The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029966	Lactobacillus curvatus strain ZJUNIT8 chromosome, complete genome	1877486	38144	92852	1877486	transposase,tRNA	Bacillus_phage(22.22%)	55	NA	NA
AWV72061.1|38144_39302_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
AWV72062.1|39346_40135_-	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
AWV72063.1|40255_41200_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
AWV72064.1|41295_41793_+	universal stress protein	NA	NA	NA	NA	NA
AWV72065.1|41868_42408_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
AWV72066.1|42497_42989_+	hypothetical protein	NA	NA	NA	NA	NA
AWV72067.1|43012_43849_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.2	1.9e-10
AWV72068.1|43835_44570_+	hypothetical protein	NA	NA	NA	NA	NA
AWV72069.1|44702_45638_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AWV72070.1|45655_46123_+	universal stress protein	NA	NA	NA	NA	NA
AWV72071.1|46147_46876_+	hypothetical protein	NA	NA	NA	NA	NA
AWV72072.1|46959_47175_+	hypothetical protein	NA	NA	NA	NA	NA
AWV72073.1|47281_47956_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	32.9	1.6e-28
AWV72074.1|47952_48846_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	29.3	2.2e-20
AWV72075.1|49250_50438_-	cyclopropane-fatty-acyl-phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	37.8	1.2e-47
AWV72076.1|50594_51635_+	AI-2E family transporter	NA	NA	NA	NA	NA
AWV72077.1|51627_51858_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWV72078.1|52025_52217_+	hypothetical protein	NA	NA	NA	NA	NA
AWV72079.1|52315_53368_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
AWV72080.1|53560_54001_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AWV72081.1|54048_54588_-	hypothetical protein	NA	NA	NA	NA	NA
AWV72082.1|54654_55575_-|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.2	9.2e-51
AWV72083.1|55778_56675_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.1	2.5e-24
AWV72084.1|56667_57921_+	ABC transporter permease	NA	NA	NA	NA	NA
AWV72085.1|58001_59081_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
AWV72086.1|59185_61081_+	M13 family peptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	29.3	1.7e-70
AWV72087.1|61141_61759_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
AWV72088.1|61944_62616_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
AWV72089.1|63405_64215_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
AWV72090.1|64610_66629_+	PTS N-acetylglucosamine transporter subunit IIABC	NA	NA	NA	NA	NA
AWV72091.1|66682_67630_-	DUF1002 domain-containing protein	NA	NA	NA	NA	NA
AWV72092.1|67740_68874_-	RDD family protein	NA	NA	NA	NA	NA
AWV72093.1|69139_70420_+	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	34.7	4.6e-64
AWV72094.1|70589_71900_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	32.6	1.5e-49
AWV72095.1|72043_72706_+	class A sortase	NA	NA	NA	NA	NA
AWV72096.1|73197_73506_+	hypothetical protein	NA	A0A2H4JHE6	uncultured_Caudovirales_phage	42.7	8.8e-14
AWV72097.1|74074_75094_+	aldehyde reductase	NA	M1NML0	Moumouvirus	26.5	1.4e-07
AWV72098.1|75326_75530_-	hypothetical protein	NA	NA	NA	NA	NA
AWV72099.1|75607_76984_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
AWV72100.1|77908_78046_+	DUF2292 domain-containing protein	NA	NA	NA	NA	NA
AWV72101.1|78611_78953_+	hypothetical protein	NA	NA	NA	NA	NA
AWV72102.1|80244_80958_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	40.6	6.1e-42
AWV72103.1|80967_82872_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	33.7	1.6e-33
AWV72104.1|82861_84193_+	hypothetical protein	NA	NA	NA	NA	NA
AWV72105.1|84197_85013_+	hypothetical protein	NA	NA	NA	NA	NA
AWV72106.1|85049_85856_+	MBL fold metallo-hydrolase	NA	A0A2H4J3R0	uncultured_Caudovirales_phage	30.9	1.1e-31
AWV72107.1|86025_87264_+	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	27.9	6.2e-18
AWV72108.1|87333_88227_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	29.3	2.2e-20
AWV72109.1|88223_88898_-|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	32.9	1.6e-28
AWV72110.1|89468_89948_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
AWV72111.1|90085_90526_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
AWV72112.1|90522_90921_+	hypothetical protein	NA	NA	NA	NA	NA
AWV72113.1|90997_91705_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
AWV72114.1|91773_91896_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AWV72115.1|91922_92852_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	34.4	2.3e-25
