The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029492	Escherichia coli strain HS30-1 chromosome, complete genome	4423666	994821	1008004	4423666		Escherichia_phage(40.0%)	12	NA	NA
AWU89509.1|994821_995583_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
AWU89510.1|995576_996203_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
AWU89511.1|996342_997482_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
AWU89512.1|997544_998537_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
AWU89513.1|998630_999995_-	GntP family transporter	NA	NA	NA	NA	NA
AWU89514.1|1000083_1000860_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AWU89515.1|1000864_1001503_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AWU89516.1|1001499_1002762_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.0	8.3e-135
AWU89517.1|1002758_1003667_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AWU89518.1|1003862_1004630_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
AWU89519.1|1004680_1005337_-	protein-serine/threonine phosphatase	NA	K7P7V3	Enterobacteria_phage	45.8	3.3e-50
AWU89520.1|1005442_1008004_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	1.3e-30
>prophage 2
CP029492	Escherichia coli strain HS30-1 chromosome, complete genome	4423666	1599560	1609002	4423666		Enterobacteria_phage(85.71%)	10	NA	NA
AWU90044.1|1599560_1600487_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
AWU90045.1|1600491_1601223_+	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AWU90046.1|1601203_1601311_-	hypothetical protein	NA	NA	NA	NA	NA
AWU90047.1|1601370_1602102_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AWU90048.1|1602323_1604009_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AWU90049.1|1604005_1604725_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AWU90050.1|1604771_1605242_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AWU90051.1|1605282_1605744_-	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
AWU90052.1|1605868_1607869_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
AWU90053.1|1607865_1609002_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
>prophage 3
CP029492	Escherichia coli strain HS30-1 chromosome, complete genome	4423666	1699790	1706084	4423666		Enterobacteria_phage(50.0%)	7	NA	NA
AWU90125.1|1699790_1701185_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.0	3.7e-19
AWU90126.1|1701359_1702253_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.9e-46
AWU90127.1|1702289_1702553_-	hypothetical protein	NA	NA	NA	NA	NA
AWU90128.1|1702625_1703711_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	8.0e-102
AWU90129.1|1703710_1704610_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	3.7e-28
AWU90130.1|1704667_1705546_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	2.5e-106
AWU90131.1|1705550_1706084_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.7	4.1e-51
>prophage 4
CP029492	Escherichia coli strain HS30-1 chromosome, complete genome	4423666	2349142	2374707	4423666	terminase,holin,transposase,lysis,integrase	Escherichia_phage(40.0%)	27	2344186:2344200	2379305:2379319
2344186:2344200	attL	CAGAAAAAAGCGCGC	NA	NA	NA	NA
AWU90709.1|2349142_2349376_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AWU90710.1|2350850_2351945_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.5	5.9e-113
AWU90711.1|2351948_2352158_-	hypothetical protein	NA	NA	NA	NA	NA
AWU90712.1|2352135_2353068_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.4e-83
AWU90713.1|2353060_2353852_-	transcriptional regulator	NA	R4TG31	Halovirus	40.7	1.3e-48
AWU90714.1|2353769_2354051_-	hypothetical protein	NA	NA	NA	NA	NA
AWU90715.1|2353989_2355447_-	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
AWU90716.1|2355643_2355829_-	hypothetical protein	NA	K7PHU6	Enterobacteria_phage	96.5	3.6e-15
AWU90717.1|2356045_2356543_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	96.4	1.6e-89
AWU90718.1|2356542_2356758_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
AWU92680.1|2357009_2357384_-	tolA family protein	NA	NA	NA	NA	NA
