5247539_5248388_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A0A0YWI7	Pseudomonas_phage	45.3	1.1e-05
AWS98457.1|5248478_5248958_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	47.1	3.0e-29
>prophage 383
CP029727	Citrobacter sp. CRE-46 strain AR_0157 chromosome, complete genome	5262516	5257288	5258806	5262516		Vibrio_phage(100.0%)	1	NA	NA
AWS98467.1|5257288_5258806_+	L-carnitine/gamma-butyrobetaine antiporter	NA	A0A2I7QNT1	Vibrio_phage	22.2	1.4e-08
>prophage 1
CP029729	Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed1, complete sequence	250887	0	40700	250887	transposase,integrase	Escherichia_phage(21.43%)	33	8109:8123	42571:42585
AWS98737.1|1135_1417_-	XRE family transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
AWS98738.1|1397_1727_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
AWS98739.1|2402_4475_-	DUF87 domain-containing protein	NA	NA	NA	NA	NA
AWS98740.1|4471_5863_-	hypothetical protein	NA	NA	NA	NA	NA
AWS98741.1|5939_6521_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	48.3	5.5e-41
AWS98742.1|6679_9688_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.6	0.0e+00
8109:8123	attL	ACATCTGGTTGGAAA	NA	NA	NA	NA
AWS98743.1|9910_10579_-	hypothetical protein	NA	NA	NA	NA	NA
AWS98744.1|11087_11900_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AWS98745.1|11902_13123_+	hypothetical protein	NA	NA	NA	NA	NA
AWS98746.1|13177_13381_-	hypothetical protein	NA	NA	NA	NA	NA
AWS98747.1|13394_14714_-	DUF1173 domain-containing protein	NA	NA	NA	NA	NA
AWS98748.1|14738_14909_-	hypothetical protein	NA	NA	NA	NA	NA
AWS98749.1|15037_16465_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.6	2.8e-102
AWS98750.1|16687_17203_+	thermonuclease family protein	NA	V5UN65	Mycobacterium_phage	28.9	1.1e-08
AWS98751.1|17199_18141_+	hypothetical protein	NA	NA	NA	NA	NA
AWS98752.1|18409_19216_-	DUF4263 domain-containing protein	NA	NA	NA	NA	NA
AWS98753.1|19478_20876_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AWS98754.1|21155_22679_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AWS98755.1|22641_24312_+|integrase	integrase	integrase	NA	NA	NA	NA
AWS98756.1|26986_27712_+	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	42.2	4.4e-40
AWS98757.1|27811_28222_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
AWS98758.1|28324_29284_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
AWS98759.1|29429_30518_+	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	61.7	9.7e-124
AWS98760.1|30580_31285_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AWS98761.1|31477_32629_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.7	1.1e-98
AWS98762.1|32982_34053_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWS98763.1|34112_34421_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AWS98764.1|34467_35343_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
AWS98765.1|35598_36861_-|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AWS98766.1|37169_38246_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWS98767.1|38464_38845_-	hypothetical protein	NA	NA	NA	NA	NA
AWS98768.1|39022_39457_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	41.1	1.2e-21
AWS98769.1|39440_40700_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	42.9	2.7e-93
42571:42585	attR	ACATCTGGTTGGAAA	NA	NA	NA	NA
>prophage 2
CP029729	Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed1, complete sequence	250887	62755	64667	250887		Salinibacter_virus(50.0%)	2	NA	NA
AWS98787.1|62755_63937_+	S49 family peptidase	NA	A0A2I6UGK8	Salinibacter_virus	31.4	7.8e-10
AWS98967.1|63953_64667_+	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	36.4	5.7e-08