>prophage 2
CP029966	Lactobacillus curvatus strain ZJUNIT8 chromosome, complete genome	1877486	335873	384535	1877486	transposase,tRNA,protease	Lactobacillus_phage(20.0%)	39	NA	NA
AWV72335.1|335873_336773_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
AWV72336.1|336900_338139_+	hypothetical protein	NA	NA	NA	NA	NA
AWV72337.1|338261_339641_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
AWV72338.1|339855_341463_+	ATP-dependent helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	40.7	2.5e-67
AWV72339.1|341598_341952_+	holo-ACP synthase	NA	NA	NA	NA	NA
AWV72340.1|341956_343099_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	30.2	2.8e-33
AWV72341.1|343176_343437_+	hypothetical protein	NA	NA	NA	NA	NA
AWV72342.1|343458_343824_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A1S5RCS0	Lactobacillus_phage	34.5	3.7e-11
AWV72343.1|343986_344514_+	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	29.9	2.6e-05
AWV72344.1|344557_345235_-	CBS domain-containing protein	NA	NA	NA	NA	NA
AWV72345.1|345509_346889_-	hypothetical protein	NA	NA	NA	NA	NA
AWV72346.1|347097_348075_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
AWV72347.1|348304_348862_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AWV72348.1|349163_352688_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
AWV72349.1|352710_354303_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AWV72350.1|354302_354569_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
AWV72351.1|354724_355111_+	septum formation initiator family protein	NA	NA	NA	NA	NA
AWV72352.1|355242_355683_+	RNA-binding protein S1	NA	NA	NA	NA	NA
AWV72353.1|355778_357149_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	R4TVK3	Phaeocystis_globosa_virus	27.2	3.0e-13
AWV72354.1|357171_357717_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	28.8	1.6e-10
AWV72355.1|357805_359902_+	cell division protein FtsH	NA	A9YVR1	Ostreococcus_tauri_virus	49.4	1.2e-106
AWV72356.1|359975_360854_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
AWV72357.1|360942_361932_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
AWV73768.1|362030_363515_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	35.8	3.2e-85
AWV73769.1|369385_369895_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AWV72358.1|370302_371763_+	peptide ABC transporter permease	NA	A0A0P0IY73	Acinetobacter_phage	36.3	4.7e-81
AWV72359.1|372141_372948_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	37.8	1.9e-36
AWV72360.1|373451_374372_-	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AWV72361.1|374513_375653_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
AWV72362.1|375674_376376_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWV72363.1|376468_376570_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AWV72364.1|376729_377650_+|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.2	9.2e-51
AWV72365.1|377889_378732_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.6	3.7e-155
AWV72366.1|378785_379037_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	95.2	3.5e-37
AWV72367.1|379297_380338_+	hypothetical protein	NA	NA	NA	NA	NA
AWV72368.1|380560_382111_-	hypothetical protein	NA	NA	NA	NA	NA
AWV72369.1|382293_383469_+|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	29.2	8.2e-28
AWV72370.1|383465_383579_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AWV72371.1|383605_384535_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	34.4	2.3e-25
>prophage 3
CP029966	Lactobacillus curvatus strain ZJUNIT8 chromosome, complete genome	1877486	468912	478783	1877486		Enterobacteria_phage(37.5%)	11	NA	NA
AWV73770.1|468912_469557_+	antibiotic acetyltransferase	NA	A0A1V0SJ47	Klosneuvirus	34.8	3.5e-12
AWV72456.1|469550_470963_+	hypothetical protein	NA	NA	NA	NA	NA
AWV72457.1|470979_471849_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	59.4	2.3e-99
AWV72458.1|471861_472443_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	45.1	1.5e-38
AWV72459.1|472458_473487_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	42.7	6.4e-69
AWV73771.1|473543_474386_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	37.6	3.9e-32
AWV72460.1|474430_475582_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	38.9	5.6e-13
AWV72461.1|475664_476213_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AWV72462.1|476394_477069_-	hypothetical protein	NA	NA	NA	NA	NA
AWV72463.1|477410_478313_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	48.5	2.4e-72
