The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	0	14433	4847638	tRNA	Bacillus_virus(50.0%)	20	NA	NA
AWX00228.1|124_625_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
AWX00229.1|1034_2366_+	MFS transporter	NA	NA	NA	NA	NA
AWX00230.1|2381_4418_+	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
AWX00231.1|4524_4971_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
AWX00232.1|4954_5746_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWX00233.1|5845_7033_+	cyanate MFS transporter	NA	NA	NA	NA	NA
AWX00234.1|7064_7772_-	hypothetical protein	NA	NA	NA	NA	NA
AWX00235.1|7922_8267_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AWX00236.1|8267_8573_-	hypothetical protein	NA	NA	NA	NA	NA
AWX00237.1|8653_8908_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AWX00238.1|8920_9103_-	hypothetical protein	NA	NA	NA	NA	NA
AWX00239.1|9220_10249_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	32.1	5.0e-13
AWX00240.1|10294_10393_+	hypothetical protein	NA	NA	NA	NA	NA
AWX04635.1|10393_10468_+	hypothetical protein	NA	NA	NA	NA	NA
AWX00241.1|10521_10770_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AWX04636.1|10798_10984_-	hypothetical protein	NA	NA	NA	NA	NA
AWX00242.1|11140_11233_+	stress response membrane protein YncL	NA	NA	NA	NA	NA
AWX00243.1|11357_12857_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AWX00244.1|12861_13107_-	DUF2543 family protein	NA	NA	NA	NA	NA
AWX00245.1|13182_14433_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	7.9e-21
>prophage 2
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	17515	18886	4847638		Bodo_saltans_virus(100.0%)	1	NA	NA
AWX00250.1|17515_18886_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.8	8.5e-109
>prophage 3
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	24692	34775	4847638		Bacillus_virus(20.0%)	10	NA	NA
AWX00256.1|24692_25811_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	34.1	6.4e-30
AWX00257.1|25794_26652_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	24.8	2.7e-12
AWX00258.1|26648_27440_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
AWX00259.1|27436_28471_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
AWX00260.1|28505_29327_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	34.6	1.2e-22
AWX00261.1|29341_30253_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AWX00262.1|30307_31552_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
AWX00263.1|31551_32253_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	42.3	4.4e-37
AWX00264.1|32245_33445_-	lipoprotein-releasing ABC transporter permease subunit LolC	NA	NA	NA	NA	NA
AWX00265.1|33701_34775_+	hypothetical protein	NA	A0A142KBN9	Gordonia_phage	25.9	1.1e-07
>prophage 4
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	39554	39812	4847638		Erwinia_phage(100.0%)	1	NA	NA
AWX00268.1|39554_39812_-	DUF1471 domain-containing protein	NA	A0A1B2IFR9	Erwinia_phage	38.6	3.3e-06
>prophage 5
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	52056	53699	4847638		Erwinia_phage(50.0%)	2	NA	NA
AWX00280.1|52056_53061_-	DNA polymerase III subunit delta'	NA	A0A2H4IBD4	Erwinia_phage	28.4	2.0e-06
AWX00281.1|53057_53699_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	39.6	1.1e-29
>prophage 6
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	56976	58102	4847638		Ralstonia_phage(50.0%)	2	NA	NA
AWX00285.1|56976_57213_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	3.4e-10
AWX00286.1|57367_58102_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.3	8.5e-15
>prophage 7
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	72364	73318	4847638		Bacillus_phage(100.0%)	1	NA	NA
AWX00299.1|72364_73318_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	A0A160LKR7	Bacillus_phage	38.0	2.8e-10
>prophage 8
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	88418	88664	4847638		Enterobacteria_phage(100.0%)	1	NA	NA
AWX00317.1|88418_88664_+	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	50.0	4.5e-13
>prophage 9
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	93267	94194	4847638		Morganella_phage(100.0%)	1	NA	NA
AWX00324.1|93267_94194_+	lipid A biosynthesis lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	41.5	3.1e-54
>prophage 10
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	101855	102392	4847638		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
AWX00332.1|101855_102392_-	O-acetyl-ADP-ribose deacetylase	NA	F1SVT2	Red_sea_bream_iridovirus	41.9	4.6e-26
>prophage 11
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	106543	107377	4847638		Pelagibacter_phage(100.0%)	1	NA	NA
AWX00340.1|106543_107377_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	39.9	2.3e-40
>prophage 12
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	114418	115483	4847638		Erwinia_phage(100.0%)	1	NA	NA
AWX00348.1|114418_115483_-	phosphate starvation-inducible protein PhoH	NA	A0A1B2ICF6	Erwinia_phage	69.5	1.4e-90
>prophage 13
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	131821	134978	4847638		Enterobacteria_phage(100.0%)	4	NA	NA
AWX00363.1|131821_132316_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	83.3	1.6e-41
AWX00364.1|132337_133660_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	89.0	5.7e-211
AWX00365.1|133770_134691_-	DMT family transporter	NA	NA	NA	NA	NA
AWX00366.1|134807_134978_-	stress-induced protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
>prophage 14
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	143203	147844	4847638	protease	uncultured_Caudovirales_phage(66.67%)	5	NA	NA
AWX00375.1|143203_144235_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	23.2	1.0e-13
AWX00376.1|144231_144993_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.4	5.4e-12
AWX00377.1|145285_146914_-	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
AWX00378.1|147000_147186_-	hypothetical protein	NA	NA	NA	NA	NA
AWX00379.1|147184_147844_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	53.9	2.0e-47
>prophage 15
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	152074	154129	4847638		Bacillus_phage(100.0%)	1	NA	NA
AWX00386.1|152074_154129_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.8	6.7e-17
>prophage 16
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	166618	171855	4847638		Tupanvirus(50.0%)	3	NA	NA
AWX00397.1|166618_168526_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.5	3.3e-50
AWX04642.1|168538_170647_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
AWX00398.1|170745_171855_+	MOSC domain-containing protein	NA	A0A0E3FP00	Synechococcus_phage	35.1	4.1e-05
>prophage 17
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	177290	183803	4847638	tRNA	Bacillus_virus(25.0%)	4	NA	NA
AWX00405.1|177290_178061_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.0	7.5e-30
AWX00406.1|178164_180777_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	21.8	2.0e-18
AWX00407.1|181031_182234_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.9	5.8e-45
AWX00408.1|182402_183803_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	37.3	8.5e-80
>prophage 18
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	202664	207212	4847638		Bacillus_phage(100.0%)	3	NA	NA
AWX00423.1|202664_204413_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.5	6.7e-58
AWX00424.1|204449_206714_-	ComEC family protein	NA	NA	NA	NA	NA
AWX00425.1|206924_207212_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	5.5e-10
>prophage 19
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	211388	212477	4847638		Streptococcus_phage(100.0%)	1	NA	NA
AWX00429.1|211388_212477_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.5	4.5e-81
>prophage 20
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	216534	246284	4847638	protease,tRNA	Tetraselmis_virus(14.29%)	23	NA	NA
AWX00432.1|216534_218817_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.9	1.1e-161
AWX00433.1|219020_219761_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.1	1.8e-20
AWX00434.1|219797_220319_-	hypothetical protein	NA	NA	NA	NA	NA
AWX00435.1|220442_221591_-	MFS transporter	NA	NA	NA	NA	NA
AWX00436.1|221631_221814_+	hypothetical protein	NA	NA	NA	NA	NA
AWX00437.1|221865_222729_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AWX00438.1|222730_223348_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.1	1.4e-74
AWX00439.1|223358_225803_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.4	8.9e-218
AWX00440.1|226014_227307_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.2	4.7e-93
AWX00441.1|227399_228743_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.3	1.6e-80
AWX00442.1|228752_229367_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AWX00443.1|229494_233160_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	2.6e-88
AWX00444.1|233295_233790_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AWX00445.1|234333_235302_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	42.7	7.9e-61
AWX00446.1|235416_237183_+	thiol reductant ABC exporter subunit CydD	NA	F2Y302	Organic_Lake_phycodnavirus	27.4	1.6e-11
AWX00447.1|237182_238904_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.2	1.0e-18
AWX00448.1|238949_239654_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AWX00449.1|239938_240157_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AWX00450.1|240228_240690_-	hypothetical protein	NA	NA	NA	NA	NA
AWX00451.1|241156_243436_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.4e-164
AWX00452.1|243463_243784_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.9	4.5e-13
AWX00453.1|244051_244273_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
AWX00454.1|244343_246284_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	40.5	3.8e-38
>prophage 21
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	263116	265819	4847638		Orgyia_leucostigma_nucleopolyhedrovirus(100.0%)	1	NA	NA
AWX00466.1|263116_265819_-	PKD domain-containing protein	NA	B0FDP2	Orgyia_leucostigma_nucleopolyhedrovirus	59.6	2.6e-186
>prophage 22
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	282224	282953	4847638		Planktothrix_phage(100.0%)	1	NA	NA
AWX00485.1|282224_282953_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.2	1.8e-28
>prophage 23
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	286073	297293	4847638		Bacillus_phage(33.33%)	13	NA	NA
AWX00490.1|286073_287543_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	3.1e-24
AWX00491.1|287526_288234_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.3	8.4e-36
AWX00492.1|288355_289483_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.2	2.5e-29
AWX00493.1|289523_290021_-	DUF2593 family protein	NA	NA	NA	NA	NA
AWX00494.1|290063_290909_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AWX00495.1|290905_291859_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
AWX00496.1|291868_293002_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	6.5e-30
AWX00497.1|293145_294258_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AWX00498.1|294423_294612_+	hypothetical protein	NA	NA	NA	NA	NA
AWX00499.1|294608_295085_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
AWX00500.1|295148_296051_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	33.6	2.2e-36
AWX00501.1|296115_296838_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
AWX00502.1|297023_297293_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	71.8	7.9e-27
>prophage 24
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	303650	305745	4847638		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
AWX00509.1|303650_303971_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	53.7	4.1e-22
AWX00510.1|304011_305301_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.7	1.8e-169
AWX00511.1|305313_305745_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	66.4	9.0e-49
>prophage 25
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	311753	313804	4847638		Escherichia_phage(50.0%)	2	NA	NA
AWX00518.1|311753_312512_+	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	26.1	1.8e-12
AWX04647.1|312598_313804_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.2	1.6e-98
>prophage 26
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	321289	323161	4847638		Planktothrix_phage(100.0%)	1	NA	NA
AWX00526.1|321289_323161_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.8	4.5e-12
>prophage 27
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	326376	330503	4847638		Synechococcus_phage(50.0%)	3	NA	NA
AWX00530.1|326376_327039_-	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	32.7	2.8e-25
AWX00531.1|327166_328066_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
AWX00532.1|328070_330503_+	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A076YHZ7	Citrobacter_phage	49.1	1.0e-08
>prophage 28
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	338078	339674	4847638		Tupanvirus(100.0%)	1	NA	NA
AWX00538.1|338078_339674_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.4	9.4e-59
>prophage 29
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	344997	345366	4847638		Campylobacter_virus(100.0%)	1	NA	NA
AWX00544.1|344997_345366_-	hypothetical protein	NA	H6SUH4	Campylobacter_virus	31.7	4.0e-05
>prophage 30
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	353677	358817	4847638		Enterobacteria_phage(33.33%)	7	NA	NA
AWX00552.1|353677_354196_-	outer membrane protein X	NA	K7PJP9	Enterobacteria_phage	31.4	3.2e-16
AWX00553.1|354550_355438_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
AWX00554.1|355736_356240_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	24.4	9.3e-05
AWX00555.1|356420_356549_-	reductase	NA	NA	NA	NA	NA
AWX00556.1|356601_357345_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
AWX00557.1|357438_358098_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
AWX00558.1|358094_358817_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	4.7e-34
>prophage 31
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	362345	362999	4847638		Enterobacteria_phage(50.0%)	2	NA	NA
AWX00562.1|362345_362609_+	DUF1471 domain-containing protein	NA	A0A142IIN6	Enterobacteria_phage	43.8	1.3e-05
AWX00563.1|362732_362999_+	DksA/TraR family C4-type zinc finger protein	NA	E5E4B1	Acinetobacter_phage	50.6	4.9e-13
>prophage 32
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	370210	377474	4847638		Bacillus_phage(33.33%)	5	NA	NA
AWX00571.1|370210_372388_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.4e-43
AWX00572.1|372485_373868_-	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	3.7e-51
AWX00573.1|374072_374750_+	transcriptional regulator	NA	NA	NA	NA	NA
AWX00574.1|374746_375742_+	secretion protein HlyD	NA	NA	NA	NA	NA
AWX00575.1|375734_377474_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.5	7.2e-20
>prophage 33
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	387092	388001	4847638		Streptococcus_phage(100.0%)	1	NA	NA
AWX00588.1|387092_388001_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	29.3	1.3e-25
>prophage 34
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	395225	398644	4847638		Klosneuvirus(50.0%)	3	NA	NA
AWX04648.1|395225_396533_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.2	2.0e-19
AWX00596.1|396580_397057_+	kinase inhibitor	NA	NA	NA	NA	NA
AWX00597.1|397123_398644_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.6	3.6e-84
