The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP021963	Citrobacter youngae strain L6 chromosome, complete genome	4945156	1749278	1757845	4945156	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
AWV26259.1|1749278_1750226_+	ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	25.3	1.7e-07
AWV26260.1|1750209_1750941_+	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AWV26261.1|1750921_1751029_-	hypothetical protein	NA	NA	NA	NA	NA
AWV26262.1|1751228_1751960_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	93.0	1.5e-104
AWV26263.1|1752185_1753871_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	2.1e-279
AWV26264.1|1753867_1754587_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AWV29161.1|1754633_1755104_+	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	77.4	1.8e-63
AWV26265.1|1755147_1755606_-	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	69.9	3.2e-52
AWV26266.1|1755811_1757845_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	2.0e-53
>prophage 2
CP021963	Citrobacter youngae strain L6 chromosome, complete genome	4945156	1798862	1808440	4945156	protease	Bacillus_phage(28.57%)	8	NA	NA
AWV26305.1|1798862_1800809_+	macrolide ABC transporter permease/ATP-binding protein MacB	NA	G9BWD6	Planktothrix_phage	42.2	3.7e-41
AWV26306.1|1800883_1801108_-	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
AWV26307.1|1801431_1801752_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
AWV26308.1|1801782_1804059_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	1.4e-164
AWV26309.1|1804328_1805690_-	U32 family peptidase	NA	Q6DW11	Phage_TP	92.9	5.3e-204
AWV26310.1|1805849_1806182_-	hypothetical protein	NA	NA	NA	NA	NA
AWV26311.1|1806317_1807040_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	32.7	9.2e-30
AWV26312.1|1807036_1808440_-	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	29.2	2.3e-32
>prophage 3
CP021963	Citrobacter youngae strain L6 chromosome, complete genome	4945156	1851832	1860830	4945156		Bacillus_phage(33.33%)	8	NA	NA
AWV26343.1|1851832_1852828_+	UDP-N-acetylglucosamine 4-epimerase	NA	A0A0K1L6Z1	Scale_drop_disease_virus	28.5	6.6e-10
AWV26344.1|1853065_1853959_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	40.9	4.8e-44
AWV26345.1|1854379_1855408_+	glycosyl transferase	NA	NA	NA	NA	NA
AWV26346.1|1855418_1856537_+	GDP-mannose 4,6-dehydratase	NA	M1HVG7	Acanthocystis_turfacea_Chlorella_virus	64.7	3.1e-133
AWV26347.1|1856540_1857506_+	GDP-fucose synthetase	NA	D1LW79	Prochlorococcus_phage	50.5	1.2e-85
AWV26348.1|1857508_1858009_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
AWV26349.1|1858001_1859450_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	32.4	1.0e-56
AWV26350.1|1859453_1860830_+	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	26.4	1.2e-30
>prophage 4
CP021963	Citrobacter youngae strain L6 chromosome, complete genome	4945156	2743958	2753966	4945156	tRNA	Brazilian_cedratvirus(28.57%)	10	NA	NA
AWV27166.1|2743958_2744738_+	heme ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.9	1.3e-10
AWV27167.1|2744734_2746177_-	hypothetical protein	NA	A0A075BSJ0	Microcystis_phage	35.3	2.2e-51
AWV27168.1|2746238_2746952_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AWV27169.1|2747270_2747735_-	endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.2	3.5e-14
AWV27170.1|2747812_2748562_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.3	9.3e-09
AWV27171.1|2748561_2749113_-	glutathione peroxidase	NA	NA	NA	NA	NA
AWV27172.1|2749173_2750154_-	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.8	6.7e-15
AWV27173.1|2750275_2750575_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AWV27174.1|2750579_2752967_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AWV27175.1|2752982_2753966_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
>prophage 5
