The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029747	Escherichia coli strain 2016C-3878 chromosome, complete genome	4995456	956377	1014830	4995456	tail,portal,protease,head,capsid,tRNA,lysis,integrase,terminase,holin	Enterobacteria_phage(48.21%)	77	966528:966574	1015253:1015299
AWT00452.1|956377_957763_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
AWT00453.1|957798_958320_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AWT00454.1|958427_958640_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
AWT00455.1|958641_959508_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
AWT00456.1|959979_960522_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
AWT00457.1|960740_961433_+	fimbrial chaperone SfmC	NA	NA	NA	NA	NA
AWT00458.1|961463_964073_+	outer membrane usher protein	NA	NA	NA	NA	NA
AWT00459.1|964085_965093_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
AWT00460.1|965103_965619_+	fimbriae assembly protein	NA	NA	NA	NA	NA
AWT04200.1|965621_966254_-	fimbriae biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
966528:966574	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
AWT00461.1|966587_967751_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.0	3.7e-198
AWT00462.1|967606_967978_-	DNA-binding protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
AWT00463.1|967949_968228_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
AWT00464.1|968275_968494_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
AWT00465.1|968592_968874_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
AWT00466.1|968884_969442_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.9	3.2e-62
AWT00467.1|969438_969597_-	DUF1317 family protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.1	1.8e-23
AWT00468.1|969593_970274_-	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
AWT00469.1|970270_971056_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	2.4e-148
AWT00470.1|971061_971358_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
AWT00471.1|971433_971640_-	cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	4.2e-28
AWT00472.1|972195_972513_-	hypothetical protein	NA	NA	NA	NA	NA
AWT00473.1|972644_972914_-	hypothetical protein	NA	A0A2H4FNC7	Salmonella_phage	75.3	4.8e-32
AWT00474.1|972994_973750_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.4	4.7e-93
AWT00475.1|973788_974019_+	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	68.0	8.5e-22
AWT00476.1|974100_974640_+	regulator	NA	M9NZI6	Enterobacteria_phage	65.6	7.5e-61
AWT00477.1|974636_975656_+	Replication protein O	NA	A0A0K2FJ31	Enterobacteria_phage	68.4	6.7e-111
AWT00478.1|975652_976354_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	97.0	7.9e-127
AWT00479.1|976350_976653_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	94.6	2.6e-42
AWT00480.1|976720_977053_+	multidrug SMR transporter	NA	NA	NA	NA	NA
AWT00481.1|977309_978836_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.7	6.1e-31
AWT00482.1|978947_979265_+	hypothetical protein	NA	NA	NA	NA	NA
AWT00483.1|979469_980399_+	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	40.0	3.0e-57
AWT00484.1|980497_980599_+	hypothetical protein	NA	NA	NA	NA	NA
AWT00485.1|980595_981051_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	67.5	3.7e-61
AWT00486.1|981050_981221_+	NinE family protein	NA	NA	NA	NA	NA
AWT00487.1|981213_981504_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
AWT00488.1|981500_981863_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
AWT00489.1|981859_982000_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
AWT00490.1|982084_982441_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	92.0	2.3e-58
AWT00491.1|982420_983635_-	hypothetical protein	NA	NA	NA	NA	NA
AWT00492.1|983637_984813_-	hypothetical protein	NA	NA	NA	NA	NA
AWT00493.1|985104_985431_+|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	99.1	1.2e-56
AWT00494.1|985434_985911_+	lysozyme	NA	K7PKX1	Enterobacterial_phage	96.1	9.5e-84
AWT00495.1|985907_986369_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	98.7	4.1e-76
AWT00496.1|986400_986694_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
AWT00497.1|987056_987251_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
AWT00498.1|987398_987500_+	hypothetical protein	NA	NA	NA	NA	NA
AWT00499.1|987639_988185_+	DNA-packaging protein NU1	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
AWT00500.1|988159_990085_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
AWT00501.1|990081_990288_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AWT00502.1|990284_991886_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	1.1e-309
AWT00503.1|991866_993186_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	98.6	4.8e-234
AWT00504.1|993195_993528_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
AWT00505.1|993583_994609_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	99.1	3.9e-191
