The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029973	Escherichia coli strain 51008369SK1 chromosome, complete genome	4848222	151126	199268	4848222	integrase,transposase,tRNA,tail	Escherichia_phage(48.15%)	52	150509:150523	185476:185490
150509:150523	attL	CGATGTTATTCAGCG	NA	NA	NA	NA
AWV08983.1|151126_151564_+|tRNA	D-aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
AWV08984.1|151560_152550_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWV13238.1|153408_153621_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AWV08985.1|153862_154081_+	hypothetical protein	NA	NA	NA	NA	NA
AWV08986.1|154410_155340_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
AWV08987.1|155336_155972_-	formate dehydrogenase cytochrome b556(fdo) subunit	NA	NA	NA	NA	NA
AWV08988.1|155968_156871_-	formate dehydrogenase-O iron-sulfur subunit	NA	NA	NA	NA	NA
AWV08989.1|156883_159934_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
AWV08990.1|159937_160192_+	hypothetical protein	NA	NA	NA	NA	NA
AWV08991.1|160127_160961_+	sulfurtransferase FdhD	NA	NA	NA	NA	NA
AWV08992.1|161113_162169_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
AWV08993.1|162218_163967_-	transcriptional regulator	NA	NA	NA	NA	NA
AWV08994.1|163966_165037_-	aminopeptidase	NA	NA	NA	NA	NA
AWV08995.1|165026_166478_-	fructose-like PTS system EIIBC component	NA	NA	NA	NA	NA
AWV08996.1|166488_166935_-	fructose-like phosphotransferase enzyme IIA component	NA	NA	NA	NA	NA
AWV08997.1|167235_167550_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
AWV08998.1|167559_168384_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
AWV08999.1|168834_170094_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
AWV09000.1|170090_171560_-	rhamnulokinase	NA	NA	NA	NA	NA
AWV09001.1|171847_172684_+	transcriptional activator RhaS	NA	NA	NA	NA	NA
AWV09002.1|172667_173606_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
AWV09003.1|173602_174637_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
AWV09004.1|174921_175542_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.3	8.4e-64
AWV09005.1|175716_175824_+	2-keto-3-deoxygluconate permease	NA	NA	NA	NA	NA
AWV09006.1|175839_176784_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
AWV09007.1|176932_177607_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
AWV09008.1|177712_179086_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
AWV09009.1|179082_179781_-	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
AWV13239.1|179930_180431_+	periplasmic protein CpxP	NA	NA	NA	NA	NA
AWV09010.1|180616_181597_-|integrase	integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
AWV09011.1|181666_181960_-	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
AWV09012.1|182096_182369_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
AWV13240.1|182538_183039_+	replication protein B	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
AWV09013.1|183102_183327_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
AWV09014.1|183326_183629_+	hypothetical protein	NA	A0A0F7LDT6	Escherichia_phage	96.0	2.5e-45
AWV09015.1|183628_183853_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
AWV09016.1|183849_184125_+	hypothetical protein	NA	A0A0F7LCM4	Escherichia_phage	100.0	2.3e-45
AWV09017.1|185599_187141_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
185476:185490	attR	CGCTGAATAACATCG	NA	NA	NA	NA
AWV09018.1|187155_187902_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
AWV09019.1|188222_188627_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
AWV09020.1|188623_188971_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
AWV09021.1|189019_190555_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	3.5e-289
AWV09022.1|190562_191165_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	95.3	3.5e-99
AWV09023.1|191224_192415_+|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	3.7e-225
AWV09024.1|192427_192946_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
AWV09025.1|193002_193278_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
AWV13241.1|193310_193430_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AWV09026.1|193422_195870_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.2	0.0e+00
AWV09027.1|195884_196364_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
AWV09028.1|196363_197527_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	4.8e-206
AWV09029.1|197572_197827_+	DNA-binding transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	100.0	6.1e-45
AWV09030.1|197899_199268_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
>prophage 2
CP029973	Escherichia coli strain 51008369SK1 chromosome, complete genome	4848222	569469	627519	4848222	holin,protease,transposase,tRNA	Enterobacteria_phage(16.67%)	54	NA	NA
AWV09353.1|569469_570822_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
AWV09354.1|570876_571263_+	cytochrome b562	NA	NA	NA	NA	NA
AWV09355.1|571307_571772_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.1	1.2e-51
AWV09356.1|571931_574070_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	3.4e-266
AWV09357.1|574463_576119_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
AWV09358.1|576168_577590_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
AWV09359.1|577708_578656_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
AWV13254.1|578840_578894_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
AWV09360.1|579034_581731_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
AWV09361.1|581936_582323_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
AWV09362.1|582395_582857_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
AWV09363.1|582869_583805_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.5	1.3e-52