CP021963	Citrobacter youngae strain L6 chromosome, complete genome	4945156	3115749	3207170	4945156	head,capsid,portal,tRNA,tail,plate,integrase,transposase	Salmonella_phage(66.67%)	94	3145136:3145160	3180343:3180367
AWV27507.1|3115749_3117042_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.0	4.3e-94
AWV27508.1|3117134_3118478_-	recombination factor protein RarA	NA	G3MBE0	Bacillus_virus	41.0	1.9e-81
AWV27509.1|3118488_3119100_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AWV27510.1|3119211_3123276_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.2	2.9e-88
AWV27511.1|3123410_3123905_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AWV27512.1|3124452_3125421_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.3	1.9e-62
AWV27513.1|3125535_3127302_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	23.3	2.7e-22
AWV27514.1|3127302_3129024_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	23.6	2.4e-15
AWV27515.1|3129068_3129773_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AWV27516.1|3130058_3130277_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AWV27517.1|3130356_3131268_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWV27518.1|3131376_3132237_+	quercetin 2,3-dioxygenase	NA	NA	NA	NA	NA
AWV27519.1|3132253_3132931_+	amidohydrolase	NA	NA	NA	NA	NA
AWV27520.1|3133318_3134446_-	23S rRNA (uracil(747)-C(5))-methyltransferase	NA	A0A1X9I6F4	Streptococcus_phage	27.7	5.5e-29
AWV27521.1|3134487_3134976_-	hypothetical protein	NA	NA	NA	NA	NA
AWV27522.1|3135035_3135881_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AWV27523.1|3135877_3136831_-	putrescine ABC transporter permease	NA	NA	NA	NA	NA
AWV27524.1|3136840_3137974_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.9	1.1e-29
AWV27525.1|3138112_3139225_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AWV27526.1|3139658_3140135_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
AWV27527.1|3140225_3141128_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	33.6	4.4e-37
AWV27528.1|3141187_3141910_-	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
AWV27529.1|3141893_3142184_-	hypothetical protein	NA	NA	NA	NA	NA
AWV27530.1|3142356_3142620_+	glutaredoxin, GrxA family	NA	A0A2I7SAE2	Vibrio_phage	66.7	1.5e-25
AWV27531.1|3142654_3143035_-	hypothetical protein	NA	NA	NA	NA	NA
AWV27532.1|3143304_3144990_+	transporter	NA	NA	NA	NA	NA
3145136:3145160	attL	ATGGGTTTTTTGTTGCCTGAAATTT	NA	NA	NA	NA
AWV27533.1|3145279_3145495_-	late control protein B	NA	Q53ZE7	Salmonella_virus	69.4	7.9e-22
AWV27534.1|3145562_3146663_-	late control protein D	NA	E5G6Q3	Salmonella_phage	94.3	1.1e-188
AWV27535.1|3146659_3147145_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	95.4	2.5e-63
AWV27536.1|3147141_3150207_-|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	78.6	0.0e+00
AWV27537.1|3150199_3150319_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	97.4	6.7e-15
AWV27538.1|3150333_3150636_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	97.0	6.1e-44
AWV27539.1|3150690_3151206_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	97.1	1.1e-90
AWV27540.1|3151215_3152388_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	93.6	9.5e-210
AWV27541.1|3152654_3153719_+	hypothetical protein	NA	NA	NA	NA	NA
AWV27542.1|3153750_3154116_-|tail	phage tail protein	tail	A0A0M4S6V4	Salmonella_phage	61.9	2.6e-33
AWV27543.1|3155713_3156319_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	97.5	7.8e-115
AWV27544.1|3156311_3157220_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	93.7	9.5e-149
AWV27545.1|3157206_3157566_-|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	95.0	2.6e-57
AWV27546.1|3157562_3158141_-|plate	baseplate assembly protein	plate	E5G6N6	Salmonella_phage	92.2	8.0e-101
AWV27547.1|3158217_3159378_+	hypothetical protein	NA	NA	NA	NA	NA
AWV27548.1|3159355_3159802_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	83.1	2.4e-60
AWV27549.1|3159794_3160226_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	92.3	3.2e-70