>prophage 35
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	406912	413441	4847638		Planktothrix_phage(33.33%)	7	NA	NA
AWX00605.1|406912_407971_-	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.3	3.1e-18
AWX00606.1|407970_408663_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
AWX00607.1|408659_409436_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWX00608.1|409614_409767_-	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
AWX00609.1|409894_410683_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
AWX00610.1|410750_412223_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	29.5	2.3e-11
AWX00611.1|412424_413441_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.4	5.2e-79
>prophage 36
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	417764	421234	4847638		Edwardsiella_phage(33.33%)	4	NA	NA
AWX00616.1|417764_418817_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	48.3	5.2e-82
AWX00617.1|419120_419480_+	hypothetical protein	NA	NA	NA	NA	NA
AWX00618.1|419579_420518_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.4	4.4e-24
AWX00619.1|420514_421234_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	36.4	6.8e-25
>prophage 37
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	449887	450679	4847638		Kaumoebavirus(100.0%)	1	NA	NA
AWX00644.1|449887_450679_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	28.1	2.0e-09
>prophage 38
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	453775	460139	4847638		Hokovirus(50.0%)	5	NA	NA
AWX00648.1|453775_455188_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	33.1	8.9e-61
AWX00649.1|455786_455993_-	DUF2517 family protein	NA	NA	NA	NA	NA
AWX00650.1|456303_456393_+	potassium-transporting ATPase subunit F	NA	NA	NA	NA	NA
AWX00651.1|456392_458072_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
AWX00652.1|458090_460139_+	K(+)-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.8	8.4e-28
>prophage 39
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	463411	464089	4847638		Bacillus_phage(100.0%)	1	NA	NA
AWX00655.1|463411_464089_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	29.7	2.0e-26
>prophage 40
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	475656	479443	4847638	tRNA	Escherichia_phage(50.0%)	2	NA	NA
AWX00667.1|475656_477324_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	94.0	0.0e+00
AWX00668.1|477493_479443_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	48.6	1.9e-08
>prophage 41
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	484050	485715	4847638		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AWX00673.1|484050_485715_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.0	1.6e-85
>prophage 42
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	489641	490688	4847638		Pseudomonas_phage(100.0%)	1	NA	NA
AWX00677.1|489641_490688_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.6	6.4e-48
>prophage 43
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	496518	497244	4847638		Planktothrix_phage(100.0%)	1	NA	NA
AWX00684.1|496518_497244_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	7.1e-30
>prophage 44
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	500820	503427	4847638	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
AWX00688.1|500820_503427_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.1	1.7e-182
>prophage 45
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	509818	512275	4847638		Synechococcus_phage(50.0%)	2	NA	NA
AWX00695.1|509818_510925_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	51.6	1.8e-08
AWX00696.1|511063_512275_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	49.4	2.0e-101
>prophage 46
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	517065	517908	4847638		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AWX00703.1|517065_517449_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	54.6	1.4e-24
AWX00704.1|517668_517908_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	72.9	8.0e-23
>prophage 47
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	537982	544346	4847638		Morganella_phage(25.0%)	5	NA	NA
AWX00721.1|537982_538411_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	36.4	5.3e-17
AWX00722.1|538470_540036_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.0	5.4e-43
AWX00723.1|540278_540842_-	alkyl hydroperoxide reductase subunit C	NA	NA	NA	NA	NA
AWX00724.1|542511_543735_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	34.3	2.6e-61
AWX00725.1|543719_544346_+	hypothetical protein	NA	A0A0F7L444	uncultured_marine_virus	51.3	3.2e-55
>prophage 48
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	553720	558137	4847638		Staphylococcus_phage(50.0%)	5	NA	NA
AWX00736.1|553720_555223_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.5	6.4e-17
AWX00737.1|555382_556471_+	oxidoreductase	NA	NA	NA	NA	NA
AWX00738.1|556528_557272_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
AWX00739.1|557455_557758_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AWX00740.1|557732_558137_+	XRE family transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	34.1	4.0e-06
>prophage 49
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	570066	574781	4847638		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
AWX00751.1|570066_570867_+	iron-enterobactin ABC transporter ATP-binding protein	NA	M1HQ77	Paramecium_bursaria_Chlorella_virus	23.2	8.4e-08
AWX00752.1|570923_574781_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	28.7	7.1e-60
>prophage 50
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	581055	589324	4847638	holin	Brazilian_cedratvirus(33.33%)	7	NA	NA
AWX00759.1|581055_581862_-	manganese/iron ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.5	1.1e-12
AWX00760.1|581864_582776_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWX00761.1|582987_583272_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AWX00762.1|583410_585444_-|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.6	3.4e-21
AWX00763.1|585572_586160_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
AWX00764.1|586173_587646_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AWX00765.1|587659_589324_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.4	5.2e-60
>prophage 51
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	593804	595332	4847638		Planktothrix_phage(100.0%)	2	NA	NA
AWX00770.1|593804_594641_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.0	1.1e-13
AWX00771.1|594627_595332_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.8	1.2e-21
>prophage 52
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	610452	613161	4847638		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AWX00785.1|610452_613161_-	cation-transporting P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	27.9	1.7e-68
>prophage 53
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	621254	621542	4847638		Shigella_phage(100.0%)	1	NA	NA
AWX00793.1|621254_621542_-	XRE family transcriptional regulator	NA	A0A088CD40	Shigella_phage	38.1	6.9e-05
>prophage 54
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	625541	626513	4847638		Enterobacteria_phage(100.0%)	1	NA	NA
AWX00797.1|625541_626513_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	32.6	1.9e-25
>prophage 55
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	636897	637287	4847638		Enterobacteria_phage(100.0%)	1	NA	NA
AWX00805.1|636897_637287_-	LexA family transcriptional regulator	NA	K7P6F7	Enterobacteria_phage	65.6	6.4e-46
>prophage 56
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	641550	680562	4847638	plate,terminase,head,integrase	Erwinia_phage(42.11%)	64	636728:636774	680576:680622
636728:636774	attL	AATGGCACGCCCTGTAGGATTCGAACCTACGACCTACGGCTTAGAAG	NA	NA	NA	NA
AWX00808.1|641550_642192_-	hypothetical protein	NA	E5AGC6	Erwinia_phage	45.8	9.3e-42
AWX00809.1|642191_642428_-	phosphoglycolate phosphatase	NA	E5AGC5	Erwinia_phage	81.6	3.3e-29
AWX00810.1|642436_643207_-	hypothetical protein	NA	E5AGC4	Erwinia_phage	76.2	9.3e-105
AWX00811.1|643184_644603_-	hypothetical protein	NA	E5AGC3	Erwinia_phage	77.8	4.1e-207
AWX04658.1|644668_645010_-	hypothetical protein	NA	E5AGC2	Erwinia_phage	74.3	1.3e-45
AWX00812.1|645077_645314_-	hypothetical protein	NA	NA	NA	NA	NA
AWX00813.1|645323_645998_-|plate	baseplate assembly protein	plate	E5AGC1	Erwinia_phage	83.5	3.3e-106
AWX00814.1|645997_646933_-	hypothetical protein	NA	E5AGC0	Erwinia_phage	89.3	4.1e-155
AWX00815.1|646907_647249_-	hypothetical protein	NA	E5AGB9	Erwinia_phage	80.5	2.4e-52
AWX00816.1|647245_647962_-	hypothetical protein	NA	E5AGB8	Erwinia_phage	73.0	8.4e-92
AWX00817.1|647963_649535_-	hypothetical protein	NA	E5AGB7	Erwinia_phage	50.3	3.4e-146
AWX00818.1|649696_650134_-	hypothetical protein	NA	E5AGB6	Erwinia_phage	67.8	1.0e-47
AWX00819.1|650168_650615_-	DUF3277 family protein	NA	E5AGB5	Erwinia_phage	75.0	1.3e-58
AWX00820.1|650617_651958_-	hypothetical protein	NA	E5AGB4	Erwinia_phage	77.1	6.4e-194
AWX00821.1|651977_652517_-	hypothetical protein	NA	E5AGB3	Erwinia_phage	69.3	6.4e-68
AWX00822.1|652509_652857_-	hypothetical protein	NA	E5AGB2	Erwinia_phage	82.3	7.2e-49
AWX04659.1|652853_653315_-	hypothetical protein	NA	E5AGB1	Erwinia_phage	64.7	1.1e-49
AWX00823.1|653305_653713_-	DUF4054 domain-containing protein	NA	E5AGB0	Erwinia_phage	75.4	4.4e-53
AWX00824.1|653712_653916_-	hypothetical protein	NA	E5AGA9	Erwinia_phage	73.1	2.9e-18
AWX00825.1|653948_654887_-	DNA-binding protein	NA	E5AGA8	Erwinia_phage	75.0	2.4e-131
AWX00826.1|654896_655406_-	hypothetical protein	NA	E5AGA7	Erwinia_phage	71.8	4.8e-57
AWX00827.1|655405_656578_-	hypothetical protein	NA	E5AGA6	Erwinia_phage	59.9	1.5e-122
AWX00828.1|656590_657397_-|head	phage head morphogenesis protein	head	E5AGA5	Erwinia_phage	63.5	4.8e-96
AWX00829.1|657389_658646_-	DUF1073 domain-containing protein	NA	E5AGA4	Erwinia_phage	62.7	9.1e-150
AWX00830.1|658654_660214_-|terminase	terminase	terminase	E5AGA3	Erwinia_phage	94.2	1.7e-294
AWX00831.1|660805_661327_-	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	97.7	2.1e-92
AWX00832.1|661599_661770_-	rz1 lytic protein	NA	U5P461	Shigella_phage	56.6	2.1e-09
AWX00833.1|661750_662128_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	39.6	2.8e-14
AWX00834.1|662124_662613_-	lysozyme	NA	A0A2H4FND7	Salmonella_phage	92.6	3.7e-83
AWX00835.1|662612_662885_-	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	98.9	2.0e-41
AWX00836.1|663108_663630_-	endodeoxyribonuclease	NA	A0A1V0E5R7	Salmonella_phage	64.7	7.0e-56
AWX00837.1|664220_664739_-	DUF1133 family protein	NA	Q716B8	Shigella_phage	89.5	2.5e-85
AWX00838.1|664738_664921_-	hypothetical protein	NA	C6ZR61	Salmonella_phage	50.0	3.2e-08
AWX00839.1|664908_665175_-	hypothetical protein	NA	G0ZNC5	Cronobacter_phage	72.6	2.7e-27
AWX00840.1|665171_665567_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M4REJ2	Salmonella_phage	94.7	6.1e-68
AWX00841.1|665563_665860_-	hypothetical protein	NA	F1C5C8	Cronobacter_phage	81.4	8.9e-40
AWX00842.1|665822_666005_-	NinF family protein	NA	A0A0M4S6T3	Salmonella_phage	66.0	7.2e-16
AWX00843.1|665997_666372_-	hypothetical protein	NA	A0A192Y677	Salmonella_phage	36.2	3.4e-12
AWX00844.1|666373_666589_-	hypothetical protein	NA	NA	NA	NA	NA
AWX00845.1|666591_666768_-	NinE family protein	NA	C6ZR57	Salmonella_phage	74.1	2.3e-19
AWX00846.1|666764_667175_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	86.8	3.6e-63
AWX00847.1|667146_667398_-	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
AWX00848.1|667352_667676_-	hypothetical protein	NA	E7C9R6	Salmonella_phage	55.1	1.1e-22
AWX00849.1|668539_668806_-	hypothetical protein	NA	NA	NA	NA	NA
AWX00850.1|668802_670173_-	replicative DNA helicase	NA	Q9MCP7	Enterobacteria_phage	75.3	1.5e-193
AWX00851.1|670169_670976_-	replication of DNA	NA	Q76H52	Enterobacteria_phage	80.5	3.2e-116
AWX00852.1|670968_671115_-	DUF2740 domain-containing protein	NA	Q687G5	Enterobacteria_phage	93.8	8.0e-18
AWX00853.1|671149_671428_-	hypothetical protein	NA	A5VW96	Enterobacteria_phage	82.4	1.1e-34
AWX00854.1|671536_671722_-	hypothetical protein	NA	Q5G8T3	Enterobacteria_phage	95.1	7.8e-26
AWX00855.1|671805_672456_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	93.1	2.9e-115
AWX00856.1|673366_673639_+	hypothetical protein	NA	NA	NA	NA	NA
AWX00857.1|674258_674567_+	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	52.9	8.4e-25
AWX00858.1|674563_675454_+	DNA recombinase	NA	K7PKG9	Enterobacteria_phage	78.3	7.4e-130
AWX00859.1|675453_675936_+	hypothetical protein	NA	G8C7S9	Escherichia_phage	84.4	4.3e-68
AWX00860.1|675945_676224_+	hypothetical protein	NA	A0A0M4R304	Salmonella_phage	55.6	1.1e-15
AWX00861.1|676220_676394_+	DUF2737 domain-containing protein	NA	A0A2H4FUQ1	Salmonella_phage	70.2	1.2e-17
AWX00862.1|676390_676879_+	hypothetical protein	NA	B1GS42	Salmonella_phage	41.3	8.7e-16
AWX00863.1|676875_677076_+	hypothetical protein	NA	NA	NA	NA	NA
AWX00864.1|677072_677408_+	hypothetical protein	NA	NA	NA	NA	NA
AWX04660.1|677555_678119_+	hypothetical protein	NA	G8C7V0	Escherichia_phage	53.8	1.9e-43
AWX04661.1|678326_678527_+	hypothetical protein	NA	G8C7S1	Escherichia_phage	50.0	5.0e-10
AWX00865.1|678539_679169_+	Eac protein	NA	A0A220NQT7	Salmonella_phage	85.2	6.0e-102
AWX00866.1|679171_679543_+	DNA-binding protein	NA	B9UDM0	Salmonella_phage	92.7	3.5e-57
AWX00867.1|679398_680562_+|integrase	integrase	integrase	B9UDL9	Salmonella_phage	91.5	2.9e-211
680576:680622	attR	AATGGCACGCCCTGTAGGATTCGAACCTACGACCTACGGCTTAGAAG	NA	NA	NA	NA
>prophage 57
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	690170	691037	4847638		Enterococcus_phage(100.0%)	1	NA	NA
AWX00876.1|690170_691037_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.5	5.0e-30
>prophage 58
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	694775	696161	4847638	tRNA	Moumouvirus(100.0%)	1	NA	NA
AWX00881.1|694775_696161_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	1.5e-44
>prophage 59
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	704268	704955	4847638		Planktothrix_phage(100.0%)	1	NA	NA
AWX00889.1|704268_704955_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.9	1.1e-32
>prophage 60
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	708087	708759	4847638		Bacillus_virus(100.0%)	1	NA	NA
AWX00893.1|708087_708759_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.3	2.7e-23
>prophage 61
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	711789	714288	4847638		uncultured_virus(100.0%)	1	NA	NA
AWX00898.1|711789_714288_+	Cu+ exporting ATPase	NA	A0A218MNH6	uncultured_virus	37.2	5.9e-108
>prophage 62
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	724265	729810	4847638		uncultured_Mediterranean_phage(33.33%)	5	NA	NA
AWX00907.1|724265_726140_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.1	8.6e-112
AWX00908.1|726250_726856_-	recombination protein RecR	NA	NA	NA	NA	NA
AWX00909.1|726855_727188_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AWX00910.1|727241_729170_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	42.9	7.9e-44
AWX00911.1|729258_729810_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.9	1.6e-29
>prophage 63
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	736579	743633	4847638		Leptospira_phage(50.0%)	6	NA	NA
