The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP021326	Acinetobacter baumannii strain XH386 chromosome, complete genome	4108882	1153189	1167995	4108882		Acinetobacter_phage(100.0%)	10	NA	NA
AWW80501.1|1153189_1153744_-	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	100.0	2.7e-98
AWW80502.1|1154000_1155500_+	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	100.0	6.1e-286
AWW80503.1|1155501_1157877_+	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	100.0	0.0e+00
AWW80504.1|1157883_1158867_+	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	100.0	2.0e-189
AWW80505.1|1158877_1159573_-	DNA mismatch repair protein MutS	NA	A0A0P0IDT4	Acinetobacter_phage	100.0	5.8e-122
AWW80506.1|1159582_1160389_-	indole-3-glycerol-phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	100.0	7.9e-147
AWW83276.1|1160398_1161448_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	100.0	9.8e-190
AWW80507.1|1161803_1164536_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	99.9	0.0e+00
AWW80508.1|1164615_1167315_+	aminopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	100.0	0.0e+00
AWW80509.1|1167410_1167995_-	glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	100.0	1.7e-111
>prophage 2
CP021326	Acinetobacter baumannii strain XH386 chromosome, complete genome	4108882	1271512	1313204	4108882	head,plate,integrase,transposase,terminase	Acinetobacter_phage(93.44%)	65	1271494:1271510	1313289:1313305
1271494:1271510	attL	CACCAAATCTACACCAA	NA	NA	NA	NA
AWW80603.1|1271512_1272532_+|integrase	integrase	integrase	A0A0R6PHH4	Moraxella_phage	43.1	3.2e-68
AWW80604.1|1272528_1272819_-	DNA-binding protein	NA	NA	NA	NA	NA
AWW80605.1|1272819_1273089_-	hypothetical protein	NA	A0A172Q0P4	Acinetobacter_phage	57.3	3.9e-18
AWW80606.1|1273090_1273591_-	adenine methyltransferase	NA	A0A0C5AN16	Bacteriophage	62.0	1.5e-47
AWW80607.1|1273587_1274025_-	hypothetical protein	NA	A0A1B1P9F6	Acinetobacter_phage	84.5	7.0e-33
AWW83278.1|1274029_1274398_-	hypothetical protein	NA	A0A1B1P9I4	Acinetobacter_phage	96.7	2.2e-64
AWW80608.1|1274408_1275287_-	hypothetical protein	NA	A0A1B1P9H8	Acinetobacter_phage	97.9	1.2e-145
AWW80609.1|1275289_1275604_-	hypothetical protein	NA	A0A1B1P9H1	Acinetobacter_phage	94.2	1.2e-53
AWW80610.1|1275611_1275821_-	hypothetical protein	NA	A0A1B1P9G5	Acinetobacter_phage	95.7	3.8e-29
AWW80611.1|1275885_1276650_-	hypothetical protein	NA	I2GUJ1	Acinetobacter_phage	66.2	6.4e-90
AWW80612.1|1276642_1276906_-	hypothetical protein	NA	NA	NA	NA	NA
AWW80613.1|1276905_1277097_-	hypothetical protein	NA	A0A1B1P9G9	Acinetobacter_phage	68.2	1.1e-14
AWW80614.1|1277303_1277807_-	hypothetical protein	NA	A0A0P0I896	Acinetobacter_phage	82.6	1.2e-65
AWW80615.1|1277809_1278811_-	hypothetical protein	NA	A0A0P0IRH5	Acinetobacter_phage	100.0	4.2e-182
AWW80616.1|1278861_1279077_-	hypothetical protein	NA	A0A0P0I8I5	Acinetobacter_phage	98.6	1.6e-30
AWW83279.1|1279097_1279760_-	LexA family transcriptional regulator	NA	A0A0P0IYD9	Acinetobacter_phage	96.8	2.0e-116
AWW80617.1|1279873_1280074_+	transcriptional regulator	NA	A0A0P0IKT3	Acinetobacter_phage	100.0	3.5e-32
AWW80618.1|1280084_1280405_+	transcriptional regulator	NA	A0A0P0HSE9	Acinetobacter_phage	87.7	1.2e-42
AWW80619.1|1280460_1280751_+	hypothetical protein	NA	NA	NA	NA	NA
AWW80620.1|1280747_1281794_+	site-specific DNA-methyltransferase	NA	A0A1B0VM49	Pseudomonas_phage	57.9	1.7e-109
AWW80621.1|1281790_1282741_+	hypothetical protein	NA	A0A0P0I481	Acinetobacter_phage	64.2	2.9e-100
AWW80622.1|1282733_1283483_+	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	100.0	9.6e-139
AWW80623.1|1283479_1283902_+	hypothetical protein	NA	A0A0P0IKW4	Acinetobacter_phage	100.0	2.9e-76
AWW80624.1|1283891_1284314_+	hypothetical protein	NA	A0A0N7IRE2	Acinetobacter_phage	100.0	8.4e-84
AWW80625.1|1284306_1284531_+	hypothetical protein	NA	A0A0P0IY41	Acinetobacter_phage	100.0	9.4e-34
AWW80626.1|1284530_1284926_+	hypothetical protein	NA	A0A0P0I8E8	Acinetobacter_phage	100.0	1.6e-68
AWW80627.1|1284922_1285423_+	hypothetical protein	NA	A0A0P0IY98	Acinetobacter_phage	100.0	3.1e-93
AWW80628.1|1285618_1286269_+	hypothetical protein	NA	A0A0P0IKQ5	Acinetobacter_phage	99.5	2.1e-94
AWW80629.1|1286530_1287289_+	hypothetical protein	NA	A0A0P0J0C5	Acinetobacter_phage	100.0	2.9e-143
AWW80630.1|1287383_1288031_+|transposase	transposase	transposase	A0A0N7IRF1	Acinetobacter_phage	100.0	5.0e-128
AWW80631.1|1288078_1288588_+	hypothetical protein	NA	A0A0P0HSK4	Acinetobacter_phage	100.0	1.2e-89
AWW80632.1|1288584_1290243_+|terminase	terminase	terminase	A0A0P0IVT4	Acinetobacter_phage	100.0	0.0e+00
AWW80633.1|1290253_1291666_+	hypothetical protein	NA	A0A0P0I486	Acinetobacter_phage	100.0	4.6e-259
AWW80634.1|1291688_1292324_+|head	phage head morphogenesis protein	head	A0A0P0IKX5	Acinetobacter_phage	100.0	7.1e-119
AWW80635.1|1292385_1292472_+	DUF2158 domain-containing protein	NA	A0A0P0IE05	Acinetobacter_phage	100.0	2.6e-08
AWW80636.1|1292612_1293929_+	hypothetical protein	NA	A0A0P0IRE1	Acinetobacter_phage	100.0	3.5e-213
AWW80637.1|1293932_1294409_+	hypothetical protein	NA	A0A0P0I8F3	Acinetobacter_phage	100.0	3.0e-85
AWW80638.1|1294473_1295499_+	hypothetical protein	NA	A0A0N7IRF2	Acinetobacter_phage	100.0	1.7e-194
AWW80639.1|1295508_1295940_+	hypothetical protein	NA	A0A0P0IYA6	Acinetobacter_phage	100.0	8.1e-58
AWW80640.1|1295943_1296330_+	DUF4054 domain-containing protein	NA	A0A0P0IKR4	Acinetobacter_phage	100.0	2.3e-67
AWW80641.1|1296326_1296887_+	hypothetical protein	NA	A0A0P0J0D1	Acinetobacter_phage	100.0	5.2e-97
AWW80642.1|1296873_1297242_+	hypothetical protein	NA	A0A0P0HSK8	Acinetobacter_phage	100.0	5.9e-65
AWW80643.1|1297244_1297784_+	hypothetical protein	NA	A0A0P0IVT9	Acinetobacter_phage	100.0	3.3e-101
AWW80644.1|1297787_1299263_+	hypothetical protein	NA	A0A0P0I492	Acinetobacter_phage	100.0	3.7e-275
AWW80645.1|1299277_1299721_+	hypothetical protein	NA	A0A0P0IKY2	Acinetobacter_phage	99.3	9.5e-78
AWW80646.1|1299720_1300185_+	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	66.2	4.2e-52
AWW83280.1|1300181_1300373_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	49.0	4.2e-06
AWW80647.1|1300380_1302405_+	hypothetical protein	NA	A0A0P0IE11	Acinetobacter_phage	99.1	0.0e+00
AWW80648.1|1302401_1302758_-	hypothetical protein	NA	A0A0P0IRF2	Acinetobacter_phage	99.2	1.3e-61
AWW80649.1|1302757_1302985_-	hypothetical protein	NA	A0A0P0I8G2	Acinetobacter_phage	100.0	1.5e-31
AWW80650.1|1302989_1303178_+	hypothetical protein	NA	A0A0P0IYB4	Acinetobacter_phage	100.0	6.5e-28
AWW80651.1|1303344_1303941_+	hypothetical protein	NA	A0A0P0IKS1	Acinetobacter_phage	100.0	7.9e-104
AWW80652.1|1303943_1304240_+	hypothetical protein	NA	A0A0P0J0D9	Acinetobacter_phage	90.8	3.7e-46