AWU90719.1|2357555_2357984_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
AWU90720.1|2359028_2359571_-	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	75.7	2.9e-76
AWU90721.1|2359567_2359858_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
AWU90722.1|2359857_2360457_-	DUF1367 domain-containing protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
AWU90723.1|2360925_2361138_-	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	75.7	3.0e-21
AWU90724.1|2361296_2361440_-	hypothetical protein	NA	NA	NA	NA	NA
AWU90725.1|2361801_2363001_+	MFS transporter	NA	NA	NA	NA	NA
AWU90726.1|2363012_2363705_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
AWU90727.1|2363701_2364583_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWU90728.1|2364713_2365991_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
AWU90729.1|2366054_2368058_-|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	26.2	3.4e-21
AWU92681.1|2368152_2369127_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
AWU90730.1|2369322_2370948_+	phosphoethanolamine--lipid A transferase MCR-1.1	NA	NA	NA	NA	NA
AWU90731.1|2370995_2371742_+	PAP2 family protein	NA	NA	NA	NA	NA
AWU92682.1|2371831_2372806_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
AWU90732.1|2374131_2374707_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.9	9.7e-107
2379305:2379319	attR	GCGCGCTTTTTTCTG	NA	NA	NA	NA
>prophage 5
CP029492	Escherichia coli strain HS30-1 chromosome, complete genome	4423666	2947109	2993225	4423666	terminase,portal,integrase,head,capsid,tail,lysis	Enterobacteria_phage(55.0%)	65	2957212:2957227	3002195:3002210
AWU91255.1|2947109_2948441_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
AWU91256.1|2948514_2949099_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.1e-102
AWU91257.1|2949098_2952581_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	37.3	2.5e-11
AWU91258.1|2952645_2953245_-	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	1.4e-108
AWU91259.1|2953311_2956794_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.8	0.0e+00
AWU91260.1|2956854_2957526_-|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	98.2	3.8e-102
2957212:2957227	attL	AATCTGGAATACGCCA	NA	NA	NA	NA
AWU91261.1|2957423_2958167_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.2e-146
AWU91262.1|2958172_2958871_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
AWU91263.1|2958870_2959200_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
AWU91264.1|2959196_2961776_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.5	0.0e+00
AWU91265.1|2961768_2962203_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AWU91266.1|2962184_2962607_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.7	2.2e-60
AWU92715.1|2962622_2963363_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	5.7e-128
AWU91267.1|2963370_2963766_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
AWU91268.1|2963762_2964341_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
AWU91269.1|2964352_2964706_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
AWU91270.1|2964717_2965113_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
AWU91271.1|2965154_2966180_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	97.9	4.7e-189
AWU91272.1|2966235_2966568_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
AWU91273.1|2966577_2967897_-|capsid	capsid assembly protein	capsid	A0A2I6TC87	Escherichia_phage	97.9	1.0e-231
AWU91274.1|2967877_2969479_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	2.9e-310
AWU91275.1|2969475_2969682_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AWU91276.1|2969678_2971604_-|terminase	terminase	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
AWU91277.1|2971578_2972124_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
AWU91278.1|2972263_2972407_-	DNA-packaging protein	NA	NA	NA	NA	NA
AWU91279.1|2972512_2972746_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
AWU91280.1|2972805_2973216_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	77.8	2.7e-55