AWV09364.1|583808_583943_-	pyrBI operon leader peptide	NA	NA	NA	NA	NA
AWV09365.1|584072_584255_+	hypothetical protein	NA	NA	NA	NA	NA
AWV09366.1|584223_584619_-	RidA family protein	NA	NA	NA	NA	NA
AWV09367.1|584749_585463_-	oxidoreductase	NA	NA	NA	NA	NA
AWV09368.1|585533_586127_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AWV09369.1|586271_586724_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
AWV09370.1|586846_588268_+	hypothetical protein	NA	NA	NA	NA	NA
AWV09371.1|588254_588560_+	hypothetical protein	NA	NA	NA	NA	NA
AWV09372.1|588605_589529_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
AWV09373.1|589712_590717_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
AWV09374.1|590878_591295_+	regulator of ribonuclease activity B	NA	NA	NA	NA	NA
AWV09375.1|591340_591844_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWV09376.1|592036_593224_+	DUF898 family protein	NA	NA	NA	NA	NA
AWV09377.1|593275_596131_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
AWV09378.1|596130_596574_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AWV09379.1|596927_598439_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
AWV09380.1|598705_599806_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AWV09381.1|599805_600888_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AWV09382.1|601048_602551_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	1.4e-83
AWV09383.1|602678_603698_-	aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	8.4e-45
AWV09384.1|604142_605405_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	35.6	2.4e-65
AWV09385.1|605434_606073_+	hypothetical protein	NA	NA	NA	NA	NA
AWV09386.1|606450_606681_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AWV13255.1|606742_607327_+	hypothetical protein	NA	NA	NA	NA	NA
AWV09387.1|607319_607679_+	hypothetical protein	NA	NA	NA	NA	NA
AWV09388.1|607710_607995_+	hypothetical protein	NA	NA	NA	NA	NA
AWV09389.1|607991_608375_+	hypothetical protein	NA	NA	NA	NA	NA
AWV09390.1|608371_611044_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	34.6	4.1e-59
AWV09391.1|611040_611373_-	hypothetical protein	NA	NA	NA	NA	NA
AWV09392.1|611444_612188_+	septation initiation protein	NA	NA	NA	NA	NA
AWV09393.1|612184_612736_+	phage polarity suppression protein	NA	NA	NA	NA	NA
AWV09394.1|612741_613014_+	hypothetical protein	NA	A0A2I8TV89	Erwinia_phage	44.9	6.3e-08
AWV09395.1|613659_614628_+	hypothetical protein	NA	NA	NA	NA	NA
AWV09396.1|614629_615562_+	RNA-directed DNA polymerase	NA	Q7M2A9	Enterobacteria_phage	29.4	1.8e-25
AWV09397.1|617723_619247_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AWV09398.1|619540_619912_+	hypothetical protein	NA	NA	NA	NA	NA
AWV09399.1|620722_621112_+|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	99.2	1.9e-61
AWV09400.1|621162_621381_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWV09401.1|621447_622609_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	2.0e-50
AWV09402.1|622889_624167_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
AWV09403.1|624126_624285_-|holin	choline transporter	holin	NA	NA	NA	NA
AWV09404.1|626379_627519_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.5e-68
>prophage 3
CP029973	Escherichia coli strain 51008369SK1 chromosome, complete genome	4848222	932158	1005001	4848222	protease,transposase,tRNA,plate	uncultured_Caudovirales_phage(20.0%)	60	NA	NA
AWV09673.1|932158_933511_+|protease	zinc metalloprotease RseP	protease	NA	NA	NA	NA
AWV09674.1|933540_935973_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
AWV09675.1|936094_936580_+	chaperone protein Skp	NA	NA	NA	NA	NA
AWV09676.1|936583_937609_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AWV09677.1|937713_938169_+	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
AWV09678.1|938172_938961_+	acyl-[acyl-carrier-protein]--UDP-N- acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
AWV09679.1|938960_940109_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
AWV09680.1|940105_940702_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
AWV09681.1|940738_944221_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
AWV09682.1|944233_945193_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
AWV09683.1|945291_947433_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
AWV09684.1|947489_947879_+	VOC family protein	NA	NA	NA	NA	NA
AWV13270.1|949289_949544_-	protein rof	NA	NA	NA	NA	NA
AWV09685.1|949536_949737_-	hypothetical protein	NA	NA	NA	NA	NA
AWV09686.1|949902_950448_+	hypothetical protein	NA	NA	NA	NA	NA
AWV09687.1|950444_950867_+|tRNA	peptidyl-tRNA hydrolase ArfB	tRNA	NA	NA	NA	NA
AWV09688.1|950880_951591_+	lipoprotein NlpE	NA	NA	NA	NA	NA
AWV09689.1|951790_952615_-	endopeptidase	NA	NA	NA	NA	NA
AWV09690.1|952668_954387_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AWV09691.1|954498_955206_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
AWV09692.1|955202_955607_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
AWV09693.1|955724_956540_-	methionine ABC transporter substrate-binding protein MetQ	NA	NA	NA	NA	NA
AWV09694.1|956579_957233_-	methionine ABC transporter	NA	NA	NA	NA	NA
AWV09695.1|957225_958257_-	methionine import ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	9.4e-36
AWV09696.1|958444_959020_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
AWV09697.1|964779_965583_+	2,5-diketo-D-gluconic acid reductase B	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
AWV09698.1|965579_966494_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWV09699.1|966734_967535_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
AWV09700.1|967538_968162_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWV09701.1|968209_969568_-	lytic transglycosylase	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