AWV72464.1|478372_478783_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.6	3.3e-08
>prophage 4
CP029966	Lactobacillus curvatus strain ZJUNIT8 chromosome, complete genome	1877486	501516	608471	1877486	integrase,head,tail,tRNA,capsid,portal,protease,holin,lysis,terminase	Lactobacillus_phage(45.28%)	98	521313:521328	549698:549713
AWV72488.1|501516_503718_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	38.8	8.2e-122
AWV72489.1|503960_504149_+	hypothetical protein	NA	NA	NA	NA	NA
AWV72490.1|504292_504559_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AWV72491.1|504558_506283_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
AWV72492.1|506425_506872_+	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
AWV72493.1|506868_509037_+	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	30.4	1.4e-65
AWV72494.1|509232_511440_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	63.1	1.1e-272
AWV72495.1|511473_512055_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	55.0	3.2e-49
AWV72496.1|513638_514856_-	hypothetical protein	NA	NA	NA	NA	NA
AWV72497.1|514870_515941_-	sensor histidine kinase	NA	A0A2K9L0Z8	Tupanvirus	32.6	7.0e-10
AWV72498.1|515950_516625_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AWV72499.1|516767_517544_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	1.2e-27
AWV72500.1|517521_519624_+	ABC transporter permease	NA	NA	NA	NA	NA
AWV72501.1|519641_520427_+	DUF975 family protein	NA	NA	NA	NA	NA
AWV72502.1|520541_521321_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
521313:521328	attL	AAAAAATAAGTGAATT	NA	NA	NA	NA
AWV72503.1|521604_522003_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
AWV72504.1|522163_522853_+	adaptor protein MecA	NA	NA	NA	NA	NA
AWV72505.1|522924_523920_+	hypothetical protein	NA	NA	NA	NA	NA
AWV72506.1|523922_524567_-	DsbA family protein	NA	NA	NA	NA	NA
AWV72507.1|524671_525253_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
AWV72508.1|525406_526081_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
AWV72509.1|526077_526884_+	NAD kinase	NA	NA	NA	NA	NA
AWV73774.1|526873_527803_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.8	6.1e-10
AWV72510.1|527885_528716_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
AWV72511.1|528747_529383_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AWV72512.1|529698_530259_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	39.5	5.0e-23
AWV72513.1|530262_530901_-	PAP2 family protein	NA	NA	NA	NA	NA
AWV72514.1|531108_533043_+	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXE4	Bacillus_phage	45.1	3.8e-22
AWV72515.1|533379_535803_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	69.9	0.0e+00
AWV72516.1|536294_537647_+	amino acid permease	NA	NA	NA	NA	NA
AWV72517.1|537681_538056_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWV72518.1|539380_541018_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AWV72519.1|541014_541725_+	16S rRNA pseudouridine(516) synthase	NA	NA	NA	NA	NA
AWV72520.1|541760_542597_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
AWV72521.1|542954_544067_-|integrase	site-specific integrase	integrase	A0A0P0IXL3	Lactobacillus_phage	41.6	1.7e-70
AWV72522.1|544179_544698_-	hypothetical protein	NA	NA	NA	NA	NA
AWV72523.1|544853_545474_-	XRE family transcriptional regulator	NA	A0A1B2APZ3	Phage_Wrath	46.3	8.1e-43
AWV73775.1|545632_545863_+	XRE family transcriptional regulator	NA	E9LUS9	Lactobacillus_phage	54.5	1.6e-15
AWV72524.1|545834_546191_+	hypothetical protein	NA	NA	NA	NA	NA
AWV72525.1|546330_546528_+	hypothetical protein	NA	NA	NA	NA	NA
AWV72526.1|546612_547098_+	hypothetical protein	NA	E5DV79	Deep-sea_thermophilic_phage	35.7	4.6e-17
AWV72527.1|547102_547795_+	DNA-binding protein	NA	Q6J1V8	Lactobacillus_phage	59.6	7.4e-69
AWV72528.1|547772_548471_+	AP2 domain-containing protein	NA	A0A0C5K996	Enterococcus_phage	46.7	2.6e-37
AWV72529.1|548463_549819_+	helicase	NA	Q9T0Y3	Lactobacillus_phage	51.8	3.2e-132
549698:549713	attR	AAAAAATAAGTGAATT	NA	NA	NA	NA
AWV72530.1|549821_550379_+	single-stranded DNA-binding protein	NA	Q9T0Y2	Lactobacillus_phage	56.6	3.5e-53
AWV72531.1|550390_550942_+	HNH endonuclease	NA	A0A286QSR3	Streptococcus_phage	52.5	7.0e-46
AWV72532.1|550971_553266_+	DNA primase	NA	Q9T0Y1	Lactobacillus_phage	60.3	4.1e-281
AWV72533.1|553486_554080_+	hypothetical protein	NA	R9QM99	Lactococcus_phage	40.9	1.7e-21
AWV72534.1|554072_554387_+	VRR-NUC domain-containing protein	NA	A0A1B0YA93	Lactobacillus_phage	60.2	1.7e-28
AWV72535.1|554392_554584_+	hypothetical protein	NA	NA	NA	NA	NA