AWU91281.1|2973303_2973438_+	hypothetical protein	NA	NA	NA	NA	NA
AWU91282.1|2973518_2974043_-	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	94.2	4.5e-87
AWU91283.1|2974245_2974398_-	hypothetical protein	NA	Q716B2	Shigella_phage	98.0	3.1e-20
AWU91284.1|2974394_2974853_-|lysis	lysis protein	lysis	Q9AZ06	Salmonella_phage	92.8	9.8e-70
AWU91285.1|2974849_2975347_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
AWU91286.1|2975346_2975562_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AWU91287.1|2976151_2977234_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	78.7	4.4e-161
AWU91288.1|2977422_2977806_-	antitermination protein Q	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
AWU91289.1|2977891_2978032_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	65.1	3.6e-07
AWU91290.1|2978028_2978391_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	9.5e-60
AWU91291.1|2978410_2978605_-	protein ninF	NA	NA	NA	NA	NA
AWU91292.1|2978597_2978981_-	DUF2591 domain-containing protein	NA	Q76H72	Enterobacteria_phage	96.5	1.7e-62
AWU91293.1|2978941_2979118_-	NinE family protein	NA	K7PHE6	Enterobacteria_phage	98.3	1.4e-27
AWU91294.1|2979114_2979642_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
AWU91295.1|2979638_2980097_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.3e-81
AWU91296.1|2980152_2980443_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
AWU91297.1|2980439_2981141_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
AWU91298.1|2981137_2982037_-	Replication protein O	NA	M1FN81	Enterobacteria_phage	99.7	6.5e-174
AWU91299.1|2982071_2982350_-	hypothetical protein	NA	K7P7A2	Enterobacteria_phage	100.0	1.6e-43
AWU91300.1|2982458_2982644_-	hypothetical protein	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
AWU91301.1|2982724_2983375_+	helix-turn-helix domain-containing protein	NA	K7PM82	Enterobacteria_phage	98.6	4.1e-122
AWU91302.1|2983687_2983960_+	hypothetical protein	NA	K7PH69	Enterobacterial_phage	96.7	4.0e-26
AWU91303.1|2983976_2984558_-	superinfection exclusion protein B	NA	Q9EYA9	Enterobacteria_phage	100.0	4.0e-100
AWU91304.1|2984818_2985187_+	lambda prophage-derived protein ea10	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
AWU91305.1|2985266_2985536_+	host cell division inhibitory peptide Kil	NA	M1FN78	Enterobacteria_phage	100.0	1.7e-42
AWU91306.1|2985490_2985907_+	Host-nuclease inhibitor protein gam	NA	A0A0P0ZBR6	Stx2-converting_phage	98.6	5.6e-72
AWU91307.1|2985912_2986698_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AWU91308.1|2986694_2987375_+	exonuclease	NA	Q6H9Z0	Enterobacteria_phage	100.0	1.2e-132
AWU91309.1|2987371_2987530_+	cruciferin	NA	A0A1U8QQC1	Enterobacteria_phage	96.2	2.6e-22
AWU91310.1|2987526_2988771_+	phosphoadenosine phosphosulfate reductase	NA	Q8W6P3	Burkholderia_virus	34.0	7.1e-46
AWU91311.1|2988782_2989385_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWU91312.1|2989381_2989960_-	hypothetical protein	NA	NA	NA	NA	NA
AWU91313.1|2990329_2990551_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
AWU91314.1|2990547_2990919_+	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	91.4	9.2e-34
AWU91315.1|2990915_2991569_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	48.5	4.8e-62
AWU91316.1|2991665_2991845_+	Eag protein	NA	K7PL40	Enterobacteria_phage	98.3	7.3e-29
AWU91317.1|2991958_2992177_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
AWU91318.1|2992154_2993225_+|integrase	integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	1.5e-201
3002195:3002210	attR	AATCTGGAATACGCCA	NA	NA	NA	NA
>prophage 1
CP029493	Escherichia coli strain HS30-1 plasmid pHS30-1, complete sequence	179444	16	63689	179444	integrase,plate,transposase	Escherichia_phage(33.33%)	58	12200:12259	76011:76142
AOO34910.1|16_901_+	RepB family plasmid replication initiator protein	NA	A0A077SLP3	Escherichia_phage	100.0	2.1e-161
AOO34911.1|1193_2003_+	GIY-YIG nuclease family protein	NA	A0A077SK46	Escherichia_phage	97.4	1.3e-154
AOO34912.1|2171_3368_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