AWT00506.1|994650_995049_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	84.1	5.2e-51
AWT00507.1|995060_995414_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
AWT00508.1|995425_996004_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
AWT00509.1|996000_996396_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
AWT04201.1|996403_997144_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.5	2.4e-126
AWT00510.1|997159_997582_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.0	7.7e-69
AWT00511.1|997608_997998_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.1	3.4e-55
AWT00512.1|997990_1000552_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	99.2	0.0e+00
AWT00513.1|1000548_1000878_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	92.7	6.0e-53
AWT00514.1|1000877_1001576_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	9.9e-130
AWT00515.1|1001580_1002324_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	1.8e-145
AWT00516.1|1002221_1002863_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	86.0	8.6e-96
AWT00517.1|1002923_1006403_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.2	0.0e+00
AWT04202.1|1006470_1007070_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	92.5	3.4e-102
AWT00518.1|1007134_1009507_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	68.8	7.9e-163
AWT00519.1|1009506_1009788_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	2.7e-17
AWT00520.1|1009797_1010502_+	chaperone of endosialidase	NA	A0A1X7QGH6	Escherichia_phage	62.3	5.4e-59
AWT00521.1|1010512_1010806_+	hypothetical protein	NA	NA	NA	NA	NA
AWT00522.1|1010916_1011054_+|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AWT04203.1|1010998_1011625_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWT00523.1|1012205_1013690_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWT00524.1|1013876_1014830_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
1015253:1015299	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 2
CP029747	Escherichia coli strain 2016C-3878 chromosome, complete genome	4995456	1369640	1379082	4995456		Enterobacteria_phage(85.71%)	10	NA	NA
AWT00858.1|1369640_1370567_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
AWT00859.1|1370571_1371303_+	ABC transporter permease	NA	NA	NA	NA	NA
AWT00860.1|1371283_1371391_-	hypothetical protein	NA	NA	NA	NA	NA
AWT00861.1|1371450_1372182_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
AWT00862.1|1372403_1374089_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.5	9.5e-304
AWT00863.1|1374085_1374805_+	two-component system response regulator YehT	NA	NA	NA	NA	NA
AWT00864.1|1374851_1375322_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	1.5e-81
AWT00865.1|1375362_1375824_-	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
AWT00866.1|1375948_1377949_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	94.9	0.0e+00
AWT00867.1|1377945_1379082_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	98.4	5.9e-164
>prophage 3
CP029747	Escherichia coli strain 2016C-3878 chromosome, complete genome	4995456	1491225	1502483	4995456		Acanthocystis_turfacea_Chlorella_virus(25.0%)	10	NA	NA
AWT00962.1|1491225_1492242_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	44.3	6.3e-77
AWT00963.1|1492310_1493318_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AWT00964.1|1493328_1494450_+	GDP-mannose 4,6-dehydratase	NA	M1HVG7	Acanthocystis_turfacea_Chlorella_virus	64.7	2.2e-131
AWT00965.1|1494453_1495419_+	GDP-L-fucose synthase	NA	M1I5W5	Acanthocystis_turfacea_Chlorella_virus	51.7	9.9e-88
AWT00966.1|1495421_1495877_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
AWT00967.1|1495888_1497274_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.5	1.9e-47
AWT00968.1|1497357_1498104_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	41.6	2.1e-08
AWT00969.1|1498128_1499499_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	28.4	6.4e-32
AWT00970.1|1499662_1501069_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.4e-37
AWT00971.1|1501316_1502483_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	1.7e-110
>prophage 4
CP029747	Escherichia coli strain 2016C-3878 chromosome, complete genome	4995456	1549615	1592031	4995456	transposase,plate	uncultured_Caudovirales_phage(44.44%)	32	NA	NA
AWT01019.1|1549615_1549870_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	61.2	1.7e-15
AWT01020.1|1549866_1550502_-	hypothetical protein	NA	NA	NA	NA	NA
AWT01021.1|1550940_1551276_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
AWT01022.1|1551279_1552493_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.4	4.7e-103
AWT01023.1|1552640_1556729_+	hypothetical protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	35.6	1.5e-23
AWT01024.1|1556739_1557081_+	hypothetical protein	NA	NA	NA	NA	NA
AWT01025.1|1557125_1557839_+	hypothetical protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	35.5	8.2e-23