AWV09702.1|969639_970395_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AWV09703.1|970428_971151_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWV09704.1|971147_971615_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
AWV13271.1|971679_972411_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
AWV09705.1|972350_972530_-	hypothetical protein	NA	NA	NA	NA	NA
AWV09706.1|972947_973733_+	hypothetical protein	NA	NA	NA	NA	NA
AWV09707.1|973869_974349_-	hypothetical protein	NA	NA	NA	NA	NA
AWV09708.1|974358_975273_-	hypothetical protein	NA	NA	NA	NA	NA
AWV09709.1|975316_975799_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AWV09710.1|975822_977175_-	hypothetical protein	NA	NA	NA	NA	NA
AWV09711.1|977185_980650_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AWV09712.1|980728_982207_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AWV09713.1|982145_982889_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
AWV09714.1|982885_985651_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.8e-81
AWV09715.1|985659_986421_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AWV09716.1|986425_987757_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AWV09717.1|987759_988284_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AWV09718.1|988280_989561_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AWV09719.1|989585_990668_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AWV09720.1|990631_992482_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AWV09721.1|992485_992899_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AWV09722.1|992905_994381_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AWV09723.1|994431_994656_-	hypothetical protein	NA	NA	NA	NA	NA
AWV09724.1|994690_995191_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AWV09725.1|995885_996404_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AWV09726.1|996436_996574_+	hypothetical protein	NA	NA	NA	NA	NA
AWV09727.1|996613_998755_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	2.4e-25
AWV09728.1|998830_1003063_+	RHS repeat family protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.4e-22
AWV09729.1|1003040_1003274_+	hypothetical protein	NA	NA	NA	NA	NA
AWV09730.1|1003864_1005001_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 4
CP029973	Escherichia coli strain 51008369SK1 chromosome, complete genome	4848222	1023891	1042339	4848222	holin	Enterobacteria_phage(21.43%)	22	NA	NA
AWV09751.1|1023891_1024947_-	outer membrane pore protein E	NA	Q1MVN1	Enterobacteria_phage	60.9	2.0e-118
AWV09752.1|1025234_1026338_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
AWV09753.1|1026349_1027603_+	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
AWV09754.1|1027958_1029173_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	56.5	7.5e-133
AWV09755.1|1029284_1029518_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AWV09756.1|1029565_1029769_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
AWV09757.1|1029768_1030200_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.7	3.0e-28
AWV09758.1|1030212_1031022_+	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	53.6	3.0e-29
AWV09759.1|1031014_1031197_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AWV09760.1|1031190_1032258_+	ash family protein	NA	NA	NA	NA	NA
AWV09761.1|1032250_1032445_+	hypothetical protein	NA	NA	NA	NA	NA
AWV09762.1|1032441_1032705_+|holin	nicotinic acetylcholine receptor subunit beta	holin	NA	NA	NA	NA
AWV09763.1|1032701_1032923_+	hypothetical protein	NA	NA	NA	NA	NA
AWV09764.1|1032915_1033518_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	34.7	5.3e-23
AWV09765.1|1033530_1036287_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.0	2.6e-298
AWV09766.1|1036353_1036605_+	hypothetical protein	NA	NA	NA	NA	NA
AWV09767.1|1037048_1038515_+	acyltransferase	NA	B6SCW4	Bacteriophage	53.3	1.4e-106
AWV09768.1|1038514_1040620_+	injection protein	NA	A0A2I7QQN9	Vibrio_phage	36.2	1.4e-86
AWV13274.1|1040682_1041120_-	hypothetical protein	NA	I6S5X4	Salmonella_phage	33.1	3.1e-12
AWV09769.1|1041141_1041378_+	hypothetical protein	NA	NA	NA	NA	NA
AWV09770.1|1041603_1041804_-	hypothetical protein	NA	H6WRV2	Salmonella_phage	43.1	1.3e-05
AWV09771.1|1041883_1042339_-	hypothetical protein	NA	A0A1W6JPI4	Morganella_phage	66.4	2.9e-45
>prophage 5
CP029973	Escherichia coli strain 51008369SK1 chromosome, complete genome	4848222	1928590	1987218	4848222	head,capsid,portal,tRNA,integrase,terminase,holin,transposase,tail	Escherichia_phage(40.43%)	69	1923685:1923699	1930165:1930179
1923685:1923699	attL	GATCGCGATGTACGC	NA	NA	NA	NA
AWV10573.1|1928590_1929709_-|integrase	integrase	integrase	Q77Z04	Phage_21	44.4	1.6e-84
AWV10574.1|1929677_1929947_-	excisionase	NA	NA	NA	NA	NA
AWV10575.1|1930008_1932450_-	exonuclease	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
1930165:1930179	attR	GCGTACATCGCGATC	NA	NA	NA	NA
AWV10576.1|1932543_1932735_-	DUF1482 family protein	NA	NA	NA	NA	NA
AWV10577.1|1932731_1932920_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AWV13301.1|1933269_1933524_+	hypothetical protein	NA	NA	NA	NA	NA
AWV10578.1|1933488_1933707_-	hypothetical protein	NA	NA	NA	NA	NA
AWV10579.1|1933778_1934078_-	hypothetical protein	NA	NA	NA	NA	NA
AWV10580.1|1934061_1934220_-	hypothetical protein	NA	NA	NA	NA	NA
AWV13302.1|1934431_1934956_-	LexA family transcriptional repressor	NA	H9C160	Pectobacterium_phage	28.0	2.2e-12
AWV10581.1|1935161_1935404_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
AWV10582.1|1935387_1935813_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AWV10583.1|1935884_1936955_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
AWV10584.1|1936995_1937418_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
