The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027788	Staphylococcus aureus strain CMRSA-6 chromosome, complete genome	3044721	12782	67077	3044721	transposase,integrase,tRNA	Bacillus_phage(20.0%)	55	15889:15905	52806:52822
AWW92047.1|12782_14069_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	2.7e-88
AWW92048.1|14712_15408_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWW92049.1|15404_15734_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
15889:15905	attL	ATAAAAGTAATTCATCA	NA	NA	NA	NA
AWW92050.1|16095_17064_+	homoserine acetyltransferase	NA	NA	NA	NA	NA
AWW92051.1|17356_18295_+	DUF2232 domain-containing protein	NA	NA	NA	NA	NA
AWW92052.1|18309_20277_+	DHH family phosphoesterase	NA	NA	NA	NA	NA
AWW92053.1|20273_20720_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
AWW92054.1|20751_22152_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	48.1	7.1e-111
AWW92055.1|22201_22429_-	hypothetical protein	NA	NA	NA	NA	NA
AWW92056.1|22429_23713_+	adenylosuccinate synthetase	NA	L7Y4J5	Megavirus	34.6	1.8e-68
AWW92057.1|24902_25604_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	39.2	3.5e-42
AWW92058.1|25616_27443_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	31.3	2.1e-30
AWW92059.1|27435_28770_+	hypothetical protein	NA	NA	NA	NA	NA
AWW92060.1|28770_29559_+	hypothetical protein	NA	NA	NA	NA	NA
AWW92061.1|29946_30747_+	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.9	1.0e-37
AWW92062.1|30973_33292_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
AWW92063.1|33659_34139_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
AWW92064.1|34384_34690_+	hypothetical protein	NA	NA	NA	NA	NA
AWW92065.1|34887_35751_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	27.8	1.2e-15
AWW92066.1|35858_37346_+	hypothetical protein	NA	NA	NA	NA	NA
AWW92067.1|37559_38660_+	hypothetical protein	NA	NA	NA	NA	NA
AWW92068.1|38652_39024_+	hypothetical protein	NA	NA	NA	NA	NA
AWW92069.1|39020_40664_+	DNA primase	NA	NA	NA	NA	NA
AWW92070.1|40888_42574_+	recombinase family protein	NA	A0A0S2SXR4	Bacillus_phage	29.4	2.8e-45
AWW92071.1|42621_43107_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	35.4	4.9e-19
AWW92072.1|43398_43737_+	hypothetical protein	NA	NA	NA	NA	NA
AWW92073.1|43736_43829_+	hypothetical protein	NA	NA	NA	NA	NA
AWW92074.1|43830_44142_+	hypothetical protein	NA	NA	NA	NA	NA
AWW92075.1|44157_44664_+	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
AWW92076.1|44684_45002_+	DNA recombinase	NA	NA	NA	NA	NA
AWW92077.1|45120_46206_+|transposase	transposase	transposase	A0A0A8WIF9	Clostridium_phage	28.3	4.5e-12
AWW92078.1|46202_48095_+|integrase	phage integrase family protein	integrase	NA	NA	NA	NA
AWW92079.1|48101_48479_+|transposase	transposase	transposase	NA	NA	NA	NA
AWW92080.1|48629_49412_+	aminoglycoside nucleotidyltransferase ANT(9)-Ia	NA	NA	NA	NA	NA
AWW92081.1|49537_50269_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(A)	NA	E4ZFQ0	Streptococcus_phage	47.5	1.9e-51
AWW92082.1|50777_51440_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
AWW92083.1|51987_52860_+	HTH domain-containing protein	NA	NA	NA	NA	NA
52806:52822	attR	TGATGAATTACTTTTAT	NA	NA	NA	NA
AWW92084.1|52916_53207_+	hypothetical protein	NA	NA	NA	NA	NA
AWW92085.1|53222_53711_+	hypothetical protein	NA	NA	NA	NA	NA
AWW92086.1|53845_54373_+	hypothetical protein	NA	NA	NA	NA	NA
AWW92087.1|54435_54852_+	hypothetical protein	NA	NA	NA	NA	NA
AWW92088.1|55318_55540_+	hypothetical protein	NA	NA	NA	NA	NA
AWW92089.1|55689_56256_+	peptidase	NA	NA	NA	NA	NA
AWW92090.1|56335_58525_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	25.8	1.4e-41
AWW92091.1|58610_59285_-|transposase	IS6-like element IS257 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	99.1	2.0e-127
AWW92092.1|59552_60914_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AWW92093.1|61213_61621_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AWW92094.1|61637_61991_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
AWW92095.1|61987_62668_+	cytochrome C biosynthesis protein	NA	NA	NA	NA	NA
AWW92096.1|62793_63141_+	mercury transporter	NA	NA	NA	NA	NA
AWW92097.1|63198_64842_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.4	1.7e-50
AWW92098.1|64923_65574_+	organomercurial lyase MerB	NA	NA	NA	NA	NA
AWW92099.1|65576_65759_-	hypothetical protein	NA	NA	NA	NA	NA
AWW92100.1|65768_66317_-	hypothetical protein	NA	NA	NA	NA	NA
AWW92101.1|66402_67077_-|transposase	IS6 family transposase IS431R	transposase	A0A0N9RU54	Staphylococcus_phage	99.1	2.6e-127
>prophage 2
CP027788	Staphylococcus aureus strain CMRSA-6 chromosome, complete genome	3044721	376658	419156	3044721	portal,terminase,head,integrase,tail,capsid,holin	Staphylococcus_phage(87.1%)	62	376548:376565	419888:419905
376548:376565	attL	ATCATACAAGGATGGGAT	NA	NA	NA	NA
AWW92365.1|376658_377864_-|integrase	site-specific integrase	integrase	Q4ZBP1	Staphylococcus_phage	100.0	8.5e-222
AWW92366.1|377974_378154_+	excisionase	NA	A0EWN7	Staphylococcus_virus	100.0	8.3e-25
AWW92367.1|378133_379066_-	hypothetical protein	NA	A0EX19	Staphylococcus_virus	98.1	4.1e-171
AWW92368.1|379097_379823_-	hypothetical protein	NA	A0A0F6N4L7	Staphylococcus_phage	100.0	9.9e-125
AWW92369.1|379850_380525_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0F6N3H6	Staphylococcus_phage	100.0	4.9e-126
AWW92370.1|380541_380874_-	XRE family transcriptional regulator	NA	R4IH08	Staphylococcus_phage	100.0	4.1e-57
AWW92371.1|381137_381332_+	XRE family transcriptional regulator	NA	A0A0F6N3M9	Staphylococcus_phage	100.0	1.1e-25
AWW92372.1|381331_382099_+	phage antirepressor Ant	NA	A0A0F6N3N8	Staphylococcus_phage	100.0	1.1e-142
AWW92373.1|382099_382324_+	hypothetical protein	NA	A0A0F6N4M2	Staphylococcus_phage	100.0	3.2e-34
AWW92374.1|382363_382582_+	hypothetical protein	NA	Q4ZBN1	Staphylococcus_phage	98.6	4.3e-31
AWW92375.1|382611_382875_+	helix-turn-helix domain-containing protein	NA	A0A2I6PEL8	Staphylococcus_phage	100.0	2.5e-46
AWW92376.1|382886_383048_+	DUF1270 domain-containing protein	NA	Q4ZBM9	Staphylococcus_phage	100.0	3.8e-21
AWW92377.1|383139_383400_+	DUF1108 domain-containing protein	NA	Q4ZBM7	Staphylococcus_phage	100.0	1.2e-43
AWW92378.1|383408_383672_+	hypothetical protein	NA	A0A2I6PDG2	Staphylococcus_phage	100.0	7.7e-43
AWW92379.1|383680_385624_+	ATPase	NA	S4V9K6	Staphylococcus_phage	100.0	0.0e+00
AWW92380.1|385625_386546_+	recombinase	NA	A0A1P8L6F6	Staphylococcus_phage	99.7	8.6e-166
AWW92381.1|386626_387244_+	MBL fold metallo-hydrolase	NA	A0A1P8L6F7	Staphylococcus_phage	100.0	1.2e-86
AWW92382.1|387244_387715_+	single-stranded DNA-binding protein	NA	A0A1P8L6D9	Staphylococcus_phage	100.0	5.7e-81
AWW92383.1|387744_388638_+	DnaD domain protein	NA	A0A1P8L6F0	Staphylococcus_phage	100.0	3.2e-141
AWW92384.1|388644_388863_+	hypothetical protein	NA	A0A1P8L6E4	Staphylococcus_phage	100.0	1.4e-37
AWW92385.1|388871_389276_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A075M042	Staphylococcus_phage	100.0	8.4e-73
AWW92386.1|389660_389918_+	DUF3310 domain-containing protein	NA	A0A1X9H067	Staphylococcus_phage	98.8	6.3e-42
AWW92387.1|389914_390163_+	hypothetical protein	NA	A0A0K1LL46	Staphylococcus_phage	97.6	1.2e-40
AWW92388.1|390175_390577_+	hypothetical protein	NA	Q4ZAC1	Staphylococcus_virus	100.0	1.1e-69
AWW92389.1|390573_390921_+	hypothetical protein	NA	D2JGL4	Staphylococcus_phage	100.0	5.9e-59
AWW92390.1|390917_391226_+	hypothetical protein	NA	Q4ZD83	Staphylococcus_virus	100.0	6.2e-52
AWW92391.1|391218_391467_+	DUF1024 domain-containing protein	NA	S4V7K0	Staphylococcus_phage	100.0	4.1e-38
AWW92392.1|391459_391996_+	dUTPase	NA	A0A1X9H0S5	Staphylococcus_phage	99.4	7.2e-96
AWW92393.1|392032_392233_+	DUF1381 domain-containing protein	NA	A0A0H3U2R7	Staphylococcus_phage	77.6	2.7e-16
AWW92394.1|392331_392568_+	hypothetical protein	NA	A0A0N7E0U3	Staphylococcus_phage	100.0	1.3e-36
AWW92395.1|392560_392734_+	transcriptional regulator	NA	R4IFL3	Staphylococcus_phage	98.2	1.1e-21
AWW92396.1|392734_393100_+	hypothetical protein	NA	Q4ZBJ9	Staphylococcus_phage	100.0	3.6e-59
AWW92397.1|393100_393247_+	hypothetical protein	NA	Q4ZBJ8	Staphylococcus_phage	100.0	7.5e-16
AWW92398.1|393270_393711_+	DUF1492 domain-containing protein	NA	Q4ZBJ7	Staphylococcus_phage	100.0	4.1e-73
AWW92399.1|394021_394516_+|terminase	terminase	terminase	R4IH30	Staphylococcus_phage	100.0	1.1e-74