AWW80653.1|1304236_1305196_+	hypothetical protein	NA	A0A0P0HSL6	Acinetobacter_phage	99.1	2.2e-180
AWW80654.1|1305198_1305861_+	hypothetical protein	NA	A0A0N7IRF4	Acinetobacter_phage	99.5	2.0e-127
AWW80655.1|1305895_1306249_+	hypothetical protein	NA	A0A0P0IVU6	Acinetobacter_phage	99.1	6.9e-63
AWW80656.1|1306251_1307436_+|plate	phage baseplate protein	plate	A0A0P0I499	Acinetobacter_phage	99.7	3.5e-220
AWW80657.1|1307435_1308026_+	hypothetical protein	NA	A0A0P0IKZ0	Acinetobacter_phage	92.9	3.5e-104
AWW80658.1|1308018_1308627_+	hypothetical protein	NA	A0A0P0IE19	Acinetobacter_phage	98.5	2.6e-110
AWW80659.1|1308690_1310745_+	hypothetical protein	NA	A0A0P0IRG3	Acinetobacter_phage	96.3	0.0e+00
AWW80660.1|1310746_1310974_+	hypothetical protein	NA	A0A0P0I8G9	Acinetobacter_phage	96.0	5.6e-34
AWW80661.1|1311051_1311441_+	hypothetical protein	NA	A0A0P0IYC0	Acinetobacter_phage	100.0	1.1e-66
AWW80662.1|1311483_1312026_+	hypothetical protein	NA	A0A0N7IRF5	Acinetobacter_phage	92.2	1.6e-95
AWW80663.1|1312194_1312716_-	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
AWW80664.1|1313012_1313204_+	hypothetical protein	NA	A0A1B1P9F8	Acinetobacter_phage	93.5	1.1e-27
1313289:1313305	attR	CACCAAATCTACACCAA	NA	NA	NA	NA
>prophage 3
CP021326	Acinetobacter baumannii strain XH386 chromosome, complete genome	4108882	1372982	1391110	4108882	integrase,transposase	Escherichia_phage(25.0%)	18	1372920:1372979	1393059:1393878
1372920:1372979	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
AWW80722.1|1372982_1373687_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AWW80723.1|1373940_1374756_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
AWW80724.1|1374868_1375573_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AWW80725.1|1375463_1376423_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.3e-47
AWW80726.1|1376602_1377157_+	aminoglycoside N-acetyltransferase AAC(6')-Ib'	NA	NA	NA	NA	NA
AWW83281.1|1377249_1377882_+	type B-3 chloramphenicol O-acetyltransferase CatB8	NA	A0A2R8FE91	Brazilian_cedratvirus	40.1	3.5e-25
AWW80727.1|1377939_1378731_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AWW80728.1|1378894_1379242_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AWW80729.1|1379235_1380075_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
AWW80730.1|1380479_1382021_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AWW83282.1|1383419_1384193_+	ArmA family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
AWW80731.1|1384173_1384455_-	hypothetical protein	NA	NA	NA	NA	NA
AWW80732.1|1384674_1384860_-	hypothetical protein	NA	NA	NA	NA	NA
AWW80733.1|1384908_1386093_+|transposase	IS4 family transposase ISEc29	transposase	A0A0F7LAS3	uncultured_marine_virus	35.4	4.5e-50
AWW80734.1|1386491_1387967_+	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
AWW80735.1|1388022_1388907_+	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AWW80736.1|1389265_1389487_-	hypothetical protein	NA	NA	NA	NA	NA
AWW80737.1|1389550_1391110_-|transposase	IS66 family transposase ISAba24	transposase	S5VTD3	Leptospira_phage	34.2	4.0e-70
1393059:1393878	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCAACGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
>prophage 4
CP021326	Acinetobacter baumannii strain XH386 chromosome, complete genome	4108882	1556935	1623443	4108882	holin,head,integrase,capsid,tail,terminase	Acinetobacter_phage(96.55%)	82	1560947:1560962	1597074:1597089
AWW80879.1|1556935_1559164_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
AWW80880.1|1559212_1559647_-	thioesterase	NA	NA	NA	NA	NA
AWW80881.1|1559646_1560804_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
1560947:1560962	attL	TTTTCAAAATCATTAA	NA	NA	NA	NA
AWW83288.1|1561029_1562274_+	lactonase	NA	NA	NA	NA	NA
AWW80882.1|1562574_1563078_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
AWW83289.1|1563097_1564132_+	UDP-N-acetylenolpyruvoylglucosamine reductase	NA	NA	NA	NA	NA
AWW80883.1|1564136_1565267_+	hypothetical protein	NA	NA	NA	NA	NA
AWW80884.1|1565266_1566295_+	lysophospholipase	NA	NA	NA	NA	NA
AWW80885.1|1566336_1568010_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
AWW80886.1|1568174_1569512_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
AWW80887.1|1570122_1570695_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWW80888.1|1571018_1571882_+	hypothetical protein	NA	NA	NA	NA	NA
AWW80889.1|1572382_1573645_+|integrase	integrase	integrase	A0A0P0IKP2	Acinetobacter_phage	99.3	1.6e-247
AWW80890.1|1573650_1573920_-	DNA-binding protein	NA	A0A0N7IRE8	Acinetobacter_phage	100.0	3.5e-43
AWW80891.1|1573920_1574178_-	hypothetical protein	NA	A0A0P0J0B1	Acinetobacter_phage	94.1	4.7e-45
AWW80892.1|1574181_1574466_-	hypothetical protein	NA	A0A0P0HSI5	Acinetobacter_phage	94.7	1.7e-43
AWW80893.1|1574462_1574672_-	hypothetical protein	NA	A0A0P0IVS1	Acinetobacter_phage	98.6	6.3e-32
AWW80894.1|1574674_1574920_-	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	98.8	3.3e-40
AWW80895.1|1574921_1575998_-	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	75.4	6.0e-142
AWW80896.1|1575994_1577116_-	AAA family ATPase	NA	A0A0D4DBX7	Acinetobacter_phage	99.7	1.3e-211
AWW80897.1|1577126_1577450_-	hypothetical protein	NA	A0A0P0IVW1	Acinetobacter_phage	79.4	1.5e-43
AWW80898.1|1577442_1577892_-	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	95.9	5.5e-73
AWW80899.1|1578094_1578961_-	hypothetical protein	NA	NA	NA	NA	NA
AWW80900.1|1578961_1579852_-	hypothetical protein	NA	NA	NA	NA	NA
AWW80901.1|1579924_1580614_-	geranylgeranyl reductase	NA	A0A2H4JAJ5	uncultured_Caudovirales_phage	73.1	5.3e-59
AWW80902.1|1580741_1580918_+	hypothetical protein	NA	NA	NA	NA	NA
AWW80903.1|1580914_1581178_+	hypothetical protein	NA	NA	NA	NA	NA
AWW80904.1|1581221_1581512_+	hypothetical protein	NA	NA	NA	NA	NA
AWW80905.1|1581508_1582555_+	site-specific DNA-methyltransferase	NA	A0A1B0VM49	Pseudomonas_phage	57.9	1.7e-109
AWW80906.1|1582551_1583502_+	hypothetical protein	NA	A0A0P0I481	Acinetobacter_phage	63.3	1.6e-98
AWW80907.1|1583494_1584244_+	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	98.4	1.2e-136
AWW80908.1|1584361_1584784_+	hypothetical protein	NA	A0A0P0I8A5	Acinetobacter_phage	100.0	1.0e-76
AWW80909.1|1584773_1585196_+	hypothetical protein	NA	A0A1X9SFD6	Acinetobacter_phage	100.0	1.1e-83
AWW80910.1|1585188_1585413_+	hypothetical protein	NA	A0A0P0IY41	Acinetobacter_phage	100.0	9.4e-34
AWW80911.1|1585412_1585808_+	hypothetical protein	NA	A0A0P0I8E8	Acinetobacter_phage	100.0	1.6e-68
AWW80912.1|1585804_1586305_+	hypothetical protein	NA	A0A0P0IY98	Acinetobacter_phage	100.0	3.1e-93
AWW80913.1|1586500_1587151_+	hypothetical protein	NA	A0A0P0IKQ5	Acinetobacter_phage	99.5	2.1e-94