AWV10585.1|1937475_1937832_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
AWV10586.1|1937925_1938108_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
AWV10587.1|1938475_1939222_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
AWV10588.1|1939236_1940778_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
AWV10589.1|1941349_1941529_+	hypothetical protein	NA	NA	NA	NA	NA
AWV10590.1|1941731_1941944_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
AWV10591.1|1942111_1942390_+	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
AWV10592.1|1942391_1943450_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	7.5e-89
AWV10593.1|1943450_1943831_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.3e-35
AWV10594.1|1943827_1944649_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	5.1e-77
AWV13303.1|1945043_1945130_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
AWV10595.1|1945618_1945831_-	hypothetical protein	NA	NA	NA	NA	NA
AWV10596.1|1945901_1946237_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	1.4e-44
AWV10597.1|1946497_1946686_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
AWV10598.1|1946682_1946844_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	87.0	5.9e-14
AWV10599.1|1946993_1947209_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
AWV10600.1|1947213_1947564_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
AWV10601.1|1947627_1948161_+	lysozyme	NA	Q08J98	Stx2-converting_phage	93.2	1.5e-98
AWV10602.1|1948097_1948325_-	hypothetical protein	NA	NA	NA	NA	NA
AWV10603.1|1948377_1948560_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
AWV10604.1|1948650_1948944_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
AWV10605.1|1949036_1949177_+	Rz1 lytic protein	NA	U5P461	Shigella_phage	84.6	1.0e-09
AWV10606.1|1949469_1949820_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	8.0e-64
AWV10607.1|1949967_1950450_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
AWV10608.1|1950449_1952207_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
AWV10609.1|1952354_1953581_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.3	3.7e-204
AWV10610.1|1954186_1955404_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
AWV10611.1|1955480_1955798_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.5	5.3e-22
AWV10612.1|1955806_1956145_+|head,tail	head-tail adaptor protein	head,tail	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
AWV10613.1|1956141_1956591_+	hypothetical protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
AWV10614.1|1956587_1956932_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	5.1e-55
AWV10615.1|1956992_1957697_+|tail	phage tail protein	tail	A0A1B5FP82	Escherichia_phage	92.7	1.4e-112
AWV10616.1|1957696_1958083_+|tail	phage tail protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
AWV13304.1|1958124_1958385_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	95.3	2.3e-39
AWV10617.1|1958431_1961659_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.0	0.0e+00
AWV10618.1|1961636_1961993_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
AWV10619.1|1961992_1962691_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	3.4e-130
AWV10620.1|1962696_1963440_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	4.5e-149
AWV10621.1|1963337_1963985_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.4	2.6e-108
AWV10622.1|1964045_1967525_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
AWV10623.1|1967592_1968192_+	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	95.0	1.6e-107
AWV10624.1|1972145_1973669_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AWV10625.1|1973962_1974334_+	hypothetical protein	NA	NA	NA	NA	NA
AWV10626.1|1975751_1975889_+|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AWV13305.1|1975833_1976460_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWV10627.1|1977055_1977919_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
AWV10628.1|1977902_1979039_-	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
AWV13306.1|1979017_1979233_-	hypothetical protein	NA	NA	NA	NA	NA
AWV10629.1|1979288_1980515_+	peptidase T	NA	NA	NA	NA	NA
AWV10630.1|1980563_1981685_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AWV10631.1|1981760_1983221_-	sensor protein PhoQ	NA	NA	NA	NA	NA
AWV10632.1|1983220_1983892_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AWV10633.1|1984060_1985431_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
AWV13307.1|1985434_1986076_-	lysogenization protein HflD	NA	NA	NA	NA	NA
AWV10634.1|1986111_1987218_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 6
CP029973	Escherichia coli strain 51008369SK1 chromosome, complete genome	4848222	2913533	2923845	4848222		Escherichia_phage(22.22%)	10	NA	NA
AWV11476.1|2913533_2914541_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	1.2e-30
AWV11477.1|2914733_2915900_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
AWV11478.1|2916080_2916635_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.8	1.0e-52
AWV11479.1|2916649_2917540_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.2	3.7e-28
AWV11480.1|2917571_2918441_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	66.7	9.8e-111
AWV11481.1|2918467_2919532_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	4.4e-105
AWV11482.1|2919756_2921163_-	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
AWV13355.1|2921334_2921727_-	serine acetyltransferase	NA	A0A191KBJ5	Streptococcus_virus	41.1	6.8e-11
AWV11483.1|2921806_2923135_-	flippase	NA	NA	NA	NA	NA
AWV11484.1|2923170_2923845_-	hypothetical protein	NA	A0A1V0E6Q2	Klebsiella_phage	25.2	6.4e-09
>prophage 7
CP029973	Escherichia coli strain 51008369SK1 chromosome, complete genome	4848222	3012710	3022153	4848222		Enterobacteria_phage(85.71%)	10	NA	NA