AWX00919.1|736579_739726_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.1	3.4e-52
AWX00920.1|740236_740611_+	Hha toxicity modulator TomB	NA	NA	NA	NA	NA
AWX00921.1|740638_740857_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
AWX00922.1|741065_741617_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
AWX00923.1|741733_742201_+	hypothetical protein	NA	NA	NA	NA	NA
AWX00924.1|742172_743633_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.8	2.0e-15
>prophage 64
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	746672	750936	4847638		Herpes_simplex_virus(50.0%)	2	NA	NA
AWX00929.1|746672_749762_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	66.1	0.0e+00
AWX00930.1|749865_750936_-	lac repressor	NA	C6ZCU4	Enterobacteria_phage	53.4	2.2e-88
>prophage 65
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	758084	761613	4847638		Bacillus_phage(100.0%)	2	NA	NA
AWX00940.1|758084_759866_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.0	4.0e-42
AWX00941.1|759858_761613_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.2	3.7e-48
>prophage 66
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	765991	767357	4847638		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
AWX00945.1|765991_766687_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.4	9.3e-88
AWX00946.1|766690_767020_-	DNA-binding protein	NA	NA	NA	NA	NA
AWX00947.1|767006_767357_-	addiction module killer protein	NA	A4JWV2	Burkholderia_virus	47.6	1.0e-13
>prophage 67
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	770513	775561	4847638	protease	Sodalis_phage(25.0%)	4	NA	NA
AWX00951.1|770513_770786_-	DNA-binding protein HU-beta	NA	A3E2K9	Sodalis_phage	61.8	8.5e-21
AWX00952.1|770996_773351_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	5.5e-225
AWX00953.1|773535_774810_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.8	1.3e-132
AWX00954.1|774937_775561_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.2e-64
>prophage 68
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	796439	798101	4847638		Staphylococcus_phage(50.0%)	2	NA	NA
AWX00975.1|796439_796910_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.0	1.0e-29
AWX00976.1|796997_798101_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	33.7	2.9e-51
>prophage 69
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	801712	806052	4847638	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
AWX00980.1|801712_802684_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	40.2	2.5e-46
AWX00981.1|802694_804542_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
AWX00982.1|804569_804902_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
AWX00983.1|804924_806052_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.3	1.2e-89
>prophage 70
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	817869	826856	4847638		Bacillus_phage(60.0%)	6	NA	NA
AWX00992.1|817869_819165_-	two-component system sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.3	2.2e-26
AWX00993.1|819186_819876_-	phosphate regulon transcriptional regulator PhoB	NA	W8CYM9	Bacillus_phage	37.6	9.7e-37
AWX00994.1|820063_821269_+	exonuclease subunit SbcD	NA	A0A0A0PQ58	Bacillus_phage	24.9	1.5e-08
AWX00995.1|821265_824397_+	exonuclease subunit SbcC	NA	M1U9H5	Synechococcus_phage	30.1	2.3e-08
AWX00996.1|824912_825818_-	fructokinase	NA	NA	NA	NA	NA
AWX00997.1|825941_826856_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	62.4	2.2e-100
>prophage 71
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	830463	831567	4847638		Bacillus_phage(100.0%)	1	NA	NA
AWX01004.1|830463_831567_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	31.4	9.5e-18
>prophage 72
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	839480	840641	4847638		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AWX01014.1|839480_840641_+	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.9	6.7e-06
>prophage 73
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	849154	849922	4847638		Planktothrix_phage(100.0%)	1	NA	NA
AWX01022.1|849154_849922_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	38.0	4.7e-24
>prophage 74
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	854769	856554	4847638		Bacillus_phage(100.0%)	1	NA	NA
AWX01027.1|854769_856554_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.9	6.9e-18
>prophage 75
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	860767	916198	4847638	holin,tail,coat,lysis,terminase,integrase,transposase	Escherichia_phage(40.3%)	81	863907:863952	912285:912330
AWX01032.1|860767_861966_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	88.8	5.1e-166
AWX01033.1|861958_862150_+	hypothetical protein	NA	NA	NA	NA	NA
AWX01034.1|862172_862529_-	hypothetical protein	NA	NA	NA	NA	NA
AWX01035.1|862531_863074_-	type IV secretion protein Rhs	NA	NA	NA	NA	NA
863907:863952	attL	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
AWX01036.1|864092_864416_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.4	4.9e-23
AWX01037.1|864415_864655_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	70.9	3.5e-26
AWX01038.1|864737_866039_-|tail	phage tail protein	tail	G8C7R8	Escherichia_phage	55.5	1.7e-119
AWX01039.1|866098_867064_-	hypothetical protein	NA	G1CSU0	Cronobacter_virus	40.2	1.3e-58
AWX01040.1|867065_870965_-	host specificity protein	NA	G8C7R4	Escherichia_phage	76.3	0.0e+00
AWX01041.1|871020_871620_-|tail	tail assembly protein	tail	G8C7R3	Escherichia_phage	95.0	3.1e-100
AWX01042.1|871607_872339_-	peptidase P60	NA	G8C7R2	Escherichia_phage	96.7	5.3e-150
AWX01043.1|872351_873125_-|tail	phage minor tail protein L	tail	G8C7R1	Escherichia_phage	94.5	3.9e-143
AWX01044.1|873121_873472_-	hypothetical protein	NA	G8C7R0	Escherichia_phage	91.4	7.5e-54
AWX01045.1|873557_873950_-	hypothetical protein	NA	NA	NA	NA	NA
AWX01046.1|874000_877174_-|tail	phage tail tape measure protein	tail	G8C7Q6	Escherichia_phage	83.6	0.0e+00
AWX01047.1|877173_877461_-	hypothetical protein	NA	I6PD79	Cronobacter_phage	61.5	1.2e-17
AWX01048.1|877478_877817_-	hypothetical protein	NA	G8C7Q5	Escherichia_phage	92.9	9.5e-54
AWX01049.1|877884_878793_-	hypothetical protein	NA	G8C7Q4	Escherichia_phage	66.5	7.0e-51
AWX01050.1|878936_879869_-|tail	phage tail protein	tail	G8C7Q3	Escherichia_phage	99.0	7.9e-167
AWX01051.1|879915_880365_-	hypothetical protein	NA	G8C7Q2	Escherichia_phage	89.9	4.6e-72
AWX01052.1|880354_880954_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	87.9	2.3e-98
AWX01053.1|880956_881310_-	hypothetical protein	NA	G8C7Q0	Escherichia_phage	90.5	5.4e-52
AWX01054.1|881311_881794_-	hypothetical protein	NA	G8C7P9	Escherichia_phage	95.6	4.3e-84
AWX01055.1|881796_882054_-	hypothetical protein	NA	G8C7P8	Escherichia_phage	52.9	9.5e-14
AWX01056.1|882093_883230_-|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	92.3	1.1e-194
AWX01057.1|883246_883999_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	96.0	4.8e-130
AWX01058.1|884106_884316_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	48.5	1.0e-13
AWX01059.1|884319_885426_-	hypothetical protein	NA	G8C7P5	Escherichia_phage	89.4	2.0e-185
AWX01060.1|885427_886831_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	95.7	6.8e-255
AWX01061.1|886835_888320_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	83.3	2.0e-252
AWX01062.1|888319_888835_-	hypothetical protein	NA	A0A0H5AUE2	Pseudomonas_phage	62.2	6.7e-51
AWX01063.1|888838_889045_-	hypothetical protein	NA	NA	NA	NA	NA
AWX01064.1|889374_889893_-	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	98.8	2.1e-92
AWX01065.1|890179_890662_-|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	57.2	2.7e-38
AWX01066.1|890658_891135_-	lysozyme	NA	K7PKX1	Enterobacterial_phage	90.3	6.0e-78
AWX01067.1|891138_891414_-|holin	phage holin family protein	holin	S4TNV9	Salmonella_phage	41.0	5.8e-09
AWX01068.1|891410_891812_-	hypothetical protein	NA	NA	NA	NA	NA
AWX01069.1|892308_892998_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.9	1.4e-56
AWX01070.1|892994_893111_-	hypothetical protein	NA	NA	NA	NA	NA
AWX01071.1|893107_893713_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	69.8	2.2e-40
AWX01072.1|893705_893870_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	73.2	6.1e-14
AWX01073.1|893862_894300_-	recombination protein NinB	NA	Q5G8S5	Enterobacteria_phage	59.2	6.8e-44
AWX01074.1|894484_894766_-	hypothetical protein	NA	NA	NA	NA	NA
AWX01075.1|894910_895096_-	hypothetical protein	NA	NA	NA	NA	NA
AWX01076.1|895095_895377_-	hypothetical protein	NA	A0A2D2W302	Escherichia_phage	40.8	1.6e-06
AWX01077.1|895376_896108_-	hypothetical protein	NA	A5LH60	Enterobacteria_phage	36.8	1.9e-14
AWX01078.1|896104_896314_-	hypothetical protein	NA	A0A1I9LJM3	Stx_converting_phage	69.1	8.2e-24
AWX01079.1|896315_896702_-	hypothetical protein	NA	A0A2H4FRZ0	Salmonella_phage	46.2	6.7e-11
AWX01080.1|896714_897134_-	hypothetical protein	NA	NA	NA	NA	NA
AWX01081.1|897130_897631_-	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	37.6	2.0e-07
AWX01082.1|897627_897909_-	hypothetical protein	NA	S4TW48	Salmonella_phage	55.3	3.2e-15
AWX01083.1|897991_898336_-	transcriptional regulator	NA	G8C7U7	Escherichia_phage	73.0	4.2e-41
AWX01084.1|898332_899034_-	Replication protein P	NA	A0A0M3ULE2	Salmonella_phage	70.8	3.7e-92
AWX01085.1|899030_899963_-	replication protein	NA	A5VW95	Enterobacteria_phage	79.4	1.5e-53
AWX01086.1|900148_900691_-	regulator	NA	M9NZI6	Enterobacteria_phage	92.2	3.3e-88
AWX01087.1|900721_900973_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	54.7	9.0e-17
AWX01088.1|901100_901793_+	hypothetical protein	NA	G8C7U1	Escherichia_phage	52.9	1.8e-59
AWX01089.1|901828_902305_+	hypothetical protein	NA	Q5G8W9	Enterobacteria_phage	64.7	1.1e-50
AWX01090.1|903166_903358_+	hypothetical protein	NA	A0A2H4FQS9	Salmonella_phage	57.8	8.3e-15
AWX01091.1|903403_903664_+	hypothetical protein	NA	NA	NA	NA	NA
AWX01092.1|903805_904003_+	hypothetical protein	NA	NA	NA	NA	NA
AWX01093.1|904157_904367_+	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	95.7	6.7e-34
AWX01094.1|904413_904923_+	Pathogenesis-related transcriptional factor and ERF protein	NA	A0A1W6DY33	Salmonella_phage	44.7	1.3e-35
AWX01095.1|904919_905204_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	94.7	2.2e-48
AWX01096.1|905222_905969_+	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	65.8	1.8e-65
AWX01097.1|905965_906583_+	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	60.2	6.2e-59
AWX01098.1|906579_907008_+	regulator	NA	M9NYX4	Enterobacteria_phage	93.0	4.9e-71
AWX01099.1|907168_907720_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	60.0	5.2e-57
AWX01100.1|907716_907935_+	hypothetical protein	NA	NA	NA	NA	NA
AWX01101.1|907931_908204_+	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	57.5	4.2e-20
AWX01102.1|908200_908401_+	hypothetical protein	NA	NA	NA	NA	NA
AWX01103.1|908397_908934_+	HNH endonuclease	NA	A0A1I9SEX5	Klebsiella_phage	51.0	9.2e-35
AWX01104.1|909000_909222_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	61.1	1.0e-16
AWX01105.1|909417_909657_+	hypothetical protein	NA	M1FPC8	Enterobacteria_phage	73.1	5.4e-27
AWX01106.1|909666_909852_+	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	52.0	1.1e-06
AWX01107.1|910043_910244_+	hypothetical protein	NA	G8C7S1	Escherichia_phage	84.8	2.2e-26
AWX01108.1|910254_910584_+	hypothetical protein	NA	G9L655	Escherichia_phage	52.1	3.5e-21
AWX01109.1|911109_912270_+|integrase	integrase	integrase	K7P7R5	Enterobacteria_phage	92.7	3.1e-213
AWX01110.1|912471_913725_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.1	1.2e-96
912285:912330	attR	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
AWX01111.1|913736_914840_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.9	1.3e-59
AWX01112.1|915145_916198_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	2.6e-118
>prophage 76
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	929401	929980	4847638		Caulobacter_phage(100.0%)	1	NA	NA
AWX01127.1|929401_929980_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	31.4	1.5e-14
>prophage 77
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	935739	937989	4847638		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AWX01130.1|935739_937989_+	type I secretion system permease/ATPase	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.5	5.2e-23
>prophage 78
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	947235	947943	4847638		Planktothrix_phage(100.0%)	1	NA	NA
AWX01138.1|947235_947943_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	2.5e-32
>prophage 79
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	957715	961588	4847638		Moraxella_phage(100.0%)	1	NA	NA
AWX01148.1|957715_961588_-	hemagglutinin	NA	A0A0R6PJK4	Moraxella_phage	35.5	4.3e-25
>prophage 80
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	981525	985730	4847638		Bradyrhizobium_phage(33.33%)	5	NA	NA
AWX01154.1|981525_982266_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	5.0e-39
AWX01155.1|982321_982789_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.4	4.0e-50
AWX01156.1|982789_983506_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWX01157.1|983538_984297_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AWX01158.1|984365_985730_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	9.9e-09
>prophage 81
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	989786	990590	4847638		Indivirus(100.0%)	1	NA	NA
AWX01162.1|989786_990590_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.8	2.7e-38
>prophage 82
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	997256	998288	4847638		Planktothrix_phage(100.0%)	1	NA	NA
AWX01164.1|997256_998288_+	D-methionine ABC transporter, ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.2	5.5e-36
>prophage 83
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1010252	1014370	4847638		Saccharomonospora_phage(50.0%)	2	NA	NA
AWX01178.1|1010252_1013735_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.5	7.7e-207
AWX01179.1|1013773_1014370_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.8	4.6e-27
>prophage 84
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1023196	1023955	4847638		Flavobacterium_phage(100.0%)	1	NA	NA
AWX01188.1|1023196_1023955_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	43.0	1.4e-25
>prophage 85
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1035313	1036747	4847638	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AWX01198.1|1035313_1036747_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.2	2.5e-26
>prophage 86
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1040682	1041027	4847638		Lake_Baikal_phage(100.0%)	1	NA	NA
AWX01202.1|1040682_1041027_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 87
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1046933	1047731	4847638		Planktothrix_phage(100.0%)	1	NA	NA
AWX01207.1|1046933_1047731_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	4.6e-14
>prophage 88
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1052899	1059673	4847638	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
AWX01211.1|1052899_1055329_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.6	5.3e-37
AWX01212.1|1055402_1055957_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