AWW80914.1|1587412_1588171_+	hypothetical protein	NA	A0A0P0J0C5	Acinetobacter_phage	100.0	2.9e-143
AWW83290.1|1588304_1588907_+	hypothetical protein	NA	J7I4N9	Acinetobacter_phage	75.0	1.4e-84
AWW80915.1|1588965_1589436_+	hypothetical protein	NA	A0A0D4DC15	Acinetobacter_phage	100.0	3.0e-82
AWW80916.1|1589425_1590853_+|terminase	terminase	terminase	A0A0D4DCE6	Acinetobacter_phage	94.7	3.2e-260
AWW80917.1|1590849_1592301_+	hypothetical protein	NA	A0A0D4DCP1	Acinetobacter_phage	97.9	6.8e-282
AWW80918.1|1592302_1593406_+|head	phage head morphogenesis protein	head	A0A0D4DBL9	Acinetobacter_phage	98.6	4.3e-204
AWW80919.1|1593414_1593843_+	hypothetical protein	NA	J7I4P3	Acinetobacter_phage	98.6	7.5e-72
AWW80920.1|1593941_1594184_+	hypothetical protein	NA	A0A0P0IY55	Acinetobacter_phage	98.8	6.2e-39
AWW80921.1|1594403_1594595_+	hypothetical protein	NA	A0A0P0IKM2	Acinetobacter_phage	98.4	1.5e-27
AWW80922.1|1594708_1595476_+	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	100.0	4.6e-120
AWW80923.1|1595503_1596460_+|capsid	phage capsid protein	capsid	A0A0D4DBM4	Acinetobacter_phage	100.0	2.1e-178
AWW80924.1|1596526_1597192_+	stress-responsive nuclear envelope protein	NA	J7I4P7	Acinetobacter_phage	74.7	1.1e-80
1597074:1597089	attR	TTAATGATTTTGAAAA	NA	NA	NA	NA
AWW80925.1|1597196_1597586_+	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	94.6	2.6e-63
AWW80926.1|1597587_1597959_+	glutamate 5-kinase	NA	A0A0P0I456	Acinetobacter_phage	94.3	2.7e-62
AWW80927.1|1598014_1598953_+	hypothetical protein	NA	NA	NA	NA	NA
AWW80928.1|1598997_1599405_+	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	73.9	8.2e-52
AWW83291.1|1599376_1599745_+	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	84.4	8.8e-53
AWW80929.1|1599746_1600145_+	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	98.5	5.3e-72
AWW80930.1|1600146_1600365_+	hypothetical protein	NA	A0A0P0I8C2	Acinetobacter_phage	94.4	9.5e-31
AWW80931.1|1600423_1600777_+	hypothetical protein	NA	J7I469	Acinetobacter_phage	99.1	1.6e-59
AWW80932.1|1600776_1602132_+|tail	phage tail protein	tail	A0A0N7IRE5	Acinetobacter_phage	98.2	1.2e-200
AWW80933.1|1602184_1603102_+	hypothetical protein	NA	A0A0P0IL42	Acinetobacter_phage	96.4	7.3e-165
AWW80934.1|1603171_1603687_+	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	97.0	5.9e-71
AWW83292.1|1603614_1603944_+	hypothetical protein	NA	A0A1B1P9F7	Acinetobacter_phage	59.0	3.7e-26
AWW80935.1|1604012_1604195_+	addiction module toxin, HicA family	NA	A0A0D4DC32	Acinetobacter_phage	100.0	7.4e-29
AWW80936.1|1604287_1604692_+	HicB family protein	NA	A0A0D4DCG1	Acinetobacter_phage	100.0	3.9e-70
AWW80937.1|1604790_1605309_+	hypothetical protein	NA	A0A0P0I8L3	Acinetobacter_phage	35.9	4.4e-26
AWW80938.1|1605373_1605874_+	hypothetical protein	NA	NA	NA	NA	NA
AWW80939.1|1606306_1611220_+|tail	phage tail protein	tail	J7I4Q7	Acinetobacter_phage	85.7	0.0e+00
AWW80940.1|1611294_1612047_+	hypothetical protein	NA	J7HXF9	Acinetobacter_phage	34.4	1.2e-32
AWW80941.1|1612050_1612443_+	hypothetical protein	NA	NA	NA	NA	NA
AWW80942.1|1612507_1612906_+	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	100.0	1.3e-73
AWW80943.1|1612905_1613412_+	hypothetical protein	NA	J7HXQ5	Acinetobacter_phage	97.6	6.5e-91
AWW80944.1|1613408_1613771_+	hypothetical protein	NA	A0A0D4DCJ1	Acinetobacter_phage	98.3	4.4e-65
AWW80945.1|1613763_1617210_+	hypothetical protein	NA	A0A0D4DBG7	Acinetobacter_phage	97.0	0.0e+00
AWW80946.1|1617278_1617668_+	hypothetical protein	NA	J7I481	Acinetobacter_phage	99.2	4.3e-66
AWW80947.1|1617867_1618209_+	hypothetical protein	NA	NA	NA	NA	NA
AWW80948.1|1618212_1618539_+	hypothetical protein	NA	NA	NA	NA	NA
AWW80949.1|1618595_1619087_+	hypothetical protein	NA	NA	NA	NA	NA
AWW80950.1|1619106_1619367_-	hypothetical protein	NA	NA	NA	NA	NA
AWW80951.1|1619532_1620432_+	alpha/beta hydrolase	NA	A0A0P0J0J7	Acinetobacter_phage	85.4	4.2e-149
AWW80952.1|1620770_1621316_+	hypothetical protein	NA	J7I0Y1	Acinetobacter_phage	99.4	5.2e-102
AWW80953.1|1621504_1622185_+	hypothetical protein	NA	A0A0P0IKS6	Acinetobacter_phage	100.0	4.6e-116
AWW80954.1|1622195_1622843_+	hypothetical protein	NA	J7I4R4	Acinetobacter_phage	100.0	3.6e-118
AWW80955.1|1622849_1623443_+	hypothetical protein	NA	A0A0P0HSM0	Acinetobacter_phage	99.5	9.7e-102
>prophage 5
CP021326	Acinetobacter baumannii strain XH386 chromosome, complete genome	4108882	2170343	2204629	4108882	head,portal,integrase,capsid,tail,terminase	Acinetobacter_phage(37.93%)	53	2169411:2169432	2204766:2204787
2169411:2169432	attL	AAAAAGCGCTCAATCTAGAGCG	NA	NA	NA	NA
AWW81443.1|2170343_2170853_-	lysozyme	NA	A0A0B5L5F7	Acinetobacter_phage	57.4	3.8e-46
AWW81444.1|2170836_2171103_-	hypothetical protein	NA	NA	NA	NA	NA
AWW81445.1|2171177_2171402_-	hypothetical protein	NA	A0A0P0I8G9	Acinetobacter_phage	95.9	1.6e-33
AWW81446.1|2171403_2173440_-	hypothetical protein	NA	A0A0P0IRG3	Acinetobacter_phage	95.0	0.0e+00
AWW81447.1|2173493_2176328_-	hypothetical protein	NA	A0A1B1P9G8	Acinetobacter_phage	36.1	4.9e-167
AWW81448.1|2176278_2176674_-	hypothetical protein	NA	A0A1B1P9H4	Acinetobacter_phage	52.8	1.6e-28
AWW81449.1|2176670_2177180_-	hypothetical protein	NA	NA	NA	NA	NA
AWW81450.1|2177182_2177644_-	hypothetical protein	NA	NA	NA	NA	NA
AWW81451.1|2177659_2181256_-	replication protein	NA	D4FUM0	Pseudomonas_phage	31.7	1.4e-41
AWW81452.1|2181313_2181598_-	hypothetical protein	NA	NA	NA	NA	NA
AWW81453.1|2181741_2181957_-	hypothetical protein	NA	NA	NA	NA	NA
AWW81454.1|2181992_2182508_-	hypothetical protein	NA	NA	NA	NA	NA
AWW81455.1|2182507_2182981_-	structural protein 3 family protein	NA	A0A2H4JBZ0	uncultured_Caudovirales_phage	61.1	6.0e-54
AWW81456.1|2183057_2183429_-	hypothetical protein	NA	Q9MCA6	Pseudomonas_phage	47.9	2.3e-21
AWW81457.1|2183428_2183914_-	hypothetical protein	NA	A0A2H4JB20	uncultured_Caudovirales_phage	43.3	1.1e-26
AWW81458.1|2183917_2184274_-|head,tail	head-tail adaptor protein	head,tail	A0A1J0GUY4	Halomonas_phage	50.0	1.9e-20
AWW81459.1|2184275_2184563_-	hypothetical protein	NA	A0A2H4J711	uncultured_Caudovirales_phage	46.5	9.3e-18
AWW81460.1|2184783_2185956_-|capsid	phage major capsid protein	capsid	A0A2H4JD98	uncultured_Caudovirales_phage	47.2	1.2e-87
AWW81461.1|2185948_2186611_-	peptidase U35	NA	A0A2H4JAI0	uncultured_Caudovirales_phage	62.3	6.2e-73
AWW81462.1|2186603_2187830_-|portal	phage portal protein	portal	A0A2H4J6S3	uncultured_Caudovirales_phage	75.9	3.9e-182
AWW81463.1|2187826_2189521_-|terminase	terminase	terminase	A0A2H4J559	uncultured_Caudovirales_phage	82.6	2.2e-271
AWW81464.1|2189692_2189884_-	hypothetical protein	NA	NA	NA	NA	NA
AWW81465.1|2189903_2190386_-|terminase	terminase small subunit	terminase	A0A2H4J8R0	uncultured_Caudovirales_phage	48.4	5.9e-25