AWW92400.1|394508_395717_+|terminase	PBSX family phage terminase large subunit	terminase	R4IG95	Staphylococcus_phage	100.0	6.1e-236
AWW92401.1|395670_397149_+|portal	phage portal protein	portal	Q4ZB45	Staphylococcus_virus	99.6	3.3e-284
AWW92402.1|397087_398071_+|head	phage head morphogenesis protein	head	A0A0N7E0U6	Staphylococcus_phage	97.4	6.2e-170
AWW92403.1|398072_398279_+	hypothetical protein	NA	A0A0N9BB04	Staphylococcus_phage	100.0	3.2e-28
AWW92404.1|398383_398980_+	hypothetical protein	NA	R4IG73	Staphylococcus_phage	100.0	5.6e-73
AWW92405.1|399000_399825_+|capsid	N4-gp56 family major capsid protein	capsid	R4IH32	Staphylococcus_phage	100.0	5.6e-148
AWW92406.1|399841_400168_+	Rho termination protein	NA	A0A0E3TAL3	Staphylococcus_phage	100.0	4.3e-51
AWW92407.1|400167_400482_+|head,tail	phage head-tail adapter protein	head,tail	R4IFL8	Staphylococcus_phage	100.0	4.0e-54
AWW92408.1|400474_400810_+|head,tail	phage head-tail adapter protein	head,tail	A0A2H4PQL0	Staphylococcus_phage	99.1	2.6e-59
AWW92409.1|400796_401210_+	HK97 gp10 family phage protein	NA	R4IG77	Staphylococcus_phage	100.0	2.0e-77
AWW92410.1|401222_401660_+	DUF3168 domain-containing protein	NA	A0A0E3T9M9	Staphylococcus_phage	99.3	7.9e-77
AWW92411.1|401646_402207_+|tail	phage tail protein	tail	A0A0H4ITY2	Staphylococcus_phage	100.0	5.9e-101
AWW92412.1|402268_402763_+	hypothetical protein	NA	R4IFM1	Staphylococcus_phage	100.0	4.3e-87
AWW92413.1|402783_403125_+	hypothetical protein	NA	A0A2H4PQL5	Staphylococcus_phage	100.0	3.5e-56
AWW92414.1|403127_406097_+|terminase	terminase	terminase	R4IG82	Staphylococcus_phage	99.7	1.5e-280
AWW92415.1|406111_407047_+|tail	phage tail protein	tail	A7YGW1	Staphylococcus_virus	98.7	4.5e-178
AWW92416.1|407057_408941_+	peptidase	NA	A0A0H4ITY6	Staphylococcus_phage	99.2	0.0e+00
AWW92417.1|408953_410852_+	hypothetical protein	NA	Q4ZBQ2	Staphylococcus_phage	99.1	0.0e+00
AWW92418.1|410851_412675_+	DUF2479 domain-containing protein	NA	A0A0E3XBS0	Staphylococcus_phage	100.0	0.0e+00
AWW92419.1|412674_413052_+	DUF2977 domain-containing protein	NA	A0A2H4PQW4	Staphylococcus_phage	99.2	6.9e-61
AWW94980.1|413061_413235_+	XkdX family protein	NA	B2ZZ00	Staphylococcus_phage	100.0	1.0e-27
AWW92420.1|413275_413575_+	DUF2951 domain-containing protein	NA	Q4ZBP8	Staphylococcus_phage	100.0	1.3e-46
AWW92421.1|413711_415586_+	CHAP domain-containing protein	NA	Q4ZBX1	Staphylococcus_virus	100.0	0.0e+00
AWW92422.1|415598_416837_+	DUF2479 domain-containing protein	NA	Q4ZB96	Staphylococcus_virus	97.6	8.8e-206
AWW92423.1|416841_417237_+	hypothetical protein	NA	A0A0H4IPB8	Staphylococcus_phage	97.7	3.3e-66
AWW92424.1|417292_417730_+|holin	phage holin	holin	A0A2H4PQP0	Staphylococcus_phage	100.0	4.1e-73
AWW92425.1|417710_419156_+	CHAP domain-containing protein	NA	Q08JW9	Staphylococcus_phage	99.6	5.3e-295
419888:419905	attR	ATCATACAAGGATGGGAT	NA	NA	NA	NA
>prophage 3
CP027788	Staphylococcus aureus strain CMRSA-6 chromosome, complete genome	3044721	485357	499763	3044721		Streptococcus_phage(90.91%)	14	NA	NA
AWW92498.1|485357_486899_+	GMP synthase (glutamine-hydrolyzing)	NA	A0A1V0SH76	Hokovirus	32.6	1.2e-23
AWW92499.1|488079_488280_-	DUF3173 domain-containing protein	NA	NA	NA	NA	NA
AWW92500.1|488777_489008_-	helix-turn-helix domain-containing protein	NA	A0A1S5SEX1	Streptococcus_phage	78.9	1.0e-27
AWW92501.1|489004_489487_-	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	68.6	8.5e-48
AWW92502.1|489615_489726_-	hypothetical protein	NA	NA	NA	NA	NA
AWW92503.1|489957_490311_+	XRE family transcriptional regulator	NA	A0A1S5SFA6	Streptococcus_phage	89.7	2.2e-53
AWW92504.1|490368_490536_-	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	62.0	2.3e-13
AWW92505.1|490654_492574_-	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	97.2	0.0e+00
AWW92506.1|492589_492676_-	tetracycline resistance protein	NA	NA	NA	NA	NA
AWW94985.1|492950_493889_-	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	56.6	1.1e-83
AWW92507.1|493896_494919_-	peptidase P60	NA	A0A1S5SEZ8	Streptococcus_phage	75.5	2.4e-132
AWW92508.1|494915_496943_-	hypothetical protein	NA	A0A1S5SF30	Streptococcus_phage	65.5	2.3e-195
AWW92509.1|496939_499384_-	ATP/GTP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	78.4	0.0e+00
AWW92510.1|499367_499763_-	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	72.6	5.9e-47
>prophage 4
CP027788	Staphylococcus aureus strain CMRSA-6 chromosome, complete genome	3044721	506200	514367	3044721		Streptococcus_phage(85.71%)	10	NA	NA
AWW92517.1|506200_506701_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	63.0	1.7e-54
AWW92518.1|506761_507541_-	hypothetical protein	NA	NA	NA	NA	NA
AWW92519.1|507582_507804_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	93.2	3.1e-29
AWW92520.1|507800_508091_-	hypothetical protein	NA	NA	NA	NA	NA
AWW92521.1|508087_509272_-	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	68.1	6.3e-161
AWW92522.1|509453_510857_-	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	66.7	7.5e-177
AWW92523.1|510878_511652_-	hypothetical protein	NA	NA	NA	NA	NA
AWW92524.1|511661_512039_-	DUF961 domain-containing protein	NA	A0A1S5SF96	Streptococcus_phage	76.4	9.6e-47
AWW92525.1|512059_512374_-	DUF961 domain-containing protein	NA	A0A1S5SF38	Streptococcus_phage	77.7	1.2e-42
AWW92526.1|512573_514367_-	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	23.8	6.9e-26
>prophage 5
CP027788	Staphylococcus aureus strain CMRSA-6 chromosome, complete genome	3044721	838258	846078	3044721		Hokovirus(16.67%)	10	NA	NA
AWW92823.1|838258_839314_-	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	30.0	2.1e-14
AWW92824.1|839313_840000_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AWW92825.1|839974_840448_-	DoxX family protein	NA	NA	NA	NA	NA
AWW92826.1|840789_841230_-	hypothetical protein	NA	NA	NA	NA	NA
AWW92827.1|841509_842094_-	hypothetical protein	NA	NA	NA	NA	NA
AWW92828.1|842192_842906_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.5	6.5e-52
AWW92829.1|842909_843329_-	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	28.7	3.7e-07
AWW92830.1|843330_843999_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.5	9.6e-66
AWW92831.1|844349_844943_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	42.9	4.4e-38
AWW92832.1|844926_846078_+	anthranilate synthase component I family protein	NA	A0A0B5J984	Pandoravirus	35.7	1.6e-23
>prophage 6
CP027788	Staphylococcus aureus strain CMRSA-6 chromosome, complete genome	3044721	858050	872837	3044721		uncultured_Caudovirales_phage(50.0%)	18	NA	NA
AWW92842.1|858050_859109_+	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	26.7	7.9e-22
AWW92843.1|859459_860002_+	5'(3')-deoxyribonucleotidase	NA	NA	NA	NA	NA
AWW92844.1|860173_860269_+	hypothetical protein	NA	NA	NA	NA	NA
AWW92845.1|860681_861599_-	lipid kinase	NA	A0A1V0SBJ0	Catovirus	22.0	3.7e-07
AWW92846.1|861689_861791_+	hypothetical protein	NA	NA	NA	NA	NA
AWW92847.1|861868_863374_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.2	2.0e-58
AWW92848.1|863439_863685_-	hypothetical protein	NA	NA	NA	NA	NA
AWW92849.1|863714_864215_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	71.5	5.9e-52
AWW92850.1|864234_865101_-	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AWW92851.1|865485_865752_+	ribonucleoside-diphosphate reductase	NA	NA	NA	NA	NA
AWW92852.1|865901_866300_+	protein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	72.0	1.2e-52
AWW92853.1|866262_868368_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	91.7	0.0e+00
AWW92854.1|868485_869457_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	91.3	4.2e-171
AWW92855.1|869589_869694_+	hypothetical protein	NA	NA	NA	NA	NA
AWW92856.1|869970_870126_+	hypothetical protein	NA	NA	NA	NA	NA
AWW95002.1|870164_871136_+	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	78.9	4.3e-139
AWW92857.1|871122_872079_+	iron ABC transporter permease	NA	A0A2H4J116	uncultured_Caudovirales_phage	57.8	1.2e-05
AWW92858.1|872075_872837_+	iron ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	31.6	8.5e-18
>prophage 7
CP027788	Staphylococcus aureus strain CMRSA-6 chromosome, complete genome	3044721	951301	966109	3044721	terminase,coat,integrase	Staphylococcus_phage(89.47%)	23	953836:953854	968398:968416
AWW92939.1|951301_952327_+	methionine import ATP-binding protein MetN 2	NA	G9BWD6	Planktothrix_phage	36.8	1.2e-27
AWW92940.1|952319_953015_+	ABC transporter permease	NA	NA	NA	NA	NA