AWV11549.1|3012710_3013847_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	5.0e-163
AWV11550.1|3013843_3015844_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
AWV11551.1|3015968_3016430_+	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	99.3	5.4e-76
AWV11552.1|3016471_3016942_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	5.2e-82
AWV11553.1|3016988_3017708_-	two-component system response regulator YehT	NA	NA	NA	NA	NA
AWV11554.1|3017704_3019390_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AWV11555.1|3019611_3020343_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
AWV11556.1|3020402_3020510_+	hypothetical protein	NA	NA	NA	NA	NA
AWV11557.1|3020490_3021222_-	ABC transporter permease	NA	NA	NA	NA	NA
AWV11558.1|3021226_3022153_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 8
CP029973	Escherichia coli strain 51008369SK1 chromosome, complete genome	4848222	3048341	3134926	4848222	head,capsid,lysis,portal,tRNA,terminase,holin,tail	Enterobacteria_phage(36.84%)	97	NA	NA
AWV11583.1|3048341_3048455_-|tRNA	phenylalanyl-tRNA synthetase subunit beta	tRNA	NA	NA	NA	NA
AWV11584.1|3048511_3048688_+	hypothetical protein	NA	NA	NA	NA	NA
AWV11585.1|3048615_3049452_+	S-formylglutathione hydrolase YeiG	NA	NA	NA	NA	NA
AWV11586.1|3051453_3051657_-	hypothetical protein	NA	NA	NA	NA	NA
AWV11587.1|3051753_3053223_-	amino acid permease	NA	NA	NA	NA	NA
AWV11588.1|3053206_3053389_-	hypothetical protein	NA	NA	NA	NA	NA
AWV11589.1|3053427_3054309_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWV11590.1|3054407_3055457_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
AWV11591.1|3055530_3056388_+	endonuclease	NA	A0A1V0SBL9	Catovirus	35.0	3.1e-24
AWV11592.1|3056390_3057479_+	sugar kinase	NA	NA	NA	NA	NA
AWV11593.1|3057534_3058785_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
AWV11594.1|3058884_3059826_-	pyrimidine-specific ribonucleoside hydrolase RihB	NA	NA	NA	NA	NA
AWV11595.1|3059955_3060654_+	transcriptional regulator YeiL	NA	NA	NA	NA	NA
AWV11596.1|3060721_3061972_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
AWV11597.1|3062990_3063932_-	pseudouridine kinase	NA	NA	NA	NA	NA
AWV11598.1|3064355_3066047_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
AWV11599.1|3066063_3067002_-	1-phosphofructokinase	NA	NA	NA	NA	NA
AWV11600.1|3067001_3068132_-	multiphosphoryl transfer protein	NA	NA	NA	NA	NA
AWV11601.1|3068499_3069681_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
AWV11602.1|3069677_3069932_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
AWV11603.1|3070086_3070659_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
AWV11604.1|3070881_3072348_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.8	1.5e-42
AWV11605.1|3072465_3073452_+	GTP-binding protein	NA	NA	NA	NA	NA
AWV11606.1|3073490_3074204_+	hypothetical protein	NA	NA	NA	NA	NA
AWV11607.1|3074615_3075182_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
AWV11608.1|3075362_3076919_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
AWV11609.1|3077000_3078815_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWV11610.1|3078815_3079910_+	ABC transporter permease	NA	NA	NA	NA	NA
AWV11611.1|3079909_3080935_+	ABC transporter permease	NA	NA	NA	NA	NA
AWV11612.1|3080936_3082526_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
AWV11613.1|3082529_3082874_-	hypothetical protein	NA	NA	NA	NA	NA
AWV11614.1|3083206_3084397_-	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
AWV11615.1|3084424_3085120_-	16S rRNA pseudouridine(516) synthase	NA	NA	NA	NA	NA
AWV11616.1|3085269_3087030_+	ATP-dependent helicase	NA	M4Q3N1	Vibrio_phage	41.8	3.2e-100
AWV11617.1|3087154_3087439_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
AWV11618.1|3087577_3088585_-	nucleoid-associated protein	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
AWV11619.1|3088766_3088994_+	DUF1414 domain-containing protein	NA	NA	NA	NA	NA
AWV11620.1|3089013_3090774_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
AWV11621.1|3091207_3091414_+	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	5.3e-31
AWV11622.1|3091410_3091503_-|capsid	capsid protein	capsid	NA	NA	NA	NA
AWV11623.1|3091693_3092896_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
AWV11624.1|3093998_3094127_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	92.9	7.3e-15
AWV11625.1|3094181_3097940_-	peptidase S74	NA	A0A2D1UII2	Escherichia_phage	88.7	0.0e+00
AWV11626.1|3098004_3098604_-	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
AWV11627.1|3098674_3102172_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	98.2	0.0e+00
AWV11628.1|3102232_3102904_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	90.1	9.9e-103
AWV11629.1|3102801_3103545_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.2e-146
AWV11630.1|3103550_3104249_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	1.5e-133
AWV11631.1|3104248_3104578_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
AWV11632.1|3104574_3107154_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	86.7	0.0e+00
AWV11633.1|3107146_3107581_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
AWV11634.1|3107562_3107985_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.7	2.2e-60
AWV13363.1|3108000_3108741_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	94.3	7.8e-125
AWV11635.1|3108748_3109144_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	5.0e-70
AWV11636.1|3109140_3109719_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
AWV11637.1|3109730_3110084_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.9e-61
AWV11638.1|3110095_3110491_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	3.1e-56