AWV27550.1|3160191_3160392_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	86.4	3.8e-26
AWV27551.1|3160321_3160750_-	hypothetical protein	NA	A0A1S6KZX8	Salmonella_phage	87.1	6.2e-58
AWV27552.1|3160746_3161262_-	glycoside hydrolase	NA	E5G6N1	Salmonella_phage	78.8	1.9e-74
AWV27553.1|3161242_3161458_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	97.2	8.5e-32
AWV27554.1|3161461_3161665_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	94.0	2.1e-32
AWV27555.1|3161664_3162129_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	94.2	7.4e-81
AWV27556.1|3162222_3162873_-	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	97.7	6.0e-113
AWV27557.1|3162876_3163974_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	90.1	2.6e-177
AWV27558.1|3163990_3164824_-|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	92.4	9.1e-122
AWV27559.1|3164966_3166733_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	95.1	0.0e+00
AWV27560.1|3166732_3167767_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	91.0	3.7e-173
AWV27561.1|3167811_3169572_-	ribonuclease H	NA	NA	NA	NA	NA
AWV27562.1|3170037_3170226_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	91.7	5.7e-24
AWV27563.1|3170363_3170591_+	hypothetical protein	NA	NA	NA	NA	NA
AWV27564.1|3170610_3173019_-	endonuclease	NA	A0A1S6L028	Salmonella_phage	95.1	0.0e+00
AWV27565.1|3173009_3173867_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	81.4	6.4e-131
AWV27566.1|3173863_3174091_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	90.7	4.3e-34
AWV27567.1|3174090_3174324_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	93.5	1.2e-31
AWV29219.1|3174391_3174733_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	86.7	6.4e-50
AWV27568.1|3174811_3175060_+	hypothetical protein	NA	NA	NA	NA	NA
AWV27569.1|3175103_3175439_-	fil domain protein	NA	A0A1S6L005	Salmonella_phage	89.3	4.6e-24
AWV27570.1|3175446_3175956_-	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	92.9	1.6e-81
AWV27571.1|3175988_3176210_-	regulator	NA	NA	NA	NA	NA
AWV27572.1|3176335_3176896_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	46.4	1.2e-40
AWV27573.1|3176969_3178247_+	hypothetical protein	NA	NA	NA	NA	NA
AWV27574.1|3178330_3179350_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	56.4	1.0e-103
AWV27575.1|3180469_3181267_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
3180343:3180367	attR	ATGGGTTTTTTGTTGCCTGAAATTT	NA	NA	NA	NA
AWV27576.1|3181253_3181814_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AWV27577.1|3181899_3183108_+	MFS transporter	NA	NA	NA	NA	NA
AWV27578.1|3183107_3183923_+	sugar-phosphatase	NA	NA	NA	NA	NA
AWV27579.1|3184030_3184312_+	hypothetical protein	NA	NA	NA	NA	NA
AWV27580.1|3184529_3185762_-	multidrug transporter MdfA	NA	NA	NA	NA	NA
AWV27581.1|3186059_3186668_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
AWV27582.1|3186732_3187491_+	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	28.3	3.3e-14
AWV29220.1|3187536_3188739_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.1	2.9e-97
AWV27583.1|3189067_3189694_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
AWV27584.1|3189699_3190797_-	oxidoreductase	NA	NA	NA	NA	NA
AWV27585.1|3190899_3191283_-	transcriptional regulator	NA	NA	NA	NA	NA
AWV27586.1|3191503_3192430_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWV27587.1|3192462_3194913_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	74.6	1.3e-22
AWV27588.1|3194964_3195162_-	glycine cleavage system protein T	NA	NA	NA	NA	NA
AWV27589.1|3195381_3196689_+	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
AWV27590.1|3196781_3197693_-	glutathione ABC transporter permease GsiD	NA	NA	NA	NA	NA
AWV27591.1|3197695_3198616_-	glutathione ABC transporter permease GsiC	NA	NA	NA	NA	NA
AWV27592.1|3198662_3200201_-	glutathione ABC transporter substrate-binding protein GsiB	NA	NA	NA	NA	NA
AWV27593.1|3200229_3202101_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.1	1.1e-13