>prophage 3
CP029729	Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed1, complete sequence	250887	73264	73996	250887		Escherichia_phage(100.0%)	1	NA	NA
AWS98802.1|73264_73996_-	hypothetical protein	NA	Q71T76	Escherichia_phage	56.1	4.3e-67
>prophage 4
CP029729	Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed1, complete sequence	250887	81038	128521	250887	transposase	Salmonella_phage(25.0%)	49	NA	NA
AWS98809.1|81038_82070_-|transposase	IS630 family transposase ISEc33	transposase	NA	NA	NA	NA
AWS98810.1|82225_83407_-	hypothetical protein	NA	NA	NA	NA	NA
AWS98811.1|83415_83712_-	toxin-plasmid maintenance system killer protein	NA	A0A222YWE2	Escherichia_phage	35.1	4.9e-06
AWS98812.1|83775_84243_-	hypothetical protein	NA	NA	NA	NA	NA
AWS98813.1|84541_84868_+	hypothetical protein	NA	NA	NA	NA	NA
AWS98814.1|85102_85879_+	hypothetical protein	NA	NA	NA	NA	NA
AWS98815.1|86028_86805_+	hypothetical protein	NA	NA	NA	NA	NA
AWS98816.1|86869_86992_+	hypothetical protein	NA	NA	NA	NA	NA
AWS98817.1|86993_87335_+	hypothetical protein	NA	NA	NA	NA	NA
AWS98818.1|87339_87699_+	hypothetical protein	NA	M9UXL5	Escherichia_phage	45.1	2.9e-08
AWS98819.1|87750_87930_+	hypothetical protein	NA	NA	NA	NA	NA
AWS98820.1|87926_88631_+	hypothetical protein	NA	A0A1W6DXB8	Sphingobium_phage	25.2	5.5e-11
AWS98821.1|88663_89083_-	hypothetical protein	NA	NA	NA	NA	NA
AWS98822.1|90005_91278_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.7	2.8e-146
AWS98823.1|93141_93744_+	DUF4165 domain-containing protein	NA	NA	NA	NA	NA
AWS98824.1|93755_93992_+	hypothetical protein	NA	NA	NA	NA	NA
AWS98825.1|94147_94744_+	hypothetical protein	NA	NA	NA	NA	NA
AWS98826.1|95135_96017_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	41.3	6.5e-54
AWS98969.1|96602_97100_-	hypothetical protein	NA	NA	NA	NA	NA
AWS98827.1|97114_97318_-	hypothetical protein	NA	NA	NA	NA	NA
AWS98828.1|97768_100225_-	DUF4165 domain-containing protein	NA	NA	NA	NA	NA
AWS98829.1|100661_101882_+|transposase	ISL3 family transposase ISKox3	transposase	NA	NA	NA	NA
AWS98830.1|101994_102171_-	hypothetical protein	NA	NA	NA	NA	NA
AWS98831.1|102185_103940_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	30.9	1.1e-68
AWS98832.1|104235_104619_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	36.3	4.1e-13
AWS98833.1|104615_104963_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
AWS98834.1|105012_106548_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.3	2.5e-258
AWS98835.1|106585_107728_-	DNA-binding protein	NA	A0A2P9HXK7	Yersinia_phage	24.6	1.0e-19
AWS98836.1|108087_108912_+	DNA modification methylase	NA	A0A2P9J4Y7	Pectobacterium_phage	37.6	2.8e-46
AWS98837.1|108926_109748_-	hypothetical protein	NA	NA	NA	NA	NA
AWS98838.1|110022_110730_-	hypothetical protein	NA	NA	NA	NA	NA
AWS98839.1|110726_110927_-	hypothetical protein	NA	NA	NA	NA	NA
AWS98840.1|110944_112021_-	hypothetical protein	NA	A0A1P8DTT7	Salmonella_phage	31.8	7.8e-09
AWS98841.1|112555_113431_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	43.5	1.6e-60
AWS98842.1|113793_114956_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	4.4e-50
AWS98970.1|115002_115539_-	hypothetical protein	NA	NA	NA	NA	NA
AWS98843.1|116133_116487_+	pili assembly chaperone	NA	NA	NA	NA	NA
AWS98844.1|116505_116856_+	plasmid transfer protein	NA	NA	NA	NA	NA
AWS98845.1|116855_117653_+	pilus assembly protein	NA	NA	NA	NA	NA
AWS98846.1|117655_118888_+	TrhK	NA	NA	NA	NA	NA
AWS98847.1|118889_119330_+	hypothetical protein	NA	NA	NA	NA	NA
AWS98848.1|119319_120678_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