AWV72536.1|554583_555012_+	hypothetical protein	NA	NA	NA	NA	NA
AWV72537.1|555358_555823_+	endonuclease	NA	A0A0P0IXF6	Lactobacillus_phage	76.5	3.7e-08
AWV72538.1|555970_556387_+	transcriptional regulator	NA	E9LUP5	Lactobacillus_phage	40.0	8.5e-20
AWV72539.1|556810_557149_+	HNH endonuclease	NA	A0A1B0YEC6	Lactobacillus_phage	72.3	1.5e-43
AWV72540.1|557238_557619_+	hypothetical protein	NA	A0A1B0YE76	Lactobacillus_phage	54.8	2.4e-29
AWV72541.1|557621_559328_+|terminase	terminase large subunit	terminase	A0A0P0IJU3	Lactobacillus_phage	76.4	1.2e-269
AWV73776.1|559349_560585_+|portal	phage portal protein	portal	A0A0P0IZM3	Lactobacillus_phage	71.7	7.8e-170
AWV72542.1|560562_561252_+|protease	Clp protease ClpP	protease	A0A1B0Y857	Lactobacillus_phage	59.6	7.6e-66
AWV72543.1|561244_562462_+|capsid	phage major capsid protein	capsid	A0A0P0IV50	Lactobacillus_phage	58.5	1.5e-125
AWV72544.1|562494_562710_+	hypothetical protein	NA	A5GYM0	Lactococcus_phage	52.9	1.0e-08
AWV72545.1|562724_563009_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B0Y2R7	Lactobacillus_phage	52.6	8.3e-19
AWV72546.1|562971_563307_+|head,tail	phage head-tail joining protein	head,tail	A0A0N7IRA3	Lactobacillus_phage	49.5	1.4e-20
AWV72547.1|563296_563626_+	hypothetical protein	NA	A0A0P0IDB8	Lactobacillus_phage	48.6	3.8e-23
AWV72548.1|563618_563999_+	hypothetical protein	NA	NA	NA	NA	NA
AWV72549.1|564009_564648_+|tail	phage tail protein	tail	A0A0P0I7R6	Lactobacillus_phage	44.1	2.4e-45
AWV72550.1|564617_564896_+	hypothetical protein	NA	G0ZNE6	Cronobacter_phage	51.2	1.4e-10
AWV72551.1|564955_565366_+	hypothetical protein	NA	A0A2H4J956	uncultured_Caudovirales_phage	44.3	4.4e-21
AWV72552.1|565615_568555_+|tail	phage tail tape measure protein	tail	A0A0P0IZN3	Lactobacillus_phage	50.8	1.4e-140
AWV72553.1|568556_569246_+	hypothetical protein	NA	A0A0A8WHP7	Clostridium_phage	25.1	2.4e-11
AWV72554.1|569242_575674_+	hypothetical protein	NA	A0A0A1ELH9	Lactobacillus_phage	49.9	1.1e-89
AWV72555.1|575670_576120_+	hypothetical protein	NA	A0A2P0ZLE0	Lactobacillus_phage	38.1	3.3e-17
AWV72556.1|576119_576356_+	hypothetical protein	NA	E9LUJ7	Lactobacillus_phage	41.8	1.4e-06
AWV72557.1|576373_576847_+|holin	holin	holin	NA	NA	NA	NA
AWV72558.1|576843_577122_+|lysis	lysis protein	lysis	NA	NA	NA	NA
AWV72559.1|577121_577955_+	N-acetylmuramidase	NA	A0A1B0Y4R9	Lactobacillus_phage	64.9	1.2e-54
AWV72560.1|578708_579170_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWV72561.1|579338_580127_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
AWV72562.1|580080_581019_-	alpha/beta hydrolase	NA	O11456	Ectromelia_virus	27.7	7.5e-16
AWV72563.1|581140_582733_-	amino acid:proton symporter	NA	NA	NA	NA	NA
AWV72564.1|582911_583109_-	hypothetical protein	NA	NA	NA	NA	NA
AWV72565.1|583538_585476_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	40.2	3.9e-35
AWV72566.1|585740_587432_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	33.5	2.3e-79
AWV72567.1|587909_588659_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
AWV72568.1|589980_591063_+	hypothetical protein	NA	NA	NA	NA	NA
AWV72569.1|591254_592829_+	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
AWV72570.1|592908_593145_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
AWV72571.1|593219_594014_+	lipase	NA	NA	NA	NA	NA
AWV72572.1|594029_596384_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	40.5	1.7e-88
AWV72573.1|596392_596866_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	58.3	9.3e-47
AWV72574.1|597096_598158_+	cell surface protein	NA	A0A142F1E5	Bacillus_phage	52.2	1.0e-16
AWV72575.1|598492_598984_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWV72576.1|599114_601775_+	DNA polymerase I	NA	B6V2J7	Bacillus_phage	28.5	1.8e-46
AWV72577.1|601786_602626_+	DNA-formamidopyrimidine glycosylase	NA	F8WPX6	Bacillus_phage	33.2	5.3e-29
AWV72578.1|602622_603213_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
AWV72579.1|603397_603871_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
AWV72580.1|603888_605271_+	helicase DnaB	NA	NA	NA	NA	NA
AWV72581.1|605270_606191_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	42.3	2.7e-26
AWV72582.1|606503_608471_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	33.8	1.2e-100
>prophage 5
CP029966	Lactobacillus curvatus strain ZJUNIT8 chromosome, complete genome	1877486	714149	722383	1877486		Bacillus_phage(50.0%)	9	NA	NA
AWV72701.1|714149_714476_-	hypothetical protein	NA	M4STD1	Rhodobacter_phage	35.6	2.4e-06