AWT01026.1|1557841_1558135_+	hypothetical protein	NA	NA	NA	NA	NA
AWT01027.1|1558257_1558566_-	putative addiction module antidote protein	NA	NA	NA	NA	NA
AWT01028.1|1558569_1558887_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	41.9	9.3e-11
AWT01029.1|1559010_1560273_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	38.8	2.5e-70
AWT01030.1|1560839_1561757_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
AWT01031.1|1561858_1562809_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
AWT01032.1|1566876_1567710_-	DUF4225 domain-containing protein	NA	A0A140XBD0	Dickeya_phage	43.3	3.0e-24
AWT01033.1|1567879_1569016_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
AWT01034.1|1569123_1569591_-	hypothetical protein	NA	NA	NA	NA	NA
AWT01035.1|1569643_1570201_-	hypothetical protein	NA	NA	NA	NA	NA
AWT01036.1|1570213_1571746_-	hypothetical protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	34.0	4.0e-22
AWT01037.1|1571969_1572497_-	hypothetical protein	NA	NA	NA	NA	NA
AWT01038.1|1574249_1574543_-	hypothetical protein	NA	NA	NA	NA	NA
AWT01039.1|1574562_1578981_-	DUF4150 domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	33.7	6.0e-23
AWT01040.1|1578983_1580165_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
AWT01041.1|1580175_1582164_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
AWT01042.1|1582377_1582896_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AWT01043.1|1583578_1584085_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AWT01044.1|1584104_1585589_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AWT01045.1|1585591_1586014_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AWT01046.1|1586018_1587842_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AWT04218.1|1587808_1588852_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AWT04219.1|1588868_1590155_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AWT04220.1|1590181_1590685_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AWT01047.1|1590687_1592031_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 5
CP029747	Escherichia coli strain 2016C-3878 chromosome, complete genome	4995456	2928626	2941554	4995456	integrase	Escherichia_phage(83.33%)	6	2934129:2934142	2942599:2942612
AWT02283.1|2928626_2929559_+	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	99.7	2.1e-167
AWT02284.1|2930146_2930677_-	hypothetical protein	NA	A0A2L1IV11	Escherichia_phage	97.7	3.3e-85
AWT02285.1|2930724_2938644_-	outer membrane autotransporter barrel domain-containing protein	NA	A0A2L1IV38	Escherichia_phage	97.9	0.0e+00
2934129:2934142	attL	TATCAAAAATCAGG	NA	NA	NA	NA
AWT02286.1|2938668_2939289_-	LuxR family transcriptional regulator	NA	A0A2L1IV08	Escherichia_phage	99.0	1.3e-117
AWT02287.1|2939606_2940236_-	pilus assembly protein	NA	A0A2L1IV36	Escherichia_phage	99.0	5.4e-119
AWT02288.1|2940984_2941554_+|integrase	integrase	integrase	A0A2L1IV36	Escherichia_phage	52.2	9.1e-49
2942599:2942612	attR	CCTGATTTTTGATA	NA	NA	NA	NA
>prophage 6
CP029747	Escherichia coli strain 2016C-3878 chromosome, complete genome	4995456	3318434	3408643	4995456	tail,plate,head,tRNA,integrase	Burkholderia_virus(37.5%)	102	3357145:3357160	3405974:3405989
AWT02613.1|3318434_3319484_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
AWT02614.1|3319480_3319960_-	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
AWT02615.1|3319959_3320670_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AWT02616.1|3320688_3321000_-	cell division protein FtsB	NA	NA	NA	NA	NA
AWT02617.1|3321193_3321517_-	hypothetical protein	NA	NA	NA	NA	NA
AWT02618.1|3321566_3322172_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
AWT02619.1|3322171_3323599_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
AWT02620.1|3323600_3324509_-	sulfate adenylyltransferase subunit 2	NA	NA	NA	NA	NA
AWT02621.1|3324760_3325798_+	aminopeptidase	NA	NA	NA	NA	NA
AWT02622.1|3325923_3326076_-	Hok/Gef family protein	NA	NA	NA	NA	NA
AWT02623.1|3326340_3327075_-	phosphoadenosine phosphosulfate reductase	NA	NA	NA	NA	NA
AWT02624.1|3327148_3328861_-	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
AWT02625.1|3328860_3330660_-	NADPH-dependent assimilatory sulfite reductase flavoprotein subunit	NA	NA	NA	NA	NA
AWT02626.1|3330975_3331341_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
AWT02627.1|3331418_3332690_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AWT02628.1|3332680_3332941_+	ferredoxin family protein	NA	NA	NA	NA	NA
AWT02629.1|3332957_3333533_+	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
AWT02630.1|3333679_3334540_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
AWT02631.1|3334536_3335316_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
AWT02632.1|3335293_3336631_-	MFS transporter	NA	NA	NA	NA	NA