AWW81466.1|2190555_2190738_-	hypothetical protein	NA	NA	NA	NA	NA
AWW81467.1|2190748_2191027_-	hypothetical protein	NA	NA	NA	NA	NA
AWW81468.1|2191023_2191323_-	HNH endonuclease	NA	A0A0R6PH58	Moraxella_phage	61.2	6.5e-22
AWW81469.1|2191252_2191543_-	hypothetical protein	NA	NA	NA	NA	NA
AWW81470.1|2191520_2192078_-	hypothetical protein	NA	A0A0A0RVZ2	Escherichia_phage	57.1	2.7e-05
AWW81471.1|2192070_2192433_-	hypothetical protein	NA	NA	NA	NA	NA
AWW81472.1|2192425_2192608_-	hypothetical protein	NA	NA	NA	NA	NA
AWW81473.1|2192597_2193128_-	hypothetical protein	NA	A0A2H4JB76	uncultured_Caudovirales_phage	44.0	5.7e-37
AWW81474.1|2193143_2193542_-	hypothetical protein	NA	T1S9H7	Salmonella_phage	38.0	4.8e-12
AWW81475.1|2193623_2193818_-	hypothetical protein	NA	NA	NA	NA	NA
AWW81476.1|2193857_2194139_-	hypothetical protein	NA	A0A1B1P9J2	Acinetobacter_phage	95.4	1.8e-42
AWW81477.1|2194089_2194293_-	hypothetical protein	NA	A0A1B1P9J1	Acinetobacter_phage	94.0	2.7e-27
AWW81478.1|2194295_2194604_-	hypothetical protein	NA	NA	NA	NA	NA
AWW81479.1|2194697_2194946_-	hypothetical protein	NA	NA	NA	NA	NA
AWW81480.1|2195305_2195803_-	antitermination protein	NA	A0A0P0IY98	Acinetobacter_phage	34.2	1.4e-16
AWW81481.1|2195969_2196248_-	hypothetical protein	NA	NA	NA	NA	NA
AWW81482.1|2196244_2197657_-	replicative DNA helicase	NA	I2GUI4	Acinetobacter_phage	41.4	1.5e-79
AWW81483.1|2197653_2198724_-	DUF1376 domain-containing protein	NA	A9YWY6	Burkholderia_phage	44.5	5.4e-34
AWW81484.1|2198723_2199020_-	hypothetical protein	NA	NA	NA	NA	NA
AWW81485.1|2199080_2199314_-	hypothetical protein	NA	A0A2H4J114	uncultured_Caudovirales_phage	50.0	3.8e-09
AWW81486.1|2199441_2200146_+	peptidase S24	NA	A0A0R6PKV4	Moraxella_phage	45.1	1.2e-53
AWW81487.1|2200390_2200681_+	hypothetical protein	NA	NA	NA	NA	NA
AWW81488.1|2200683_2201100_+	hypothetical protein	NA	NA	NA	NA	NA
AWW81489.1|2201083_2201320_+	hypothetical protein	NA	NA	NA	NA	NA
AWW81490.1|2201322_2201739_+	hypothetical protein	NA	NA	NA	NA	NA
AWW81491.1|2201748_2202309_+	hypothetical protein	NA	NA	NA	NA	NA
AWW81492.1|2202317_2202686_+	hypothetical protein	NA	NA	NA	NA	NA
AWW81493.1|2202685_2203456_+	phage repressor protein/antirepressor Ant	NA	A0A0P0IDX3	Acinetobacter_phage	57.5	1.9e-41
AWW81494.1|2203452_2203704_+	hypothetical protein	NA	NA	NA	NA	NA
AWW81495.1|2203669_2204629_-|integrase	integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	35.4	4.5e-48
2204766:2204787	attR	AAAAAGCGCTCAATCTAGAGCG	NA	NA	NA	NA
>prophage 6
CP021326	Acinetobacter baumannii strain XH386 chromosome, complete genome	4108882	2663484	2721624	4108882	transposase,tRNA	Escherichia_phage(25.0%)	54	NA	NA
AWW81923.1|2663484_2664201_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AWW81924.1|2664371_2664998_+	glutathione S-transferase	NA	NA	NA	NA	NA
AWW81925.1|2665008_2665788_-	F420-dependent NADP oxidoreductase	NA	NA	NA	NA	NA
AWW81926.1|2665874_2667290_-	OmpA family protein	NA	NA	NA	NA	NA
AWW81927.1|2667503_2668739_-	aspartate carbamoyltransferase	NA	NA	NA	NA	NA
AWW81928.1|2668751_2669768_-	aspartate carbamoyltransferase	NA	NA	NA	NA	NA
AWW81929.1|2669891_2670236_-	hypothetical protein	NA	NA	NA	NA	NA
AWW81930.1|2670474_2672679_+	ribosomal RNA large subunit methyltransferase K/L	NA	NA	NA	NA	NA
AWW81931.1|2672704_2673121_-	hypothetical protein	NA	NA	NA	NA	NA
AWW81932.1|2673389_2673878_+	CinA family protein	NA	A0A218MNG4	uncultured_virus	43.3	4.0e-29
AWW81933.1|2673934_2676514_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	32.4	1.3e-123
AWW81934.1|2676815_2677622_+	peptidase M23	NA	G9BW84	Planktothrix_phage	35.9	9.0e-18
AWW81935.1|2677618_2678044_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWW81936.1|2678135_2678558_-	osmotically inducible protein C	NA	NA	NA	NA	NA
AWW81937.1|2678996_2679662_+	transcriptional regulator Crp	NA	NA	NA	NA	NA
AWW81938.1|2681053_2682103_+	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
AWW81939.1|2682162_2682948_-	type I deoxyribonuclease HsdR	NA	NA	NA	NA	NA
AWW81940.1|2683058_2683376_-	hypothetical protein	NA	NA	NA	NA	NA
AWW81941.1|2683498_2684818_-	adenylosuccinate synthase	NA	A0A2P1EKE7	Megavirus	36.0	4.8e-69
AWW81942.1|2684882_2686049_-	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
AWW81943.1|2686324_2687350_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AWW81944.1|2687619_2690256_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.6	1.8e-75
AWW81945.1|2690321_2691602_+	aspartate kinase	NA	NA	NA	NA	NA
AWW81946.1|2691848_2692103_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	8.8e-12
AWW81947.1|2692172_2692739_-	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	42.4	1.8e-25
AWW81948.1|2692804_2693194_-	hypothetical protein	NA	NA	NA	NA	NA
AWW81949.1|2693432_2693990_+	cytochrome b	NA	NA	NA	NA	NA
AWW81950.1|2694033_2695032_-	adenosine deaminase	NA	NA	NA	NA	NA
AWW81951.1|2695143_2696463_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.8	7.8e-59
AWW81952.1|2696785_2697013_-	hypothetical protein	NA	NA	NA	NA	NA
AWW81953.1|2697381_2698932_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AWW81954.1|2698955_2699786_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AWW81955.1|2699851_2700814_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AWW81956.1|2701324_2702047_+	pirin family protein	NA	NA	NA	NA	NA
AWW81957.1|2702111_2702735_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWW81958.1|2703259_2704219_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AWW81959.1|2704281_2705115_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AWW81960.1|2705947_2706652_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWW81961.1|2707685_2708246_-|transposase	transposase	transposase	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AWW81962.1|2708371_2708722_-|transposase	transposase	transposase	NA	NA	NA	NA
AWW81963.1|2708939_2709644_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWW81964.1|2709773_2710589_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
AWW81965.1|2710741_2710921_-	hypothetical protein	NA	NA	NA	NA	NA
AWW83308.1|2710912_2711122_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
AWW81966.1|2711187_2711892_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AWW81967.1|2711903_2712563_-	transposon DNA-invertase	NA	E5FFF9	Burkholderia_phage	48.6	2.4e-37
AWW83309.1|2712673_2715562_-|transposase	DDE transposase	transposase	Q1MVP5	Enterobacteria_phage	63.8	0.0e+00
AWW81968.1|2715586_2716291_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWW81969.1|2716361_2717222_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AWW83310.1|2717404_2717944_-	recombinase	NA	Q1MVP4	Enterobacteria_phage	98.8	1.2e-85