AWS98849.1|120686_121199_+	transcriptional regulator	NA	NA	NA	NA	NA
AWS98850.1|121199_122057_+	htdT	NA	NA	NA	NA	NA
AWS98851.1|122066_123017_+	TrhV	NA	NA	NA	NA	NA
AWS98852.1|123025_125707_+	conjugal transfer protein	NA	NA	NA	NA	NA
AWS98853.1|125910_126114_+	hypothetical protein	NA	NA	NA	NA	NA
AWS98854.1|126551_127352_-	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	99.6	1.9e-145
AWS98855.1|127348_128521_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	99.2	7.0e-229
>prophage 5
CP029729	Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed1, complete sequence	250887	131959	132967	250887		Aeromonas_phage(100.0%)	1	NA	NA
AWS98859.1|131959_132967_+	peptide transporter	NA	A0A1I9KFW9	Aeromonas_phage	32.1	3.9e-10
>prophage 6
CP029729	Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed1, complete sequence	250887	136213	137248	250887		Enterobacteria_phage(100.0%)	1	NA	NA
AWS98864.1|136213_137248_+	stbA family protein	NA	A0A0A7NPX4	Enterobacteria_phage	34.3	6.7e-42
>prophage 7
CP029729	Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed1, complete sequence	250887	141461	210533	250887	transposase,integrase	Escherichia_phage(23.08%)	61	189086:189145	207358:209014
AWS98869.1|141461_142735_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.7	2.8e-146
AWS98870.1|145999_146512_+	signal peptidase I	NA	NA	NA	NA	NA
AWS98871.1|146498_148007_+	conjugal transfer protein	NA	NA	NA	NA	NA
AWS98971.1|148196_149204_+	plasmid transfer protein	NA	NA	NA	NA	NA
AWS98872.1|149226_152403_+	conjugal transfer protein TraN	NA	NA	NA	NA	NA
AWS98873.1|152430_153303_-	lipoprotein	NA	NA	NA	NA	NA
AWS98874.1|153484_155269_+	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	26.4	2.1e-19
AWS98875.1|155666_156542_+	hypothetical protein	NA	NA	NA	NA	NA
AWS98876.1|156600_156978_+	hypothetical protein	NA	NA	NA	NA	NA
AWS98877.1|157038_158025_+	hypothetical protein	NA	NA	NA	NA	NA
AWS98878.1|158084_159137_+	ATP-binding protein	NA	NA	NA	NA	NA
AWS98879.1|159175_159445_+	hypothetical protein	NA	NA	NA	NA	NA
AWS98880.1|159515_160643_+	DUF3150 domain-containing protein	NA	NA	NA	NA	NA
AWS98881.1|160720_162733_+	VWA domain-containing protein	NA	NA	NA	NA	NA
AWS98882.1|162804_163026_+	hypothetical protein	NA	NA	NA	NA	NA
AWS98883.1|163119_164373_+	hypothetical protein	NA	A0A0H5AWB1	Pseudomonas_phage	29.7	3.0e-12
AWS98884.1|164647_165172_+	hypothetical protein	NA	NA	NA	NA	NA
AWS98885.1|165162_166128_+	hypothetical protein	NA	NA	NA	NA	NA
AWS98886.1|167211_168132_+	hypothetical protein	NA	NA	NA	NA	NA
AWS98887.1|168204_169140_+	hypothetical protein	NA	NA	NA	NA	NA
AWS98888.1|169316_170273_+	hypothetical protein	NA	NA	NA	NA	NA
AWS98889.1|170685_170955_+	hypothetical protein	NA	NA	NA	NA	NA
AWS98890.1|171009_171600_+	hypothetical protein	NA	NA	NA	NA	NA
AWS98891.1|171607_171865_+	hypothetical protein	NA	NA	NA	NA	NA
AWS98892.1|171938_172475_+	hypothetical protein	NA	NA	NA	NA	NA
AWS98893.1|172491_172947_+	hypothetical protein	NA	NA	NA	NA	NA
AWS98894.1|172930_173158_+	hypothetical protein	NA	NA	NA	NA	NA
AWS98895.1|173161_173440_+	hypothetical protein	NA	NA	NA	NA	NA
AWS98896.1|173528_174488_+	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
AWS98897.1|174498_175407_+	hypothetical protein	NA	NA	NA	NA	NA
AWS98898.1|175342_175687_+	hypothetical protein	NA	NA	NA	NA	NA
AWS98899.1|176702_177407_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWS98900.1|177465_177717_+	hypothetical protein	NA	NA	NA	NA	NA
AWS98901.1|177830_178976_+	ABC transporter permease	NA	NA	NA	NA	NA
AWS98972.1|178972_179773_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.7	1.8e-10