AWT02633.1|3336724_3338179_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AWT02634.1|3338248_3339034_-	SDR family NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	1.1e-20
AWT02635.1|3339351_3340629_+	MFS transporter	NA	NA	NA	NA	NA
AWT02636.1|3340655_3342134_+	sugar kinase	NA	NA	NA	NA	NA
AWT02637.1|3342298_3343216_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
AWT02638.1|3343386_3344904_+	carbohydrate porin	NA	NA	NA	NA	NA
AWT02639.1|3344964_3346335_+	PTS sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
AWT02640.1|3346334_3347744_+	glycosyl hydrolase family 32	NA	F8WPR5	Bacillus_phage	22.7	5.6e-15
AWT02641.1|3347769_3348777_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AWT02642.1|3348861_3349533_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	3.0e-14
AWT02643.1|3349705_3350308_+	LemA family protein	NA	NA	NA	NA	NA
AWT02644.1|3350291_3351215_+	YgcG family protein	NA	NA	NA	NA	NA
AWT02645.1|3351229_3352378_+	YgcG family protein	NA	NA	NA	NA	NA
AWT04306.1|3352383_3353256_+	YgcG family protein	NA	NA	NA	NA	NA
AWT02646.1|3353315_3354614_-	enolase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
AWT02647.1|3354700_3356338_-	CTP synthetase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
AWT02648.1|3356565_3357357_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
3357145:3357160	attL	TTGCGCGTAAAACACC	NA	NA	NA	NA
AWT02649.1|3357428_3357764_-	mRNA interferase MazF	NA	NA	NA	NA	NA
AWT02650.1|3357763_3358012_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AWT02651.1|3358089_3360324_-	GTP pyrophosphokinase	NA	NA	NA	NA	NA
AWT02652.1|3360371_3361673_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	29.8	2.6e-38
AWT02653.1|3361729_3364486_+	signal transduction histidine kinase	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
AWT02654.1|3364888_3365461_-	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
AWT02655.1|3365532_3366006_+|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	52.4	8.1e-35
AWT02656.1|3366012_3366627_-|tail	tail assembly chaperone	tail	Q9MCR5	Enterobacteria_phage	61.5	1.7e-61
AWT02657.1|3366626_3368558_-	short-chain fatty acid transporter	NA	A0A0K2FIZ6	Escherichia_phage	44.4	9.0e-40
AWT02658.1|3368560_3369139_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
AWT02659.1|3369131_3370235_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	55.0	1.4e-106
AWT02660.1|3370225_3370573_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	61.5	1.7e-34
AWT02661.1|3370627_3371224_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	5.4e-36
AWT02662.1|3371220_3372393_-	phage protein D	NA	Q6QIA2	Burkholderia_phage	47.1	7.3e-85
AWT02663.1|3372380_3372596_-	hypothetical protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
AWT02664.1|3372592_3373477_-	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.9	6.8e-51
AWT02665.1|3373476_3376689_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	31.3	5.8e-84
AWT02666.1|3376764_3376923_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AWT02667.1|3376846_3377182_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AWT02668.1|3377279_3377561_-	hypothetical protein	NA	NA	NA	NA	NA
AWT02669.1|3377563_3378085_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
AWT02670.1|3378084_3379512_-|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
AWT02671.1|3379501_3379756_-	hypothetical protein	NA	NA	NA	NA	NA
AWT02672.1|3379752_3380217_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.0	1.3e-37
AWT02673.1|3380216_3380663_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AWT02674.1|3380664_3381003_-	DUF2190 family protein	NA	NA	NA	NA	NA
AWT02675.1|3381012_3381966_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
AWT02676.1|3381980_3383096_-	peptidase	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
AWT02677.1|3383310_3383769_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
AWT02678.1|3383771_3384593_-|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.5	3.1e-98
AWT02679.1|3384573_3386070_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.6	6.1e-169
AWT02680.1|3386069_3387593_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.5	1.8e-184
AWT02681.1|3387589_3388132_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	53.3	4.9e-44
AWT02682.1|3388134_3388446_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	60.6	4.0e-30
AWT02683.1|3388445_3388772_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
AWT04307.1|3388768_3389380_-	hypothetical protein	NA	A0A0S4L1H0	Pseudomonas_phage	34.2	6.9e-10
AWT02684.1|3389408_3390146_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.5	2.9e-63
AWT02685.1|3390148_3390499_-	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.9	9.0e-23
AWT02686.1|3390629_3391373_+	hypothetical protein	NA	NA	NA	NA	NA
AWT02687.1|3391348_3391753_-	hypothetical protein	NA	NA	NA	NA	NA
AWT02688.1|3391751_3391967_+	hypothetical protein	NA	NA	NA	NA	NA
AWT02689.1|3392158_3392923_+	restriction endonuclease subunit M	NA	A2I2Y7	Vibrio_virus	64.4	4.0e-100