AWV11639.1|3110532_3111558_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	96.8	2.9e-186
AWV11640.1|3111613_3111946_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	96.4	4.6e-53
AWV11641.1|3111955_3113275_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	1.2e-232
AWV11642.1|3113255_3114857_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	5.5e-309
AWV11643.1|3114853_3115060_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AWV11644.1|3115056_3116982_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
AWV11645.1|3116956_3117502_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
AWV13364.1|3117641_3117785_-	DNA-packaging protein	NA	NA	NA	NA	NA
AWV11646.1|3117890_3118124_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
AWV11647.1|3118180_3118591_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
AWV11648.1|3118636_3118801_+	hypothetical protein	NA	NA	NA	NA	NA
AWV11649.1|3118877_3119135_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	98.8	1.1e-38
AWV11650.1|3119131_3119455_-	DNA-binding protein	NA	A0A220NRM9	Escherichia_phage	99.1	7.9e-58
AWV11651.1|3119476_3119944_-|lysis	lysis protein	lysis	A5LH84	Enterobacteria_phage	100.0	1.6e-75
AWV11652.1|3119940_3120438_-	lysozyme	NA	A5LH83	Enterobacteria_phage	100.0	1.3e-91
AWV11653.1|3120437_3120653_-|holin	holin	holin	A5LH82	Enterobacteria_phage	98.6	2.0e-33
AWV11654.1|3120720_3121095_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	93.5	4.4e-60
AWV11655.1|3121352_3121586_-	hypothetical protein	NA	NA	NA	NA	NA
AWV11656.1|3121729_3122269_-	hypothetical protein	NA	NA	NA	NA	NA
AWV11657.1|3122483_3123236_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.4	9.9e-136
AWV11658.1|3123249_3124239_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	4.3e-195
AWV11659.1|3124246_3125044_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	98.9	1.9e-148
AWV11660.1|3125063_3125453_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A291AX14	Escherichia_phage	98.4	4.6e-68
AWV11661.1|3125449_3125776_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	7.8e-53
AWV11662.1|3126425_3126920_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.8	1.2e-86
AWV11663.1|3126916_3127858_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.7	3.9e-153
AWV11664.1|3127847_3128027_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
AWV13365.1|3128202_3128760_-	protein YmfL	NA	U5P4K1	Shigella_phage	96.8	8.8e-97
AWV11665.1|3128797_3128998_-	cell division protein	NA	NA	NA	NA	NA
AWV11666.1|3129095_3129722_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	1.9e-47
AWV11667.1|3130117_3130393_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	96.7	5.9e-46
AWV11668.1|3130310_3130556_-	hypothetical protein	NA	NA	NA	NA	NA
AWV11669.1|3130696_3130921_-	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	66.2	2.2e-14
AWV11670.1|3130993_3131356_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
AWV11671.1|3131420_3132245_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	6.0e-150
AWV11672.1|3132372_3132909_+	HD family hydrolase	NA	A0A0P0ZCH9	Stx2-converting_phage	98.3	5.3e-99
AWV11673.1|3132899_3133262_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	99.2	3.6e-67
AWV11674.1|3133258_3133474_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	92.1	3.7e-27
AWV11675.1|3133535_3133745_+	hypothetical protein	NA	NA	NA	NA	NA
AWV11676.1|3133747_3134926_+	recombinase	NA	A0A2D1GN00	Marinobacter_phage	30.6	2.7e-31
>prophage 9
CP029973	Escherichia coli strain 51008369SK1 chromosome, complete genome	4848222	3672227	3685409	4848222		Escherichia_phage(50.0%)	12	NA	NA
AWV12147.1|3672227_3674789_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
AWV12148.1|3674894_3675551_+	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
AWV12149.1|3675601_3676369_-	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
AWV12150.1|3676564_3677473_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	5.1e-118
AWV12151.1|3677469_3678732_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
AWV12152.1|3678728_3679367_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AWV12153.1|3679371_3680148_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AWV12154.1|3680236_3681601_+	permease	NA	NA	NA	NA	NA
AWV12155.1|3681694_3682687_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
AWV12156.1|3682749_3683889_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
AWV12157.1|3684027_3684654_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
AWV12158.1|3684647_3685409_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 1
CP029975	Escherichia coli strain 51008369SK1 plasmid p51008369SK1_B, complete sequence	113340	0	7647	113340		Wolbachia_phage(50.0%)	6	NA	NA
AWV13516.1|521_980_+	hypothetical protein	NA	NA	NA	NA	NA
AWV13517.1|976_1795_+	conjugal transfer protein	NA	NA	NA	NA	NA
AWV13518.1|1791_2940_+	plasmid transfer ATPase TraJ	NA	NA	NA	NA	NA
AWV13519.1|2936_3227_+	conjugal transfer protein	NA	NA	NA	NA	NA
AWV13520.1|3241_3793_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	30.5	3.3e-19
AWV13521.1|3882_7647_+	DNA primase	NA	A0A1B0VML8	Pseudomonas_phage	30.1	2.6e-19
>prophage 2
CP029975	Escherichia coli strain 51008369SK1 plasmid p51008369SK1_B, complete sequence	113340	22875	67993	113340	transposase,integrase	Enterobacteria_phage(15.79%)	56	60958:61017	76651:77473
AWV13538.1|22875_23280_-|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	55.2	6.5e-33
AWV13645.1|23338_24565_+|transposase	transposase	transposase	O80301	Enterobacteria_phage	99.7	1.0e-193
AWV13539.1|25406_25658_+	hypothetical protein	NA	NA	NA	NA	NA
AWV13646.1|25729_25882_-	Hok/Gef family protein	NA	NA	NA	NA	NA
AWV13540.1|26173_27382_+	conjugal transfer protein TrbA	NA	NA	NA	NA	NA
AWV13541.1|27400_28471_+	DsbC family protein	NA	NA	NA	NA	NA