AWW81970.1|2717973_2718678_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWW81971.1|2718689_2718899_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
AWW81972.1|2719297_2720392_-	arginine N-succinyltransferase	NA	NA	NA	NA	NA
AWW81973.1|2720388_2721624_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.2e-23
>prophage 7
CP021326	Acinetobacter baumannii strain XH386 chromosome, complete genome	4108882	2786380	2823831	4108882	head,portal,integrase,capsid,tail,terminase	Acinetobacter_phage(44.12%)	54	2807703:2807722	2830013:2830032
AWW82024.1|2786380_2787745_+|integrase	integrase	integrase	A0A0R6PGY7	Moraxella_phage	42.7	2.9e-85
AWW82025.1|2787728_2787923_-	hypothetical protein	NA	A0A1B1P9F8	Acinetobacter_phage	54.1	2.7e-13
AWW82026.1|2788156_2788525_-	hypothetical protein	NA	NA	NA	NA	NA
AWW82027.1|2788524_2789034_-	lysozyme	NA	A0A0B5L5F7	Acinetobacter_phage	57.4	3.8e-46
AWW82028.1|2789017_2789284_-	hypothetical protein	NA	NA	NA	NA	NA
AWW82029.1|2789358_2789583_-	hypothetical protein	NA	A0A0P0I8G9	Acinetobacter_phage	95.9	1.6e-33
AWW82030.1|2789584_2791621_-	hypothetical protein	NA	A0A0P0IRG3	Acinetobacter_phage	95.0	0.0e+00
AWW82031.1|2791674_2794509_-	hypothetical protein	NA	A0A1B1P9G8	Acinetobacter_phage	36.1	4.9e-167
AWW82032.1|2794459_2794855_-	hypothetical protein	NA	A0A1B1P9H4	Acinetobacter_phage	52.8	1.6e-28
AWW82033.1|2794851_2795361_-	hypothetical protein	NA	NA	NA	NA	NA
AWW82034.1|2795363_2795825_-	hypothetical protein	NA	NA	NA	NA	NA
AWW82035.1|2795840_2799434_-	replication protein	NA	A0A0U4JEA4	Pseudomonas_phage	39.9	3.0e-44
AWW82036.1|2799496_2799829_-	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	43.1	1.1e-14
AWW82037.1|2799905_2800121_-	hypothetical protein	NA	NA	NA	NA	NA
AWW82038.1|2800156_2800672_-	hypothetical protein	NA	NA	NA	NA	NA
AWW82039.1|2800673_2801150_-	structural protein 3 family protein	NA	A0A2H4JBZ0	uncultured_Caudovirales_phage	66.2	6.4e-56
AWW82040.1|2801221_2801596_-	hypothetical protein	NA	Q9MCA6	Pseudomonas_phage	44.5	1.7e-19
AWW82041.1|2801595_2802081_-	hypothetical protein	NA	A0A2H4JB20	uncultured_Caudovirales_phage	45.3	6.4e-27
AWW82042.1|2802084_2802441_-|head,tail	head-tail adaptor protein	head,tail	A0A1J0GUY4	Halomonas_phage	50.0	1.9e-20
AWW82043.1|2802442_2802730_-	hypothetical protein	NA	A0A2H4J711	uncultured_Caudovirales_phage	46.5	2.5e-18
AWW82044.1|2802950_2804123_-|capsid	phage major capsid protein	capsid	A0A2H4JD98	uncultured_Caudovirales_phage	47.2	9.2e-88
AWW82045.1|2804115_2804778_-	peptidase U35	NA	A0A2H4JAI0	uncultured_Caudovirales_phage	62.3	6.2e-73
AWW82046.1|2804770_2805997_-|portal	phage portal protein	portal	A0A2H4J6S3	uncultured_Caudovirales_phage	75.9	3.9e-182
AWW82047.1|2805993_2807688_-|terminase	terminase	terminase	A0A2H4J559	uncultured_Caudovirales_phage	82.6	2.2e-271
2807703:2807722	attL	AAAAAACCGCCCGAAGGCGG	NA	NA	NA	NA
AWW82048.1|2807859_2808051_-	hypothetical protein	NA	NA	NA	NA	NA
AWW82049.1|2808070_2808553_-|terminase	terminase small subunit	terminase	A0A2H4J8R0	uncultured_Caudovirales_phage	48.4	5.9e-25
AWW82050.1|2808699_2808924_-	hypothetical protein	NA	NA	NA	NA	NA
AWW82051.1|2808968_2809268_-	HNH endonuclease	NA	A0A0R6PH58	Moraxella_phage	61.2	1.1e-21
AWW82052.1|2809197_2809491_-	hypothetical protein	NA	NA	NA	NA	NA
AWW82053.1|2809496_2809679_-	hypothetical protein	NA	NA	NA	NA	NA
AWW82054.1|2809668_2810199_-	hypothetical protein	NA	A0A2H4JB76	uncultured_Caudovirales_phage	44.0	4.4e-37
AWW82055.1|2810214_2810613_-	hypothetical protein	NA	T1S9H7	Salmonella_phage	38.0	4.8e-12
AWW82056.1|2810688_2810907_-	hypothetical protein	NA	NA	NA	NA	NA
AWW82057.1|2811616_2811892_-	hypothetical protein	NA	NA	NA	NA	NA
AWW82058.1|2812271_2812769_-	antitermination protein	NA	A0A0P0IY98	Acinetobacter_phage	34.2	1.4e-16
AWW82059.1|2812935_2813316_-	hypothetical protein	NA	A0A0D4DBZ8	Acinetobacter_phage	44.4	3.0e-16
AWW82060.1|2813317_2813602_-	hypothetical protein	NA	A0A1B1P9J7	Acinetobacter_phage	63.8	3.5e-33
AWW82061.1|2813594_2814017_-	hypothetical protein	NA	A0A0N7IRE2	Acinetobacter_phage	98.6	3.5e-82
AWW82062.1|2814006_2814351_-	hypothetical protein	NA	A0A068CDI0	Acinetobacter_phage	75.2	8.0e-40
AWW82063.1|2814347_2814626_-	hypothetical protein	NA	NA	NA	NA	NA
AWW82064.1|2814622_2816035_-	replicative DNA helicase	NA	I2GUI4	Acinetobacter_phage	41.6	6.5e-80
AWW82065.1|2816031_2817102_-	DUF1376 domain-containing protein	NA	A9YWY6	Burkholderia_phage	44.5	5.4e-34
AWW82066.1|2817101_2817398_-	hypothetical protein	NA	NA	NA	NA	NA
AWW82067.1|2817452_2817653_-	hypothetical protein	NA	NA	NA	NA	NA
AWW82068.1|2817759_2818416_+	peptidase S24	NA	A0A0R6PJ00	Moraxella_phage	36.9	1.2e-31
AWW82069.1|2818656_2819379_+	hypothetical protein	NA	NA	NA	NA	NA
AWW82070.1|2819391_2819808_+	hypothetical protein	NA	NA	NA	NA	NA
AWW82071.1|2819791_2820028_+	hypothetical protein	NA	A0A2H4J515	uncultured_Caudovirales_phage	43.5	1.1e-08
AWW82072.1|2820030_2820465_+	hypothetical protein	NA	NA	NA	NA	NA
AWW82073.1|2820461_2821010_+	hypothetical protein	NA	NA	NA	NA	NA
AWW82074.1|2821021_2821411_+	hypothetical protein	NA	J7HXR6	Acinetobacter_phage	96.1	1.2e-68
AWW82075.1|2821407_2821758_+	hypothetical protein	NA	J7I0Y4	Acinetobacter_phage	100.0	3.4e-62
AWW82076.1|2821760_2822039_+	DNA-binding protein	NA	NA	NA	NA	NA
AWW82077.1|2822457_2823831_+|integrase	integrase	integrase	A0A0R6PGY7	Moraxella_phage	41.5	1.9e-76
2830013:2830032	attR	AAAAAACCGCCCGAAGGCGG	NA	NA	NA	NA
>prophage 8
CP021326	Acinetobacter baumannii strain XH386 chromosome, complete genome	4108882	2829447	2858121	4108882	terminase,head,tail	Acinetobacter_phage(93.75%)	38	NA	NA
AWW83315.1|2829447_2829993_-	hypothetical protein	NA	A0A0B5L5G7	Acinetobacter_phage	100.0	4.7e-103
AWW82081.1|2830034_2830424_-	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	99.2	3.3e-66
AWW82082.1|2830491_2833917_-	hypothetical protein	NA	A0A0P0HSH9	Acinetobacter_phage	94.2	0.0e+00
AWW82083.1|2833909_2834272_-	hypothetical protein	NA	A0A0P0J0A2	Acinetobacter_phage	79.2	8.1e-51
AWW82084.1|2834268_2834775_-	hypothetical protein	NA	J7HXQ5	Acinetobacter_phage	97.0	1.5e-90
AWW82085.1|2834774_2835173_-	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	97.7	4.1e-72
AWW82086.1|2835265_2835853_-	hypothetical protein	NA	NA	NA	NA	NA
AWW82087.1|2835943_2840254_-|tail	phage tail tape measure protein	tail	A0A0D4DC37	Acinetobacter_phage	98.3	0.0e+00
AWW82088.1|2840381_2840645_-	hypothetical protein	NA	NA	NA	NA	NA
AWW82089.1|2840646_2841327_-	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	49.3	2.5e-53
AWW82090.1|2841431_2841890_-	transcriptional regulator	NA	A0A0P0IRJ4	Acinetobacter_phage	100.0	1.1e-84
AWW82091.1|2841898_2842198_-	hypothetical protein	NA	A0A0P0IE58	Acinetobacter_phage	100.0	7.4e-50