AWW92941.1|953032_953854_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
953836:953854	attL	AGTTATTCCTGCTAAATAA	NA	NA	NA	NA
AWW92942.1|953997_955218_-|integrase	site-specific integrase	integrase	Q4ZE80	Staphylococcus_phage	47.3	3.5e-98
AWW92943.1|955305_956034_-	exotoxin	NA	A0EX09	Staphylococcus_phage	32.3	2.4e-22
AWW95005.1|956057_956786_-	exotoxin	NA	A0EX09	Staphylococcus_phage	35.4	7.9e-29
AWW92944.1|956960_957695_-	XRE family transcriptional regulator	NA	Q4ZE79	Staphylococcus_phage	98.4	8.5e-132
AWW92945.1|957844_958057_+	XRE family transcriptional regulator	NA	Q4ZE78	Staphylococcus_phage	98.6	3.4e-33
AWW92946.1|958057_958330_+	pathogenicity island protein	NA	Q4ZE77	Staphylococcus_phage	100.0	3.4e-46
AWW95006.1|958341_958488_+	pathogenicity island protein	NA	NA	NA	NA	NA
AWW92947.1|958480_958690_+	pathogenicity island protein	NA	Q4ZE76	Staphylococcus_phage	95.7	7.7e-30
AWW92948.1|958692_958986_+	DUF1474 domain-containing protein	NA	A0A1W6JQH0	Staphylococcus_phage	61.8	1.8e-24
AWW92949.1|959073_959943_+	mobile element-associated protein	NA	A0A1W6JQL5	Staphylococcus_phage	96.9	4.2e-162
AWW92950.1|959959_961417_+	virulence-associated protein E	NA	A0A1W6JQD6	Staphylococcus_phage	96.7	1.4e-279
AWW92951.1|961718_962081_+	pathogenicity island protein	NA	A0A1W6JQD5	Staphylococcus_phage	96.7	2.9e-64
AWW92952.1|962082_962367_+	pathogenicity island protein	NA	A0A1W6JQE4	Staphylococcus_phage	98.9	1.6e-49
AWW92953.1|962363_963005_+	pathogenicity island protein	NA	Q4ZE67	Staphylococcus_phage	94.8	2.7e-113
AWW92954.1|963453_963795_+	pathogenicity island protein	NA	Q4ZE66	Staphylococcus_phage	98.2	1.6e-56
AWW92955.1|963806_964385_+	pathogenicity island protein	NA	A0A2H4JBG0	uncultured_Caudovirales_phage	40.0	3.3e-30
AWW95007.1|964402_964621_+	hypothetical protein	NA	NA	NA	NA	NA
AWW92956.1|964671_965199_+|coat	spore coat protein	coat	Q4ZE87	Staphylococcus_phage	96.0	1.6e-87
AWW95008.1|965330_965543_+	pathogenicity island family protein	NA	Q4ZE86	Staphylococcus_phage	97.1	3.2e-31
AWW92957.1|965539_966109_+|terminase	terminase small subunit	terminase	A0A1W6JQF0	Staphylococcus_phage	98.4	1.2e-101
968398:968416	attR	AGTTATTCCTGCTAAATAA	NA	NA	NA	NA
>prophage 8
CP027788	Staphylococcus aureus strain CMRSA-6 chromosome, complete genome	3044721	1058292	1113159	3044721	protease,bacteriocin,holin,tRNA	Streptococcus_phage(28.57%)	57	NA	NA
AWW93048.1|1058292_1059282_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AWW93049.1|1059576_1059972_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
AWW93050.1|1060342_1061062_+	adaptor protein MecA	NA	NA	NA	NA	NA
AWW93051.1|1061182_1061440_+	competence protein	NA	NA	NA	NA	NA
AWW93052.1|1061445_1062168_+	competence protein	NA	NA	NA	NA	NA
AWW93053.1|1062215_1064024_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	24.4	9.3e-47
AWW93054.1|1064483_1065290_-	DsbA family protein	NA	NA	NA	NA	NA
AWW93055.1|1065312_1065678_-	globin	NA	NA	NA	NA	NA
AWW93056.1|1065781_1066375_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
AWW93057.1|1066560_1066908_+	hypothetical protein	NA	NA	NA	NA	NA
AWW93058.1|1066924_1067560_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
AWW93059.1|1067576_1068386_+	NAD(+) kinase	NA	NA	NA	NA	NA
AWW93060.1|1068382_1069237_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
AWW93061.1|1069257_1070643_+	magnesium transporter	NA	NA	NA	NA	NA
AWW93062.1|1070652_1072497_+	sodium:proton antiporter	NA	NA	NA	NA	NA
AWW93063.1|1072774_1073545_+	enoyl-[acyl-carrier-protein] reductase FabI	NA	NA	NA	NA	NA
AWW93064.1|1073739_1074825_-	AI-2E family transporter	NA	NA	NA	NA	NA
AWW93065.1|1075166_1076735_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
AWW93066.1|1076876_1077635_+	esterase family protein	NA	NA	NA	NA	NA
AWW93067.1|1077828_1078338_+	hypothetical protein	NA	NA	NA	NA	NA
AWW93068.1|1078450_1079659_-	MFS transporter	NA	NA	NA	NA	NA
AWW93069.1|1079618_1080794_-	diacylglycerol beta-glucosyltransferase	NA	NA	NA	NA	NA
AWW93070.1|1081226_1082708_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L- lysine ligase	NA	NA	NA	NA	NA
AWW93071.1|1082691_1082952_+	hypothetical protein	NA	NA	NA	NA	NA
AWW93072.1|1082951_1084514_+	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	28.2	4.9e-36
AWW93073.1|1084815_1085619_+	hypothetical protein	NA	S5MAL1	Bacillus_phage	40.5	1.6e-30
AWW93074.1|1085837_1088162_+	PDZ domain-containing protein	NA	W5SAB9	Pithovirus	27.4	2.8e-11
AWW93075.1|1088178_1089537_+	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
AWW93076.1|1089675_1091187_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
AWW93077.1|1091673_1092243_-	competence protein ComK	NA	NA	NA	NA	NA
AWW93078.1|1092452_1092671_+	IDEAL domain-containing protein	NA	NA	NA	NA	NA
AWW93079.1|1092751_1093738_-	lipoate--protein ligase	NA	NA	NA	NA	NA
AWW93080.1|1093936_1094113_+	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
AWW93081.1|1094127_1094730_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWW95010.1|1095030_1095108_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
AWW93082.1|1095646_1095748_+	hypothetical protein	NA	NA	NA	NA	NA
AWW95011.1|1095757_1096030_+|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
AWW93083.1|1096073_1098038_+|bacteriocin	bacteriocin-associated integral membrane family protein	bacteriocin	NA	NA	NA	NA
AWW93084.1|1098040_1098361_+	YxeA family protein	NA	NA	NA	NA	NA
AWW93085.1|1098357_1098999_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.7	2.2e-19
AWW93086.1|1099086_1099377_-	hypothetical protein	NA	NA	NA	NA	NA
AWW93087.1|1099655_1099943_+	hypothetical protein	NA	NA	NA	NA	NA
AWW93088.1|1099948_1101430_+	glycosyl transferase family 1	NA	NA	NA	NA	NA
AWW93089.1|1101518_1101875_-	DoxX family protein	NA	NA	NA	NA	NA
AWW93090.1|1102351_1103311_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWW93091.1|1103356_1103488_-	hypothetical protein	NA	NA	NA	NA	NA
AWW93092.1|1103551_1103842_-	NINE protein	NA	A0A060AN66	Enterococcus_phage	38.0	7.5e-07
AWW93093.1|1103931_1104483_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWW93094.1|1104534_1105473_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
AWW93095.1|1105623_1105728_+	hypothetical protein	NA	NA	NA	NA	NA
AWW93096.1|1105804_1107016_+	isochorismate synthase	NA	NA	NA	NA	NA
AWW93097.1|1107002_1108676_+	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylate synthase	NA	NA	NA	NA	NA
AWW93098.1|1108662_1109466_+	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
AWW93099.1|1109458_1110280_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
AWW93100.1|1110518_1110848_-	staphostatin B	NA	NA	NA	NA	NA
AWW93101.1|1110885_1112067_-|protease	cysteine protease staphopain B	protease	NA	NA	NA	NA
AWW93102.1|1112148_1113159_-|protease	serine protease	protease	A0A2H4PQP7	Staphylococcus_phage	32.3	6.2e-16
>prophage 9
CP027788	Staphylococcus aureus strain CMRSA-6 chromosome, complete genome	3044721	1132053	1140526	3044721		Synechococcus_phage(33.33%)	9	NA	NA
AWW93119.1|1132053_1132536_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	6.2e-22
AWW93120.1|1132522_1133647_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AWW93121.1|1133650_1134355_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	42.1	7.3e-48
AWW93122.1|1134354_1134618_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AWW93123.1|1134619_1135291_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AWW93124.1|1135283_1137473_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.7	1.0e-140
AWW93125.1|1137451_1138936_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.7	3.2e-45
AWW93126.1|1138928_1139957_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.4	1.3e-61
AWW93127.1|1139959_1140526_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.1	6.1e-29
>prophage 10
CP027788	Staphylococcus aureus strain CMRSA-6 chromosome, complete genome	3044721	1400049	1407806	3044721	transposase,head	Staphylococcus_phage(71.43%)	15	NA	NA
AWW93369.1|1400049_1400247_+	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	48.4	1.7e-10
AWW93370.1|1400934_1401159_+	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	71.0	4.3e-18
AWW93371.1|1401452_1401659_+	hypothetical protein	NA	A0A2H4PQT0	Staphylococcus_phage	59.7	1.3e-13
AWW93372.1|1402359_1402470_+	hypothetical protein	NA	NA	NA	NA	NA
AWW93373.1|1402897_1403083_+	hypothetical protein	NA	A0A0F6N3H3	Staphylococcus_phage	78.7	2.4e-19