AWX01213.1|1055946_1056651_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
AWX01214.1|1056827_1057283_+	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
AWX01215.1|1057342_1058233_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AWX04674.1|1058248_1059673_+	polynucleotide adenylyltransferase	NA	H7BUW3	unidentified_phage	31.5	1.6e-25
>prophage 89
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1072244	1078785	4847638		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
AWX01229.1|1072244_1073171_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.3	5.3e-22
AWX01230.1|1073278_1073941_+	carbonate dehydratase	NA	NA	NA	NA	NA
AWX01231.1|1074005_1074542_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	1.3e-17
AWX01232.1|1074748_1077139_+	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
AWX01233.1|1077225_1078785_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	57.6	3.2e-19
>prophage 90
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1087026	1088451	4847638		Erysipelothrix_phage(100.0%)	1	NA	NA
AWX01240.1|1087026_1088451_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.3	3.5e-41
>prophage 91
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1099391	1099955	4847638		Sphingobium_phage(100.0%)	1	NA	NA
AWX01248.1|1099391_1099955_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	33.1	6.7e-12
>prophage 92
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1104146	1105190	4847638		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AWX01253.1|1104146_1105190_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.6	1.1e-103
>prophage 93
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1131141	1132866	4847638		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AWX01276.1|1131141_1132866_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.7	4.9e-37
>prophage 94
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1145651	1146353	4847638		Planktothrix_phage(100.0%)	1	NA	NA
AWX01288.1|1145651_1146353_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	34.5	1.1e-22
>prophage 95
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1152626	1158018	4847638		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
AWX01294.1|1152626_1154984_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.7	1.4e-29
AWX01295.1|1155111_1158018_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	36.6	4.9e-21
>prophage 96
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1165656	1167024	4847638		Pseudomonas_phage(50.0%)	2	NA	NA
AWX01303.1|1165656_1166505_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A0A0YWI7	Pseudomonas_phage	42.3	4.9e-06
AWX01304.1|1166544_1167024_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	42.5	1.2e-28
>prophage 97
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1176560	1177709	4847638		Halovirus(100.0%)	1	NA	NA
AWX01309.1|1176560_1177709_-	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	31.9	5.4e-48
>prophage 98
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1181208	1195036	4847638	tRNA	Megavirus(20.0%)	13	NA	NA
AWX01314.1|1181208_1184025_-|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	25.5	3.8e-79
AWX01315.1|1184070_1184997_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
AWX01316.1|1185004_1185097_-	DUF2575 domain-containing protein	NA	NA	NA	NA	NA
AWX01317.1|1185325_1185589_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
AWX01318.1|1185647_1186547_-	transcriptional activator NhaR	NA	NA	NA	NA	NA
AWX01319.1|1186605_1187781_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.7	4.7e-84
AWX01320.1|1187954_1189100_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	35.3	4.1e-24
AWX01321.1|1189187_1191101_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.6	3.8e-147
AWX01322.1|1191218_1191404_-	hypothetical protein	NA	NA	NA	NA	NA
AWX01323.1|1191396_1191963_+	acetate uptake transporter	NA	NA	NA	NA	NA
AWX01324.1|1191939_1193262_-	MFS transporter	NA	NA	NA	NA	NA
AWX01325.1|1193384_1193972_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
AWX01326.1|1194082_1195036_-	transaldolase	NA	A0A127KNC6	Cyanophage	32.1	5.7e-11
>prophage 99
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1208436	1215699	4847638		Bacillus_phage(33.33%)	5	NA	NA
AWX01341.1|1208436_1210374_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	36.2	3.6e-12
AWX01342.1|1210600_1212268_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.6	1.1e-41
AWX01343.1|1212359_1213259_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWX01344.1|1213367_1214369_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
AWX01345.1|1214466_1215699_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.4	4.4e-88
>prophage 100
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1224646	1225969	4847638		Geobacillus_virus(100.0%)	1	NA	NA
AWX01355.1|1224646_1225969_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	1.2e-78
>prophage 101
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1231428	1234227	4847638		Salmonella_phage(50.0%)	3	NA	NA
AWX01360.1|1231428_1231608_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	69.8	2.5e-13
AWX01361.1|1231715_1232333_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
AWX01362.1|1232637_1234227_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	26.0	7.0e-30
>prophage 102
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1237965	1239030	4847638		Bacillus_phage(100.0%)	1	NA	NA
AWX01368.1|1237965_1239030_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.9	3.4e-20
>prophage 103
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1246294	1247574	4847638		Salmonella_phage(50.0%)	2	NA	NA
AWX01378.1|1246294_1246840_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	56.4	4.4e-24
AWX01379.1|1246836_1247574_+	AAA family ATPase	NA	A0A1W6JP39	Morganella_phage	48.1	7.1e-62
>prophage 104
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1251305	1252970	4847638		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AWX01383.1|1251305_1252970_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.4	2.5e-14
>prophage 105
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1292121	1299234	4847638	protease	Bacillus_virus(50.0%)	3	NA	NA
AWX01421.1|1292121_1292727_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	G3M9Z8	Bacillus_virus	39.8	7.2e-28
AWX01422.1|1293027_1293645_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AWX01423.1|1293648_1299234_-	GAF domain-containing protein	NA	Q67624	IC4_retrovirus	33.3	3.4e-07
>prophage 106
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1305019	1307925	4847638		Mycobacterium_phage(50.0%)	2	NA	NA
AWX01431.1|1305019_1305841_+	alpha/beta hydrolase	NA	A0A249XMC3	Mycobacterium_phage	28.4	4.3e-15
AWX01432.1|1305972_1307925_+	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	30.2	2.6e-26
>prophage 107
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1320875	1322171	4847638		Pseudomonas_phage(50.0%)	2	NA	NA
AWX01449.1|1320875_1321319_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.1	5.1e-15
AWX01450.1|1321349_1322171_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.3	8.8e-45
>prophage 108
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1329780	1332243	4847638		Staphylococcus_phage(100.0%)	1	NA	NA
AWX01460.1|1329780_1332243_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	35.7	7.9e-73
>prophage 109
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1337053	1344699	4847638		Liberibacter_phage(33.33%)	6	NA	NA
AWX01464.1|1337053_1340149_+	restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	28.5	4.2e-55
AWX01465.1|1340148_1340862_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AWX01466.1|1340907_1342389_-	SAM-dependent methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	33.1	5.6e-58
AWX01467.1|1342381_1342984_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AWX01468.1|1343000_1343189_-	hypothetical protein	NA	NA	NA	NA	NA
AWX01469.1|1343451_1344699_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	43.5	2.1e-82
>prophage 110
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1363071	1373248	4847638		Paramecium_bursaria_Chlorella_virus(25.0%)	8	NA	NA
AWX01487.1|1363071_1364004_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	1.3e-52
AWX01488.1|1364016_1364478_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
AWX01489.1|1364551_1364938_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
AWX01490.1|1365076_1366525_+	N-acetylglucosamine-binding protein GbpA	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	36.1	1.1e-21
AWX01491.1|1366619_1369004_-	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
AWX01492.1|1369078_1369309_+	hypothetical protein	NA	NA	NA	NA	NA
AWX04686.1|1369204_1371913_-	magnesium-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	25.1	2.6e-37
AWX01493.1|1372300_1373248_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	22.1	1.2e-13
>prophage 111
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1378455	1381199	4847638		Vibrio_phage(50.0%)	2	NA	NA
AWX01499.1|1378455_1380594_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.9	1.7e-268
AWX01500.1|1380734_1381199_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	55.2	2.3e-50
>prophage 112
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1394609	1402766	4847638		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
AWX01516.1|1394609_1395608_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	43.0	3.7e-69
AWX01517.1|1395648_1397217_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.4	7.4e-08
AWX01518.1|1397310_1398312_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
AWX01519.1|1398298_1399321_-	ABC transporter permease	NA	NA	NA	NA	NA
AWX01520.1|1399334_1400837_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.8	2.0e-10
AWX01521.1|1400969_1401926_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWX01522.1|1402235_1402766_+	inorganic pyrophosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.7	1.6e-55
>prophage 113
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1419375	1421025	4847638		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AWX01537.1|1419375_1421025_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.7	1.7e-10
>prophage 114
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1437031	1438963	4847638		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AWX01559.1|1437031_1438963_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.2	2.6e-10
>prophage 115
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1442938	1455924	4847638	protease,tRNA	Lactococcus_phage(20.0%)	11	NA	NA
AWX01563.1|1442938_1445380_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.2	8.4e-67
AWX01564.1|1445418_1445844_-	HTH-type transcriptional repressor NsrR	NA	NA	NA	NA	NA
AWX04688.1|1446036_1447335_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.4	6.4e-66
AWX01565.1|1447439_1447637_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
AWX01566.1|1447708_1448713_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
AWX01567.1|1448715_1449975_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
AWX01568.1|1450031_1451312_-	GTPase HflX	NA	NA	NA	NA	NA
AWX01569.1|1451386_1451698_-	RNA-binding protein Hfq	NA	NA	NA	NA	NA
AWX01570.1|1451783_1452734_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AWX01571.1|1452726_1454571_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.4	2.2e-59
AWX01572.1|1454580_1455924_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.1	2.6e-17
>prophage 116
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1459840	1460386	4847638		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AWX01576.1|1459840_1460386_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.0	1.5e-29
>prophage 117
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1467669	1468647	4847638		Tupanvirus(100.0%)	1	NA	NA
AWX01580.1|1467669_1468647_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.8	5.8e-27
>prophage 118
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1474592	1475123	4847638		Morganella_phage(100.0%)	1	NA	NA
AWX01587.1|1474592_1475123_+	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	51.6	3.3e-45
>prophage 119
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1481413	1483394	4847638		Vibrio_phage(50.0%)	2	NA	NA
AWX01598.1|1481413_1483060_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	69.3	6.9e-190
AWX01599.1|1483100_1483394_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	2.1e-12
>prophage 120
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1500231	1501734	4847638		Burkholderia_virus(100.0%)	1	NA	NA
AWX01610.1|1500231_1501734_-	proline/glycine betaine transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.0	5.9e-55
>prophage 121
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1508250	1509039	4847638		Pithovirus(100.0%)	1	NA	NA
AWX01616.1|1508250_1509039_+	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.7	5.9e-14
>prophage 122
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1514589	1516035	4847638		Bacillus_virus(50.0%)	2	NA	NA
AWX01623.1|1514589_1515345_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	26.7	6.1e-16
AWX01624.1|1515354_1516035_+	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.0	3.5e-07
>prophage 123
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1521818	1523333	4847638		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
AWX01631.1|1521818_1523333_+	sugar ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	24.0	7.2e-08
>prophage 124
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1527908	1531044	4847638		Bacillus_phage(50.0%)	2	NA	NA
AWX01637.1|1527908_1528640_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	37.7	4.8e-26
AWX01638.1|1528896_1531044_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	24.2	3.2e-30
>prophage 125
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1534134	1536093	4847638		Staphylococcus_phage(100.0%)	1	NA	NA
AWX01642.1|1534134_1536093_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.1	3.0e-91
>prophage 126
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1542111	1543461	4847638		Moraxella_phage(100.0%)	1	NA	NA
AWX01649.1|1542111_1543461_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	72.0	3.0e-159
>prophage 127
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1549648	1553247	4847638		Enterobacteria_phage(50.0%)	2	NA	NA
AWX01656.1|1549648_1550173_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	96.3	5.1e-54
AWX01657.1|1550424_1553247_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.8	0.0e+00
>prophage 128
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1556411	1558920	4847638		Yellowstone_lake_mimivirus(50.0%)	2	NA	NA
AWX01662.1|1556411_1557491_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.6	1.6e-30
AWX01663.1|1557507_1558920_-	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.3	8.2e-200
>prophage 129
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1565980	1566589	4847638		Lactococcus_phage(100.0%)	1	NA	NA
AWX01672.1|1565980_1566589_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	40.7	2.7e-14
>prophage 130
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1573688	1574798	4847638		Mycoplasma_phage(100.0%)	1	NA	NA
AWX01678.1|1573688_1574798_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