AWW82092.1|2842443_2842773_-	hypothetical protein	NA	A0A1B1P9F7	Acinetobacter_phage	55.1	4.5e-24
AWW82093.1|2842700_2843216_-	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	96.6	2.5e-77
AWW82094.1|2843285_2844203_-	hypothetical protein	NA	J7HXP7	Acinetobacter_phage	100.0	2.0e-170
AWW82095.1|2844255_2845434_-|tail	phage tail protein	tail	A0A0D4DCQ4	Acinetobacter_phage	66.3	1.2e-103
AWW82096.1|2845433_2845787_-	hypothetical protein	NA	A0A0D4DCF7	Acinetobacter_phage	96.6	3.3e-57
AWW82097.1|2845883_2846405_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
AWW82098.1|2846513_2846732_-	hypothetical protein	NA	A0A0P0I8C2	Acinetobacter_phage	94.2	1.2e-28
AWW82099.1|2846733_2847177_-	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	94.6	2.0e-75
AWW82100.1|2847133_2847502_-	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	82.8	2.0e-52
AWW82101.1|2847473_2847884_-	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	73.3	7.7e-50
AWW82102.1|2847935_2848229_-	hypothetical protein	NA	NA	NA	NA	NA
AWW82103.1|2848236_2848434_-	hypothetical protein	NA	NA	NA	NA	NA
AWW82104.1|2848502_2848871_-	glutamate 5-kinase	NA	J7I467	Acinetobacter_phage	92.6	8.7e-61
AWW82105.1|2848871_2849252_-	hypothetical protein	NA	A0A0P0IVQ3	Acinetobacter_phage	84.9	6.9e-53
AWW82106.1|2849255_2849591_-	HeH/LEM domain protein	NA	A0A0N7IRE4	Acinetobacter_phage	100.0	2.7e-53
AWW82107.1|2849635_2850586_-	methyltransferase	NA	A0A0P0HSG2	Acinetobacter_phage	94.9	3.7e-172
AWW82108.1|2850599_2851391_-	hypothetical protein	NA	A0A0P0J090	Acinetobacter_phage	74.2	2.3e-90
AWW82109.1|2851477_2851792_-	hypothetical protein	NA	A0A0S3UFT8	Pseudomonas_phage	50.5	5.2e-14
AWW82110.1|2852011_2852242_-	hypothetical protein	NA	NA	NA	NA	NA
AWW82111.1|2852238_2853345_-|head	phage head morphogenesis protein	head	A0A0P0IR98	Acinetobacter_phage	90.2	2.1e-190
AWW82112.1|2853354_2854695_-	hypothetical protein	NA	A0A0P0IDW1	Acinetobacter_phage	92.2	3.4e-235
AWW82113.1|2854734_2856027_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	86.0	6.4e-215
AWW82114.1|2855986_2856502_-	hypothetical protein	NA	A0A1B1P9C2	Acinetobacter_phage	61.3	3.2e-45
AWW82115.1|2856560_2857202_-	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	88.7	6.3e-115
AWW82116.1|2857170_2857605_-	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	84.7	7.4e-67
AWW82117.1|2857665_2858121_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	95.4	2.7e-80
>prophage 9
CP021326	Acinetobacter baumannii strain XH386 chromosome, complete genome	4108882	2862079	2874427	4108882		Acinetobacter_phage(95.65%)	24	NA	NA
AWW82124.1|2862079_2862556_-	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	40.3	1.2e-25
AWW82125.1|2862552_2862954_-	hypothetical protein	NA	A0A0P0I8E8	Acinetobacter_phage	96.2	2.6e-66
AWW82126.1|2862953_2863346_-	hypothetical protein	NA	J7HXM5	Acinetobacter_phage	57.8	1.2e-07
AWW82127.1|2863338_2863677_-	hypothetical protein	NA	A0A0P0IKW4	Acinetobacter_phage	56.3	1.1e-30
AWW82128.1|2863673_2864474_-	hypothetical protein	NA	A0A0P0IDV1	Acinetobacter_phage	95.5	2.8e-144
AWW82129.1|2864476_2865358_-	replication protein	NA	A0A0P0IKQ2	Acinetobacter_phage	95.2	3.3e-138
AWW82130.1|2865350_2865575_-	hypothetical protein	NA	A0A0P0I444	Acinetobacter_phage	97.3	3.2e-34
AWW82131.1|2865646_2865919_-	hypothetical protein	NA	J7I0V3	Acinetobacter_phage	90.0	7.2e-36
AWW82132.1|2865980_2866301_-	transcriptional regulator	NA	A0A0P0HSE9	Acinetobacter_phage	87.7	1.2e-42
AWW82133.1|2866311_2866500_-	hypothetical protein	NA	NA	NA	NA	NA
AWW82134.1|2866604_2867357_+	phage repressor protein	NA	J7I4M9	Acinetobacter_phage	74.3	5.5e-102
AWW82135.1|2867371_2867587_+	hypothetical protein	NA	A0A0P0IKK4	Acinetobacter_phage	98.6	9.4e-31
AWW82136.1|2867638_2868646_+	hypothetical protein	NA	A0A0P0IY33	Acinetobacter_phage	100.0	2.9e-183
AWW82137.1|2868647_2869151_+	hypothetical protein	NA	A0A0P0I896	Acinetobacter_phage	100.0	1.1e-77
AWW82138.1|2869289_2869493_+	hypothetical protein	NA	A0A0P0IKZ8	Acinetobacter_phage	100.0	1.2e-27
AWW82139.1|2869499_2869742_-	hypothetical protein	NA	A0A0P0I4B0	Acinetobacter_phage	100.0	5.2e-38
AWW82140.1|2869935_2870379_+	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	94.5	1.7e-71
AWW82141.1|2870378_2870669_+	hypothetical protein	NA	A0A0P0IDU2	Acinetobacter_phage	95.8	5.1e-48
AWW82142.1|2870661_2870985_+	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	95.3	4.8e-55
AWW82143.1|2870996_2872118_+	AAA family ATPase	NA	A0A0N7IRE0	Acinetobacter_phage	99.5	2.8e-211
AWW82144.1|2872114_2873047_+	hypothetical protein	NA	A0A0P0I438	Acinetobacter_phage	80.0	2.2e-137
AWW82145.1|2873048_2873300_+	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	100.0	6.4e-39
AWW82146.1|2873300_2873708_+	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	52.2	7.5e-13
AWW82147.1|2873704_2874427_+	hypothetical protein	NA	A0A0P0HSE1	Acinetobacter_phage	88.2	1.7e-55
>prophage 10
CP021326	Acinetobacter baumannii strain XH386 chromosome, complete genome	4108882	3796260	3868687	4108882	transposase,tRNA	uncultured_Caudovirales_phage(22.22%)	69	NA	NA
AWW82974.1|3796260_3797193_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AWW82975.1|3797242_3798439_-	cell division protein FtsW	NA	NA	NA	NA	NA
AWW82976.1|3798463_3799810_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
AWW82977.1|3799970_3800222_-	hypothetical protein	NA	NA	NA	NA	NA
AWW82978.1|3800242_3802096_-	ferrous iron transporter B	NA	NA	NA	NA	NA
AWW82979.1|3802092_3802392_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
AWW82980.1|3802499_3803420_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.7	6.7e-33
AWW82981.1|3803566_3804382_+	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AWW82982.1|3804626_3805928_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
AWW82983.1|3805983_3807123_+	threonine synthase	NA	NA	NA	NA	NA
AWW82984.1|3807229_3808237_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
AWW82985.1|3808488_3809124_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AWW82986.1|3809134_3810703_+	histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.3	2.4e-06
AWW82987.1|3810727_3812149_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AWW82988.1|3812152_3813337_-	peptidase S41	NA	A0A0R6PIZ1	Moraxella_phage	23.0	8.3e-12
AWW82989.1|3813352_3814900_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
AWW82990.1|3815025_3816096_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AWW82991.1|3816095_3817196_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AWW82992.1|3817339_3818788_+	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.4	5.5e-50
AWW82993.1|3818780_3819188_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AWW82994.1|3819229_3819865_+	hypothetical protein	NA	NA	NA	NA	NA