AWW93374.1|1403594_1403699_+	hypothetical protein	NA	NA	NA	NA	NA
AWW93375.1|1403653_1403827_+	hypothetical protein	NA	NA	NA	NA	NA
AWW93376.1|1403827_1404079_+	hypothetical protein	NA	NA	NA	NA	NA
AWW93377.1|1404124_1404709_+|head	phage head morphogenesis protein	head	Q4ZE35	Staphylococcus_virus	72.0	2.0e-30
AWW93378.1|1404917_1406090_+|transposase	IS256 family transposase IS256	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
AWW93379.1|1406161_1406410_+	hypothetical protein	NA	NA	NA	NA	NA
AWW93380.1|1406444_1406567_+	hypothetical protein	NA	NA	NA	NA	NA
AWW93381.1|1406686_1406953_+	hypothetical protein	NA	NA	NA	NA	NA
AWW93382.1|1406949_1407087_+	hypothetical protein	NA	NA	NA	NA	NA
AWW93383.1|1407515_1407806_+	hypothetical protein	NA	S6B1L4	Thermus_phage	35.1	5.4e-05
>prophage 11
CP027788	Staphylococcus aureus strain CMRSA-6 chromosome, complete genome	3044721	1683395	1691707	3044721	tRNA	Staphylococcus_phage(16.67%)	7	NA	NA
AWW93637.1|1683395_1684181_-	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	8.0e-19
AWW93638.1|1684306_1685197_-	endonuclease	NA	A0A2H4UU70	Bodo_saltans_virus	33.1	2.0e-26
AWW93639.1|1685206_1686553_-	DEAD/DEAH box family ATP-dependent RNA helicase	NA	A0A1V0SIR5	Klosneuvirus	33.7	5.3e-55
AWW93640.1|1686666_1687767_-	Nif3-like dinuclear metal center hexameric protein	NA	A0A1S5V250	Saudi_moumouvirus	29.6	5.2e-08
AWW93641.1|1687769_1688447_-|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
AWW93642.1|1688577_1689684_-	RNA polymerase sigma factor SigA	NA	A0A2I7SAT0	Vibrio_phage	38.1	1.1e-37
AWW93643.1|1689907_1691707_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.0	4.6e-54
>prophage 12
CP027788	Staphylococcus aureus strain CMRSA-6 chromosome, complete genome	3044721	1762177	1771220	3044721	tRNA	uncultured_Mediterranean_phage(50.0%)	7	NA	NA
AWW93713.1|1762177_1762696_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.5	5.6e-29
AWW93714.1|1762717_1764991_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.8	1.2e-62
AWW93715.1|1765193_1767473_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.8	1.8e-31
AWW93716.1|1767747_1768008_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.3	8.2e-05
AWW93717.1|1768026_1769166_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.7	5.4e-85
AWW93718.1|1769188_1770214_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
AWW93719.1|1770215_1771220_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	1.7e-05
>prophage 13
CP027788	Staphylococcus aureus strain CMRSA-6 chromosome, complete genome	3044721	1903400	1916129	3044721	tRNA	Staphylococcus_phage(100.0%)	6	NA	NA
AWW93840.1|1903400_1909961_-	DUF1542 domain-containing protein	NA	A0A2H4PQU6	Staphylococcus_phage	98.1	2.0e-304
AWW93841.1|1910286_1910598_-	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	100.0	1.6e-52
AWW93842.1|1910619_1913037_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	99.2	0.0e+00
AWW93843.1|1913324_1914506_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	100.0	5.6e-218
AWW93844.1|1914615_1915569_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	100.0	2.2e-79
AWW93845.1|1915565_1916129_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	99.5	8.3e-103
>prophage 14
CP027788	Staphylococcus aureus strain CMRSA-6 chromosome, complete genome	3044721	1919289	1982824	3044721	protease,transposase	Staphylococcus_phage(94.55%)	70	NA	NA
AWW93850.1|1919289_1920291_+	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	99.7	9.0e-185
AWW93851.1|1920412_1920877_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	99.4	5.8e-70
AWW93852.1|1920889_1922071_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	99.2	1.6e-225
AWW93853.1|1922081_1922714_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	99.5	1.7e-112
AWW95030.1|1922720_1923752_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	99.4	4.8e-197
AWW93854.1|1924244_1925747_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2H4PQX2	Staphylococcus_phage	100.0	2.3e-30
AWW93855.1|1926269_1926584_+	ArsR family transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	100.0	2.0e-53
AWW93856.1|1926583_1927876_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	99.5	5.0e-228
AWW93857.1|1927893_1928289_+	protein ArsC	NA	A0A2H4PQT9	Staphylococcus_phage	100.0	6.3e-73
AWW93858.1|1928583_1929438_-	autolysin	NA	Q4ZCC7	Staphylococcus_virus	38.6	9.8e-39
AWW93859.1|1929713_1929938_-	hypothetical protein	NA	NA	NA	NA	NA
AWW93860.1|1930136_1930607_+	RNA polymerase sigma factor SigS	NA	A0A2H4PQT5	Staphylococcus_phage	99.4	1.0e-82
AWW93861.1|1930719_1931163_+	competence protein ComK	NA	NA	NA	NA	NA
AWW93862.1|1931149_1931593_-	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	85.0	3.0e-55
AWW93863.1|1931888_1932524_+|protease	CPBP family intramembrane metalloprotease SdpA	protease	NA	NA	NA	NA
AWW93864.1|1932963_1933677_-	transaldolase	NA	M1PR54	Cyanophage	35.3	5.5e-19
AWW93865.1|1933936_1934239_+	hypothetical protein	NA	NA	NA	NA	NA
AWW93866.1|1934494_1934860_+	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	100.0	3.6e-59
AWW93867.1|1934856_1935210_+	camphor resistance protein CrcB	NA	A0A2H4PQQ7	Staphylococcus_phage	99.1	1.0e-21
AWW93868.1|1937286_1938138_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	97.8	7.0e-154
AWW93869.1|1938349_1939258_-	NERD domain-containing protein	NA	A0A2H4PQQ8	Staphylococcus_phage	98.7	3.2e-136
AWW93870.1|1939382_1940576_-	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	99.7	1.9e-218
AWW93871.1|1940946_1942539_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	100.0	0.0e+00
AWW93872.1|1942674_1943160_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	35.4	4.9e-19
AWW95031.1|1943534_1944281_-	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	98.4	7.1e-142
AWW93873.1|1944285_1944759_-	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	98.1	4.7e-83
AWW93874.1|1944824_1945082_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	100.0	7.2e-46
AWW93875.1|1945078_1946080_-	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	97.6	4.8e-186
AWW93876.1|1946084_1947563_-	2-succinylbenzoate-CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	97.0	2.0e-281
AWW95032.1|1947721_1948177_-	DUF4909 domain-containing protein	NA	A0A2H4PQN7	Staphylococcus_phage	98.6	3.0e-79
AWW93877.1|1948479_1949130_+	calcium-binding protein	NA	A0A2H4PQM8	Staphylococcus_phage	88.4	2.7e-44
AWW93878.1|1949210_1950206_+	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	96.4	7.1e-73
AWW93879.1|1950281_1950908_+	hypothetical protein	NA	A0A2H4PQM7	Staphylococcus_phage	82.7	7.1e-79
AWW93880.1|1950948_1951293_+	DUF3969 domain-containing protein	NA	A0A2H4PQN6	Staphylococcus_phage	92.0	6.3e-53
AWW93881.1|1951390_1951942_+	hypothetical protein	NA	A0A2H4PQN4	Staphylococcus_phage	94.1	1.0e-20
AWW93882.1|1952159_1952801_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4PQN8	Staphylococcus_phage	93.2	2.6e-76
AWW93883.1|1952914_1953100_-	hypothetical protein	NA	NA	NA	NA	NA
AWW93884.1|1953101_1953278_-	hypothetical protein	NA	NA	NA	NA	NA
AWW93885.1|1953288_1953672_-	hypothetical protein	NA	NA	NA	NA	NA
AWW93886.1|1953863_1954073_-|transposase	transposase	transposase	A0A2H4PQV6	Staphylococcus_phage	100.0	1.4e-31
AWW93887.1|1954275_1954419_-	hypothetical protein	NA	A0A2H4PQU1	Staphylococcus_phage	100.0	6.4e-20
AWW93888.1|1954621_1954717_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
AWW93889.1|1954839_1954941_+	hypothetical protein	NA	NA	NA	NA	NA
AWW95033.1|1955288_1955648_-	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
AWW93890.1|1956186_1957452_-	hypothetical protein	NA	A0A2H4PQT3	Staphylococcus_phage	99.7	2.6e-221
AWW93891.1|1958763_1961631_-	ATP-binding protein	NA	A0A2H4PQV1	Staphylococcus_phage	100.0	7.7e-229
AWW93892.1|1962480_1963680_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	99.7	5.5e-229
AWW93893.1|1963672_1965412_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	99.4	4.4e-288
AWW93894.1|1965392_1965527_-	hypothetical protein	NA	NA	NA	NA	NA
AWW93895.1|1965591_1966311_-|protease	serine protease SplF	protease	A0A2H4PQP1	Staphylococcus_phage	100.0	1.1e-131
AWW93896.1|1966461_1967178_-|protease	serine protease SplE	protease	A0A2H4PQN5	Staphylococcus_phage	100.0	1.1e-131
AWW93897.1|1967279_1967387_+	hypothetical protein	NA	NA	NA	NA	NA