AWT04308.1|3393041_3393407_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWT02690.1|3393495_3393684_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	1.8e-17
AWT02691.1|3393737_3394046_+	IclR family transcriptional regulator	NA	Q5ZR02	Pseudomonas_phage	55.9	3.5e-23
AWT02692.1|3394056_3394974_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	55.0	2.4e-75
AWT02693.1|3394973_3395291_+	hypothetical protein	NA	NA	NA	NA	NA
AWT02694.1|3395306_3397076_+|integrase	integrase	integrase	A4JWN2	Burkholderia_virus	69.6	3.1e-228
AWT02695.1|3397086_3398253_+	hypothetical protein	NA	A4JWN1	Burkholderia_virus	59.7	9.7e-122
AWT02696.1|3398255_3398525_+	hypothetical protein	NA	NA	NA	NA	NA
AWT02697.1|3398552_3399083_+	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
AWT04309.1|3399093_3399315_-	hypothetical protein	NA	NA	NA	NA	NA
AWT02698.1|3399371_3399644_+	hypothetical protein	NA	NA	NA	NA	NA
AWT02699.1|3399653_3399959_+	hypothetical protein	NA	NA	NA	NA	NA
AWT02700.1|3399955_3400639_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.9	4.5e-34
AWT02701.1|3400635_3400866_+	hypothetical protein	NA	NA	NA	NA	NA
AWT02702.1|3400855_3401071_+	hypothetical protein	NA	NA	NA	NA	NA
AWT02703.1|3401060_3401513_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	46.6	1.6e-24
AWT02704.1|3401484_3401883_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	55.9	3.9e-30
AWT02705.1|3401997_3402630_+	hypothetical protein	NA	NA	NA	NA	NA
AWT02706.1|3402978_3404244_-	glucarate dehydratase	NA	NA	NA	NA	NA
AWT02707.1|3404264_3405605_-	glucarate dehydratase	NA	Q6A202	Oenococcus_phage	24.3	9.1e-07
AWT02708.1|3405606_3406959_-	MFS transporter	NA	NA	NA	NA	NA
3405974:3405989	attR	GGTGTTTTACGCGCAA	NA	NA	NA	NA
AWT02709.1|3407393_3407843_-	flavodoxin	NA	NA	NA	NA	NA
AWT02710.1|3407860_3408643_-|tRNA	tRNA pseudouridine(65) synthase TruC	tRNA	NA	NA	NA	NA
>prophage 7
CP029747	Escherichia coli strain 2016C-3878 chromosome, complete genome	4995456	4414792	4420860	4995456	transposase	Stx2-converting_phage(57.14%)	8	NA	NA
AWT03654.1|4414792_4415599_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	42.1	4.2e-47
AWT03655.1|4415614_4416253_-	aldolase	NA	A0A077SK32	Escherichia_phage	52.7	6.6e-56
AWT03656.1|4416249_4417512_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	45.8	6.0e-93
AWT03657.1|4418168_4418372_+	hypothetical protein	NA	B6DZU5	Stx2-converting_phage	100.0	2.5e-33
AWT03658.1|4418337_4418445_-	copper resistance protein	NA	NA	NA	NA	NA
AWT03659.1|4418421_4419099_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AWT03660.1|4419098_4419446_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AWT03661.1|4419465_4420860_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	57.9	1.1e-143
>prophage 8
CP029747	Escherichia coli strain 2016C-3878 chromosome, complete genome	4995456	4920907	4937399	4995456	tail,plate	Burkholderia_phage(35.29%)	21	NA	NA
AWT04077.1|4920907_4921699_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.1	2.0e-46
AWT04078.1|4921713_4922169_-	hypothetical protein	NA	F6MIM0	Haemophilus_phage	42.7	2.3e-26
AWT04079.1|4922165_4922873_-	DUF4376 domain-containing protein	NA	A0A0E3JQ06	Enterobacteria_phage	42.4	4.1e-14
AWT04080.1|4922869_4924450_-	short-chain fatty acid transporter	NA	A0A0M3ULH6	Salmonella_phage	40.8	1.3e-84
AWT04081.1|4924452_4925169_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	37.2	1.8e-22
AWT04082.1|4925161_4926277_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	51.4	6.9e-101
AWT04083.1|4926267_4926627_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	4.7e-35
AWT04084.1|4926725_4927427_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	36.3	4.9e-12
AWT04085.1|4927436_4928477_-	phage protein D	NA	A4JWL3	Burkholderia_virus	44.8	4.4e-73
AWT04086.1|4928464_4928674_-	hypothetical protein	NA	A4JWL2	Burkholderia_virus	60.3	1.3e-16
AWT04087.1|4928673_4929627_-	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	3.3e-35
AWT04088.1|4932103_4932232_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AWT04089.1|4932191_4932509_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AWT04090.1|4932559_4933084_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	9.5e-69
AWT04091.1|4933083_4934508_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.4	3.2e-191
AWT04092.1|4934497_4934695_-	hypothetical protein	NA	NA	NA	NA	NA
AWT04093.1|4934691_4935147_-	hypothetical protein	NA	NA	NA	NA	NA
AWT04094.1|4935291_4935606_-	hypothetical protein	NA	Q5ZQY8	Pseudomonas_phage	43.2	9.2e-19
AWT04095.1|4935618_4936224_-	lytic murein transglycosylase	NA	Q5ZQZ1	Pseudomonas_phage	57.1	3.3e-57
AWT04096.1|4936226_4936514_-	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	48.1	1.5e-15
AWT04097.1|4937051_4937399_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	49.0	2.2e-21
>prophage 1