AWV72702.1|714491_714857_-	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
AWV72703.1|714966_715962_-	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	35.0	8.2e-45
AWV72704.1|716114_718409_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.3	8.7e-74
AWV72705.1|718443_718962_+	adenine phosphoribosyltransferase	NA	A0A2K9L2N8	Tupanvirus	31.1	2.8e-12
AWV72706.1|719180_719795_-	transcriptional repressor LexA	NA	A0A1B1P7Q3	Bacillus_phage	57.4	1.3e-16
AWV72707.1|719930_720173_+	DUF896 family protein	NA	NA	NA	NA	NA
AWV72708.1|720253_720481_+	YneF family protein	NA	NA	NA	NA	NA
AWV72709.1|720637_722383_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.9	6.9e-47
>prophage 6
CP029966	Lactobacillus curvatus strain ZJUNIT8 chromosome, complete genome	1877486	812066	820093	1877486		Acanthocystis_turfacea_Chlorella_virus(33.33%)	7	NA	NA
AWV72784.1|812066_812786_+	aquaporin family protein	NA	M1HCP3	Acanthocystis_turfacea_Chlorella_virus	34.5	1.3e-28
AWV72785.1|813172_814546_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	28.9	1.2e-41
AWV72786.1|814589_815069_-	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	37.5	6.5e-16
AWV72787.1|815520_817554_+	potassium transporter Kup	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	35.8	1.3e-68
AWV72788.1|817779_818388_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A249XZV3	Enterococcus_phage	49.7	9.2e-23
AWV72789.1|818526_818796_+	hypothetical protein	NA	NA	NA	NA	NA
AWV73781.1|818827_820093_+	excinuclease ABC subunit A	NA	M1Q231	Streptococcus_phage	39.0	1.2e-80
>prophage 7
CP029966	Lactobacillus curvatus strain ZJUNIT8 chromosome, complete genome	1877486	1052359	1059999	1877486	tRNA	Staphylococcus_phage(33.33%)	7	NA	NA
AWV73016.1|1052359_1053217_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	41.9	3.9e-19
AWV73017.1|1053402_1053897_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	39.2	1.1e-26
AWV73018.1|1053912_1054863_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	65.9	1.5e-125
AWV73019.1|1055243_1057127_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	30.4	6.5e-51
AWV73020.1|1057269_1057731_-	hypothetical protein	NA	NA	NA	NA	NA
AWV73021.1|1057794_1058994_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	A0A1B0V011	Roseobacter_phage	40.6	1.9e-32
AWV73022.1|1059141_1059999_+	hypothetical protein	NA	M1Q1P6	Streptococcus_phage	41.5	8.6e-59
>prophage 8
CP029966	Lactobacillus curvatus strain ZJUNIT8 chromosome, complete genome	1877486	1254872	1327806	1877486	tail,tRNA,capsid,transposase,protease,holin,terminase	Lactococcus_phage(20.0%)	94	NA	NA
AWV73208.1|1254872_1255826_-|tRNA	methionyl-tRNA formyltransferase	tRNA	M4QRX9	Synechococcus_phage	26.3	7.7e-08
AWV73209.1|1255844_1258259_-	primosomal protein N'	NA	NA	NA	NA	NA
AWV73210.1|1258277_1259480_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	35.0	4.2e-43
AWV73211.1|1259569_1259827_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AWV73212.1|1259831_1260443_-	guanylate kinase	NA	A0A212PP84	Cowpox_virus	29.4	2.1e-19
AWV73213.1|1260514_1260739_-	hypothetical protein	NA	A0A172JI00	Bacillus_phage	49.3	1.3e-14
AWV73214.1|1260860_1261187_+	hypothetical protein	NA	NA	NA	NA	NA
AWV73215.1|1261237_1262938_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AWV73216.1|1262986_1263439_-	arginine repressor	NA	NA	NA	NA	NA
AWV73217.1|1263519_1264350_-	TlyA family rRNA (cytidine-2'-O)-methyltransferase	NA	NA	NA	NA	NA
AWV73218.1|1264358_1265231_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
AWV73219.1|1265230_1265461_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
AWV73220.1|1265462_1266812_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	32.6	3.2e-36
AWV73221.1|1266804_1267656_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	40.6	4.3e-34
AWV73222.1|1267817_1268246_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
AWV73223.1|1268245_1268689_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
AWV73224.1|1268724_1269282_-	elongation factor P	NA	NA	NA	NA	NA
AWV73225.1|1269648_1269936_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
AWV73226.1|1269964_1270306_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
AWV73227.1|1270320_1270629_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
AWV73228.1|1270776_1271388_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AWV73229.1|1271647_1271884_+	hypothetical protein	NA	NA	NA	NA	NA
AWV73230.1|1273138_1274392_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