AWV13542.1|28463_30755_+	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
AWV13543.1|30791_33491_-	relaxase NikB	NA	NA	NA	NA	NA
AWV13544.1|33501_33834_-	nikA protein	NA	NA	NA	NA	NA
AWV13545.1|34067_34403_+	molybdopterin-guanine dinucleotide biosynthesis protein MobC	NA	NA	NA	NA	NA
AWV13546.1|34488_35337_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AWV13547.1|35461_35677_-	hypothetical protein	NA	NA	NA	NA	NA
AWV13548.1|35685_35883_+	hypothetical protein	NA	NA	NA	NA	NA
AWV13549.1|35916_36168_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWV13550.1|36430_37372_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.0	3.5e-61
AWV13551.1|37436_37703_-	hypothetical protein	NA	NA	NA	NA	NA
AWV13552.1|37794_38229_-	post-segregation killing protein PndC	NA	NA	NA	NA	NA
AWV13553.1|38251_38497_-	hypothetical protein	NA	NA	NA	NA	NA
AWV13554.1|38518_38818_+	hypothetical protein	NA	NA	NA	NA	NA
AWV13555.1|38957_39458_-	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	26.9	9.3e-05
AWV13556.1|39920_40517_-	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	61.9	3.1e-15
AWV13557.1|40513_41233_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
AWV13558.1|41229_41664_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
AWV13559.1|41718_43767_-	hypothetical protein	NA	G8DH78	Emiliania_huxleyi_virus	28.9	3.8e-20
AWV13560.1|43735_43969_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AWV13561.1|44026_44554_-	plasmid-derived single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.5	1.6e-47
AWV13562.1|44550_44757_-	hypothetical protein	NA	NA	NA	NA	NA
AWV13563.1|45721_47389_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	52.8	6.2e-162
AWV13564.1|47366_47552_+	hypothetical protein	NA	NA	NA	NA	NA
AWV13565.1|47666_47858_-	hypothetical protein	NA	NA	NA	NA	NA
AWV13566.1|47854_48277_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AWV13647.1|48323_48626_-	antirestriction protein	NA	NA	NA	NA	NA
AWV13567.1|48721_49294_-	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
AWV13568.1|49987_50422_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AWV13569.1|50433_50655_-	hypothetical protein	NA	NA	NA	NA	NA
AWV13570.1|50655_51339_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.0e-30
AWV13571.1|51723_52695_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
AWV13648.1|52663_52933_-	hypothetical protein	NA	NA	NA	NA	NA
AWV13572.1|53043_53292_+	protein ImpC	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
AWV13573.1|53288_53726_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
AWV13574.1|53725_55000_+	protein ImpB	NA	F1C5A5	Cronobacter_phage	60.2	1.7e-143
AWV13575.1|55001_55418_-	recombinase	NA	NA	NA	NA	NA
AWV13576.1|55410_56391_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	51.4	1.7e-79
AWV13577.1|56804_57113_-	molecular chaperone GroEL	NA	NA	NA	NA	NA
AWV13578.1|57199_57844_-	ParA family protein	NA	NA	NA	NA	NA
AWV13579.1|58023_58803_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.6	4.0e-55
AWV13580.1|58804_59218_-	hypothetical protein	NA	NA	NA	NA	NA
AWV13581.1|59749_60676_+	hypothetical protein	NA	NA	NA	NA	NA
AWV13582.1|60720_60978_+	hypothetical protein	NA	NA	NA	NA	NA
60958:61017	attL	TTGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACAT	NA	NA	NA	NA
AWV13583.1|61011_61716_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AWV13584.1|62412_63426_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AWV13585.1|63582_64056_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	G3MBI7	Bacillus_virus	32.1	3.7e-19
AWV13586.1|64148_64940_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AWV13587.1|65103_65451_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AWV13588.1|66306_67011_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AWV13589.1|67132_67993_+	inhibitor-resistant class A broad-spectrum beta-lactamase TEM-30	NA	Q1MVP3	Enterobacteria_phage	99.7	3.9e-160
76651:77473	attR	TTGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGTTGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGTGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCC	NA	NA	NA	NA
>prophage 3
CP029975	Escherichia coli strain 51008369SK1 plasmid p51008369SK1_B, complete sequence	113340	71956	77409	113340	transposase	Salmonella_phage(33.33%)	7	NA	NA
AWV13591.1|71956_73171_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	29.1	3.2e-19
AWV13592.1|73198_73504_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWV13593.1|73615_75109_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AWV13594.1|75139_75391_+	hypothetical protein	NA	NA	NA	NA	NA
AWV13595.1|75284_75587_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AWV13596.1|75673_76489_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AWV13597.1|76704_77409_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 4
CP029975	Escherichia coli strain 51008369SK1 plasmid p51008369SK1_B, complete sequence	113340	87908	88757	113340		Vibrio_phage(100.0%)	1	NA	NA
AWV13612.1|87908_88757_-	3'-5' exonuclease	NA	K7RFY5	Vibrio_phage	40.1	3.5e-28
>prophage 5
CP029975	Escherichia coli strain 51008369SK1 plasmid p51008369SK1_B, complete sequence	113340	92256	92520	113340		Enterobacteria_phage(100.0%)	1	NA	NA
AWV13618.1|92256_92520_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	54.0	6.1e-08
>prophage 6
CP029975	Escherichia coli strain 51008369SK1 plasmid p51008369SK1_B, complete sequence	113340	109405	110560	113340	integrase	Pseudomonas_phage(100.0%)	1	106609:106621	110754:110766
106609:106621	attL	TTTTTGTCCAGCG	NA	NA	NA	NA
AWV13642.1|109405_110560_+|integrase	integrase	integrase	B5WZU7	Pseudomonas_phage	43.0	1.0e-46
AWV13642.1|109405_110560_+|integrase	integrase	integrase	B5WZU7	Pseudomonas_phage	43.0	1.0e-46