AWS98902.1|179774_180713_+	MCE family protein	NA	NA	NA	NA	NA
AWS98903.1|180712_181354_+	ABC transporter	NA	NA	NA	NA	NA
AWS98904.1|181701_182979_+	serine dehydratase subunit alpha family protein	NA	NA	NA	NA	NA
AWS98905.1|184435_185617_-	recombinase	NA	NA	NA	NA	NA
AWS98906.1|185831_186044_+	hypothetical protein	NA	NA	NA	NA	NA
AWS98907.1|186220_186862_+	hypothetical protein	NA	NA	NA	NA	NA
AWS98908.1|187141_188215_+	hypothetical protein	NA	NA	NA	NA	NA
AWS98909.1|188292_188436_-	hypothetical protein	NA	NA	NA	NA	NA
189086:189145	attL	CTATTTTTCGGGGATCTGATTGCCCTCTGGCAATATCATTCAGCACGCCATAGTCGGCAT	NA	NA	NA	NA
AWS98910.1|190794_191499_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AWS98911.1|192383_192926_+	DNA-binding protein	NA	NA	NA	NA	NA
AWS98912.1|193284_194169_-	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AWS98913.1|194224_195700_-	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
AWS98914.1|196098_197283_-|transposase	IS4 family transposase ISEc29	transposase	A0A0F7LAS3	uncultured_marine_virus	35.4	4.5e-50
AWS98915.1|197331_197517_+	hypothetical protein	NA	NA	NA	NA	NA
AWS98916.1|197736_198018_+	hypothetical protein	NA	NA	NA	NA	NA
AWS98973.1|197998_198772_-	ArmA family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
AWS98917.1|200170_201712_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AWS98918.1|202116_202956_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AWS98919.1|202949_203297_-	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AWS98920.1|203460_204252_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AWS98921.1|204257_204548_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
AWS98922.1|204659_205157_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
AWS98923.1|205301_206315_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AWS98924.1|206253_206556_+|transposase	transposase	transposase	NA	NA	NA	NA
AWS98925.1|206589_207294_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWS98926.1|209975_210533_+	recombinase	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
207358:209014	attR	CTATTTTTCGGGGATCTGATTGCCCTCTGGCAATATCATTCAGCACGCCATAGTCGGCATCATGGTCCATTCGCCAGAAAACCGAAGCACCGGCATCAGCCAGGCGTGGAGAAAACTGGTATCCCAGCAGCCAGAAAAGGCCAAAGACAAGTTCGCTGGCACCTGCTGTATCGGTCATAATTTCGGTTGGATTCAGCCCGGTCTCCTGTTCCAGAAGACCTTCCAGCACAAAGATAGAGTCCCTCAGCGTCCCCGGTATAACGATGCCATGAAAGCCGGAATACTGATCGGACACAAAGTTGTACCAGGTGATCCCTCTGTTATTACCAAAGTATTTGCGGTTCGGTCCGGCATTGATTGTTCTGACTGGCGTAACAAAGCGCATTCCATCTGCAGATGCCACTTCTCCTCCACCCCATATCTGTGCCAGTGGCAGCGTTGCCTGAAAATCAACCAGTCTGGCATTAGCGCTGGTGATAGTTTCAGCCCGCAGATAGTTCGCTTTTGTCCAGTTCAGCCGGTGTCGGGTCAGTGCAGGAACATTTGATCTGATCAGTGGTTCCAGACCGATATTGCAGGCTTCAGCCATCAGCACGGCGCTGATGCTGACGGGCAGATCATCAACTCTGGCACTGGCTTCACTAGCATGGAAAAACTCATCAGCAAATCCGGTATGGGCGTTAATTTCGAGCAGCAACTCCGTTAAATCCACCGGAGGGAGTAGATCACTGATCATTTTGCTCAGTCGTTTCAGACTGTCCGGCTCATCAAGACTGGCGAGGGGAGAAATTGTCAACCGGGGCTTCGGGCCAGAAACATCGAGTTCGACAGCCTCATTTTCGCAAAGACGTGCAGCAACCTGTCTGTAACGACTATCAAGCTGATGACCCAGAGATTTTATTGCTTCCTGCGGGTCTGTCGGGTGCCCCAAAGAACGATAAACCTTAATCCGGTTTGCCTGCCAGTCAGCACCCTGTAGTAATCTTGCACGAGGATCTCCCCACCGGTTACTGCCGGTAACGTAGACATCCCTCCGCCTCAGACTATCCTGCAGTTTACTGAGAAAGCAGAGCGTGTATCCCCTGCGGGTGATATGTTTTTCCTTGTTAATCACCAGCCGTTTCCATGACCGACTGATAATTTCCGTTGGTGCGTCGTCAAAAAACTGCCGCCGTGAGCTGAACTCCCGGCTGAGGTAGTCACAGGCATTCAGAGTGGTAACCCCGGCAGGTGCGGATGAAAATTTAACGGTATTCAGCAGATGGGGCAGGAAACGACGAACGCGCCCGTACTGCTCCACCATTTCTTCATGAAAATTATCGTCTGAGGGCCGGGCAATTTCACGGACAAGCGTGATGATTTCAGCCAGCTTTTGCCTTGGGATGTAGCTGAACACCTCAGCACGAATCGATTCGTCCGGTGTTTCTTCTTTCAGCAGGTACGAACATGCGCTGGCGAGCGCCAATGCAGATTTATCCAGATCCTTCAGCGAGCGGAGCCGTTTTTTCTGCCCAATCTTTCTGGCGTCACGGATGATAACGGCCAGCATGGCGTCCAGAACGTCCAATGCATCATCCAGCGCCAGCGTTTCCCATGCAAGGACAAAGGCAACCAGAACCGCCATCCTTTTCTGCGGTGACATCCTGGCAATATTGAA	NA	NA	NA	NA