CP029748	Escherichia coli strain 2016C-3878 plasmid pMCR1-PA, complete sequence	276880	0	27867	276880	transposase,integrase	Escherichia_phage(36.36%)	26	13316:13375	17281:18101
AWT04373.1|228_933_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWT04374.1|2570_2813_+	relaxase	NA	NA	NA	NA	NA
AWT04375.1|2844_3522_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWT04376.1|3600_4800_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AWT04377.1|4831_5716_-	EamA family transporter	NA	NA	NA	NA	NA
AWT04640.1|5853_6246_-	cysteine hydrolase	NA	NA	NA	NA	NA
AWT04378.1|8058_8301_+	relaxase	NA	NA	NA	NA	NA
AWT04379.1|8332_9010_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWT04380.1|9088_10288_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AWT04381.1|10319_11204_-	EamA family transporter	NA	NA	NA	NA	NA
AWT04641.1|11341_11734_-	cysteine hydrolase	NA	NA	NA	NA	NA
13316:13375	attL	CGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATT	NA	NA	NA	NA
AWT04382.1|13368_14073_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWT04383.1|14617_14932_-|transposase	transposase	transposase	NA	NA	NA	NA
AWT04384.1|14870_15884_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AWT04385.1|16039_16513_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
AWT04386.1|16582_17287_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWT04387.1|17657_20624_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.8	0.0e+00
17281:18101	attR	AATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCGCGCGGCGTACGCATCGAGTTCCTTAAGGAGCATTTGACCTTCACCGGCGAGGACTCGCCGATGGCGAACCTGATGCTGTCGGTAATGGGCGCGTTCGCCGAGTTCGAACGCGCCTTGATCCGCGAGCGGCAGCGCGAGGGCATCGCGCTCGCCAAGCAGCGCGGGGCCTACCGTGGCAGGAAGAAATCCCTGTCGTCTGAGCGTATTGCCGAACTGCGCCAACGTGTCGAGGCTGGCGAGCAAAAGACCAAGCTGGCTCGTGAATTCGGAATCAGTCGCGAAACCCTGTATCAATACTTGAGAACGGATCAGTAAATATGCCACGTCGTTCAATCCTGTCCGCCGCCGAGCGCGAAAGCCTGCTGGCGTTGCCGGACACCAAGGATGAGTTGATCCGTCACTACACGTTCAGCGAAACCGACCTCTCCATCATCCGGCAGCGGCGCGGCCCGGCCAACCGGCTGGGCTTCGCCGTGCAGCTCTGTTACCTGCGCTTTCCTGGTGTCATCCTGGGCGTCGATGAGCCGCCGTTTCCGCCCTTGTTGAAACTGGTCGCCGACCAGCTCAAGGTCAGCGTCGAAAGCTGGGACGAATACGGGCAGCGGGAGCAGACCCGGCGCGAGCACCTGGTCGAACTGCAAACGGTGTTCGGCTTCCAGCCCTTTACCATGGGCCACTACCGGCAGGCCGTCCAGTTGCTGACCGAGATGGCCTTGCAGACCGACAAGGGCATCGTGCTGGCCAGCACCTTGATCGAGCAC	NA	NA	NA	NA
AWT04388.1|20702_21707_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AWT04389.1|21888_22065_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
AWT04390.1|22394_23210_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.2	1.3e-08
AWT04391.1|23270_24074_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AWT04392.1|24073_24910_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AWT04393.1|25140_26001_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AWT04394.1|26183_26741_-	recombinase	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
AWT04395.1|26886_27066_-	replication initiator protein	NA	NA	NA	NA	NA
AWT04396.1|27162_27867_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 2
CP029748	Escherichia coli strain 2016C-3878 plasmid pMCR1-PA, complete sequence	276880	41089	42094	276880		Aeromonas_phage(100.0%)	1	NA	NA
AWT04404.1|41089_42094_+	peptide transporter	NA	A0A1I9KFW9	Aeromonas_phage	33.8	2.7e-11
>prophage 3
CP029748	Escherichia coli strain 2016C-3878 plasmid pMCR1-PA, complete sequence	276880	45199	46237	276880		Enterobacteria_phage(100.0%)	1	NA	NA
AWT04409.1|45199_46237_+	stbA family protein	NA	A0A0A7NPX4	Enterobacteria_phage	35.0	3.6e-43
>prophage 4
CP029748	Escherichia coli strain 2016C-3878 plasmid pMCR1-PA, complete sequence	276880	60920	62705	276880		Bacillus_phage(100.0%)	1	NA	NA
AWT04419.1|60920_62705_+	ATP-dependent helicase	NA	S5M596	Bacillus_phage	26.7	3.5e-22
>prophage 5
CP029748	Escherichia coli strain 2016C-3878 plasmid pMCR1-PA, complete sequence	276880	82142	132663	276880	transposase	Escherichia_phage(33.33%)	57	NA	NA
AWT04644.1|82142_83117_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
AWT04441.1|83312_84938_+	phosphoethanolamine--lipid A transferase MCR-1.1	NA	NA	NA	NA	NA
AWT04442.1|84985_85732_+	PAP2 family protein	NA	NA	NA	NA	NA
AWT04443.1|85757_86102_+	hypothetical protein	NA	NA	NA	NA	NA
AWT04444.1|86123_87299_-	recombinase	NA	NA	NA	NA	NA
AWT04445.1|87469_87682_+	hypothetical protein	NA	NA	NA	NA	NA
AWT04446.1|88042_89125_+	hypothetical protein	NA	NA	NA	NA	NA
AWT04447.1|89291_90791_-	kinase	NA	NA	NA	NA	NA
AWT04448.1|90816_92454_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
AWT04449.1|92453_93494_-	VWA domain-containing protein	NA	NA	NA	NA	NA
AWT04450.1|93579_94218_-	VWA domain-containing protein	NA	NA	NA	NA	NA
AWT04451.1|94217_94859_-	tellurium resistance protein TerX	NA	NA	NA	NA	NA
AWT04452.1|94881_95520_-	VWA domain-containing protein	NA	NA	NA	NA	NA
AWT04453.1|95982_96450_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
AWT04454.1|96467_97676_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