>prophage 131
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1589546	1595571	4847638		Brucella_phage(66.67%)	4	NA	NA
AWX01692.1|1589546_1589849_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	53.8	2.9e-22
AWX04692.1|1589855_1590143_+	putative addiction module antidote protein	NA	A0A141GEX5	Brucella_phage	44.3	1.2e-12
AWX04693.1|1590139_1591771_-	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
AWX01693.1|1591887_1595571_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	91.8	2.2e-26
>prophage 132
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1608173	1613585	4847638		Prochlorococcus_phage(33.33%)	6	NA	NA
AWX01699.1|1608173_1609763_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	48.4	1.4e-67
AWX01700.1|1609778_1611071_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
AWX01701.1|1611118_1611811_-	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
AWX01702.1|1611822_1612095_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	56.7	1.2e-19
AWX01703.1|1612281_1612872_-	DUF416 family protein	NA	NA	NA	NA	NA
AWX01704.1|1612913_1613585_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	30.1	1.3e-22
>prophage 133
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1622005	1632738	4847638		Bacillus_phage(33.33%)	5	NA	NA
AWX01714.1|1622005_1623547_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.4	8.3e-12
AWX01715.1|1623727_1624036_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
AWX01716.1|1624035_1624353_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
AWX01717.1|1624409_1628633_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.4	4.5e-68
AWX01718.1|1628709_1632738_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.4	3.6e-22
>prophage 134
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1636727	1641776	4847638		Tupanvirus(25.0%)	4	NA	NA
AWX01725.1|1636727_1637912_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.5	2.6e-13
AWX01726.1|1638789_1639740_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	1.1e-27
AWX01727.1|1639782_1640796_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.4	4.3e-17
AWX01728.1|1640792_1641776_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.9	4.3e-14
>prophage 135
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1651322	1653692	4847638		Escherichia_phage(100.0%)	1	NA	NA
AWX01737.1|1651322_1653692_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	30.2	2.4e-71
>prophage 136
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1658870	1663346	4847638		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
AWX01743.1|1658870_1659845_+	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	27.7	2.8e-21
AWX01744.1|1659903_1660116_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AWX01745.1|1660359_1661070_-	DUF3053 domain-containing protein	NA	NA	NA	NA	NA
AWX01746.1|1661400_1661688_+	transcriptional regulator	NA	NA	NA	NA	NA
AWX01747.1|1661726_1663346_-	ABC transporter ATP-binding protein	NA	A0A2I4R674	Erysipelothrix_phage	26.1	4.0e-25
>prophage 137
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1667281	1670572	4847638		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
AWX01752.1|1667281_1668052_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	31.3	1.9e-25
AWX01753.1|1668054_1668597_-	Sec-independent protein translocase TatB	NA	NA	NA	NA	NA
AWX01754.1|1668600_1668855_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
AWX01755.1|1668931_1670572_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	28.4	1.7e-42
>prophage 138
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1682917	1684747	4847638		Catovirus(100.0%)	1	NA	NA
AWX01768.1|1682917_1684747_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.4	1.3e-83
>prophage 139
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1688673	1692534	4847638		Bacillus_phage(50.0%)	3	NA	NA
AWX01774.1|1688673_1690836_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	2.5e-115
AWX01775.1|1690915_1691632_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
AWX01776.1|1691631_1692534_-	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	29.4	2.0e-18
>prophage 140
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1710283	1714482	4847638		uncultured_marine_virus(33.33%)	4	NA	NA
AWX01793.1|1710283_1711414_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	33.5	5.1e-19
AWX01794.1|1711418_1712096_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
AWX01795.1|1712092_1713355_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HPJ2	Paramecium_bursaria_Chlorella_virus	26.4	1.5e-22
AWX01796.1|1713351_1714482_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	30.2	1.4e-27
>prophage 141
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1718545	1730471	4847638		Indivirus(20.0%)	12	NA	NA
AWX01800.1|1718545_1718875_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	2.5e-14
AWX01801.1|1719019_1720288_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.4	2.2e-42
AWX01802.1|1720294_1721779_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
AWX01803.1|1721829_1723854_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.5	5.8e-114
AWX01804.1|1723939_1724221_+	peptidylprolyl isomerase C	NA	NA	NA	NA	NA
AWX04694.1|1724275_1725097_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
AWX01805.1|1725172_1726192_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AWX01806.1|1726191_1726659_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
AWX01807.1|1726690_1726942_-	glutaredoxin 3	NA	A0A141ZMK2	Faustovirus	38.2	3.8e-07
AWX01808.1|1726953_1727385_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AWX01809.1|1727633_1729178_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
AWX01810.1|1729187_1730471_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	35.4	4.6e-08
>prophage 142
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1734587	1737968	4847638		Vibrio_phage(33.33%)	3	NA	NA
AWX01815.1|1734587_1735616_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	80.8	2.3e-18
AWX01816.1|1735625_1736822_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	27.8	4.6e-34
AWX01817.1|1737035_1737968_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	36.4	2.9e-36
>prophage 143
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1747660	1755259	4847638		Catovirus(20.0%)	10	NA	NA
AWX01827.1|1747660_1748650_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	27.3	7.2e-09
AWX01828.1|1748716_1749991_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
AWX01829.1|1749990_1750761_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AWX01830.1|1750764_1751244_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.9	2.4e-26
AWX01831.1|1751246_1752056_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.6	1.2e-25
AWX01832.1|1752128_1752296_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
AWX01833.1|1752318_1752555_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
AWX01834.1|1752772_1753438_-	JAB domain-containing protein	NA	NA	NA	NA	NA
AWX04696.1|1753611_1754823_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.6	5.1e-41
AWX04695.1|1754803_1755259_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	60.8	9.5e-49
>prophage 144
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1767725	1772734	4847638		uncultured_virus(33.33%)	5	NA	NA
AWX01848.1|1767725_1769396_-	NAD-dependent DNA ligase LigB	NA	A0A218MKC8	uncultured_virus	23.3	1.1e-20
AWX01849.1|1769413_1769599_+	hypothetical protein	NA	NA	NA	NA	NA
AWX01850.1|1769646_1770270_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.0	9.7e-20
AWX01851.1|1770324_1770600_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AWX01852.1|1770619_1772734_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis(diphosphate) 3'-diphosphatase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 145
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1776944	1778336	4847638		environmental_Halophage(100.0%)	1	NA	NA
AWX01856.1|1776944_1778336_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	95.9	2.3e-69
>prophage 146
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1784500	1793657	4847638		uncultured_Caudovirales_phage(60.0%)	8	NA	NA
AWX01860.1|1784500_1785724_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	69.4	5.5e-160
AWX01861.1|1785819_1787445_-	ATP-dependent helicase	NA	Q331U3	Clostridium_botulinum_C_phage	21.9	1.1e-09
AWX01862.1|1787446_1789147_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AWX01863.1|1789352_1789703_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.8e-23
AWX01864.1|1789750_1790113_+	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AWX01865.1|1790130_1791882_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AWX01866.1|1791929_1793219_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.8	1.6e-170
AWX01867.1|1793231_1793657_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	73.6	1.0e-52
>prophage 147
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1797122	1800369	4847638		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
AWX01872.1|1797122_1797836_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.6	9.5e-96
AWX04697.1|1797837_1798161_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AWX01873.1|1798291_1798687_-	hypothetical protein	NA	NA	NA	NA	NA
AWX01874.1|1798795_1799815_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AWX01875.1|1800165_1800369_-	AlpA family phage regulatory protein	NA	A0A1V0E8E5	Vibrio_phage	41.1	7.5e-06
>prophage 148
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1804256	1805078	4847638		Yersinia_phage(100.0%)	1	NA	NA
AWX01880.1|1804256_1805078_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.0	1.8e-45
>prophage 149
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1809310	1810294	4847638		Wolbachia_phage(100.0%)	1	NA	NA
AWX01888.1|1809310_1810294_+	hydroxyacid dehydrogenase	NA	Q9JMN3	Wolbachia_phage	44.2	2.4e-73
>prophage 150
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1821792	1825967	4847638		Morganella_phage(33.33%)	5	NA	NA
AWX01901.1|1821792_1822317_-	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	58.9	9.9e-50
AWX01902.1|1822434_1823160_+	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	42.7	5.2e-41
AWX01903.1|1823259_1823670_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
AWX01904.1|1823772_1824732_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
AWX01905.1|1824878_1825967_+	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	62.2	3.9e-125
>prophage 151
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1831260	1833357	4847638		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AWX01912.1|1831260_1833357_-	peptidase domain-containing ABC transporter	NA	F2Y1V5	Organic_Lake_phycodnavirus	23.9	3.9e-12
>prophage 152
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1859747	1860905	4847638		Salmonella_phage(100.0%)	1	NA	NA
AWX01937.1|1859747_1860905_+	MFS transporter	NA	S4TR35	Salmonella_phage	26.6	1.3e-28
>prophage 153
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1871872	1872877	4847638		Tupanvirus(100.0%)	1	NA	NA
AWX01950.1|1871872_1872877_-	alpha/beta hydrolase	NA	A0A2K9KZN8	Tupanvirus	28.4	2.6e-06
>prophage 154
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1878334	1880023	4847638		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
AWX01956.1|1878334_1880023_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	31.5	2.6e-59
>prophage 155
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1883263	1884448	4847638		Salmonella_phage(100.0%)	1	NA	NA
AWX04699.1|1883263_1884448_+	multidrug transporter EmrD	NA	S4TR35	Salmonella_phage	25.6	1.6e-15
>prophage 156
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1895834	1896810	4847638		Synechococcus_phage(50.0%)	2	NA	NA
AWX01971.1|1895834_1896263_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	37.3	1.1e-14
AWX01972.1|1896399_1896810_-	heat shock protein IbpA	NA	A0A218MKI2	uncultured_virus	39.2	5.4e-19
>prophage 157
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1900254	1901403	4847638		Oenococcus_phage(100.0%)	1	NA	NA
AWX01976.1|1900254_1901403_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	33.1	9.4e-53
>prophage 158
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1906825	1914213	4847638		Bacillus_virus(33.33%)	8	NA	NA
AWX01983.1|1906825_1909237_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.2	3.1e-114
AWX01984.1|1909265_1910339_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
AWX01985.1|1910338_1911439_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	1.5e-52
AWX01986.1|1911443_1912838_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
AWX01987.1|1913163_1913364_-	hypothetical protein	NA	NA	NA	NA	NA
AWX01988.1|1913475_1913616_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
AWX01989.1|1913632_1913992_+	ribonuclease P protein component	NA	NA	NA	NA	NA
AWX01990.1|1913955_1914213_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 159
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1921081	1927935	4847638		Moraxella_phage(33.33%)	7	NA	NA
AWX01997.1|1921081_1922422_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.6	5.6e-65
AWX01998.1|1922584_1923250_+	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
AWX01999.1|1923344_1924070_-	phosphate transport system regulator PhoU	NA	NA	NA	NA	NA
AWX02000.1|1924096_1924870_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	30.6	3.4e-14
AWX02001.1|1924917_1925808_-	phosphate ABC transporter permease PtsA	NA	NA	NA	NA	NA
AWX02002.1|1925807_1926767_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
AWX02003.1|1926894_1927935_-	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	38.7	1.3e-48
>prophage 160
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1933567	1937008	4847638		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
AWX02007.1|1933567_1935397_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	42.9	1.2e-131
AWX02008.1|1935637_1937008_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7P8	Chrysochromulina_ericina_virus	33.2	2.9e-32
>prophage 161
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1948791	1949784	4847638		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
AWX02022.1|1948791_1949784_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.0	3.5e-48
>prophage 162
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1952948	1960897	4847638		Enterobacteria_phage(50.0%)	7	NA	NA
AWX02025.1|1952948_1954817_+	low affinity potassium transporter Kup	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	29.7	2.3e-64
AWX02026.1|1955042_1955462_+	D-ribose pyranase	NA	NA	NA	NA	NA
AWX02027.1|1955469_1956975_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	21.7	7.6e-18
AWX02028.1|1956979_1957945_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
AWX02029.1|1957972_1958863_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.7	3.3e-05
AWX02030.1|1958971_1959901_+	ribokinase	NA	NA	NA	NA	NA
AWX02031.1|1959904_1960897_+	transcriptional regulator RbsR	NA	C6ZCU4	Enterobacteria_phage	33.7	1.1e-36
>prophage 163
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1973032	1975825	4847638		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AWX02039.1|1973032_1975825_+	DNA polymerase I	NA	A0A1B1IWN2	uncultured_Mediterranean_phage	27.6	8.4e-55