>prophage 8
CP029729	Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed1, complete sequence	250887	213762	217928	250887	transposase	Enterobacteria_phage(50.0%)	4	NA	NA
AWS98929.1|213762_214623_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AWS98930.1|214915_215293_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
AWS98931.1|215382_216021_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AWS98975.1|216721_217928_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.9	5.7e-101
>prophage 9
CP029729	Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed1, complete sequence	250887	221758	225993	250887		Salmonella_phage(66.67%)	5	NA	NA
AWS98937.1|221758_222565_+	HNH endonuclease	NA	G0X580	Salmonella_phage	37.9	1.3e-13
AWS98938.1|222670_223090_+	hypothetical protein	NA	NA	NA	NA	NA
AWS98939.1|223397_223847_+	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	35.4	7.5e-06
AWS98940.1|224614_225019_-	DNA-binding protein	NA	NA	NA	NA	NA
AWS98941.1|225639_225993_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	4.1e-23
>prophage 10
CP029729	Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed1, complete sequence	250887	232838	233480	250887		Streptomyces_phage(100.0%)	1	NA	NA
AWS98947.1|232838_233480_-	TerD family protein	NA	A0A2P1N0C0	Streptomyces_phage	25.1	1.8e-05
>prophage 11
CP029729	Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed1, complete sequence	250887	238056	250613	250887	transposase	Caulobacter_phage(37.5%)	13	NA	NA
AWS98953.1|238056_239136_-	hypothetical protein	NA	A0A172Q0S8	Acinetobacter_phage	33.8	1.1e-39
AWS98954.1|239137_239911_-	hypothetical protein	NA	NA	NA	NA	NA
AWS98977.1|239903_241046_-	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	28.4	1.8e-32
AWS98955.1|241057_242116_-	carbamoyl-phosphate synthase large chain	NA	NA	NA	NA	NA
AWS98956.1|242426_243011_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	29.4	2.0e-11
AWS98957.1|243007_244159_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
AWS98958.1|244181_244637_+	Tellurium resistance protein TerB	NA	NA	NA	NA	NA
AWS98959.1|244660_245701_+	tellurium resistance protein TerC	NA	K7QKE8	Escherichia_phage	46.3	4.1e-71
AWS98960.1|245739_246318_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.8	1.9e-33
AWS98961.1|246404_246980_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	9.6e-30
AWS98962.1|247064_248306_+	tellurium resistance protein TerF	NA	A0A2D1GNA9	Pseudoalteromonas_phage	25.1	4.8e-10
AWS98963.1|248642_249290_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
AWS98964.1|249689_250613_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	99.7	4.6e-175
>prophage 1
CP029730	Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed2, complete sequence	136246	95929	123456	136246	tail,integrase,transposase,head	Escherichia_phage(37.5%)	26	90356:90373	128399:128416
90356:90373	attL	AACTTTCACATGTGAAAG	NA	NA	NA	NA
AWS99085.1|95929_96940_-|integrase	integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
AWS99086.1|96942_97479_-	hypothetical protein	NA	NA	NA	NA	NA
AWS99087.1|97471_97759_-	hypothetical protein	NA	NA	NA	NA	NA
AWS99088.1|97777_98098_-	hypothetical protein	NA	NA	NA	NA	NA
AWS99089.1|100773_101697_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	4.9e-177
AWS99090.1|102083_103115_-|transposase	IS630 family transposase ISEc33	transposase	NA	NA	NA	NA
AWS99091.1|103390_103921_-	chromosome partitioning protein ParB	NA	A0A0R6PHV6	Moraxella_phage	35.8	2.9e-17