AWW82995.1|3819995_3820214_+	hypothetical protein	NA	NA	NA	NA	NA
AWW82996.1|3820273_3820933_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.6	1.5e-34
AWW82997.1|3820975_3822268_-	DNA modification methylase	NA	A0A0P0BWH0	Ostreococcus_mediterraneus_virus	32.6	2.5e-38
AWW82998.1|3822264_3823350_-	riboflavin biosynthesis protein RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.6	5.1e-48
AWW82999.1|3823365_3823824_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AWW83000.1|3823981_3825379_-	ammonia channel protein	NA	H8ZJB2	Ostreococcus_tauri_virus	31.2	5.4e-34
AWW83001.1|3825436_3825775_-	transcriptional regulator	NA	NA	NA	NA	NA
AWW83002.1|3826054_3826282_+	membrane fusogenic activity	NA	NA	NA	NA	NA
AWW83003.1|3826347_3827205_+	ATP-binding protein	NA	NA	NA	NA	NA
AWW83004.1|3827287_3829075_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83334.1|3829457_3830261_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
AWW83005.1|3830260_3831097_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AWW83335.1|3831216_3831441_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83006.1|3831651_3833145_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AWW83007.1|3833175_3833787_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83008.1|3833764_3834388_-|transposase	transposase	transposase	NA	NA	NA	NA
AWW83009.1|3834469_3835687_+	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
AWW83010.1|3835769_3837566_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83011.1|3837860_3839348_+	sodium-independent anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	79.4	8.3e-219
AWW83012.1|3839360_3840212_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	45.9	8.2e-70
AWW83013.1|3840279_3840579_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83014.1|3840651_3841023_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83015.1|3841397_3842828_-|transposase	transposase	transposase	NA	NA	NA	NA
AWW83016.1|3842820_3843936_-|transposase	transposase	transposase	NA	NA	NA	NA
AWW83017.1|3843965_3844886_-|transposase	transposase	transposase	NA	NA	NA	NA
AWW83018.1|3844890_3846801_-|transposase	transposase	transposase	NA	NA	NA	NA
AWW83019.1|3846801_3847512_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	I6WI48	Vibriophage	29.3	4.1e-06
AWW83020.1|3847716_3848010_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83021.1|3847903_3848206_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AWW83022.1|3848292_3849108_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
AWW83023.1|3850712_3852623_-|transposase	transposase	transposase	NA	NA	NA	NA
AWW83024.1|3852623_3853334_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	I6WI48	Vibriophage	29.3	5.3e-06
AWW83025.1|3853645_3853915_-	hypothetical protein	NA	NA	NA	NA	NA
AWW83026.1|3853968_3854325_-	hypothetical protein	NA	NA	NA	NA	NA
AWW83027.1|3854370_3854688_-	hypothetical protein	NA	NA	NA	NA	NA
AWW83028.1|3854894_3855827_-	recombinase	NA	A0A0K2CP59	Brevibacillus_phage	28.8	1.7e-23
AWW83029.1|3855927_3856155_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83030.1|3856155_3857658_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83031.1|3857742_3858906_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83032.1|3858926_3859508_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83033.1|3859794_3861591_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83034.1|3861885_3863373_+	sodium-independent anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	79.4	8.3e-219
AWW83035.1|3863385_3864237_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	45.9	8.2e-70
AWW83036.1|3864304_3864604_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83037.1|3864676_3865048_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83038.1|3865422_3866061_-|transposase	transposase	transposase	NA	NA	NA	NA
AWW83039.1|3866065_3867976_-|transposase	transposase	transposase	NA	NA	NA	NA
AWW83040.1|3867976_3868687_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	I6WI48	Vibriophage	29.3	4.1e-06
>prophage 1
CP021327	Acinetobacter baumannii strain XH386 plasmid pXH386, complete sequence	112155	0	107030	112155	integrase,tail,capsid,terminase	Pseudomonas_phage(30.0%)	109	29383:29406	94387:94410
AWW83345.1|237_657_-	dehydrogenase	NA	NA	NA	NA	NA
AWW83346.1|666_780_-	dehydrogenase	NA	NA	NA	NA	NA
AWW83347.1|916_1525_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AWW83348.1|1629_1860_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83349.1|1943_3071_-	alkene reductase	NA	NA	NA	NA	NA
AWW83350.1|3271_3949_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
AWW83351.1|4033_5191_-	NADH-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
AWW83352.1|5787_6090_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AWW83353.1|6413_7253_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AWW83354.1|7481_8594_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.3	1.2e-31
AWW83355.1|8615_8891_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
AWW83356.1|10296_10800_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83357.1|11047_12211_+	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.0	2.2e-09
AWW83358.1|13634_13880_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83359.1|14113_14440_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83360.1|14455_15178_+	hypothetical protein	NA	J9Q7Y8	Salmonella_phage	34.1	4.2e-14
AWW83361.1|15253_15502_-	transcriptional regulator	NA	A0A0M3LSW2	Mannheimia_phage	44.8	1.3e-07
AWW83362.1|15560_15902_-	hypothetical protein	NA	NA	NA	NA	NA
AWW83363.1|16009_16228_-	hypothetical protein	NA	NA	NA	NA	NA
AWW83364.1|16291_16627_-	hypothetical protein	NA	NA	NA	NA	NA
AWW83365.1|17953_18160_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83366.1|18311_18605_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83367.1|18892_19318_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83368.1|19757_20558_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83369.1|20951_21521_+	peptidoglycan-binding protein LysM	NA	NA	NA	NA	NA
AWW83370.1|21555_21834_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83371.1|21897_22191_-	hypothetical protein	NA	NA	NA	NA	NA
AWW83372.1|22316_24026_-	ATP-dependent helicase	NA	L7TNS5	Rhizobium_phage	46.2	3.4e-131
AWW83373.1|24104_24743_+	chromosome partitioning protein ParB	NA	L7TL04	Rhizobium_phage	46.1	1.0e-48
AWW83374.1|24771_25374_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83375.1|25370_26021_+	chromosome partitioning protein ParB	NA	L7TMF9	Rhizobium_phage	41.9	3.8e-35
AWW83376.1|26020_26677_+	ABC transporter	NA	L7TNS9	Rhizobium_phage	54.8	5.9e-60
AWW83377.1|26673_27096_+	thiol reductase thioredoxin	NA	NA	NA	NA	NA