>prophage 164
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1979696	1982170	4847638		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
AWX02044.1|1979696_1981109_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	1.1e-05
AWX02045.1|1981120_1982170_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	3.4e-09
>prophage 165
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	1993875	1996653	4847638		Staphylococcus_phage(50.0%)	3	NA	NA
AWX02054.1|1993875_1994766_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	94.6	2.1e-63
AWX02055.1|1994921_1995818_+	sugar kinase	NA	NA	NA	NA	NA
AWX02056.1|1995852_1996653_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.5	7.1e-23
>prophage 166
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2017757	2019260	4847638		Bacillus_virus(100.0%)	1	NA	NA
AWX02078.1|2017757_2019260_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.7	1.1e-11
>prophage 167
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2027440	2030923	4847638		Bacillus_thuringiensis_phage(33.33%)	4	NA	NA
AWX02087.1|2027440_2028061_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	2.2e-64
AWX02088.1|2028127_2028802_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
AWX02089.1|2028854_2030228_-	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
AWX02090.1|2030224_2030923_-	DNA-binding transcriptional regulator CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	2.4e-06
>prophage 168
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2042780	2047244	4847638		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
AWX02102.1|2042780_2043626_-	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.7	7.5e-15
AWX02103.1|2044025_2044265_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
AWX02104.1|2044345_2044831_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
AWX02105.1|2044923_2045850_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
AWX02106.1|2045912_2047244_-	HslU--HslV peptidase ATPase subunit	NA	A0A173GE36	Erwinia_phage	29.7	1.9e-44
>prophage 169
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2062576	2065755	4847638		Synechococcus_phage(50.0%)	2	NA	NA
AWX02119.1|2062576_2063239_-	fructose-6-phosphate aldolase	NA	A0A0E3FJJ0	Synechococcus_phage	34.6	2.2e-30
AWX02120.1|2063253_2065755_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	25.9	3.9e-11
>prophage 170
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2084738	2086589	4847638		Acinetobacter_phage(100.0%)	1	NA	NA
AWX02136.1|2084738_2086589_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	28.4	1.0e-11
>prophage 171
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2096669	2098316	4847638		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AWX02142.1|2096669_2098316_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CRC5	Ostreococcus_lucimarinus_virus	31.9	1.5e-64
>prophage 172
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2124118	2125957	4847638	tRNA	Tupanvirus(100.0%)	1	NA	NA
AWX02164.1|2124118_2125957_+|tRNA	selenocysteinyl-tRNA-specific translation elongation factor SelB	tRNA	A0A2K9KZ60	Tupanvirus	25.1	6.9e-13
>prophage 173
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2149218	2150760	4847638		Staphylococcus_phage(100.0%)	1	NA	NA
AWX02184.1|2149218_2150760_-	xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.8e-15
>prophage 174
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2155085	2156081	4847638		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
AWX02187.1|2155085_2156081_-	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	24.3	1.8e-12
>prophage 175
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2164808	2165423	4847638		Streptococcus_phage(100.0%)	1	NA	NA
AWX02194.1|2164808_2165423_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	34.0	6.2e-19
>prophage 176
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2211792	2213835	4847638		Indivirus(100.0%)	1	NA	NA
AWX02225.1|2211792_2213835_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	5.2e-46
>prophage 177
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2218811	2219837	4847638		Escherichia_phage(100.0%)	1	NA	NA
AWX02230.1|2218811_2219837_+	tellurium resistance protein TerC	NA	K7QKE8	Escherichia_phage	47.7	2.1e-75
>prophage 178
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2239027	2240105	4847638		Vibrio_phage(50.0%)	2	NA	NA
AWX02253.1|2239027_2239693_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	55.3	3.3e-58
AWX02254.1|2239862_2240105_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	80.6	6.0e-10
>prophage 179
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2243219	2246094	4847638		Streptococcus_phage(50.0%)	2	NA	NA
AWX02258.1|2243219_2245391_-	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	37.3	9.9e-120
AWX02259.1|2245467_2246094_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	63.7	2.9e-32
>prophage 180
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2249098	2253322	4847638		Staphylococcus_phage(33.33%)	4	NA	NA
AWX02264.1|2249098_2249770_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	26.6	3.9e-14
AWX02265.1|2249756_2250812_+	cell division protein FtsX	NA	NA	NA	NA	NA
AWX02266.1|2251062_2251920_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	42.3	9.2e-45
AWX02267.1|2252056_2253322_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.8	3.7e-26
>prophage 181
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2258898	2260378	4847638		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
AWX02273.1|2258898_2259663_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.0	2.8e-13
AWX02274.1|2259664_2260378_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.2	1.1e-14
>prophage 182
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2263779	2265587	4847638		Planktothrix_phage(50.0%)	2	NA	NA
AWX02278.1|2263779_2264850_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.5	5.2e-21
AWX02279.1|2264846_2265587_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	24.1	9.2e-09
>prophage 183
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2282707	2285155	4847638		Dickeya_phage(100.0%)	1	NA	NA
AWX02293.1|2282707_2285155_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	83.3	1.2e-33
>prophage 184
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2288232	2288991	4847638		Escherichia_phage(100.0%)	1	NA	NA
AWX02297.1|2288232_2288991_+	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.3	2.8e-21
>prophage 185
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2292331	2294725	4847638		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
AWX02299.1|2292331_2294725_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	41.4	4.7e-14
>prophage 186
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2299877	2300660	4847638		Mycobacterium_phage(100.0%)	1	NA	NA
AWX02304.1|2299877_2300660_+	pimeloyl-[acyl-carrier protein] methyl ester esterase	NA	A0A0M3UKI8	Mycobacterium_phage	32.0	3.1e-07
>prophage 187
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2306897	2310677	4847638		Bacillus_phage(66.67%)	3	NA	NA
AWX02309.1|2306897_2307617_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
AWX02310.1|2307613_2308960_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	24.1	2.5e-12
AWX02311.1|2309057_2310677_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	51.7	5.5e-139
>prophage 188
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2327459	2328272	4847638		Vibrio_phage(100.0%)	1	NA	NA
AWX02327.1|2327459_2328272_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	50.2	2.7e-70
>prophage 189
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2338520	2345066	4847638		Acinetobacter_phage(33.33%)	7	NA	NA
AWX02339.1|2338520_2339084_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.5	5.1e-60
AWX02340.1|2339156_2340392_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AWX02341.1|2340388_2342476_-	hypothetical protein	NA	H9YQA8	environmental_Halophage	84.8	2.0e-64
AWX02342.1|2342533_2343166_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
AWX02343.1|2343476_2343881_+	OsmC family protein	NA	NA	NA	NA	NA
AWX02344.1|2343947_2344817_-	phosphoribulokinase	NA	NA	NA	NA	NA
AWX02345.1|2344847_2345066_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	39.1	1.1e-05
>prophage 190
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2350884	2356252	4847638		Salmonella_phage(50.0%)	5	NA	NA
AWX02352.1|2350884_2351844_+	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	93.5	9.9e-56
AWX02353.1|2351846_2352464_+	malonate decarboxylase holo-ACP synthase	NA	NA	NA	NA	NA
AWX02354.1|2352463_2353360_+	malonate decarboxylase subunit epsilon	NA	NA	NA	NA	NA
AWX02355.1|2353399_2354332_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWX02356.1|2354347_2356252_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.5	5.9e-76
>prophage 191
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2364059	2367428	4847638		Streptococcus_phage(50.0%)	2	NA	NA
AWX02369.1|2364059_2366174_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	1.8e-57
AWX02370.1|2366243_2367428_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	7.5e-13
>prophage 192
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2387314	2391639	4847638	tRNA	Prochlorococcus_phage(33.33%)	6	NA	NA
AWX02407.1|2387314_2388262_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	30.5	8.4e-07
AWX02408.1|2388286_2388796_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	3.3e-18
AWX02409.1|2388923_2390048_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
AWX02410.1|2390019_2390493_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
AWX02411.1|2390519_2391074_+	hypothetical protein	NA	NA	NA	NA	NA
AWX02412.1|2391066_2391639_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	S4VW33	Pandoravirus	25.7	1.9e-09
>prophage 193
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2405052	2407137	4847638		Bacillus_virus(100.0%)	1	NA	NA
AWX02420.1|2405052_2407137_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	34.8	7.0e-22
>prophage 194
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2420391	2421435	4847638		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AWX02435.1|2420391_2421435_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 195
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2440292	2441660	4847638	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AWX02452.1|2440292_2441660_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.4	5.1e-21
>prophage 196
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2445623	2449625	4847638	protease	Pseudomonas_phage(50.0%)	4	NA	NA
AWX04712.1|2445623_2446121_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.6	3.8e-27
AWX02459.1|2446223_2447006_+	transcriptional regulator NanR	NA	NA	NA	NA	NA
AWX02460.1|2447128_2448022_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
AWX02461.1|2448134_2449625_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	21.3	1.4e-08
>prophage 197
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2457615	2484105	4847638	tRNA	Staphylococcus_phage(18.18%)	26	NA	NA
AWX04713.1|2457615_2458557_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	33.6	1.5e-16
AWX02466.1|2458536_2460039_-	ATP-binding protein	NA	A0A248XCZ8	Klebsiella_phage	43.4	4.8e-81
AWX02467.1|2460176_2461823_+	DAK2 domain-containing protein	NA	NA	NA	NA	NA
AWX02468.1|2461970_2462990_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	5.4e-44
AWX02469.1|2463073_2463577_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWX02470.1|2463700_2466556_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.9	1.6e-141
AWX02471.1|2466555_2466999_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AWX02472.1|2467067_2468579_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.2	1.2e-47
AWX02473.1|2468844_2469945_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AWX02474.1|2469944_2471027_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AWX02475.1|2471164_2473498_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.7	8.4e-40
AWX02476.1|2473730_2474384_+	isoprenoid biosynthesis protein ElbB	NA	NA	NA	NA	NA
AWX02477.1|2474380_2475106_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AWX02478.1|2475145_2475418_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AWX02479.1|2475414_2476269_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
AWX02480.1|2476314_2476806_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AWX02481.1|2476888_2477176_-	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
AWX02482.1|2477198_2478632_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
AWX02483.1|2478679_2479405_-	lipopolysaccharide ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	1.1e-22
AWX02484.1|2479411_2479966_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
AWX02485.1|2479934_2480510_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AWX02486.1|2480506_2481073_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.6	8.5e-55
AWX02487.1|2481087_2482074_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.7	1.1e-38
AWX02488.1|2482087_2483065_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
AWX02489.1|2483006_2483207_-	hypothetical protein	NA	NA	NA	NA	NA
AWX02490.1|2483292_2484105_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.8	2.4e-18
>prophage 198
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2488149	2489637	4847638		Vibrio_phage(50.0%)	2	NA	NA
AWX02496.1|2488149_2488437_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	69.8	1.0e-16
AWX02497.1|2488665_2489637_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	26.2	3.5e-08
>prophage 199
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2492768	2494471	4847638		Bacillus_phage(100.0%)	2	NA	NA
AWX02502.1|2492768_2493812_-	two-component system sensor histidine kinase PmrB	NA	W8CYF6	Bacillus_phage	23.0	1.6e-11
AWX02503.1|2493808_2494471_-	two-component system response regulator PmrA	NA	W8CYM9	Bacillus_phage	38.1	9.0e-32
>prophage 200
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2497913	2509575	4847638	protease	Micromonas_pusilla_virus(25.0%)	8	NA	NA
AWX02508.1|2497913_2499848_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.5	2.0e-116
AWX02509.1|2499946_2500795_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.0	7.5e-23
AWX02510.1|2500787_2502125_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AWX02511.1|2502347_2502680_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
AWX02512.1|2502962_2504309_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	94.4	9.6e-65
AWX02513.1|2504867_2505332_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
AWX02514.1|2505360_2506863_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
AWX02515.1|2506887_2509575_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	27.0	1.9e-27
>prophage 201
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2515016	2516912	4847638		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AWX02522.1|2515016_2516912_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.5	5.4e-53
>prophage 202
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2522597	2530389	4847638		Invertebrate_iridovirus(25.0%)	10	NA	NA