AWV27594.1|3202087_3203053_-	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
AWV27595.1|3203244_3204033_-	aminoglycoside resistance protein	NA	NA	NA	NA	NA
AWV27596.1|3204207_3205443_+	molybdopterin molybdenumtransferase MoeA	NA	NA	NA	NA	NA
AWV27597.1|3205442_3206192_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
AWV27598.1|3206240_3207170_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	48.3	3.0e-65
>prophage 6
CP021963	Citrobacter youngae strain L6 chromosome, complete genome	4945156	3220965	3248057	4945156	head,capsid,terminase,portal,tail,holin	Cronobacter_phage(87.5%)	37	NA	NA
AWV27608.1|3220965_3222669_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	80.2	1.5e-224
AWV27609.1|3222668_3223214_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	7.4e-64
AWV27610.1|3223185_3223911_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	53.9	8.9e-65
AWV27611.1|3223900_3224437_-|tail	phage tail protein	tail	F1BUK2	Cronobacter_phage	37.0	2.4e-22
AWV27612.1|3224448_3226545_-|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	77.8	1.0e-145
AWV27613.1|3226555_3227149_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	3.1e-92
AWV27614.1|3227135_3228320_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	81.4	2.6e-183
AWV27615.1|3228316_3228646_-	hypothetical protein	NA	F1BUK8	Cronobacter_phage	68.8	9.3e-38
AWV27616.1|3228642_3230703_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	69.5	5.3e-272
AWV27617.1|3230890_3231157_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	57.3	3.0e-18
AWV27618.1|3231134_3231323_-	hypothetical protein	NA	F1BUL1	Cronobacter_phage	75.8	2.0e-21
AWV27619.1|3231252_3231633_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	64.0	1.8e-29
AWV27620.1|3231632_3231974_-	hypothetical protein	NA	F1BUL3	Cronobacter_phage	94.1	6.9e-52
AWV27621.1|3231960_3232263_-|holin	holin	holin	A0A0M5M1H1	Salmonella_phage	55.3	1.4e-19
AWV27622.1|3232273_3232729_-|tail	phage tail protein	tail	F1BUL4	Cronobacter_phage	72.8	5.9e-59
AWV27623.1|3232725_3233853_-|tail	phage tail protein	tail	F1BUL5	Cronobacter_phage	81.6	3.1e-173
AWV27624.1|3233849_3234557_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	75.2	1.4e-99
AWV27625.1|3234553_3235060_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	68.7	6.2e-65
AWV27626.1|3235056_3235560_-|head	head completion protein	head	F1BUL8	Cronobacter_phage	82.7	1.2e-63
AWV27627.1|3235605_3236307_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	69.4	1.2e-90
AWV27628.1|3236310_3237333_-|capsid	major capsid protein	capsid	F1BUM2	Cronobacter_phage	81.8	1.0e-159
AWV27629.1|3237394_3238198_-|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	56.8	1.3e-80
AWV27630.1|3238359_3240135_+|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	86.3	4.2e-294
AWV27631.1|3240131_3241193_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.8	7.9e-163
AWV27632.1|3241189_3241513_+	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	93.3	4.7e-50
AWV27633.1|3241486_3241693_-	hypothetical protein	NA	NA	NA	NA	NA
AWV27634.1|3241812_3243828_-	replication protein A	NA	F1BUM9	Cronobacter_phage	75.0	2.2e-299
AWV27635.1|3243829_3244042_-	hypothetical protein	NA	NA	NA	NA	NA
AWV27636.1|3244038_3244908_-	adenine methylase	NA	F1BUN1	Cronobacter_phage	81.7	1.3e-131
AWV27637.1|3244897_3245227_-	hypothetical protein	NA	Q7Y4B7	Escherichia_virus	46.4	6.7e-12
AWV27638.1|3245217_3245451_-	hypothetical protein	NA	NA	NA	NA	NA
AWV27639.1|3245518_3245920_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	67.7	2.0e-50
AWV27640.1|3245919_3246348_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	53.3	1.6e-26
AWV27641.1|3246337_3246565_-	hypothetical protein	NA	NA	NA	NA	NA
AWV27642.1|3246574_3247078_-	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	4.5e-60
AWV27643.1|3247108_3247330_-	regulator	NA	NA	NA	NA	NA
AWV27644.1|3247475_3248057_+	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	39.6	1.8e-31