AOO34913.1|3384_4386_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
AOO34914.1|4611_6318_+	hypothetical protein	NA	Q71TM1	Escherichia_phage	100.0	0.0e+00
AOO34915.1|6377_7967_+	hypothetical protein	NA	A0A1B0V7E4	Salmonella_phage	97.9	4.9e-302
AOO34916.1|7976_8792_+	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	97.0	3.9e-109
AOO34917.1|8827_9409_+	hypothetical protein	NA	Q71TM4	Escherichia_phage	96.9	1.8e-100
AOO34918.1|9420_9930_+|plate	baseplate protein	plate	Q1MVJ9	Enterobacteria_phage	99.4	6.6e-91
AOO34919.1|11395_11551_-	type I toxin-antitoxin system hok family toxin	NA	A0A1I9LJU7	Stx_converting_phage	90.2	4.0e-15
AOO34920.1|11948_12287_+	hypothetical protein	NA	U5P4I9	Shigella_phage	91.2	1.6e-32
12200:12259	attL	TGTAGATTCAATCTGTCAATGCAACACCCCTTTCAATTATCTCTTTCGGTGTTTTGAACT	NA	NA	NA	NA
AOO34921.2|12311_12650_+	hypothetical protein	NA	U5P429	Shigella_phage	87.8	9.6e-38
AOO34922.2|12652_13866_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.0	3.5e-167
AWU92768.1|14289_14541_-	hypothetical protein	NA	NA	NA	NA	NA
AOO34925.1|14693_15119_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	50.4	2.9e-31
AOO34926.1|15118_16390_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.3	1.0e-153
AOO34927.1|16706_17915_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	81.8	1.7e-190
AOO34929.1|19138_20110_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	89.7	4.2e-155
AOO34930.1|20109_21276_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	3.0e-224
AOO34931.1|22016_23027_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	53.9	6.7e-87
AOO34933.1|23671_24376_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AOO34934.1|24968_25874_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AOO34935.1|27107_27692_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AWU92769.1|27637_27994_+	hypothetical protein	NA	NA	NA	NA	NA
AOO34936.1|28096_28789_-	hypothetical protein	NA	B1B6L9	Salmonella_phage	39.1	1.3e-25
AOO34937.1|28896_29115_+	hypothetical protein	NA	NA	NA	NA	NA
AWU92770.1|29197_29575_+	hypothetical protein	NA	Q6JIG6	Burkholderia_virus	38.4	2.0e-07
AOO34938.1|29546_30311_-|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AOO34939.1|31620_34608_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.4	1.1e-294
AOO34940.1|35056_35506_-	DNA-binding protein	NA	NA	NA	NA	NA
AOO34941.1|35517_37842_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	28.2	6.0e-38
AOO34942.1|37861_38107_-	hypothetical protein	NA	NA	NA	NA	NA
AOO34943.1|38521_38992_-	micrococcal nuclease	NA	A0A0R6PHV6	Moraxella_phage	37.1	2.8e-19
AOO34944.1|39119_39956_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AOO34945.1|39955_40759_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AOO34946.1|40819_41635_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AOO34949.1|42566_43271_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AOO34951.1|45926_46631_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AOO34952.1|46835_47627_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AWU92771.1|47632_47923_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
AOO34953.1|48034_48532_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
AOO34955.1|48936_49641_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AOO34956.1|49830_50646_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
AOO34957.1|50796_51501_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AOO34958.1|51731_52595_+	KR domain-containing protein	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
AOO34959.1|52632_52878_+	hypothetical protein	NA	NA	NA	NA	NA
AOO34961.1|53346_54138_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
AWU92772.1|54992_55178_-	hypothetical protein	NA	NA	NA	NA	NA
AOO34962.1|55317_55650_-	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
AOO34963.1|55819_56611_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AOO34964.1|56703_57963_-	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