AWX02529.1|2522597_2522927_-	GIY-YIG nuclease family protein	NA	S6DF82	Invertebrate_iridovirus	46.8	8.8e-12
AWX02530.1|2522941_2523376_+	hypothetical protein	NA	NA	NA	NA	NA
AWX02531.1|2523355_2523874_-	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	29.3	1.8e-11
AWX02532.1|2524002_2524647_+	hypothetical protein	NA	NA	NA	NA	NA
AWX02533.1|2524687_2525725_+	permease	NA	NA	NA	NA	NA
AWX02534.1|2525775_2526351_-	osmotically-inducible protein OsmY	NA	NA	NA	NA	NA
AWX02535.1|2526360_2526951_-	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	31.8	4.1e-12
AWX02536.1|2526972_2527368_-	YraN family protein	NA	NA	NA	NA	NA
AWX02537.1|2527325_2529464_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
AWX02538.1|2529525_2530389_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	44.2	3.3e-50
>prophage 203
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2547768	2548914	4847638		Streptococcus_phage(100.0%)	1	NA	NA
AWX02554.1|2547768_2548914_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	39.0	4.1e-48
>prophage 204
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2554598	2556893	4847638		Tetraselmis_virus(100.0%)	1	NA	NA
AWX02558.1|2554598_2556893_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.7	1.5e-158
>prophage 205
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2574080	2575046	4847638		Escherichia_phage(100.0%)	1	NA	NA
AWX02578.1|2574080_2575046_-	TerC family protein	NA	A0A291LBC5	Escherichia_phage	33.4	5.2e-36
>prophage 206
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2583058	2584546	4847638		Pithovirus(100.0%)	1	NA	NA
AWX02585.1|2583058_2584546_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	W5SAS9	Pithovirus	28.6	4.9e-09
>prophage 207
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2590258	2595381	4847638		Klosneuvirus(33.33%)	3	NA	NA
AWX02593.1|2590258_2591665_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	27.4	3.9e-32
AWX02594.1|2592060_2593581_+	PAS domain S-box protein	NA	A0A1B0V854	Salmonella_phage	37.1	1.1e-32
AWX02595.1|2593821_2595381_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.9	1.9e-08
>prophage 208
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2598977	2604301	4847638	tRNA	Vibrio_phage(33.33%)	4	NA	NA
AWX02600.1|2598977_2600822_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
AWX02601.1|2600974_2602720_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	1.9e-76
AWX02602.1|2602835_2603051_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AWX02603.1|2603287_2604301_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	6.3e-109
>prophage 209
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2613620	2614862	4847638		Sinorhizobium_phage(100.0%)	1	NA	NA
AWX02616.1|2613620_2614862_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	50.1	6.1e-90
>prophage 210
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2619999	2622834	4847638		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
AWX02620.1|2619999_2621430_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.0	1.5e-39
AWX02621.1|2621507_2621804_-	hypothetical protein	NA	NA	NA	NA	NA
AWX02622.1|2622180_2622834_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	45.5	5.4e-45
>prophage 211
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2629818	2637928	4847638		Ralstonia_phage(25.0%)	8	NA	NA
AWX02629.1|2629818_2630979_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.4	5.9e-87
AWX02630.1|2630981_2631647_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	47.5	1.2e-39
AWX02631.1|2631837_2633316_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
AWX02632.1|2633519_2634152_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	36.2	1.5e-20
AWX02633.1|2634148_2634571_+	DUF1249 family protein	NA	NA	NA	NA	NA
AWX02634.1|2634598_2635426_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
AWX02635.1|2635425_2636007_+	esterase YqiA	NA	NA	NA	NA	NA
AWX02636.1|2636035_2637928_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.8	3.8e-91
>prophage 212
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2647707	2656079	4847638		Stx_converting_phage(25.0%)	6	NA	NA
AWX02647.1|2647707_2648109_+	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	44.4	2.8e-20
AWX02648.1|2648227_2650486_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	2.2e-85
AWX02649.1|2650648_2651386_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
AWX02650.1|2651447_2652860_+	cell division protein FtsP	NA	NA	NA	NA	NA
AWX02651.1|2652990_2655165_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	71.7	3.1e-105
AWX02652.1|2655251_2656079_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	44.9	1.9e-63
>prophage 213
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2665190	2672294	4847638		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
AWX02664.1|2665190_2666738_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.9	1.2e-10
AWX02665.1|2666740_2667490_-	L-fucose operon activator	NA	NA	NA	NA	NA
AWX02666.1|2667566_2668433_-	glutathione-dependent disulfide-bond oxidoreductase	NA	NA	NA	NA	NA
AWX02667.1|2668616_2670479_+	bifunctional glutathionylspermidine amidase/synthase	NA	Q56ES0	Aeromonas_virus	23.8	5.9e-20
AWX02668.1|2670531_2670966_-	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
AWX02669.1|2670962_2672294_-	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	B9UDL7	Salmonella_phage	34.8	8.5e-05
>prophage 214
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2682240	2684025	4847638		Tupanvirus(100.0%)	1	NA	NA
AWX02675.1|2682240_2684025_+	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L0Z8	Tupanvirus	23.3	1.8e-13
>prophage 215
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2725582	2726737	4847638		Staphylococcus_phage(100.0%)	1	NA	NA
AWX02717.1|2725582_2726737_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	3.1e-128
>prophage 216
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2739507	2741056	4847638		Mycobacterium_phage(50.0%)	2	NA	NA
AWX02729.1|2739507_2740278_+	alpha/beta hydrolase	NA	A0A249XTU1	Mycobacterium_phage	35.7	1.6e-08
AWX02730.1|2740261_2741056_+	short chain dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	25.5	1.3e-05
>prophage 217
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2756430	2757663	4847638		Catovirus(100.0%)	1	NA	NA
AWX02743.1|2756430_2757663_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.6	4.1e-102
>prophage 218
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2765451	2768325	4847638		Prochlorococcus_phage(100.0%)	1	NA	NA
AWX02751.1|2765451_2768325_+	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.1	4.1e-262
>prophage 219
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2772777	2774211	4847638		Pandoravirus(100.0%)	1	NA	NA
AWX02757.1|2772777_2774211_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.2	5.7e-31
>prophage 220
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2778627	2786216	4847638	tRNA	Brevibacillus_phage(20.0%)	7	NA	NA
AWX02764.1|2778627_2779524_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	29.3	1.5e-29
AWX02765.1|2779552_2780266_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
AWX02766.1|2780271_2782005_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	9.2e-60
AWX02767.1|2782095_2783193_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	3.1e-05
AWX02768.1|2783203_2784721_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	37.5	7.7e-87
AWX02769.1|2784769_2785312_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
AWX02770.1|2785475_2786216_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A7K9	Microcystis_virus	35.7	2.2e-10
>prophage 221
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2792928	2795829	4847638		Tetraselmis_virus(50.0%)	2	NA	NA
AWX02777.1|2792928_2794911_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.0	1.6e-153
AWX02778.1|2794944_2795829_-	SDR family NAD(P)-dependent oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	56.3	4.5e-79
>prophage 222
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2813879	2818879	4847638		Trichoplusia_ni_ascovirus(33.33%)	4	NA	NA
AWX02800.1|2813879_2814641_+	2-deoxy-D-gluconate 3-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	3.5e-19
AWX02801.1|2814953_2816369_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.5	7.1e-26
AWX02802.1|2816451_2817738_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWX02803.1|2817751_2818879_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.5	8.8e-11
>prophage 223
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2825816	2826854	4847638		Enterobacteria_phage(100.0%)	1	NA	NA
AWX02812.1|2825816_2826854_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	2.8e-27
>prophage 224
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2832832	2834992	4847638		Staphylococcus_phage(100.0%)	1	NA	NA
AWX02818.1|2832832_2834992_+	bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase	NA	A0A2H4PQU7	Staphylococcus_phage	26.5	2.9e-18
>prophage 225
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2839710	2843861	4847638		Hokovirus(50.0%)	3	NA	NA
AWX02824.1|2839710_2841957_+	phosphoenolpyruvate-protein phosphotransferase PtsP	NA	A0A1V0SGR7	Hokovirus	23.9	5.4e-12
AWX02825.1|2842184_2843060_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AWX02826.1|2843066_2843861_+	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	62.9	2.0e-118
>prophage 226
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2849290	2864740	4847638	tRNA	Klosneuvirus(16.67%)	10	NA	NA
AWX02832.1|2849290_2852173_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	23.9	1.1e-60
AWX02833.1|2852169_2855712_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	21.0	3.3e-11
AWX02834.1|2855708_2857529_+	exodeoxyribonuclease V subunit alpha	NA	A0A2P0VMS9	Tetraselmis_virus	27.1	3.3e-23
AWX02835.1|2857562_2858894_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
AWX02836.1|2859121_2860375_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	28.0	1.4e-12
AWX02837.1|2860873_2861119_+	hypothetical protein	NA	NA	NA	NA	NA
AWX02838.1|2861118_2862216_+	murein transglycosylase A	NA	NA	NA	NA	NA
AWX02839.1|2862291_2863098_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.7	1.1e-15
AWX02840.1|2863088_2863535_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
AWX02841.1|2863534_2864740_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	38.0	3.5e-74
>prophage 227
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2868012	2868768	4847638		Bacillus_phage(100.0%)	1	NA	NA
AWX02846.1|2868012_2868768_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	28.1	2.7e-08
>prophage 228
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2873585	2874428	4847638		Vibrio_phage(100.0%)	1	NA	NA
AWX02850.1|2873585_2874428_-	preQ(1) synthase	NA	A0A2I7SAX1	Vibrio_phage	36.4	1.8e-40
>prophage 229
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2878914	2886997	4847638		Oenococcus_phage(25.0%)	5	NA	NA
AWX04724.1|2878914_2880255_+	glucarate dehydratase	NA	Q6A202	Oenococcus_phage	24.0	4.5e-06
AWX02857.1|2880270_2881608_+	glucarate dehydratase	NA	NA	NA	NA	NA
AWX02858.1|2881685_2882831_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.8	3.3e-50
AWX02859.1|2882881_2885641_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.7	1.3e-55
AWX02860.1|2885698_2886997_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	28.0	2.0e-38
>prophage 230
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2890362	2893381	4847638		Only_Syngen_Nebraska_virus(50.0%)	2	NA	NA
AWX02863.1|2890362_2892000_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.9	2.7e-154
AWX02864.1|2892082_2893381_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	57.9	2.4e-129
>prophage 231
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2896745	2897417	4847638		Vibrio_phage(100.0%)	1	NA	NA
AWX02868.1|2896745_2897417_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	31.4	1.1e-11
>prophage 232
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2911586	2913616	4847638		Hokovirus(50.0%)	2	NA	NA
AWX02879.1|2911586_2913011_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	28.4	1.0e-35
AWX02880.1|2913010_2913616_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.6	5.0e-29
>prophage 233
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2916627	2920302	4847638		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
AWX02886.1|2916627_2917389_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	47.2	3.9e-55
AWX02887.1|2917382_2918009_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	50.0	5.7e-36
AWX02888.1|2918125_2919250_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.1	3.8e-06
AWX02889.1|2919309_2920302_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
>prophage 234
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2925845	2931270	4847638	integrase	Cafeteria_roenbergensis_virus(33.33%)	4	2923371:2923383	2930977:2930989
2923371:2923383	attL	TCTTGGGCTGAAT	NA	NA	NA	NA
AWX02897.1|2925845_2928413_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	21.1	4.9e-33
AWX02898.1|2928572_2930027_+|integrase	integrase	integrase	A0A0R6PHE0	Moraxella_phage	28.3	5.8e-23
AWX02899.1|2930038_2930614_+	hypothetical protein	NA	NA	NA	NA	NA
AWX02900.1|2930703_2931270_-	helix-turn-helix domain-containing protein	NA	M1PL54	Cellulophaga_phage	44.4	4.7e-37
2930977:2930989	attR	ATTCAGCCCAAGA	NA	NA	NA	NA
>prophage 235
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2940792	2946852	4847638		Liberibacter_phage(50.0%)	3	NA	NA
AWX02912.1|2940792_2944032_-	DEAD/DEAH box helicase	NA	A0A220A398	Liberibacter_phage	28.4	5.2e-64
AWX02913.1|2944090_2945308_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AWX02914.1|2945304_2946852_-	DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	28.2	2.5e-48
>prophage 236
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2950215	2951937	4847638		Bdellovibrio_phage(100.0%)	1	NA	NA
AWX04726.1|2950215_2951937_+	ATP-dependent helicase	NA	H9C0J4	Bdellovibrio_phage	24.9	1.3e-08
>prophage 237
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2956474	2957236	4847638		Phaeocystis_globosa_virus(100.0%)	1	NA	NA
AWX02919.1|2956474_2957236_-	ABC transporter ATP-binding protein	NA	R4TX06	Phaeocystis_globosa_virus	29.8	3.7e-13
>prophage 238
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2976357	2977371	4847638		Enterobacteria_phage(100.0%)	1	NA	NA
AWX02939.1|2976357_2977371_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.0	5.4e-28
>prophage 239
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2985698	2986664	4847638		Tetraselmis_virus(100.0%)	1	NA	NA
AWX02946.1|2985698_2986664_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.8	2.0e-35
>prophage 240
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	2992227	3000162	4847638	tRNA	Bodo_saltans_virus(20.0%)	8	NA	NA
AWX02954.1|2992227_2992881_+	ATP-binding cassette domain-containing protein	NA	A0A2H4UU96	Bodo_saltans_virus	25.7	4.0e-08
AWX02955.1|2992877_2993738_+	metal ABC transporter permease	NA	NA	NA	NA	NA
AWX02956.1|2993752_2994631_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWX02957.1|2994761_2995259_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	47.1	9.1e-29
AWX02958.1|2995348_2996407_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.1	1.5e-113