AWT04455.1|97686_98643_-	citrate lyase subunit beta	NA	NA	NA	NA	NA
AWT04456.1|98642_99722_-	hypothetical protein	NA	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
AWT04457.1|99723_100497_-	hypothetical protein	NA	NA	NA	NA	NA
AWT04458.1|100489_101632_-	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	1.7e-30
AWT04459.1|101641_102700_-	carbamoyl-phosphate synthase large chain	NA	NA	NA	NA	NA
AWT04460.1|103023_103605_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
AWT04461.1|103604_104762_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
AWT04462.1|104784_105240_+	Tellurite resistance protein TerB	NA	NA	NA	NA	NA
AWT04463.1|105262_106303_+	TerC family protein	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
AWT04464.1|106351_106930_+	chemical-damaging agent resistance protein C	NA	A0A2P1N0L4	Streptomyces_phage	40.0	3.3e-06
AWT04465.1|106997_107573_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
AWT04466.1|108001_109243_+	tellurium resistance protein TerF	NA	NA	NA	NA	NA
AWT04467.1|109805_110087_-	hypothetical protein	NA	NA	NA	NA	NA
AWT04468.1|110136_110328_-	hypothetical protein	NA	NA	NA	NA	NA
AWT04469.1|110419_110791_-	hypothetical protein	NA	NA	NA	NA	NA
AWT04470.1|111133_111526_+	hypothetical protein	NA	NA	NA	NA	NA
AWT04471.1|111504_111816_+	hypothetical protein	NA	NA	NA	NA	NA
AWT04645.1|112129_112423_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWT04472.1|112427_113753_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
AWT04473.1|113813_114020_+	hypothetical protein	NA	NA	NA	NA	NA
AWT04474.1|114121_114532_+	hypothetical protein	NA	NA	NA	NA	NA
AWT04475.1|114544_115360_+	HNH endonuclease	NA	G0X580	Salmonella_phage	35.4	1.9e-15
AWT04476.1|115613_116039_+	hypothetical protein	NA	NA	NA	NA	NA
AWT04477.1|116587_116896_+	hypothetical protein	NA	NA	NA	NA	NA
AWT04478.1|116911_117769_+	HNH endonuclease	NA	G0X580	Salmonella_phage	34.2	3.9e-11
AWT04479.1|117830_118079_+	hypothetical protein	NA	NA	NA	NA	NA
AWT04480.1|118617_119043_-	DUF4158 domain-containing protein	NA	A0A1B0V7H9	Salmonella_phage	47.2	7.6e-08
AWT04481.1|119742_120876_-	permease	NA	NA	NA	NA	NA
AWT04482.1|120981_121305_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AWT04483.1|121847_122552_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AWT04646.1|122581_123286_+	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	28.7	6.4e-20
AWT04484.1|123373_123640_+	hypothetical protein	NA	NA	NA	NA	NA
AWT04485.1|123858_124863_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AWT04486.1|125280_126717_-	glutathione synthase	NA	NA	NA	NA	NA
AWT04487.1|126804_126993_-	hypothetical protein	NA	NA	NA	NA	NA
AWT04488.1|126983_127688_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWT04489.1|127809_128715_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AWT04490.1|128711_129950_+	MFS transporter	NA	NA	NA	NA	NA
AWT04491.1|129949_130534_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AWT04492.1|130479_130836_+	hypothetical protein	NA	NA	NA	NA	NA
AWT04493.1|131026_131791_-|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AWT04494.1|131958_132663_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 6
CP029748	Escherichia coli strain 2016C-3878 plasmid pMCR1-PA, complete sequence	276880	138596	140754	276880		Burkholderia_phage(50.0%)	2	NA	NA
AWT04501.1|138596_140024_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
AWT04502.1|140238_140754_+	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
>prophage 7
CP029748	Escherichia coli strain 2016C-3878 plasmid pMCR1-PA, complete sequence	276880	147019	175899	276880	transposase,protease	Escherichia_phage(50.0%)	28	NA	NA
AWT04509.1|147019_147724_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWT04510.1|147729_148476_+	winged helix family transcriptional regulator	NA	NA	NA	NA	NA
AWT04511.1|148475_148994_+	hypothetical protein	NA	NA	NA	NA	NA
AWT04512.1|148998_149415_-	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
AWT04513.1|150026_150902_-	class A extended-spectrum beta-lactamase CTX-M-14	NA	A0A1B0VBP7	Salmonella_phage	99.6	6.1e-153
AWT04514.1|151204_151909_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWT04515.1|152022_152799_+	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
AWT04516.1|152819_153041_+	hypothetical protein	NA	NA	NA	NA	NA
AWT04517.1|153027_154053_+	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
AWT04518.1|154474_155227_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
AWT04519.1|157037_157523_+	phenol hydroxylase	NA	NA	NA	NA	NA
AWT04520.1|157719_158810_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
AWT04521.1|158899_159715_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.2	1.3e-08
AWT04522.1|159801_160104_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AWT04523.1|159997_160249_-	hypothetical protein	NA	NA	NA	NA	NA