AWW93898.1|1967335_1968055_-|protease	serine protease SplD	protease	A0A2H4PQP9	Staphylococcus_phage	99.6	4.6e-130
AWW93899.1|1968175_1968895_-|protease	serine protease SplC	protease	A0A2H4PQP7	Staphylococcus_phage	99.2	1.2e-130
AWW93900.1|1968952_1969675_-|protease	serine protease SplB	protease	A0A2H4PQN0	Staphylococcus_phage	99.6	2.4e-131
AWW93901.1|1969799_1970507_-|protease	serine protease SplA	protease	A0A2H4PQN3	Staphylococcus_phage	100.0	2.6e-130
AWW93902.1|1970942_1971161_-	hypothetical protein	NA	NA	NA	NA	NA
AWW93903.1|1971470_1972037_+	DUF4888 domain-containing protein	NA	A0A2H4PQH6	Staphylococcus_phage	100.0	3.3e-99
AWW93904.1|1972510_1973209_-	BsaG protein	NA	A0A2H4PQH0	Staphylococcus_phage	94.4	3.8e-113
AWW93905.1|1973205_1973967_-	lantibiotic immunity ABC transporter MutE/EpiE family permease subunit	NA	A0A2H4PQH2	Staphylococcus_phage	100.0	4.4e-131
AWW93906.1|1973963_1974656_-	lantibiotic ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	100.0	6.2e-124
AWW93907.1|1974678_1976052_-	peptidase S8	NA	A0A2H4PQH1	Staphylococcus_phage	100.0	2.9e-258
AWW93908.1|1976061_1976580_-	enterotoxin	NA	A0A2H4PQG9	Staphylococcus_phage	100.0	2.0e-95
AWW93909.1|1976595_1977840_-	lanthionine synthetase	NA	A0A2H4PQH9	Staphylococcus_phage	100.0	5.1e-238
AWW93910.1|1977832_1979575_-	lantibiotic dehydratase	NA	A0A2H4PQG8	Staphylococcus_phage	54.1	2.5e-259
AWW93911.1|1979639_1979783_-	gallidermin/nisin family lantibiotic	NA	A0A2H4PQH4	Staphylococcus_phage	80.9	5.3e-14
AWW93912.1|1980226_1980418_+	hypothetical protein	NA	NA	NA	NA	NA
AWW93913.1|1980519_1980663_-	gallidermin/nisin family lantibiotic	NA	NA	NA	NA	NA
AWW93914.1|1980903_1981887_-	bi-component leukocidin LukED subunit D	NA	A0A2H4PQH7	Staphylococcus_phage	99.1	2.3e-185
AWW93915.1|1981888_1982824_-	beta-channel forming cytolysin	NA	A0A2H4PQI5	Staphylococcus_phage	99.7	5.1e-174
>prophage 15
CP027788	Staphylococcus aureus strain CMRSA-6 chromosome, complete genome	3044721	2080497	2165914	3044721	portal,terminase,head,integrase,tail,protease,capsid,holin	Staphylococcus_phage(94.87%)	111	2129791:2129808	2155838:2155855
AWW94004.1|2080497_2081664_+|protease	cysteine protease staphopain A	protease	NA	NA	NA	NA
AWW94005.1|2081694_2082021_+	staphostatin A	NA	NA	NA	NA	NA
AWW94006.1|2082312_2082486_-	NETI motif-containing protein	NA	NA	NA	NA	NA
AWW94007.1|2082466_2083069_-	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
AWW94008.1|2083339_2084161_-	NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.7	1.8e-69
AWW94009.1|2084153_2085623_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	45.1	4.5e-108
AWW94010.1|2085806_2086883_+	nitric oxide synthase oxygenase	NA	NA	NA	NA	NA
AWW94011.1|2086902_2087697_+	ACT domain-containing protein	NA	NA	NA	NA	NA
AWW94012.1|2087768_2087876_+	hypothetical protein	NA	NA	NA	NA	NA
AWW94013.1|2087886_2089449_-	sodium-dependent dicarboxylate transporter SdcS	NA	NA	NA	NA	NA
AWW94014.1|2089653_2090751_-	pectate lyase	NA	U5PWM6	Bacillus_phage	34.6	1.9e-47
AWW94015.1|2091122_2091683_+	cysteine hydrolase	NA	G3MA16	Bacillus_virus	41.2	2.0e-32
AWW94016.1|2091735_2092665_+	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
AWW94017.1|2092859_2093033_-	hypothetical protein	NA	NA	NA	NA	NA
AWW94018.1|2093084_2094464_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AWW94019.1|2094583_2095612_-	hypothetical protein	NA	NA	NA	NA	NA
AWW94020.1|2095880_2096282_+	YolD-like family protein	NA	U3PG23	Staphylococcus_phage	42.9	6.0e-23
AWW94021.1|2096854_2097028_-	hypothetical protein	NA	NA	NA	NA	NA
AWW94022.1|2097478_2098519_+	linear amide C-N hydrolase	NA	NA	NA	NA	NA
AWW94023.1|2098575_2099418_-	hypothetical protein	NA	NA	NA	NA	NA
AWW94024.1|2099414_2099972_-	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
AWW94025.1|2100031_2100556_-	hypothetical protein	NA	NA	NA	NA	NA
AWW94026.1|2100676_2101240_+	thioredoxin family protein	NA	NA	NA	NA	NA
AWW94027.1|2101305_2102046_-	phenol-soluble modulin export ABC transporter permease subunit PmtD	NA	NA	NA	NA	NA
AWW94028.1|2102045_2102918_-	phenol-soluble modulin export ABC transporter ATP-binding protein PmtC	NA	A0A2H4PQG7	Staphylococcus_phage	35.2	6.1e-28
AWW94029.1|2102914_2103595_-	phenol-soluble modulin export ABC transporter permease subunit PmtB	NA	NA	NA	NA	NA
AWW94030.1|2103595_2104492_-	phenol-soluble modulin export ABC transporter ATP-binding protein PmtA	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	1.1e-16
AWW94031.1|2104488_2104869_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWW94032.1|2105132_2105309_-	hypothetical protein	NA	NA	NA	NA	NA
AWW94033.1|2105551_2105650_-	hypothetical protein	NA	NA	NA	NA	NA
AWW94034.1|2105849_2107136_+	hypothetical protein	NA	NA	NA	NA	NA
AWW94035.1|2107459_2107750_-	MAP domain-containing protein	NA	NA	NA	NA	NA
AWW94036.1|2107760_2109515_-	MAP domain-containing protein	NA	NA	NA	NA	NA
AWW94037.1|2109900_2110101_+	hypothetical protein	NA	A0A1P8L6A7	Staphylococcus_phage	100.0	3.4e-27
AWW94038.1|2110472_2110652_+	hypothetical protein	NA	A0A1W6JQ29	Staphylococcus_phage	100.0	2.2e-25
AWW94039.1|2110675_2110984_+	hypothetical protein	NA	M9NTD8	Staphylococcus_phage	100.0	2.1e-39
AWW94040.1|2110962_2111223_+	hypothetical protein	NA	M9NS66	Staphylococcus_phage	100.0	2.3e-23
AWW94041.1|2111275_2111626_-	inhibitor	NA	A7TWS0	Staphylococcus_phage	100.0	7.5e-54
AWW94042.1|2112135_2112594_-	amidase	NA	R9QTN8	Staphylococcus_phage	98.7	2.4e-84
AWW94043.1|2112519_2112675_+	amidase	NA	NA	NA	NA	NA
AWW94044.1|2113122_2113614_-	kinase	NA	A7TWR8	Staphylococcus_phage	100.0	8.0e-86
AWW94045.1|2113804_2114560_-	CHAP domain-containing protein	NA	D2JLG5	Staphylococcus_phage	100.0	3.4e-152
AWW94046.1|2114571_2114826_-|holin	phage holin	holin	D2JLG4	Staphylococcus_phage	100.0	4.1e-41
AWW95038.1|2115037_2115214_-|holin	putative holin-like toxin	holin	D2JLG3	Staphylococcus_phage	96.6	3.8e-22
AWW94047.1|2115322_2116096_-	enterotoxin	NA	A0A1X9H080	Staphylococcus_phage	100.0	1.1e-145
AWW94048.1|2116468_2116843_-	hypothetical protein	NA	G4KNR3	Staphylococcus_phage	100.0	3.3e-39
AWW94049.1|2116898_2117186_-	hypothetical protein	NA	A0A1X9H0N7	Staphylococcus_phage	100.0	7.6e-44
AWW94050.1|2117231_2117384_-	hypothetical protein	NA	A0A1W6JPL6	Staphylococcus_phage	98.0	1.7e-18
AWW94051.1|2117376_2121159_-	hypothetical protein	NA	A0A1X9H096	Staphylococcus_phage	99.7	0.0e+00
AWW94052.1|2121174_2122659_-|tail	phage tail protein	tail	A0A2I6PDJ0	Staphylococcus_phage	100.0	1.2e-297
AWW94053.1|2122655_2127185_-|tail	phage tail tape measure protein	tail	A0A1X9H084	Staphylococcus_phage	100.0	0.0e+00
AWW94054.1|2127429_2127780_-	hypothetical protein	NA	G4KNQ8	Staphylococcus_phage	100.0	7.8e-59
AWW94055.1|2127829_2128054_-	hypothetical protein	NA	A0A075LYE8	Staphylococcus_phage	98.6	8.8e-32
AWW94056.1|2128095_2128740_-|tail	phage tail protein	tail	W5R9H4	Staphylococcus_phage	100.0	6.5e-120
AWW94057.1|2128740_2129148_-	hypothetical protein	NA	G4KNQ6	Staphylococcus_phage	100.0	7.1e-72
AWW94058.1|2129144_2129549_-	hypothetical protein	NA	A0A2I6PDJ6	Staphylococcus_phage	100.0	4.3e-69
AWW94059.1|2129545_2129908_-|head,tail	phage head-tail adapter protein	head,tail	G4KNQ4	Staphylococcus_phage	100.0	4.4e-65
2129791:2129808	attL	ATAATTTTTCTTCTTTTT	NA	NA	NA	NA
AWW94060.1|2129891_2130176_-|head,tail	phage head-tail adapter protein	head,tail	A0A2I6PDJ5	Staphylococcus_phage	100.0	2.3e-45
AWW94061.1|2130165_2130450_-	hypothetical protein	NA	A0A2I6PDJ3	Staphylococcus_phage	100.0	1.8e-45
AWW94062.1|2130469_2131615_-|capsid	phage major capsid protein	capsid	A0A1X9H072	Staphylococcus_phage	100.0	5.6e-215
AWW94063.1|2131638_2132376_-|protease	Clp protease ClpP	protease	C8CH20	Staphylococcus_phage	100.0	2.3e-129
AWW94064.1|2132359_2133547_-|portal	phage portal protein	portal	A0A2I6PDI1	Staphylococcus_phage	100.0	1.0e-219
AWW94065.1|2133562_2135224_-|terminase	terminase large subunit	terminase	A0A2I6PDJ8	Staphylococcus_phage	100.0	0.0e+00
AWW94066.1|2135220_2135565_-	hypothetical protein	NA	G4KNP9	Staphylococcus_phage	100.0	9.4e-57
AWW94067.1|2135695_2135995_-	HNH endonuclease	NA	A0EWY8	Staphylococcus_phage	100.0	4.6e-52
AWW94068.1|2136226_2136643_-	transcriptional regulator	NA	A0A1X9H0U8	Staphylococcus_phage	100.0	2.9e-76
AWW94069.1|2136670_2136871_-	DUF1514 domain-containing protein	NA	R9QT57	Staphylococcus_phage	98.5	1.4e-28
AWW94070.1|2136870_2137020_-	transcriptional regulator	NA	A0A1W6JPZ2	Staphylococcus_phage	100.0	4.8e-18