AWS99092.1|103925_104123_-	hypothetical protein	NA	NA	NA	NA	NA
AWS99093.1|104209_104434_-	hypothetical protein	NA	NA	NA	NA	NA
AWS99094.1|104628_105660_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AWS99095.1|105946_106900_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AWS99096.1|106964_108497_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.5	1.9e-16
AWS99097.1|108483_109503_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
AWS99098.1|109580_110951_+	hypothetical protein	NA	NA	NA	NA	NA
AWS99099.1|110947_111868_+	carbohydrate kinase	NA	NA	NA	NA	NA
AWS99100.1|112281_112986_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWS99135.1|113135_113429_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWS99101.1|113850_114555_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AWS99102.1|115569_118542_-	conjugal transfer protein TraI	NA	NA	NA	NA	NA
AWS99103.1|118709_119327_+	hypothetical protein	NA	NA	NA	NA	NA
AWS99104.1|119308_119542_+	hypothetical protein	NA	NA	NA	NA	NA
AWS99105.1|119541_121734_+	DNA topoisomerase 3	NA	A0A1X9I6W8	Streptococcus_phage	29.4	9.9e-43
AWS99106.1|121748_122237_+	hypothetical protein	NA	NA	NA	NA	NA
AWS99107.1|122327_122627_-	RNA-binding protein	NA	A0A0K1LLW2	Caulobacter_phage	55.4	3.6e-20
AWS99108.1|122631_122838_-	hypothetical protein	NA	NA	NA	NA	NA
AWS99109.1|122838_123456_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
128399:128416	attR	CTTTCACATGTGAAAGTT	NA	NA	NA	NA
>prophage 1
CP029731	Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed3, complete sequence	108148	8215	19811	108148	transposase	Enterobacteria_phage(33.33%)	14	NA	NA
AWS99141.1|8215_9139_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.2	1.0e-166
AWS99142.1|9521_10727_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.2	1.1e-205
AWS99143.1|10723_11695_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.9	1.4e-113
AWS99144.1|11830_13102_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.0	6.1e-154
AWS99145.1|13101_13524_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	51.5	3.1e-30
AWS99146.1|13583_14804_-|transposase	ISL3 family transposase ISKox3	transposase	NA	NA	NA	NA
AWS99147.1|15027_15699_-	DNA breaking-rejoining protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.7	5.1e-83
AWS99148.1|16057_16735_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
AWS99149.1|16734_16956_+	hypothetical protein	NA	NA	NA	NA	NA
AWS99150.1|16966_17386_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AWS99151.1|17439_18219_+	hypothetical protein	NA	NA	NA	NA	NA
AWS99152.1|18623_19130_+	antirestriction protein	NA	A0A1I9S7Y0	Rhodococcus_phage	31.8	4.8e-09
AWS99153.1|19172_19364_+	hypothetical protein	NA	NA	NA	NA	NA
AWS99154.1|19550_19811_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	46.2	4.1e-12
>prophage 2
CP029731	Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed3, complete sequence	108148	69776	92325	108148	transposase	Escherichia_phage(40.0%)	21	NA	NA
AWS99209.1|69776_70757_-|transposase	IS5 family transposase ISKpn26	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
AWS99246.1|71200_72157_+	hypothetical protein	NA	NA	NA	NA	NA
AWS99210.1|73309_73969_-	endonuclease III	NA	NA	NA	NA	NA
AWS99211.1|75234_75405_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AWS99212.1|75518_75818_+	DUF2293 domain-containing protein	NA	NA	NA	NA	NA
AWS99213.1|75901_76144_-	hypothetical protein	NA	NA	NA	NA	NA
AWS99214.1|76162_76342_+	hypothetical protein	NA	NA	NA	NA	NA
AWS99215.1|76271_77111_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.5	2.9e-11