AWT04524.1|160279_161773_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AWT04525.1|161884_162190_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWT04526.1|162217_163432_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
AWT04527.1|163648_164533_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
AWT04528.1|164563_166057_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AWT04529.1|166168_166474_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWT04530.1|166501_167716_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
AWT04531.1|167932_168817_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
AWT04532.1|169418_170123_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWT04533.1|172534_173251_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	2.4e-139
AWT04534.1|174460_174565_-	hypothetical protein	NA	NA	NA	NA	NA
AWT04535.1|174561_175026_-	mRNA interferase PemK	NA	NA	NA	NA	NA
AWT04536.1|175245_175899_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 8
CP029748	Escherichia coli strain 2016C-3878 plasmid pMCR1-PA, complete sequence	276880	180850	182516	276880		Archaeal_BJ1_virus(50.0%)	2	NA	NA
AWT04544.1|180850_181711_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	9.7e-10
AWT04545.1|181769_182516_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	29.7	8.7e-07
>prophage 9
CP029748	Escherichia coli strain 2016C-3878 plasmid pMCR1-PA, complete sequence	276880	206869	207091	276880		Vibrio_virus(100.0%)	1	NA	NA
AWT04567.1|206869_207091_-	protein TraR	NA	A2I309	Vibrio_virus	40.8	3.3e-07
>prophage 10
CP029748	Escherichia coli strain 2016C-3878 plasmid pMCR1-PA, complete sequence	276880	215191	216088	276880		Yersinia_phage(100.0%)	1	NA	NA
AWT04578.1|215191_216088_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	3.7e-44
>prophage 11
CP029748	Escherichia coli strain 2016C-3878 plasmid pMCR1-PA, complete sequence	276880	219509	223557	276880		Macacine_betaherpesvirus(66.67%)	5	NA	NA
AWT04586.1|219509_220049_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.9	1.2e-45
AWT04587.1|220074_220281_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AWT04588.1|220282_220492_-	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
AWT04589.1|221419_222391_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	96.6	8.8e-169
AWT04590.1|222390_223557_-	protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	99.7	1.6e-228
>prophage 12
CP029748	Escherichia coli strain 2016C-3878 plasmid pMCR1-PA, complete sequence	276880	234718	238877	276880		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
AWT04598.1|234718_235099_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	55.0	1.9e-26
AWT04599.1|235170_235443_-	hypothetical protein	NA	NA	NA	NA	NA
AWT04600.1|236341_237199_-	metal ABC transporter permease	NA	NA	NA	NA	NA
AWT04601.1|237195_238053_-	metal ABC transporter permease	NA	NA	NA	NA	NA
AWT04602.1|238049_238877_-	manganese/iron ABC transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	27.0	3.6e-14
>prophage 13
CP029748	Escherichia coli strain 2016C-3878 plasmid pMCR1-PA, complete sequence	276880	242772	244775	276880		Salmonella_phage(50.0%)	2	NA	NA
AWT04606.1|242772_243750_+	repFIB replication protein A	NA	J9Q7H0	Salmonella_phage	63.9	4.6e-101
AWT04607.1|244034_244775_-	recombinase	NA	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
>prophage 14
CP029748	Escherichia coli strain 2016C-3878 plasmid pMCR1-PA, complete sequence	276880	247970	258483	276880	transposase,bacteriocin,protease,integrase	Enterobacteria_phage(33.33%)	12	251238:251251	263812:263825
AWT04612.1|247970_248924_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
AWT04613.1|249027_249417_+|protease	outer membrane protease	protease	NA	NA	NA	NA
AWT04614.1|249783_250047_-	hypothetical protein	NA	NA	NA	NA	NA
AWT04615.1|250196_250379_-	hypothetical protein	NA	NA	NA	NA	NA
AWT04616.1|250538_251751_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.6	6.0e-167
251238:251251	attL	CAGAACGTCCTGAC	NA	NA	NA	NA
AWT04617.1|252932_253136_-	hypothetical protein	NA	NA	NA	NA	NA
AWT04618.1|253231_253507_+	hypothetical protein	NA	NA	NA	NA	NA
AWT04619.1|253813_254095_-	hypothetical protein	NA	NA	NA	NA	NA
AWT04657.1|254540_255515_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
AWT04620.1|256295_257111_+|bacteriocin	lipid II-degrading bacteriocin colicin M	bacteriocin	NA	NA	NA	NA
AWT04658.1|257160_257514_-	colicin M immunity protein	NA	NA	NA	NA	NA
AWT04621.1|257691_258483_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	2.7e-51
263812:263825	attR	GTCAGGACGTTCTG	NA	NA	NA	NA
>prophage 15
CP029748	Escherichia coli strain 2016C-3878 plasmid pMCR1-PA, complete sequence	276880	272117	274511	276880	transposase	Salmonella_phage(100.0%)	2	NA	NA
AWT04634.1|272117_273380_+|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AWT04635.1|273635_274511_+	class A extended-spectrum beta-lactamase CTX-M-55	NA	A0A1B0VBP7	Salmonella_phage	82.1	2.4e-125