AWW94071.1|2137016_2137403_-	hypothetical protein	NA	W5R986	Staphylococcus_phage	100.0	3.0e-64
AWW94072.1|2137399_2137606_-	DUF1381 domain-containing protein	NA	A0A1X9H0C2	Staphylococcus_phage	100.0	1.3e-21
AWW94073.1|2137642_2138179_-	dUTPase	NA	A0A1X9H0S5	Staphylococcus_phage	100.0	1.4e-96
AWW94074.1|2138171_2138582_-	acetyltransferase	NA	C8CH13	Staphylococcus_phage	100.0	2.3e-70
AWW94075.1|2138578_2139064_-	DUF1024 domain-containing protein	NA	A0A1X9H0D4	Staphylococcus_phage	93.4	3.6e-70
AWW94076.1|2139056_2139341_-	hypothetical protein	NA	S4V9L1	Staphylococcus_phage	97.9	2.1e-46
AWW94077.1|2139337_2139787_-	hypothetical protein	NA	A0A2I6PDH2	Staphylococcus_phage	99.3	2.1e-80
AWW94078.1|2139851_2140100_-	hypothetical protein	NA	A0A0K1LL46	Staphylococcus_phage	97.6	1.2e-40
AWW94079.1|2140096_2140354_-	DUF3310 domain-containing protein	NA	A0A1X9H067	Staphylococcus_phage	98.8	6.3e-42
AWW94080.1|2140738_2141143_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A075M042	Staphylococcus_phage	100.0	8.4e-73
AWW94081.1|2141151_2141370_-	hypothetical protein	NA	A0A1P8L6E4	Staphylococcus_phage	100.0	1.4e-37
AWW94082.1|2141376_2142270_-	DnaD domain protein	NA	A0A1P8L6F0	Staphylococcus_phage	100.0	3.2e-141
AWW94083.1|2142299_2142770_-	single-stranded DNA-binding protein	NA	A0A1P8L6D9	Staphylococcus_phage	100.0	5.7e-81
AWW94084.1|2142770_2143388_-	MBL fold metallo-hydrolase	NA	A0A1P8L6F7	Staphylococcus_phage	100.0	1.2e-86
AWW94085.1|2143468_2144389_-	recombinase	NA	A0A1P8L6F6	Staphylococcus_phage	99.7	8.6e-166
AWW94086.1|2144390_2146334_-	ATPase	NA	S4V9K6	Staphylococcus_phage	100.0	0.0e+00
AWW94087.1|2146342_2146606_-	hypothetical protein	NA	A0A2I6PDG2	Staphylococcus_phage	100.0	7.7e-43
AWW94088.1|2146614_2146935_-	DUF1108 domain-containing protein	NA	Q8SDW6	Staphylococcus_phage	99.1	1.3e-52
AWW94089.1|2146855_2147185_-	hypothetical protein	NA	D2JGJ7	Staphylococcus_phage	100.0	1.4e-33
AWW94090.1|2147274_2147436_-	DUF1270 domain-containing protein	NA	D2JGJ6	Staphylococcus_phage	100.0	4.3e-20
AWW94091.1|2147432_2147753_-	DUF771 domain-containing protein	NA	A0A2I6PDH6	Staphylococcus_phage	100.0	1.5e-56
AWW94092.1|2147811_2148444_+	hypothetical protein	NA	A7TW95	Staphylococcus_phage	100.0	1.5e-113
AWW94093.1|2148458_2148599_-	hypothetical protein	NA	A0A2I6PDG0	Staphylococcus_phage	100.0	1.9e-16
AWW94094.1|2148629_2148827_-	hypothetical protein	NA	A0A1W6JPV3	Staphylococcus_phage	100.0	1.2e-24
AWW94095.1|2148842_2149592_-	oxidoreductase	NA	O80074	Staphylococcus_phage	100.0	2.0e-136
AWW94096.1|2149642_2149972_+	hypothetical protein	NA	A0A0H3U4Z1	Staphylococcus_phage	100.0	4.6e-53
AWW94097.1|2149960_2150176_-	DUF2829 domain-containing protein	NA	A0A0H3U4C7	Staphylococcus_phage	100.0	4.8e-35
AWW94098.1|2150191_2150455_-	XRE family transcriptional regulator	NA	A0A2I6PF09	Staphylococcus_phage	100.0	7.2e-41
AWW94099.1|2150451_2150625_-	transcriptional regulator	NA	NA	NA	NA	NA
AWW94100.1|2150587_2151301_+	XRE family transcriptional regulator	NA	M9NUL0	Staphylococcus_phage	100.0	1.2e-130
AWW94101.1|2151316_2152249_+	ATP-dependent helicase	NA	A0A2I6PEZ7	Staphylococcus_phage	100.0	5.7e-173
AWW94102.1|2152254_2152596_+	hypothetical protein	NA	A0A2I6PF04	Staphylococcus_phage	100.0	4.6e-56
AWW94103.1|2152799_2152982_+	hypothetical protein	NA	M9NSW6	Staphylococcus_phage	100.0	4.1e-27
AWW94104.1|2153081_2153546_+	hypothetical protein	NA	A0EWV3	Staphylococcus_phage	100.0	1.1e-28
AWW94105.1|2153604_2154642_+|integrase	site-specific integrase	integrase	A0EWV2	Staphylococcus_phage	100.0	9.1e-180
AWW94106.1|2155760_2156777_-	bi-component leukocidin LukGH subunit G	NA	A0A2I6PER8	Staphylococcus_phage	29.0	1.1e-25
2155838:2155855	attR	ATAATTTTTCTTCTTTTT	NA	NA	NA	NA
AWW94107.1|2156798_2157854_-	bi-component leukocidin LukGH subunit H	NA	A0A1X9IGW5	Staphylococcus_phage	34.3	2.8e-35
AWW94108.1|2158288_2159512_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
AWW94109.1|2160788_2161700_-	ferrichrome ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWW94110.1|2161860_2163168_+	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
AWW94111.1|2164020_2164464_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWW94112.1|2164628_2165006_-	hypothetical protein	NA	NA	NA	NA	NA
AWW94113.1|2165323_2165914_-|terminase	terminase small subunit	terminase	Q4ZE85	Staphylococcus_phage	95.8	1.1e-97
>prophage 16
CP027788	Staphylococcus aureus strain CMRSA-6 chromosome, complete genome	3044721	2180667	2310080	3044721	terminase,integrase,tail,transposase,holin	Staphylococcus_phage(93.48%)	143	2209631:2209690	2247923:2249247
AWW94129.1|2180667_2181918_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.2	7.6e-40
AWW94130.1|2182124_2182349_-	oxidoreductase	NA	NA	NA	NA	NA
AWW94131.1|2183268_2184807_-	recombinase family protein	NA	A0A0N9RZT8	Staphylococcus_phage	100.0	5.3e-277
AWW94132.1|2184796_2185378_-	DNA-binding protein	NA	A0A0N9SK69	Staphylococcus_phage	97.9	1.6e-101
AWW94133.1|2185579_2186173_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0N7GFG7	Staphylococcus_phage	100.0	7.9e-112
AWW94134.1|2186156_2186549_-	hypothetical protein	NA	A0A0N9RRM7	Staphylococcus_phage	96.9	2.0e-63
AWW94135.1|2186550_2187297_-	NTP pyrophosphohydrolase	NA	A0A0N9SIY2	Staphylococcus_phage	88.7	5.3e-121
AWW94136.1|2187309_2187549_-	hypothetical protein	NA	A0A0N9S8B1	Staphylococcus_phage	94.9	8.2e-36
AWW94137.1|2187564_2187813_-	thioredoxin	NA	A0A0N9SGY3	Staphylococcus_phage	98.8	4.0e-41
AWW94138.1|2187853_2188456_-	hypothetical protein	NA	A0A0N9RTZ3	Staphylococcus_phage	99.0	9.8e-110
AWW94139.1|2188483_2189506_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0N9SK77	Staphylococcus_phage	99.7	4.3e-198
AWW94140.1|2189550_2189907_-	hypothetical protein	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	60.2	5.9e-38
AWW95040.1|2190220_2193097_-	intein-containing ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0N7GFG8	Staphylococcus_phage	99.4	0.0e+00
AWW94141.1|2193151_2193598_-	hypothetical protein	NA	A0A0N9STF9	Staphylococcus_phage	93.2	5.1e-71
AWW95041.1|2193597_2194011_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A0N9RZU5	Staphylococcus_phage	97.8	8.9e-70
AWW94142.1|2194211_2194913_-	hypothetical protein	NA	A0A0N9RRN5	Staphylococcus_phage	96.6	1.8e-123
AWW94143.1|2194924_2195434_-	hypothetical protein	NA	A0A0N9SIY9	Staphylococcus_phage	97.0	7.3e-82
AWW94144.1|2195563_2196166_-	hypothetical protein	NA	A0A0N9S8C0	Staphylococcus_phage	89.2	1.8e-55
AWW94145.1|2196165_2196396_-	hypothetical protein	NA	A0A0N9SGZ7	Staphylococcus_phage	100.0	1.8e-32
AWW94146.1|2196409_2196592_-	hypothetical protein	NA	A0A0N7GFG9	Staphylococcus_phage	100.0	3.1e-27
AWW94147.1|2196594_2196948_-	hypothetical protein	NA	A0A0N9RU04	Staphylococcus_phage	100.0	1.2e-59
AWW94148.1|2196980_2197979_-	DNA (cytosine-5-)-methyltransferase	NA	A0A0N9SK84	Staphylococcus_phage	99.7	3.1e-193
AWW94149.1|2197993_2198680_-	methyltransferase domain-containing protein	NA	A0A0N9SHZ9	Staphylococcus_phage	96.1	4.0e-123
AWW94150.1|2198669_2198861_-	hypothetical protein	NA	A0A0N9STH2	Staphylococcus_phage	96.8	5.2e-33
AWW94151.1|2198853_2199465_-	nucleoside 2-deoxyribosyltransferase	NA	A0A0N9RZV9	Staphylococcus_phage	97.5	4.9e-109
AWW94152.1|2199427_2199658_-	hypothetical protein	NA	A0A0N9SKA8	Staphylococcus_phage	96.6	8.2e-25
AWW94153.1|2199657_2199909_-	hypothetical protein	NA	A0A0N9RRP5	Staphylococcus_phage	100.0	3.8e-39
AWW94154.1|2199931_2200237_-	hypothetical protein	NA	A0A0N7GFH0	Staphylococcus_phage	100.0	1.8e-51
AWW94155.1|2200217_2200505_-	hypothetical protein	NA	A0A0N9SIZ8	Staphylococcus_phage	92.6	2.3e-40
AWW94156.1|2200497_2200764_-	hypothetical protein	NA	A0A0N9S8D1	Staphylococcus_phage	97.7	4.3e-41
AWW94157.1|2201063_2201447_-	hypothetical protein	NA	A0A0N9RU12	Staphylococcus_phage	94.7	2.6e-47
AWW94158.1|2201533_2202832_-	ATP-dependent DNA ligase	NA	A0A0N9SK95	Staphylococcus_phage	98.1	2.6e-240
AWW94159.1|2202841_2203156_-	hypothetical protein	NA	A0A0N9SI08	Staphylococcus_phage	81.7	4.7e-39
AWW94160.1|2203294_2203675_-	hypothetical protein	NA	A0A0N9STI1	Staphylococcus_phage	96.0	8.8e-48
AWW94161.1|2203787_2206274_-	hypothetical protein	NA	A0A0N7GFH1	Staphylococcus_phage	99.5	0.0e+00
AWW94162.1|2206618_2208055_-	PHP domain-containing protein	NA	A0A0N9SKC7	Staphylococcus_phage	98.3	2.7e-275