AWW83378.1|27134_28088_+	hypothetical protein	NA	A0A2H4P6X5	Pseudomonas_phage	42.1	4.6e-61
AWW83379.1|28078_28402_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83380.1|28370_28865_+	hypothetical protein	NA	A0A0D4DBK8	Acinetobacter_phage	33.9	5.4e-05
AWW83381.1|28976_29378_+	hypothetical protein	NA	NA	NA	NA	NA
29383:29406	attL	AATTATTAATAAGCGCTTATTATT	NA	NA	NA	NA
AWW83382.1|29530_30136_+	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	34.3	4.0e-18
AWW83383.1|30145_31390_+|terminase	terminase	terminase	A0A2H4P6Z9	Pseudomonas_phage	62.4	1.3e-151
AWW83384.1|31435_33106_+	hypothetical protein	NA	J9Q7R1	Salmonella_phage	51.9	8.1e-146
AWW83385.1|33149_34028_+	hypothetical protein	NA	A0A2H4P6Z8	Pseudomonas_phage	29.4	7.3e-13
AWW83386.1|34163_35066_+|capsid	phage capsid protein	capsid	A0A2H4P701	Pseudomonas_phage	58.3	6.9e-91
AWW83387.1|35204_35699_+	hypothetical protein	NA	L7TKJ9	Rhizobium_phage	28.7	6.8e-08
AWW83388.1|35705_36476_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83389.1|36534_37173_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83390.1|37159_37510_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	35.1	2.5e-09
AWW83391.1|37506_37893_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	32.8	1.6e-12
AWW83392.1|37892_38390_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83393.1|38474_39020_+	hypothetical protein	NA	A0A2H4P707	Pseudomonas_phage	52.2	6.3e-39
AWW83394.1|39114_39468_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83395.1|39524_39821_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83396.1|39823_45412_+|tail	tail length tape measure protein	tail	NA	NA	NA	NA
AWW83397.1|45484_45811_+|tail	phage tail protein	tail	D6PGG4	uncultured_phage	31.1	9.0e-09
AWW83398.1|45810_46506_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	48.0	2.8e-60
AWW83399.1|46502_47252_+|tail	phage tail protein	tail	J9Q7R4	Salmonella_phage	40.5	7.8e-48
AWW83400.1|47245_47824_+|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	35.6	2.5e-25
AWW83401.1|47847_59031_+|tail	phage tail protein	tail	A4JX16	Burkholderia_virus	36.4	7.6e-155
AWW83402.1|59031_59346_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83403.1|59359_60094_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83404.1|60103_60355_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83405.1|60487_60691_-	hypothetical protein	NA	NA	NA	NA	NA
AWW83406.1|60814_61207_+	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	56.2	9.7e-34
AWW83407.1|61206_61845_+	lysozyme	NA	A0A075DXC6	Acinetobacter_phage	65.0	2.0e-68
AWW83408.1|62848_63970_+	RepB family plasmid replication initiator protein	NA	NA	NA	NA	NA
AWW83409.1|64086_64818_+	hypothetical protein	NA	L7TM14	Rhizobium_phage	26.6	1.7e-15
AWW83410.1|64905_65337_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83411.1|65373_66777_+	DNA helicase	NA	L7TS87	Rhizobium_phage	38.8	4.3e-84
AWW83412.1|66864_67959_+	DNA primase	NA	A0A2H4P738	Pseudomonas_phage	43.7	1.1e-87
AWW83413.1|68022_68577_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83414.1|68576_69068_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83415.1|69061_69670_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83416.1|69666_70176_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83417.1|70188_71892_+	DNA ligase	NA	A0A2H4P729	Pseudomonas_phage	40.2	2.3e-87
AWW83418.1|71931_72504_+	guanylate kinase	NA	A0A218KC48	Bacillus_phage	28.5	7.1e-09
AWW83419.1|72576_73197_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83420.1|73184_73613_-	hypothetical protein	NA	NA	NA	NA	NA
AWW83421.1|73609_74287_-	partition protein	NA	E5FFJ3	Burkholderia_phage	26.8	2.8e-12
AWW83422.1|74901_75486_-|integrase	integrase	integrase	A0A0A8WF93	Clostridium_phage	29.9	4.0e-07
AWW83423.1|75825_76245_-	transcriptional regulator	NA	NA	NA	NA	NA
AWW83424.1|76666_76861_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83425.1|77101_79024_+	cobalamin biosynthesis protein CobT	NA	A0A2H4P735	Pseudomonas_phage	43.9	3.9e-75
AWW83426.1|79168_80413_+	porphyrin biosynthesis protein	NA	L7TKP0	Rhizobium_phage	41.7	2.4e-86
AWW83427.1|80437_81103_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AWW83428.1|81153_81834_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83429.1|81879_84237_+	DNA polymerase III subunit alpha	NA	L7TNG6	Rhizobium_phage	43.4	4.3e-177
AWW83430.1|84285_84861_+	hypothetical protein	NA	A0A2D1GG92	Gordonia_phage	44.4	2.1e-24
AWW83431.1|84857_86123_+	hypothetical protein	NA	A0A2H4P750	Pseudomonas_phage	38.1	5.9e-72
AWW83432.1|86212_87301_+	hypothetical protein	NA	A0A2H4P749	Pseudomonas_phage	35.3	5.0e-11
AWW83433.1|87443_88304_+	hypothetical protein	NA	A0A2H4P7I7	Pseudomonas_phage	31.5	1.9e-29
AWW83434.1|88366_89404_+	5'-3' exonuclease	NA	J9Q7S6	Salmonella_phage	36.6	8.8e-50
AWW83435.1|89406_91605_+	recombinase RecA	NA	J9Q736	Salmonella_phage	50.7	3.6e-53
AWW83436.1|91692_92052_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83437.1|93243_93699_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83438.1|93698_94079_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83439.1|94166_94388_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83440.1|94421_95537_+	serine/threonine protein phosphatase	NA	A0A2H4P756	Pseudomonas_phage	38.1	1.3e-59
94387:94410	attR	AATTATTAATAAGCGCTTATTATT	NA	NA	NA	NA
AWW83441.1|95536_97477_+	recombinase RecF	NA	L7TNH6	Rhizobium_phage	42.8	6.4e-118
AWW83442.1|97569_98406_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83443.1|98537_99140_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	42.8	1.1e-31
AWW83444.1|99213_99594_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83445.1|99615_101988_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	50.7	3.1e-207
AWW83446.1|102085_103075_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A2H4P762	Pseudomonas_phage	38.4	2.5e-54
AWW83447.1|103087_103999_+	hypothetical protein	NA	A0A0K2FHE7	Achromobacter_phage	44.4	7.7e-66
AWW83448.1|104002_104287_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83449.1|104286_104514_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83450.1|104544_104802_+	hypothetical protein	NA	NA	NA	NA	NA
AWW83451.1|104794_105160_+	nucleotide pyrophosphohydrolase	NA	A0A0S0NAG1	Pseudomonas_phage	63.6	2.8e-35
AWW83452.1|105156_105828_+	AAA family ATPase	NA	NA	NA	NA	NA
AWW83453.1|106490_107030_+	DNA polymerase III subunit epsilon	NA	J9Q6J8	Salmonella_phage	48.9	2.0e-37
>prophage 2
CP021327	Acinetobacter baumannii strain XH386 plasmid pXH386, complete sequence	112155	110257	111121	112155		Pseudomonas_phage(100.0%)	1	NA	NA
AWW83460.1|110257_111121_+	hypothetical protein	NA	A0A2H4P788	Pseudomonas_phage	29.7	8.8e-11