AWV73231.1|1274409_1275951_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase PurH	NA	Q58MG4	Prochlorococcus_phage	49.7	7.6e-74
AWV73232.1|1275919_1276537_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	34.4	4.5e-25
AWV73233.1|1276541_1277564_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.0	1.1e-63
AWV73234.1|1277596_1279003_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.5	2.8e-51
AWV73235.1|1278987_1281210_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.6	2.7e-149
AWV73236.1|1281206_1281881_-	phosphoribosylformylglycinamidine synthase I	NA	NA	NA	NA	NA
AWV73237.1|1281877_1282138_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AWV73238.1|1282130_1282856_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FUQ7	Synechococcus_phage	40.1	2.1e-37
AWV73239.1|1282966_1284265_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.2	5.5e-17
AWV73240.1|1284280_1285432_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AWV73241.1|1285394_1285880_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	40.0	9.3e-18
AWV73242.1|1286050_1286770_-	aquaporin family protein	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	35.6	3.9e-28
AWV73243.1|1286792_1288619_-	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
AWV73244.1|1288630_1290148_-	glycerol kinase	NA	NA	NA	NA	NA
AWV73245.1|1290373_1291552_-	penicillin-binding protein	NA	NA	NA	NA	NA
AWV73246.1|1291714_1292152_-	universal stress protein	NA	NA	NA	NA	NA
AWV73247.1|1292421_1293351_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	34.4	1.4e-25
AWV73248.1|1293488_1294211_+	dehydrogenase	NA	NA	NA	NA	NA
AWV73249.1|1294365_1294566_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	78.5	1.1e-22
AWV73250.1|1294821_1295148_-	hypothetical protein	NA	NA	NA	NA	NA
AWV73251.1|1295308_1295587_-	hypothetical protein	NA	NA	NA	NA	NA
AWV73252.1|1295616_1295877_-	hypothetical protein	NA	NA	NA	NA	NA
AWV73253.1|1295990_1297217_+	hypothetical protein	NA	NA	NA	NA	NA
AWV73254.1|1297261_1298170_-	N-acetylmuramidase	NA	Q9MCC8	Lactobacillus_phage	62.5	1.7e-57
AWV73255.1|1298166_1298406_-|holin	phage holin	holin	D2J020	Enterococcus_phage	54.5	4.1e-19
AWV73256.1|1298410_1298686_-	hypothetical protein	NA	NA	NA	NA	NA
AWV73257.1|1298771_1298894_-	XkdX family protein	NA	NA	NA	NA	NA
AWV73258.1|1299112_1299613_-	hypothetical protein	NA	NA	NA	NA	NA
AWV73259.1|1299630_1302012_-	hypothetical protein	NA	A0A2K9VC32	Lactobacillus_phage	39.3	5.4e-10
AWV73260.1|1302011_1303511_-	hypothetical protein	NA	A0A1B2APX2	Phage_Wrath	38.1	4.2e-77
AWV73261.1|1303512_1304241_-|tail	phage tail protein	tail	A0A1S5SAI1	Streptococcus_phage	38.7	4.0e-41
AWV73262.1|1304224_1306723_-|tail	phage tail protein	tail	A0A1B1IMY1	Lactococcus_phage	58.1	1.5e-132
AWV73789.1|1306712_1307099_-	hypothetical protein	NA	E8ZDK1	Streptococcus_phage	52.8	1.3e-27
AWV73263.1|1307113_1307380_-	hypothetical protein	NA	Q9F4J5	Streptococcus_phage	54.8	2.8e-16
AWV73264.1|1307376_1308003_-|tail	phage tail protein	tail	A0A141E164	Streptococcus_phage	63.2	1.6e-59
AWV73265.1|1308014_1308350_-	hypothetical protein	NA	A0A1B1IMT0	Lactococcus_phage	69.4	1.0e-36
AWV73266.1|1308349_1308586_-	hypothetical protein	NA	A0A1P8BMT2	Lactococcus_phage	69.2	3.5e-23
AWV73267.1|1308578_1308917_-	hypothetical protein	NA	A0A1P8BMP0	Lactococcus_phage	74.1	9.9e-43
AWV73268.1|1308879_1309299_-	hypothetical protein	NA	Q7Y4I2	Streptococcus_phage	67.9	1.1e-43
AWV73269.1|1309303_1309642_-	hypothetical protein	NA	A0A1P8BKC8	Lactococcus_phage	43.0	1.1e-12
AWV73270.1|1309644_1310538_-|capsid	phage major capsid protein	capsid	Q7Y4I4	Streptococcus_phage	62.7	6.3e-105
AWV73271.1|1310541_1311000_-	phage scaffold protein	NA	A0A141E167	Streptococcus_phage	53.4	1.2e-35
AWV73272.1|1311079_1312489_-|terminase	terminase	terminase	A0A1P8BMS5	Lactococcus_phage	75.9	2.4e-223
AWV73273.1|1312550_1312817_-	hypothetical protein	NA	Q5ULN6	Lactobacillus_virus	70.1	9.8e-30
AWV73274.1|1312858_1313635_-	hypothetical protein	NA	A0A1B1IMX1	Lactococcus_phage	63.3	2.0e-94
AWV73275.1|1313624_1314869_-	hypothetical protein	NA	O64275	Lactococcus_phage	74.6	3.1e-174
AWV73276.1|1314985_1315312_-	HNH endonuclease	NA	A0A1B1IMY5	Lactococcus_phage	72.6	9.5e-43
AWV73277.1|1315368_1315551_-	hypothetical protein	NA	NA	NA	NA	NA
AWV73278.1|1315691_1316408_-	hypothetical protein	NA	NA	NA	NA	NA
AWV73790.1|1316451_1316904_-	hypothetical protein	NA	Q2I8C1	Bacillus_phage	49.6	2.0e-27
AWV73279.1|1316992_1317415_-	single-stranded DNA-binding protein	NA	G4KNN8	Staphylococcus_phage	38.1	3.0e-20