AWW94163.1|2208067_2208442_-	hypothetical protein	NA	A0A0N9RRQ3	Staphylococcus_phage	95.2	1.3e-59
AWW94164.1|2208611_2209106_+	hypothetical protein	NA	A0A0N9SJ02	Staphylococcus_phage	96.4	1.0e-64
2209631:2209690	attL	AGATAAAGTCCGTATAATTGTGTAAAAGTAAAAAGGCCATATAACAGTCCTTTTACGGTA	NA	NA	NA	NA
AWW94165.1|2209732_2210905_+|transposase	IS256 family transposase IS256	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
AWW94166.1|2211041_2212481_-	bifunctional aminoglycoside N-acetyltransferase AAC(6')-Ie/aminoglycoside O-phosphotransferase APH(2'')-Ia	NA	A0A0N9SKF6	Staphylococcus_phage	100.0	8.5e-285
AWW95042.1|2212481_2212874_-	GNAT family N-acetyltransferase	NA	A0A0N7GFH7	Staphylococcus_phage	100.0	6.9e-72
AWW94167.1|2212930_2214103_-|transposase	IS256 family transposase IS256	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
AWW94168.1|2214495_2214903_-	WYL domain-containing protein	NA	A0A1B0RXM3	Streptococcus_phage	98.3	1.1e-59
AWW94169.1|2214875_2215091_-	WYL domain-containing protein	NA	E4ZFP5	Streptococcus_phage	98.6	3.4e-33
AWW94170.1|2215723_2216518_-	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	100.0	2.3e-154
AWW94171.1|2216610_2217054_-	GNAT family N-acetyltransferase	NA	E4ZFP7	Streptococcus_phage	98.6	1.5e-70
AWW94172.1|2217025_2217277_-	streptothricin acetyltransferase	NA	A0A1B0RXL7	Streptococcus_phage	98.7	2.5e-27
AWW94173.1|2218123_2218846_-	hypothetical protein	NA	A0A0N7GFH2	Staphylococcus_phage	98.3	1.4e-89
AWW94174.1|2218954_2219755_-	serine/threonine protein phosphatase	NA	A0A0N9SKA2	Staphylococcus_phage	100.0	4.0e-151
AWW94175.1|2219758_2220253_-	hypothetical protein	NA	A0A0N9SI15	Staphylococcus_phage	98.8	5.2e-85
AWW94176.1|2220309_2220579_-	hypothetical protein	NA	A0A0N9STI7	Staphylococcus_phage	100.0	6.9e-39
AWW95043.1|2220562_2220754_-	hypothetical protein	NA	A0A0N9RZX7	Staphylococcus_phage	82.5	8.6e-20
AWW94177.1|2221055_2221451_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A0N9SKD8	Staphylococcus_phage	90.1	6.7e-59
AWW94178.1|2221450_2221681_-	addiction module antitoxin	NA	A0A0N9RRQ9	Staphylococcus_phage	85.5	6.5e-30
AWW94179.1|2221856_2222378_-	serine/threonine protein phosphatase	NA	A0A0N9SJ06	Staphylococcus_phage	94.2	1.9e-93
AWW94180.1|2222377_2223028_-	hypothetical protein	NA	A0A0N7GFH3	Staphylococcus_phage	96.3	3.5e-113
AWW95044.1|2223027_2223345_-	hypothetical protein	NA	A0A0N9S8E9	Staphylococcus_phage	82.7	1.2e-42
AWW94181.1|2223337_2224063_-	serine/threonine protein phosphatase	NA	A0A0N9SH20	Staphylococcus_phage	95.9	4.8e-135
AWW94182.1|2224062_2224284_-	hypothetical protein	NA	A0A0N9RU28	Staphylococcus_phage	95.9	5.5e-34
AWW94183.1|2224472_2225015_-	hypothetical protein	NA	A0A0N9SI25	Staphylococcus_phage	97.2	7.2e-96
AWW94184.1|2225029_2225302_-	hypothetical protein	NA	A0A0N9STJ5	Staphylococcus_phage	96.7	6.7e-42
AWW94185.1|2225327_2225483_-	transcriptional regulator	NA	A0A0N9RZY5	Staphylococcus_phage	98.0	2.2e-18
AWW94186.1|2225779_2225965_-	hypothetical protein	NA	A0A0N9SKE7	Staphylococcus_phage	100.0	1.5e-24
AWW94187.1|2225949_2226129_-	hypothetical protein	NA	A0A0N9RRR6	Staphylococcus_phage	91.5	1.1e-21
AWW94188.1|2226142_2226625_-	hypothetical protein	NA	A0A0N9SJ15	Staphylococcus_phage	94.3	8.8e-69
AWW94189.1|2226626_2226815_-	hypothetical protein	NA	A0A0N9S8F9	Staphylococcus_phage	95.2	4.5e-29
AWW94190.1|2226820_2227012_-	hypothetical protein	NA	A0A0N9SH33	Staphylococcus_phage	88.0	6.2e-18
AWW94191.1|2227008_2227236_-	hypothetical protein	NA	NA	NA	NA	NA
AWW94192.1|2227240_2227507_-	hypothetical protein	NA	A0A0N9RU37	Staphylococcus_phage	95.5	3.6e-40
AWW94193.1|2227496_2227700_-	hypothetical protein	NA	A0A1W6JP82	Staphylococcus_phage	72.3	9.2e-20
AWW94194.1|2227718_2227970_-	hypothetical protein	NA	NA	NA	NA	NA
AWW94195.1|2228243_2228477_-	hypothetical protein	NA	A0A0N7GFH5	Staphylococcus_phage	97.4	2.6e-34
AWW94196.1|2228498_2228723_-	hypothetical protein	NA	A0A0N9SI40	Staphylococcus_phage	100.0	2.0e-31
AWW94197.1|2228728_2229076_-	nuclease	NA	A0A0N9STK3	Staphylococcus_phage	100.0	4.4e-62
AWW94198.1|2229072_2229483_-	hypothetical protein	NA	A0A0N9RZZ6	Staphylococcus_phage	97.1	1.1e-72
AWW94199.1|2229522_2229786_-	hypothetical protein	NA	A0A0N9SKF2	Staphylococcus_phage	100.0	6.9e-44
AWW94200.1|2229788_2230160_-	hypothetical protein	NA	A0A2H4JFL4	uncultured_Caudovirales_phage	38.7	3.9e-16
AWW94201.1|2230162_2230471_-	hypothetical protein	NA	A0A0N9RRS4	Staphylococcus_phage	85.3	1.3e-41
AWW94202.1|2230763_2231039_-	hypothetical protein	NA	A0A0N7GFH6	Staphylococcus_phage	92.3	2.0e-41
AWW94203.1|2231051_2231249_-	hypothetical protein	NA	A0A0N9SH39	Staphylococcus_phage	92.3	3.2e-25
AWW94204.1|2231259_2232297_-	hypothetical protein	NA	A0A0N9RU46	Staphylococcus_phage	97.7	8.8e-191
AWW94205.1|2232553_2233291_-	MBL fold hydrolase	NA	A0A0N9RZK9	Staphylococcus_phage	99.6	7.0e-134
AWW94206.1|2233484_2235251_-	single-stranded DNA-binding protein	NA	A0A0N9SK20	Staphylococcus_phage	99.7	0.0e+00
AWW94207.1|2235253_2236366_-	hypothetical protein	NA	A0A0N9RRG7	Staphylococcus_phage	99.7	1.8e-218
AWW94208.1|2236382_2237915_-	helicase DnaB	NA	A0A0N9SIU7	Staphylococcus_phage	99.0	2.4e-293
AWW95045.1|2237936_2238455_-	hypothetical protein	NA	A0A0N9S850	Staphylococcus_phage	99.4	1.8e-91
AWW94209.1|2238531_2239500_-	hypothetical protein	NA	A0A0N9SGS5	Staphylococcus_phage	99.4	1.0e-180
AWW94210.1|2239622_2240582_-	hypothetical protein	NA	A0A0N7GFF9	Staphylococcus_phage	100.0	6.7e-169
AWW94211.1|2240625_2241306_-	hypothetical protein	NA	A0A0N9RTS7	Staphylococcus_phage	100.0	2.0e-127
AWW94212.1|2241323_2241812_-	hypothetical protein	NA	A0A0N9SK25	Staphylococcus_phage	99.4	2.3e-53
AWW94213.1|2241827_2242076_-	hypothetical protein	NA	A0A0N9SHT9	Staphylococcus_phage	97.6	1.7e-39
AWW94214.1|2242234_2243239_-	hypothetical protein	NA	A0A0N9ST56	Staphylococcus_phage	99.4	1.0e-183
AWW94215.1|2243250_2244531_-	hypothetical protein	NA	A0A0N9RZM2	Staphylococcus_phage	99.8	1.1e-235
AWW94216.1|2244829_2245873_-|integrase	integrase	integrase	A0A0N9SK33	Staphylococcus_phage	98.6	8.0e-192
AWW94217.1|2246564_2246993_-	hypothetical protein	NA	A0A0N9RRH5	Staphylococcus_phage	98.6	9.5e-75
AWW94218.1|2247070_2247592_-	hypothetical protein	NA	A0A0N7GFG0	Staphylococcus_phage	98.3	1.7e-89
AWW94219.1|2247591_2247855_-	hypothetical protein	NA	A0A0N9SIV3	Staphylococcus_phage	89.7	4.3e-38
AWW94220.1|2248024_2249197_+|transposase	IS256 family transposase IS256	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
AWW94221.1|2249489_2250170_-	hypothetical protein	NA	A0A0N9S858	Staphylococcus_phage	93.4	8.5e-118
2247923:2249247	attR	AGATAAAGTCCGTATAATTGTGTAAAAGTAAAAAGGCCATATAACAGTCCTTTTACGGTACAATGTTTTTAACGACAAAAACATACCCAGGAGGACTTTTACATGACCCAAGTACATTTTACACTGAAAAGCGAAGAGATTCAAAGCATTATTGAATATTCTGTAAAGGATGACGTTTCTAAAAATATTTTAACAACGGTATTTAATCAACTAATGGAAAATCAACGAACAGAATATATTCAAGCAAAAGAATATGAACGAACAGAAAACCGACAAAGTCAACGAAATGGCTATTATGAGCGCAGCTTTACGACACGTGTAGGCACGCTAGAATTAAAAGTACCCAGAACACGTGATGGCCATTTTTCACCCACAGTGTTTGAACGTTATCAACGAAACGAAAAAGCCCTCATGGCTTCAATGTTGGAAATGTATGTATCAGGCGTTTCAACTCGTAAAGTATCAAAAATTGTGGAAGAACTTTGTGGTAAATCCGTCTCTAAGTCCTTCGTTTCTAGCTTAACAGAACAGCTAGAACCTATGGTTAACGAGTGGCAGAATCGTTTATTATCAGAAAAAAATTATCCTTACTTAATGACCGATGTACTCTATATAAAAGTACGAGAAGAAAATCGAGTACTCTCAAAAAGCTGTCATATAGCGATTGGAATAACCAAAGATGGCGACCGTGAAATTATCGGCTTCATGATTCAAAGTGGCGAAAGCGAAGAGACCTGGACAACATTTTTTGAATACCTAAAAGAACGCGGTTTACAAGGTACGGAACTCGTTATTTCTGATGCGCACAAAGGATTAGTCTCTGCCATTAGAAAATCCTTCACCAACGTAAGTTGGCAAAGATGCCAAGTTCACTTCCTAAGAAATATCTTTACCACCATTCCTAAAAAAAATTCAAAATCTTTCAGAGAAGCTGTTAAAGGAATTTTTAAGTTCACAGATATTAACTTAGCGCGTGAGGCTAAAAATCGATTGATTCATGATTATATCGATCAACCAAAATATTCAAAAGCTTGCGCATCATTGGATGATGGATTCGAAGACGCCTTTCAATATACCGTACAAGGAAATTCCCACAATCGACTAAAGAGTACCAATCTAATTGAACGACTGAATCAAGAAGTACGCAGAAGAGAAAAGATTATTCGCATCTTCCCCAATCAAACATCAGCCAATCGCTTAATTGGAGCCGTTCTTATGGACCTACATGATGAATGGATTTATTCTTCAAGAAAATACATCAATTTTGATAAGTAGAAATGGTAAAAACATTGTATAGCATTTTACACAGGAGTCTGGACTTGACT	NA	NA	NA	NA
AWW94222.1|2250265_2250589_-	hypothetical protein	NA	A0A0N9RTT7	Staphylococcus_phage	92.5	1.7e-52
AWW94223.1|2250636_2251296_-	antirestriction protein ArdA	NA	A0A0N9SK30	Staphylococcus_phage	93.2	7.7e-116
AWW94224.1|2251450_2251840_-	hypothetical protein	NA	A0A0N9SHU5	Staphylococcus_phage	93.0	1.3e-62
AWW94225.1|2251976_2252237_-	hypothetical protein	NA	A0A0N9ST70	Staphylococcus_phage	98.8	3.5e-40