110754:110766	attR	CGCTGGACAAAAA	NA	NA	NA	NA
>prophage 1
CP029976	Escherichia coli strain 51008369SK1 plasmid p51008369SK1_C, complete sequence	33826	0	5115	33826		Macacine_betaherpesvirus(100.0%)	8	NA	NA
AWV13653.1|1056_1461_+	hypothetical protein	NA	NA	NA	NA	NA
AWV13654.1|1596_2124_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
AWV13655.1|2186_2408_-	hypothetical protein	NA	NA	NA	NA	NA
AWV13656.1|2430_2646_-	hypothetical protein	NA	NA	NA	NA	NA
AWV13657.1|2695_2947_-	hypothetical protein	NA	NA	NA	NA	NA
AWV13658.1|2983_3286_-	hypothetical protein	NA	NA	NA	NA	NA
AWV13659.1|3451_4114_-	peptidyl-arginine deiminase	NA	NA	NA	NA	NA
AWV13660.1|4215_5115_-	resolvase	NA	I3WFA4	Macacine_betaherpesvirus	56.5	1.0e-22
>prophage 2
CP029976	Escherichia coli strain 51008369SK1 plasmid p51008369SK1_C, complete sequence	33826	9773	11612	33826		Klosneuvirus(50.0%)	2	NA	NA
AWV13666.1|9773_11036_-	AAA family ATPase	NA	A0A1V0SKF8	Klosneuvirus	31.4	3.0e-07
AWV13667.1|11117_11612_-	micrococcal nuclease	NA	A0A0R6PHV6	Moraxella_phage	37.2	4.2e-18
>prophage 3
CP029976	Escherichia coli strain 51008369SK1 plasmid p51008369SK1_C, complete sequence	33826	30429	32266	33826		Aeromonas_phage(50.0%)	3	NA	NA
AWV13694.1|30429_30945_-	J domain-containing protein	NA	A0A219YC37	Aeromonas_phage	32.2	2.5e-05
AWV13695.1|31583_31934_-	DNA-binding protein	NA	NA	NA	NA	NA
AWV13696.1|31930_32266_-	addiction module killer protein	NA	A0A141GEX6	Brucella_phage	44.3	4.4e-11
>prophage 1
CP029978	Escherichia coli strain 51008369SK1 plasmid p51008369SK1_E, complete sequence	99465	18805	63005	99465	transposase,protease,integrase	Macacine_betaherpesvirus(26.67%)	54	14087:14146	31489:31593
14087:14146	attL	CTGGGACGGAAGTCGCTGTCGTTCTCAAAATCGGTGGAGCTGCATGACAAAGTCATCGGG	NA	NA	NA	NA
AWV13801.1|18805_19612_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
AWV13802.1|20333_21089_+	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
AWV13803.1|21676_22843_+	protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
AWV13804.1|22842_23814_+	protein SopB	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
AWV13805.1|24241_24514_+	hypothetical protein	NA	NA	NA	NA	NA
AWV13881.1|24551_25454_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
AWV13806.1|25838_26522_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.0	1.1e-29
AWV13807.1|26522_26744_+	hypothetical protein	NA	NA	NA	NA	NA
AWV13808.1|26757_27192_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AWV13809.1|27236_28007_+	hypothetical protein	NA	NA	NA	NA	NA
AWV13810.1|28420_28846_+	antirestriction protein	NA	NA	NA	NA	NA
AWV13811.1|28892_29315_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AWV13812.1|29311_29482_+	hypothetical protein	NA	NA	NA	NA	NA
AWV13813.1|29420_30197_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.5	3.3e-09
AWV13814.1|30251_30812_+	conjugal transfer protein	NA	NA	NA	NA	NA
AWV13815.1|30945_31158_+	hypothetical protein	NA	NA	NA	NA	NA
AWV13816.1|31458_31641_-	hypothetical protein	NA	U5P0U6	Shigella_phage	100.0	8.5e-09
31489:31593	attR	CCCGATGACTTTGTCATGCAGCTCCACCGATTTTGAGAACGACAGCGACTTCCGTCCCAGTGTAACCGGCTCATTTAAACCGTCTGGTCTGTTTCCTCCGGCTCT	NA	NA	NA	NA
AWV13817.1|31602_32280_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AWV13818.1|32279_32627_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AWV13819.1|32646_34218_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
AWV13820.1|34921_35155_+	hypothetical protein	NA	NA	NA	NA	NA
AWV13821.1|35100_35343_-	hypothetical protein	NA	NA	NA	NA	NA
AWV13882.1|35398_35548_+	Hok/Gef family protein	NA	NA	NA	NA	NA
AWV13822.1|35831_36089_+	transcriptional regulator	NA	NA	NA	NA	NA
AWV13884.1|36124_36241_-	replication protein RepA	NA	NA	NA	NA	NA
AWV13883.1|36324_36399_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
AWV13823.1|38158_39379_+	arginine deiminase	NA	NA	NA	NA	NA
AWV13824.1|39389_40301_+	carbamate kinase	NA	NA	NA	NA	NA
AWV13825.1|40385_41390_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
AWV13826.1|41437_42841_+	YfcC family protein	NA	NA	NA	NA	NA
AWV13827.1|42921_43401_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
AWV13828.1|43757_43979_-	hypothetical protein	NA	NA	NA	NA	NA
AWV13829.1|44009_44360_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
AWV13830.1|44356_44719_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	88.5	9.0e-34
AWV13831.1|45557_46136_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
AWV13832.1|46548_46902_-	hypothetical protein	NA	NA	NA	NA	NA
AWV13833.1|47373_48396_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWV13834.1|48582_48834_-	hypothetical protein	NA	NA	NA	NA	NA
AWV13835.1|48800_49058_+	replication protein RepA	NA	NA	NA	NA	NA
AWV13886.1|49098_49209_-	replication protein RepA	NA	NA	NA	NA	NA
AWV13885.1|49292_49367_+	positive regulator of RepFIC repA1 expression	NA	NA	NA	NA	NA
AWV13836.1|49359_50217_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
AWV13837.1|50579_50966_+	hypothetical protein	NA	NA	NA	NA	NA
AWV13838.1|51155_51809_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWV13839.1|52028_52493_+	mRNA interferase PemK	NA	NA	NA	NA	NA
AWV13840.1|52489_52594_+	hypothetical protein	NA	NA	NA	NA	NA
AWV13841.1|52629_55527_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
AWV13842.1|55621_56227_+	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
AWV13887.1|57003_57396_+	cysteine hydrolase	NA	NA	NA	NA	NA
AWV13843.1|57533_58418_+	EamA family transporter	NA	NA	NA	NA	NA
AWV13844.1|58449_59649_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AWV13845.1|59727_60405_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWV13888.1|60436_60679_-	relaxase	NA	NA	NA	NA	NA
AWV13846.1|62300_63005_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