AWV73280.1|1317401_1317581_-	hypothetical protein	NA	NA	NA	NA	NA
AWV73281.1|1317698_1317893_-	hypothetical protein	NA	NA	NA	NA	NA
AWV73282.1|1317889_1318129_-	hypothetical protein	NA	NA	NA	NA	NA
AWV73283.1|1318145_1318439_-	hypothetical protein	NA	NA	NA	NA	NA
AWV73284.1|1318461_1318764_-	hypothetical protein	NA	NA	NA	NA	NA
AWV73285.1|1318735_1319029_-	hypothetical protein	NA	NA	NA	NA	NA
AWV73286.1|1319292_1320075_-	hypothetical protein	NA	I2E8X7	Clostridium_phage	44.4	3.8e-45
AWV73791.1|1320354_1321050_-	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	51.5	1.3e-60
AWV73287.1|1321051_1321378_-	hypothetical protein	NA	NA	NA	NA	NA
AWV73288.1|1321374_1321557_-	hypothetical protein	NA	NA	NA	NA	NA
AWV73289.1|1321553_1321874_-	DUF771 domain-containing protein	NA	NA	NA	NA	NA
AWV73290.1|1321889_1322078_-	XRE family transcriptional regulator	NA	D2IZX1	Enterococcus_phage	58.1	7.0e-14
AWV73291.1|1322203_1322428_+	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	81.1	1.3e-27
AWV73292.1|1322762_1323023_-	hypothetical protein	NA	NA	NA	NA	NA
AWV73293.1|1323086_1323290_-	XRE family transcriptional regulator	NA	A0A1S7FZ25	Listeria_phage	43.9	3.6e-08
AWV73294.1|1323524_1323842_+	XRE family transcriptional regulator	NA	A0A059T6G1	Listeria_phage	48.1	3.2e-19
AWV73295.1|1323879_1324332_+	hypothetical protein	NA	R4IBK9	Listeria_phage	37.7	2.8e-16
AWV73296.1|1324434_1325868_+	hypothetical protein	NA	A0A0A8WJ41	Clostridium_phage	34.1	2.6e-20
AWV73297.1|1325970_1326564_+	DUF5067 domain-containing protein	NA	Q6SEF8	Lactobacillus_prophage	57.2	5.2e-39
AWV73298.1|1326678_1327806_+	hypothetical protein	NA	B4XYR4	Lactobacillus_phage	37.9	8.3e-70
>prophage 9
CP029966	Lactobacillus curvatus strain ZJUNIT8 chromosome, complete genome	1877486	1364882	1415528	1877486	bacteriocin,integrase,transposase,protease	Streptococcus_phage(21.43%)	44	1413422:1413441	1423227:1423246
AWV73333.1|1364882_1365821_+|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	34.4	1.8e-25
AWV73334.1|1366193_1367975_+	glycerophosphodiester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	23.6	1.5e-09
AWV73335.1|1368211_1369567_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AWV73336.1|1369726_1370155_+	hypothetical protein	NA	NA	NA	NA	NA
AWV73337.1|1370202_1370823_+	endonuclease III	NA	NA	NA	NA	NA
AWV73338.1|1370860_1371901_-	threonine ammonia-lyase	NA	A0A1W6JHY1	Lactococcus_phage	30.8	4.7e-11
AWV73339.1|1372116_1372449_+	hypothetical protein	NA	NA	NA	NA	NA
AWV73340.1|1372792_1373119_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AWV73341.1|1373273_1373456_-	hypothetical protein	NA	NA	NA	NA	NA
AWV73342.1|1373446_1373638_-	hypothetical protein	NA	NA	NA	NA	NA
AWV73343.1|1375760_1376054_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AWV73344.1|1376252_1376543_-	hypothetical protein	NA	NA	NA	NA	NA
AWV73345.1|1376686_1377316_+	glutathione S-transferase	NA	NA	NA	NA	NA
AWV73346.1|1377361_1377769_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
AWV73347.1|1377930_1379562_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWV73348.1|1380346_1380952_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AWV73349.1|1380948_1382073_-	hypothetical protein	NA	NA	NA	NA	NA
AWV73350.1|1382069_1382816_-	ABC transporter permease	NA	NA	NA	NA	NA
AWV73351.1|1382819_1383692_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.4	1.2e-18
AWV73352.1|1383834_1384476_+	3-methyladenine DNA glycosylase	NA	NA	NA	NA	NA
AWV73353.1|1384562_1385681_+	NAD(P)-dependent alcohol dehydrogenase	NA	M1PHA2	Moumouvirus	30.2	2.2e-14
AWV73354.1|1385956_1386811_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWV73355.1|1386987_1387725_-	zinc-binding alcohol dehydrogenase	NA	NA	NA	NA	NA
AWV73356.1|1387952_1388336_-	hypothetical protein	NA	NA	NA	NA	NA
AWV73357.1|1388446_1389400_-	nucleoside hydrolase	NA	NA	NA	NA	NA
AWV73358.1|1389537_1390509_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AWV73359.1|1394738_1395323_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	53.9	5.3e-52
AWV73360.1|1395444_1395963_+	DsbA family protein	NA	NA	NA	NA	NA
AWV73361.1|1396067_1396523_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWV73362.1|1396613_1397558_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	38.7	1.1e-51
AWV73363.1|1397560_1398595_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	54.8	1.5e-94
AWV73364.1|1398591_1399476_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	31.7	1.3e-09
AWV73365.1|1399677_1400214_-	hypothetical protein	NA	NA	NA	NA	NA