AWW95046.1|2252311_2252527_-	hypothetical protein	NA	A0A0N7GFG1	Staphylococcus_phage	94.4	2.2e-32
AWW94226.1|2252978_2253263_-	hypothetical protein	NA	A0A0N9SK40	Staphylococcus_phage	96.8	1.2e-44
AWW94227.1|2253308_2253587_-	hypothetical protein	NA	NA	NA	NA	NA
AWW94228.1|2254562_2254871_-	hypothetical protein	NA	NA	NA	NA	NA
AWW94229.1|2255260_2255518_-	hypothetical protein	NA	A0A0N9RRI7	Staphylococcus_phage	95.0	4.3e-14
AWW94230.1|2257382_2258258_-	hypothetical protein	NA	A0A0N9SIV7	Staphylococcus_phage	99.7	6.3e-166
AWW94231.1|2258293_2260579_-	helicase	NA	A0A0N9S864	Staphylococcus_phage	100.0	0.0e+00
AWW94232.1|2260714_2262211_+	hypothetical protein	NA	A0A0N9SGU3	Staphylococcus_phage	98.6	8.3e-267
AWW94233.1|2262469_2262799_+	HU family DNA-binding protein	NA	A0A0N9RTU9	Staphylococcus_phage	95.4	8.1e-50
AWW94234.1|2262824_2263010_+	hypothetical protein	NA	A0A0N7GFG2	Staphylococcus_phage	100.0	1.7e-25
AWW94235.1|2263018_2264203_+	hypothetical protein	NA	A0A0N9SK37	Staphylococcus_phage	97.5	4.8e-217
AWW94236.1|2265901_2266786_+	hypothetical protein	NA	A0A0N9SHV5	Staphylococcus_phage	100.0	4.5e-172
AWW94237.1|2266778_2268578_+|terminase	terminase	terminase	A0A0N9RZP6	Staphylococcus_phage	99.7	2.0e-206
AWW94238.1|2268595_2270158_+	hypothetical protein	NA	A0A0N9SK48	Staphylococcus_phage	100.0	6.6e-299
AWW94239.1|2270150_2271530_+	hypothetical protein	NA	A0A0N9RRJ7	Staphylococcus_phage	97.8	4.1e-244
AWW94240.1|2271557_2271998_+	hypothetical protein	NA	A0A0N9SIW4	Staphylococcus_phage	98.6	3.0e-76
AWW94241.1|2272037_2273039_+	hypothetical protein	NA	A0A0N9S885	Staphylococcus_phage	99.5	5.6e-110
AWW94242.1|2273113_2273665_+	hypothetical protein	NA	A0A0N9SGV3	Staphylococcus_phage	100.0	1.5e-80
AWW94243.1|2273682_2274117_+	hypothetical protein	NA	A0A0N9RTW0	Staphylococcus_phage	100.0	3.5e-69
AWW94244.1|2274106_2274424_+	hypothetical protein	NA	A0A0N9SK47	Staphylococcus_phage	100.0	2.6e-53
AWW94245.1|2274427_2275093_+	hypothetical protein	NA	A0A0N9SHW2	Staphylococcus_phage	99.5	3.8e-123
AWW94246.1|2275082_2275604_+	hypothetical protein	NA	A0A0N9ST98	Staphylococcus_phage	100.0	2.0e-95
AWW94247.1|2275609_2276482_+	hypothetical protein	NA	A0A0N9RZR7	Staphylococcus_phage	100.0	1.5e-159
AWW94248.1|2276520_2277312_+	hypothetical protein	NA	A0A0N7GFG4	Staphylococcus_phage	97.7	8.6e-138
AWW94249.1|2277395_2277953_+	hypothetical protein	NA	A0A0N9SK55	Staphylococcus_phage	100.0	2.7e-98
AWW94250.1|2277952_2278426_+	hypothetical protein	NA	A0A0N9RRK6	Staphylococcus_phage	98.1	2.5e-84
AWW94251.1|2278441_2279458_+	recombinase	NA	A0A0N9SIX3	Staphylococcus_phage	99.4	2.3e-196
AWW94252.1|2279554_2287828_+|tail	phage tail tape measure protein	tail	A0A0N9S894	Staphylococcus_phage	99.8	0.0e+00
AWW94253.1|2287849_2289931_+	hypothetical protein	NA	A0A0N9SGW2	Staphylococcus_phage	99.3	0.0e+00
AWW94254.1|2289991_2298193_+	hypothetical protein	NA	A0A0N9RTX0	Staphylococcus_phage	89.9	0.0e+00
AWW94255.1|2298195_2298570_+	hypothetical protein	NA	A0A0N9SK58	Staphylococcus_phage	87.9	8.6e-56
AWW94256.1|2298771_2301441_+	hypothetical protein	NA	A0A0N9SHX2	Staphylococcus_phage	99.8	0.0e+00
AWW95047.1|2301487_2301949_+	hypothetical protein	NA	A0A0N9STA8	Staphylococcus_phage	96.2	7.3e-65
AWW94257.1|2301930_2302443_+	hypothetical protein	NA	A0A0N9RZS7	Staphylococcus_phage	85.3	7.9e-44
AWW94258.1|2302464_2302794_+|holin	phage holin	holin	A0A0N9SK62	Staphylococcus_phage	96.3	1.0e-52
AWW94259.1|2302845_2304507_+	hypothetical protein	NA	A0A0N9RRL9	Staphylococcus_phage	91.3	1.9e-115
AWW94260.1|2304506_2305034_+	hypothetical protein	NA	A1BU75	Staphylococcus_virus	29.4	2.9e-09
AWW94261.1|2305190_2306693_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N9SGX6	Staphylococcus_phage	95.4	9.8e-276
AWW94262.1|2307663_2309313_-	hypothetical protein	NA	A0A0N9SHY1	Staphylococcus_phage	94.5	6.1e-312
AWW94263.1|2309465_2310080_-	LPXTG cell wall anchor domain-containing protein	NA	A0A0N9STB7	Staphylococcus_phage	96.6	6.8e-74
>prophage 17
CP027788	Staphylococcus aureus strain CMRSA-6 chromosome, complete genome	3044721	2826625	2882998	3044721	protease,transposase,holin	Enterobacteria_phage(22.22%)	53	NA	NA
AWW94773.1|2826625_2827315_-|holin	holin-like protein CidB	holin	NA	NA	NA	NA
AWW94774.1|2827307_2827703_-|holin	holin-like murein hydrolase modulator CidA	holin	NA	NA	NA	NA
AWW95066.1|2827915_2828779_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWW94775.1|2828960_2829179_+	hypothetical protein	NA	NA	NA	NA	NA
AWW94776.1|2829567_2829999_+	CHAP domain-containing protein	NA	NA	NA	NA	NA
AWW94777.1|2830263_2830368_-	hypothetical protein	NA	NA	NA	NA	NA
AWW94778.1|2830758_2831016_-	hypothetical protein	NA	NA	NA	NA	NA
AWW94779.1|2831594_2832872_-	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
AWW94780.1|2833125_2834292_+	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
AWW94781.1|2834461_2834983_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	41.1	2.0e-26
AWW94782.1|2835391_2837497_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	38.5	3.1e-118
AWW94783.1|2837565_2837736_-	FeoB-associated Cys-rich membrane protein	NA	NA	NA	NA	NA
AWW94784.1|2837748_2839743_-	ferrous iron transport protein B	NA	NA	NA	NA	NA
AWW94785.1|2839754_2839982_-	ferrous iron transporter A	NA	NA	NA	NA	NA
AWW94786.1|2840197_2842666_-	MMPL family transporter	NA	NA	NA	NA	NA
AWW94787.1|2842831_2843380_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AWW94788.1|2843456_2843624_-	hypothetical protein	NA	NA	NA	NA	NA
AWW94789.1|2843735_2845280_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AWW94790.1|2845469_2846069_-	maltose acetyltransferase	NA	NA	NA	NA	NA
AWW94791.1|2846307_2846499_+	hypothetical protein	NA	NA	NA	NA	NA
AWW94792.1|2846738_2849147_+	copper-exporting P-type ATPase A	NA	A0A218MNH6	uncultured_virus	40.8	2.9e-128
AWW94793.1|2849691_2849898_+	copper resistance protein CopZ	NA	NA	NA	NA	NA
AWW94794.1|2849987_2850986_-	D-lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	30.2	3.5e-35
AWW94795.1|2851008_2852163_-	N-succinyldiaminopimelate aminotransferase	NA	NA	NA	NA	NA
AWW94796.1|2852589_2854098_-	dehydrosqualene desaturase	NA	NA	NA	NA	NA
AWW94797.1|2854109_2854973_-	dehydrosqualene synthase	NA	NA	NA	NA	NA
AWW94798.1|2855009_2856137_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AWW94799.1|2856142_2857636_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AWW95067.1|2857628_2858117_-	glycosyl-4,4'-diaponeurosporenoate acyltransferase	NA	NA	NA	NA	NA
AWW94800.1|2858297_2859065_-	CHAP domain-containing protein	NA	NA	NA	NA	NA
AWW94801.1|2859425_2861237_-	O-acetyltransferase OatA	NA	A0A1R3Y5Q6	Salmonella_virus	31.5	1.3e-35
AWW94802.1|2861922_2862624_-	transglycosylase IsaA	NA	Q4Z8Z7	Staphylococcus_phage	46.8	2.1e-39
AWW94803.1|2863231_2864287_-	PTS transporter subunit IIC	NA	NA	NA	NA	NA
AWW95068.1|2864697_2865267_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AWW94804.1|2865464_2865965_+	hypothetical protein	NA	NA	NA	NA	NA
AWW94805.1|2866184_2866415_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
AWW94806.1|2866577_2866955_-	glyoxalase	NA	NA	NA	NA	NA
AWW94807.1|2866971_2867793_-	NmrA/HSCARG family protein	NA	NA	NA	NA	NA
AWW94808.1|2867811_2868111_-	DUF2316 domain-containing protein	NA	NA	NA	NA	NA
AWW94809.1|2868241_2868799_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWW94810.1|2868791_2869496_+	KR domain-containing protein	NA	NA	NA	NA	NA
AWW94811.1|2869593_2870604_+	amidohydrolase	NA	NA	NA	NA	NA
AWW94812.1|2871601_2872492_-	GTP-binding protein	NA	NA	NA	NA	NA
AWW94813.1|2872591_2873932_-	ferrous iron transporter B	NA	NA	NA	NA	NA
AWW94814.1|2873925_2875032_-	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
AWW94815.1|2875426_2875963_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	43.6	9.9e-29
AWW94816.1|2876063_2876879_-	ATP-binding protein	NA	NA	NA	NA	NA
AWW94817.1|2876871_2878314_-|transposase	transposase	transposase	NA	NA	NA	NA
AWW94818.1|2878285_2878879_-	HTH domain-containing protein	NA	A0A0A7NPV4	Enterobacteria_phage	50.6	3.3e-41
AWW94819.1|2879142_2879523_-	penicillinase repressor BlaI	NA	NA	NA	NA	NA
AWW94820.1|2879512_2881270_-	beta-lactam sensor/signal transducer BlaR1	NA	NA	NA	NA	NA
AWW94821.1|2881376_2882222_+	BlaZ family penicillin-hydrolyzing class A beta-lactamase PC1	NA	A0A1B0VBP7	Salmonella_phage	34.0	1.5e-31
AWW94822.1|2882482_2882998_-|transposase	transposase	transposase	NA	NA	NA	NA