AWS99216.1|77489_78455_-	hypothetical protein	NA	NA	NA	NA	NA
AWS99217.1|78456_79389_-|transposase	transposase	transposase	NA	NA	NA	NA
AWS99218.1|79385_80072_-	hypothetical protein	NA	NA	NA	NA	NA
AWS99219.1|80105_80870_-|transposase	transposase	transposase	NA	NA	NA	NA
AWS99220.1|81315_81582_+	hypothetical protein	NA	NA	NA	NA	NA
AWS99221.1|81609_83139_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AWS99222.1|83099_83294_-	hypothetical protein	NA	NA	NA	NA	NA
AWS99223.1|83435_84281_+	RmtC family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
AWS99224.1|85668_86685_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
AWS99225.1|86816_87347_-	N-acetyltransferase	NA	NA	NA	NA	NA
AWS99226.1|87350_87620_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AWS99227.1|88487_89465_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	61.3	1.2e-101
AWS99228.1|91205_92325_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	3.0e-51
>prophage 1
CP029734	Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed6, complete sequence	76953	24506	42236	76953	protease,transposase	Escherichia_phage(50.0%)	19	NA	NA
AWS99453.1|24506_25211_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AWS99454.1|27971_28832_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AWS99455.1|29014_29572_-	recombinase	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
AWS99513.1|29717_29897_-	hypothetical protein	NA	NA	NA	NA	NA
AWS99456.1|29873_30638_+|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AWS99457.1|30828_31185_-	hypothetical protein	NA	NA	NA	NA	NA
AWS99458.1|31130_31715_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AWS99459.1|31714_32953_-	MFS transporter	NA	NA	NA	NA	NA
AWS99460.1|32949_33864_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AWS99461.1|33985_34690_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWS99462.1|34824_34920_+	23S rRNA methyltransferase attenuator leader peptide ErmL	NA	NA	NA	NA	NA
AWS99463.1|35045_35783_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.6	6.3e-135
AWS99464.1|35787_35898_+	hypothetical protein	NA	E4ZFP9	Streptococcus_phage	88.6	1.9e-08
AWS99465.1|36412_36862_+	hypothetical protein	NA	NA	NA	NA	NA
AWS99466.1|37390_38872_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AWS99467.1|38883_39588_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWS99468.1|40797_40902_-	hypothetical protein	NA	NA	NA	NA	NA
AWS99469.1|40898_41363_-	mRNA interferase PemK	NA	NA	NA	NA	NA
AWS99470.1|41582_42236_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 1
CP029735	Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed7, complete sequence	63868	7918	62363	63868	coat,transposase	Escherichia_phage(22.73%)	60	NA	NA
AWS99526.1|7918_8935_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.9e-186
AWS99585.1|8972_9095_-	sugar kinase	NA	Q6QLL3	Human_immunodeficiency_virus	97.3	5.9e-14
AWS99527.1|9216_9627_+	hypothetical protein	NA	NA	NA	NA	NA
AWS99528.1|9631_10486_+	hypothetical protein	NA	NA	NA	NA	NA
AWS99529.1|10482_11676_+	hypothetical protein	NA	NA	NA	NA	NA
AWS99530.1|11677_12712_+	UDP-N-acetylglucosamine 4,6-dehydratase/5-epimerase	NA	K7Y9E1	Megavirus	39.1	1.2e-46
AWS99531.1|12713_13817_+	capsular biosynthesis protein	NA	A0A0E3HJ59	Synechococcus_phage	23.5	1.9e-05
AWS99532.1|13813_14944_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	51.4	1.7e-107
AWS99533.1|14943_16158_+	glycosyltransferase WbuB	NA	NA	NA	NA	NA
AWS99534.1|16144_16552_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AWS99586.1|16705_16882_+	hypothetical protein	NA	Q76S41	Shigella_phage	63.5	5.2e-11