AWV73366.1|1400368_1403221_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	54.6	4.0e-302
AWV73367.1|1403233_1405237_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
AWV73368.1|1405653_1406286_-	HD domain-containing protein	NA	NA	NA	NA	NA
AWV73369.1|1406398_1408123_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	54.8	2.1e-181
AWV73370.1|1408501_1409422_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	51.5	3.7e-84
AWV73792.1|1409509_1409866_-	hypothetical protein	NA	NA	NA	NA	NA
AWV73371.1|1410031_1411060_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AWV73372.1|1411087_1411921_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AWV73373.1|1412287_1413229_-	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
1413422:1413441	attL	TGGCAAATTCTATAATTAAT	NA	NA	NA	NA
AWV73374.1|1413520_1414441_+|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.2	9.2e-51
AWV73375.1|1414940_1415528_+|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	33.2	5.7e-22
1423227:1423246	attR	ATTAATTATAGAATTTGCCA	NA	NA	NA	NA
>prophage 10
CP029966	Lactobacillus curvatus strain ZJUNIT8 chromosome, complete genome	1877486	1757275	1800913	1877486	transposase,head	Staphylococcus_prophage(27.27%)	40	NA	NA
AWV73655.1|1757275_1758196_+|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.2	9.2e-51
AWV73656.1|1758886_1759738_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AWV73657.1|1759752_1760232_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
AWV73658.1|1760279_1760660_-	hypothetical protein	NA	NA	NA	NA	NA
AWV73659.1|1761331_1761532_-	hypothetical protein	NA	NA	NA	NA	NA
AWV73660.1|1761625_1763032_+	dipeptidase	NA	NA	NA	NA	NA
AWV73807.1|1763224_1764067_+	hypothetical protein	NA	NA	NA	NA	NA
AWV73661.1|1765710_1766151_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
AWV73662.1|1766175_1766601_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
AWV73663.1|1766616_1766811_-	hypothetical protein	NA	NA	NA	NA	NA
AWV73664.1|1766816_1767365_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
AWV73665.1|1767383_1767635_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AWV73666.1|1767759_1768650_-	SDR family NAD(P)-dependent oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	46.2	5.2e-59
AWV73667.1|1768672_1769461_-	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
AWV73668.1|1769500_1769770_-	hypothetical protein	NA	NA	NA	NA	NA
AWV73669.1|1769966_1771640_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
AWV73670.1|1771717_1772662_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWV73671.1|1772658_1773513_-	metal ABC transporter permease	NA	NA	NA	NA	NA
AWV73672.1|1773509_1774250_-	metal ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	23.5	1.1e-09
AWV73673.1|1774900_1775188_+	hypothetical protein	NA	NA	NA	NA	NA
AWV73674.1|1775394_1775907_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AWV73675.1|1775903_1776755_-	sialate O-acetylesterase	NA	NA	NA	NA	NA
AWV73808.1|1776885_1777560_-	hypothetical protein	NA	NA	NA	NA	NA
AWV73676.1|1777743_1778664_+|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.2	9.2e-51
AWV73677.1|1779067_1779148_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AWV73678.1|1779174_1780104_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	33.3	1.8e-25
AWV73679.1|1780113_1780266_-	hypothetical protein	NA	NA	NA	NA	NA
AWV73680.1|1780258_1782916_-	helicase SNF2	NA	I3VYY6	Thermoanaerobacterium_phage	23.2	1.8e-22
AWV73681.1|1782912_1784172_-	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
AWV73682.1|1784340_1785270_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	34.4	3.0e-25
AWV73683.1|1785515_1785845_-	FRG domain-containing protein	NA	NA	NA	NA	NA
AWV73684.1|1786026_1787313_-	DNA (cytosine-5-)-methyltransferase	NA	A0A141E0F9	Streptococcus_phage	38.4	3.5e-24
AWV73685.1|1787441_1788914_+	restriction endonuclease	NA	NA	NA	NA	NA
AWV73686.1|1791816_1794084_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	31.1	2.3e-127
AWV73687.1|1794331_1794919_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.5	1.3e-18
AWV73688.1|1794991_1795708_+|head	phage head morphogenesis protein	head	NA	NA	NA	NA
AWV73689.1|1795826_1796075_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AWV73690.1|1796422_1796665_+	hypothetical protein	NA	NA	NA	NA	NA
AWV73691.1|1797223_1799941_+	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
AWV73692.1|1799992_1800913_-|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.2	9.2e-51