AOO34965.1|58224_59016_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AOO34966.1|59073_59682_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
AOO34967.1|59777_60620_-	alpha/beta fold putative hydrolase EstX	NA	NA	NA	NA	NA
AOO34968.1|60786_61800_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AWU92773.1|61738_62353_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AOO34971.1|62528_63089_+|transposase	transposase	transposase	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
AWU92774.1|63092_63689_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	85.1	4.7e-64
76011:76142	attR	TGTAGATTCAATCTGTCAATGCAACACCCCTTTCAATTATCTCTTTCGGTGTTTTGAACTTCAGTGTCTTTCTCGGTCTGTTGTTTAGCTGAGCAGCAACCAGATCTAGTTCATGTTGAGTATATTGGGCAA	NA	NA	NA	NA
>prophage 2
CP029493	Escherichia coli strain HS30-1 plasmid pHS30-1, complete sequence	179444	68996	143825	179444	integrase,transposase	Escherichia_phage(44.44%)	66	68159:68218	119370:120120
68159:68218	attL	CTACACCGACACGGCCGGCTTCACCGATCACGTCTTTGCCCTGATGCACCTGCTAGGCTT	NA	NA	NA	NA
AOO34977.1|68996_70073_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AOO34981.1|71415_71832_-	PIN domain-containing protein	NA	NA	NA	NA	NA
AOO34982.1|71828_72059_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AOO34983.1|72854_73559_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AOO34986.1|74966_75995_+|integrase	integrase	integrase	Q5XLQ5	Enterobacteria_phage	42.4	2.2e-61
AOO34988.1|76957_77881_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	99.7	1.4e-176
AOO34989.1|78506_78893_+	hypothetical protein	NA	NA	NA	NA	NA
AOO34990.1|79032_79956_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.4	1.8e-171
AOO34992.1|80508_81021_-	hypothetical protein	NA	NA	NA	NA	NA
AWU92775.1|83509_84723_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
AWU92776.1|85425_85617_+	hypothetical protein	NA	Q6QLL3	Human_immunodeficiency_virus	100.0	2.1e-13
AOO35000.2|85654_86671_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
AOO35001.1|88004_88727_-	hypothetical protein	NA	NA	NA	NA	NA
AOO35002.1|88723_89209_-	plasmid transfer protein	NA	NA	NA	NA	NA
AWU92777.1|89863_90838_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
AOO35004.2|90927_91674_-	PAP2 family protein	NA	NA	NA	NA	NA
AWU92778.1|91721_93347_-	phosphoethanolamine--lipid A transferase MCR-1.1	NA	NA	NA	NA	NA
AWU92779.1|93542_94517_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
AOO35007.1|94984_95515_+	hypothetical protein	NA	NA	NA	NA	NA
AOO35008.1|96642_97689_+	thioredoxin family protein	NA	NA	NA	NA	NA
AWU92780.1|97678_98128_+	hypothetical protein	NA	NA	NA	NA	NA
AOO35009.1|99859_103375_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	36.1	2.7e-98
AOO35010.1|103744_103945_+	DUF839 domain-containing protein	NA	NA	NA	NA	NA
AOO35011.1|104234_104522_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	4.5e-20
AOO35012.1|104518_104770_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AWU92781.1|105022_105154_+	replication protein RepA4	NA	NA	NA	NA	NA
AWU92782.1|105381_109320_+	helicase	NA	Q1MVN7	Enterobacteria_phage	98.2	0.0e+00
AOO35013.1|109353_109794_+	peptide-binding protein	NA	Q71TR9	Escherichia_phage	99.3	3.8e-79
AOO35014.1|109790_110039_+	modulator protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
AOO35015.1|111033_111684_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AOO35016.1|111776_112421_-	maturation control protein	NA	A0A1B0VAG4	Salmonella_phage	86.3	1.7e-96
AOO35017.1|112609_113170_-	recombinase	NA	Q71TG3	Escherichia_phage	98.9	1.0e-100
AOO35018.1|113419_113731_-	lysogeny establishment protein	NA	Q5XLQ4	Enterobacteria_phage	93.2	2.8e-44
AOO35019.1|113781_114813_-	recombinase	NA	Q71TG5	Escherichia_phage	99.1	3.2e-193
AOO35020.1|114820_115042_-	creatininase	NA	Q5QBN7	Enterobacteria_phage	98.6	5.8e-36
AOO35021.1|115453_115567_+	peptidase	NA	Q5XLQ7	Enterobacteria_phage	100.0	3.2e-14
AOO35022.1|115585_115681_+	peptidase	NA	Q38402	Escherichia_phage	100.0	2.8e-11
AOO35023.1|115646_115856_+	c1 repressor inactivator	NA	A0A077SK26	Escherichia_phage	100.0	1.8e-31