AWS99535.1|16891_17860_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	29.1	3.6e-13
AWS99536.1|19195_20602_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	A0A1D7RI04	Synechococcus_phage	29.1	1.4e-29
AWS99537.1|20682_22899_+	hypothetical protein	NA	NA	NA	NA	NA
AWS99538.1|23281_24298_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.9e-186
AWS99539.1|25055_25613_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	59.1	6.4e-55
AWS99540.1|25629_26889_-	flippase	NA	NA	NA	NA	NA
AWS99541.1|26892_27774_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	64.8	8.7e-107
AWS99542.1|27825_28725_-	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	35.3	7.2e-32
AWS99543.1|28724_29810_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.8	1.1e-98
AWS99544.1|30121_30292_-	hypothetical protein	NA	NA	NA	NA	NA
AWS99545.1|30345_31005_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
AWS99587.1|31205_31583_-	N-acetyltransferase	NA	NA	NA	NA	NA
AWS99546.1|32553_32865_-	hypothetical protein	NA	NA	NA	NA	NA
AWS99547.1|33070_33355_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AWS99548.1|33454_34117_-	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
AWS99549.1|34497_35160_+	resolvase	NA	M9Q1K0	Clostridium_phage	29.1	9.7e-10
AWS99550.1|35287_36508_+|transposase	ISL3 family transposase ISKox3	transposase	NA	NA	NA	NA
AWS99588.1|36570_36810_+	DNA polymerase V	NA	I6PD82	Cronobacter_phage	55.1	4.4e-21
AWS99551.1|36812_37193_+	sOS mutagenesis and repair protein UmuD	NA	Q71TH8	Escherichia_phage	48.1	4.7e-25
AWS99552.1|38089_38275_-	hypothetical protein	NA	NA	NA	NA	NA
AWS99589.1|38232_38445_-	hypothetical protein	NA	NA	NA	NA	NA
AWS99553.1|38507_38783_-	hypothetical protein	NA	NA	NA	NA	NA
AWS99554.1|38800_39055_-	hypothetical protein	NA	NA	NA	NA	NA
AWS99555.1|39164_39986_-	sprT domain-containing protein	NA	NA	NA	NA	NA
AWS99556.1|39982_40162_-	hypothetical protein	NA	NA	NA	NA	NA
AWS99557.1|40178_40361_-	hypothetical protein	NA	NA	NA	NA	NA
AWS99558.1|40887_41975_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	1.4e-45
AWS99559.1|42323_42779_-	DNA-binding protein	NA	NA	NA	NA	NA
AWS99560.1|42790_45118_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	28.1	8.6e-37
AWS99561.1|45121_46384_-	ATP-binding protein	NA	A0A1V0SKF8	Klosneuvirus	31.4	1.3e-07
AWS99562.1|46466_46961_-	micrococcal nuclease	NA	A0A0R6PHV6	Moraxella_phage	37.3	8.0e-17
AWS99563.1|46957_47284_-	hypothetical protein	NA	NA	NA	NA	NA
AWS99564.1|47369_47684_-	hypothetical protein	NA	NA	NA	NA	NA
AWS99565.1|47771_48164_-	conjugal transfer protein	NA	NA	NA	NA	NA
AWS99566.1|48160_50002_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AWS99567.1|49998_51033_-	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
AWS99568.1|51029_51227_-	DNA-binding protein	NA	NA	NA	NA	NA
AWS99569.1|51228_52443_-	type IV secretion system protein VirB10	NA	NA	NA	NA	NA
AWS99570.1|52439_53369_-	conjugal transfer protein	NA	NA	NA	NA	NA
AWS99571.1|53374_54103_-	pilus assembly protein	NA	NA	NA	NA	NA
AWS99572.1|54297_55353_-	pilus assembly protein	NA	NA	NA	NA	NA
AWS99573.1|55364_55622_-	hypothetical protein	NA	NA	NA	NA	NA
AWS99574.1|55631_56402_-	pilus assembly protein	NA	NA	NA	NA	NA
AWS99575.1|56411_59165_-	conjugal transfer protein	NA	NA	NA	NA	NA
AWS99576.1|59189_59480_-	hypothetical protein	NA	NA	NA	NA	NA
AWS99577.1|59463_60108_-	transglycosylase	NA	NA	NA	NA	NA
AWS99578.1|60153_60390_-	hypothetical protein	NA	NA	NA	NA	NA
AWS99579.1|60340_60850_-	transcription termination factor NusG	NA	NA	NA	NA	NA
AWS99580.1|61202_62363_-|coat	spore coat protein CotH	coat	NA	NA	NA	NA