AOO35024.1|115966_116818_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.3	1.0e-157
AWU92783.1|116850_117162_-	phage antirepressor Ant	NA	A0A077SLR9	Escherichia_phage	98.0	2.9e-49
AOO35025.1|117464_118508_-	DUF968 domain-containing protein	NA	A0A077SLM1	Escherichia_phage	98.6	1.5e-203
AOO35026.1|118535_118673_-	pdcA	NA	Q71TH5	Escherichia_phage	97.8	2.4e-16
AOO35029.1|120827_121532_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
119370:120120	attR	AAGCCTAGCAGGTGCATCAGGGCAAAGACGTGATCGGTGAAGCCGGCCGTGTCGGTGTAGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGCAACGTTTTCTGCCTCTGACGCCTCTTTTAATGGTCTCAGATGTCCTTTGGTCACCAGTTCTGCCAGCGTGAAGGAATAATGGCCGAGCATATTGATATGTCCGTGGCAAAGCGGGGAGAGGCGTGCGATATCTTCATCATTCAGTGTTTCACCCTGCGCCCGGAGATGATCCAGGGCTGCCTGCATATAAATAGTGTTCCATAACACGACGGCGTTAGTGACCAGCCCCAGTGTGCCCAGTTGATCTTCCTGACCGTCGGTATATCGTTTTCTTATCTCACCTTTTTGACCGTGACAGATGGCTCTGGCAACGGCATGGCGACTTTCTCCCCGATTAAGCTGGGTCAGAATGCGCCGGCGGTAATCTTCATCATCAATATAATTAAGCAGATACAGCGTTTTGTTGATGCGCCCCACTTCAATGATTGCCTGAGTCAGTCCGGAAGGACGTTCACTTTTCAGCAATGAACGGACCAGCACTGAAACCTGTACTTTGCCCAGCTTCAGGGAGCCAGCGGTCCGGATCATTTCGTCCCACTGAAGGACTATTTTTCGGGGATCTGATTGCCCTCTGGCAATATCATTCAGCACGCCATAGTCGGCATCATGGTCCATTCGCCAGAAAACCGAAGCACCGGCATCAGCCAGGCGTG	NA	NA	NA	NA
AOO35031.1|122499_123714_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	29.1	3.2e-19
AOO35032.1|123741_124047_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AOO35033.1|124158_125652_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AOO35034.1|125682_125928_+	hypothetical protein	NA	NA	NA	NA	NA
AOO35035.1|125939_126644_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AOO35037.1|127261_128122_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AOO35040.2|129118_130585_+	HAMP domain-containing protein	NA	A0A1B0V854	Salmonella_phage	98.6	3.6e-73
AOO35041.1|130820_131201_-	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	99.2	9.7e-63
AOO35042.1|131200_131422_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	A0A222YXU1	Escherichia_phage	98.6	3.3e-31
AOO35044.1|132799_134062_-	hypothetical protein	NA	Q1MVG4	Enterobacteria_phage	99.0	3.9e-233
AOO35045.1|134063_134282_-	hypothetical protein	NA	Q71TI9	Escherichia_phage	100.0	3.4e-36
AOO35046.1|134363_135065_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	97.4	2.8e-140
AOO35047.1|135735_136362_-	norphogenetic protein	NA	Q1MVG8	Enterobacteria_phage	100.0	2.1e-123
AOO35048.1|136259_136922_-	norphogenetic protein	NA	Q71T83	Escherichia_phage	100.0	4.5e-124
AOO35049.1|136863_137019_-	norphogenetic protein	NA	Q1MVH0	Enterobacteria_phage	98.0	1.2e-19
AOO35050.1|137471_137822_+	hypothetical protein	NA	Q716C1	Shigella_phage	97.7	5.2e-39
AOO35051.1|137741_138893_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.6e-42
AOO35052.2|138849_139263_-	hypothetical protein	NA	Q716C1	Shigella_phage	53.5	8.7e-17
AOO35053.1|139654_140389_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWU92784.1|140585_141859_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	6.1e-170
AOO35056.1|141980_142748_+	hypothetical protein	NA	NA	NA	NA	NA
AOO35057.1|142800_143160_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.5e-44
AOO35058.1|143159_143825_-	plasmid stability protein	NA	J9Q7R7	Salmonella_phage	98.2	2.0e-116
>prophage 3
CP029493	Escherichia coli strain HS30-1 plasmid pHS30-1, complete sequence	179444	148556	160933	179444	transposase	Erysipelothrix_phage(50.0%)	7	NA	NA
AOO35063.2|148556_149770_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.0	1.8e-166
AOO35065.1|149891_150242_-	hypothetical protein	NA	Q716C1	Shigella_phage	98.9	1.4e-39
AWU92785.1|150424_151603_+	recombinase	NA	J9Q736	Salmonella_phage	95.6	2.5e-157
AOO35066.1|151904_154982_-	restriction endonuclease subunit R	NA	A0A2K5B2C2	Erysipelothrix_phage	33.1	1.6e-126
AOO35067.1|154991_156836_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	40.6	1.2e-121
AOO35068.1|156910_157597_-	DUF4391 domain-containing protein	NA	NA	NA	NA	NA
AOO35069.1|157600_160933_-	helicase	NA	A0A2K5B2B9	Erysipelothrix_phage	41.9	3.3e-239