AWX02959.1|2996475_2996976_+	recombination regulator RecX	NA	NA	NA	NA	NA
AWX02960.1|2997107_2999735_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.2	1.7e-81
AWX02961.1|2999976_3000162_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 241
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3014414	3019684	4847638		Bacillus_virus(20.0%)	5	NA	NA
AWX02973.1|3014414_3015617_-	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.3	3.2e-27
AWX02974.1|3015951_3016911_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	72.1	1.3e-135
AWX02975.1|3016920_3019065_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	48.8	7.8e-202
AWX02976.1|3019037_3019448_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.3	3.0e-17
AWX02977.1|3019444_3019684_-	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	41.9	3.7e-12
>prophage 242
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3024542	3025148	4847638		Canarypox_virus(100.0%)	1	NA	NA
AWX02986.1|3024542_3025148_+	ankyrin repeat domain-containing protein	NA	Q6VZ28	Canarypox_virus	25.2	1.6e-06
>prophage 243
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3040934	3045215	4847638		Escherichia_phage(66.67%)	4	NA	NA
AWX03000.1|3040934_3041282_-	addiction module antidote protein, HigA family	NA	A0A222YWD7	Escherichia_phage	63.3	1.6e-32
AWX03001.1|3041292_3041592_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	61.7	6.1e-28
AWX04731.1|3041842_3043003_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AWX03002.1|3043022_3045215_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	30.7	1.6e-32
>prophage 244
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3060030	3066117	4847638		Tetraselmis_virus(50.0%)	3	NA	NA
AWX03006.1|3060030_3060753_+	SDR family NAD(P)-dependent oxidoreductase	NA	A0A2P0VP75	Tetraselmis_virus	27.1	2.0e-08
AWX03007.1|3061253_3063452_-	glycoside hydrolase family 2	NA	NA	NA	NA	NA
AWX03008.1|3063420_3066117_-	PAS domain-containing sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	34.4	2.3e-65
>prophage 245
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3093130	3097456	4847638		Salmonella_phage(50.0%)	3	NA	NA
AWX04733.1|3093130_3093730_+	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	36.5	4.4e-09
AWX03031.1|3093947_3095303_-	calmodulin-binding protein	NA	NA	NA	NA	NA
AWX03032.1|3095299_3097456_-	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	41.7	5.2e-36
>prophage 246
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3103685	3105194	4847638		Enterobacteria_phage(100.0%)	1	NA	NA
AWX03038.1|3103685_3105194_-	DUF4041 domain-containing protein	NA	Q5G8X0	Enterobacteria_phage	46.3	2.3e-51
>prophage 247
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3111382	3111658	4847638		Vibrio_phage(100.0%)	1	NA	NA
AWX03045.1|3111382_3111658_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	62.5	1.4e-18
>prophage 248
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3114827	3125141	4847638		Staphylococcus_phage(50.0%)	6	NA	NA
AWX03051.1|3114827_3116897_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	34.8	1.5e-72
AWX03052.1|3116932_3117148_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
AWX03053.1|3117510_3121983_-	ATP-binding protein	NA	A0A2H4PQT3	Staphylococcus_phage	27.0	7.4e-69
AWX03054.1|3122145_3122790_-	hypothetical protein	NA	NA	NA	NA	NA
AWX03055.1|3122791_3124039_-	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	62.0	8.5e-140
AWX03056.1|3124658_3125141_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	6.8e-29
>prophage 249
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3138126	3141687	4847638		Pseudomonas_phage(50.0%)	4	NA	NA
AWX03073.1|3138126_3139347_-	diguanylate cyclase	NA	A0A2K8I9Y5	Pseudomonas_phage	39.8	1.2e-05
AWX03074.1|3139339_3139876_-	YfiR family protein	NA	NA	NA	NA	NA
AWX03075.1|3140029_3140404_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
AWX03076.1|3140616_3141687_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	4.5e-89
>prophage 250
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3148485	3151059	4847638		Enterobacteria_phage(100.0%)	1	NA	NA
AWX03084.1|3148485_3151059_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
>prophage 251
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3156704	3157157	4847638		Cyanophage(100.0%)	1	NA	NA
AWX03085.1|3156704_3157157_+	DUF4385 domain-containing protein	NA	M4QHR1	Cyanophage	50.0	3.9e-34
>prophage 252
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3163914	3180974	4847638	tRNA	Achromobacter_phage(12.5%)	19	NA	NA
AWX03090.1|3163914_3164334_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	37.2	1.2e-13
AWX03091.1|3164538_3165624_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AWX03092.1|3165663_3166353_-	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	48.8	7.9e-55
AWX03093.1|3166668_3167052_+	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	71.8	2.1e-33
AWX03094.1|3167104_3168433_-	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.5	4.7e-48
AWX03095.1|3168565_3169303_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
AWX03096.1|3169287_3170907_-	L-aspartate oxidase	NA	NA	NA	NA	NA
AWX03097.1|3171334_3171910_+	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	28.1	8.2e-05
AWX03098.1|3171941_3172592_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
AWX03099.1|3172591_3173545_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
AWX03100.1|3173541_3174018_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
AWX03101.1|3174203_3176009_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.7	2.5e-23
AWX03102.1|3176024_3176999_+	signal peptidase I	NA	NA	NA	NA	NA
AWX03103.1|3177222_3177903_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.0	9.6e-21
AWX03104.1|3177899_3178805_+	GTPase Era	NA	NA	NA	NA	NA
AWX03105.1|3178822_3179530_+	DNA repair protein RecO	NA	NA	NA	NA	NA
AWX03106.1|3179605_3180337_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AWX03107.1|3180336_3180717_+	holo-ACP synthase	NA	NA	NA	NA	NA
AWX03108.1|3180713_3180974_-	4Fe-4S dicluster domain-containing protein	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	51.2	1.4e-17
>prophage 253
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3187176	3198357	4847638		Bacillus_phage(50.0%)	8	NA	NA
AWX03115.1|3187176_3191064_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.0	7.7e-131
AWX04736.1|3191596_3193030_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	27.9	6.8e-16
AWX03116.1|3193026_3193779_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
AWX03117.1|3193775_3195113_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	33.0	8.8e-10
AWX03118.1|3195193_3195532_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
AWX03119.1|3195608_3196799_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
AWX03120.1|3196871_3197117_+	hypothetical protein	NA	NA	NA	NA	NA
AWX03121.1|3197103_3198357_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.4	3.0e-100
>prophage 254
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3205706	3212012	4847638		Faustovirus(20.0%)	8	NA	NA
AWX03130.1|3205706_3206921_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	1.2e-34
AWX03131.1|3206945_3207332_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	1.2e-52
AWX03132.1|3207345_3207669_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	46.7	4.5e-21
AWX03133.1|3207745_3208261_+	co-chaperone HscB	NA	NA	NA	NA	NA
AWX03134.1|3208275_3210126_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.1	2.0e-105
AWX03135.1|3210127_3210463_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AWX03136.1|3210464_3210665_+	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AWX03137.1|3210725_3212012_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	39.4	4.9e-34
>prophage 255
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3225143	3230374	4847638		Escherichia_phage(66.67%)	4	NA	NA
AWX03145.1|3225143_3227549_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	38.1	9.0e-138
AWX03146.1|3227545_3228175_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	55.4	3.0e-61
AWX03147.1|3228167_3228947_+	dimethyl sulfoxide reductase	NA	NA	NA	NA	NA
AWX03148.1|3229942_3230374_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	7.4e-19
>prophage 256
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3239196	3245442	4847638		Acinetobacter_phage(33.33%)	6	NA	NA
AWX03155.1|3239196_3240738_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	57.8	4.4e-162
AWX03156.1|3240796_3241018_+	hypothetical protein	NA	NA	NA	NA	NA
AWX03157.1|3241014_3241365_-	hypothetical protein	NA	NA	NA	NA	NA
AWX03158.1|3241364_3242384_-	peptidase M4 family protein	NA	NA	NA	NA	NA
AWX03159.1|3242442_3243816_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	34.0	1.9e-39
AWX03160.1|3243975_3245442_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	1.0e-88
>prophage 257
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3259672	3259861	4847638		Escherichia_phage(100.0%)	1	NA	NA
AWX03172.1|3259672_3259861_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	76.7	1.9e-19
>prophage 258
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3266287	3274178	4847638		Prochlorococcus_phage(50.0%)	8	NA	NA
AWX03176.1|3266287_3266929_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	40.0	2.6e-28
AWX03177.1|3266925_3267963_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	45.1	7.4e-73
AWX03178.1|3268229_3269660_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AWX03179.1|3269654_3269900_-	hypothetical protein	NA	NA	NA	NA	NA
AWX03180.1|3269876_3270503_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AWX03181.1|3270585_3271875_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.9	4.1e-65
AWX03182.1|3271956_3272673_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
AWX03183.1|3272759_3274178_-	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	33.8	2.3e-40
>prophage 259
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3283908	3284622	4847638		Cyanophage(100.0%)	1	NA	NA
AWX03194.1|3283908_3284622_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.2	9.1e-38
>prophage 260
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3306115	3325886	4847638		Streptococcus_phage(25.0%)	24	NA	NA
AWX03209.1|3306115_3306991_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	26.9	1.6e-12
AWX03210.1|3307203_3307629_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AWX03211.1|3307615_3308065_+	hypothetical protein	NA	NA	NA	NA	NA
AWX03212.1|3308128_3308704_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
AWX03213.1|3308796_3309696_+	peroxidase	NA	S4VVJ7	Pandoravirus	32.4	1.5e-24
AWX03214.1|3309871_3310885_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWX03215.1|3310884_3311718_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
AWX03216.1|3311717_3312593_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
AWX03217.1|3312582_3313677_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	38.9	1.6e-30
AWX03218.1|3313744_3314656_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	42.0	2.7e-55
AWX03219.1|3314661_3315498_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
AWX03220.1|3315542_3316052_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
AWX03221.1|3316092_3317820_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	31.6	3.3e-17
AWX03222.1|3317865_3318123_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AWX03223.1|3318194_3318380_+	hypothetical protein	NA	NA	NA	NA	NA
AWX03224.1|3318310_3318433_-	transcriptional regulator	NA	NA	NA	NA	NA
AWX03225.1|3318440_3319412_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.3	5.1e-76
AWX03226.1|3319575_3320337_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
AWX03227.1|3320324_3320516_+	hypothetical protein	NA	NA	NA	NA	NA
AWX03228.1|3320566_3321562_+	cell division protein ZipA	NA	NA	NA	NA	NA
AWX03229.1|3321630_3323646_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.3	9.1e-152
AWX03230.1|3323647_3323863_+	hypothetical protein	NA	NA	NA	NA	NA
AWX03231.1|3323859_3324855_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
AWX03232.1|3324944_3325886_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.9	1.1e-06
>prophage 261
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3340628	3341360	4847638		Clostridioides_phage(100.0%)	1	NA	NA
AWX03245.1|3340628_3341360_-	DNA-binding response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	25.5	2.2e-15
>prophage 262
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3345182	3348841	4847638		Morganella_phage(33.33%)	3	NA	NA
AWX04744.1|3345182_3346103_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.7	4.9e-76
AWX03248.1|3346371_3347751_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.0	1.1e-15
AWX03249.1|3347911_3348841_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	83.9	4.4e-141
>prophage 263
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3358010	3359096	4847638		Pandoravirus(100.0%)	1	NA	NA
AWX03258.1|3358010_3359096_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	1.5e-87
>prophage 264
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3367451	3368588	4847638		Brazilian_cedratvirus(100.0%)	1	NA	NA
AWX03267.1|3367451_3368588_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.3	3.0e-19
>prophage 265
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3375018	3376536	4847638		Mollivirus(100.0%)	1	NA	NA
AWX03275.1|3375018_3376536_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	43.8	5.4e-88
>prophage 266
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3380771	3381545	4847638		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AWX03281.1|3380771_3381545_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	3.6e-08
>prophage 267
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3386229	3387249	4847638		Enterobacteria_phage(100.0%)	1	NA	NA
AWX03289.1|3386229_3387249_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.8	5.5e-20
>prophage 268
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3396385	3399606	4847638		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
AWX03299.1|3396385_3397045_+	sugar phosphatase	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	26.6	1.7e-06
AWX03300.1|3397120_3398953_+	SLC13 family permease	NA	NA	NA	NA	NA
AWX03301.1|3399006_3399606_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	1.5e-06
>prophage 269
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3418548	3419553	4847638		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
AWX03317.1|3418548_3419553_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	26.5	7.5e-30
>prophage 270
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3441325	3453022	4847638		Pseudomonas_phage(33.33%)	7	NA	NA
AWX03339.1|3441325_3442378_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	50.9	7.7e-09
AWX03340.1|3442401_3442656_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	66.7	2.6e-27
AWX03341.1|3442655_3443786_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	1.0e-176
AWX03342.1|3443894_3446180_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	64.3	3.8e-287
AWX03343.1|3446528_3447257_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
AWX03344.1|3447403_3450040_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.0	9.6e-93
AWX03345.1|3450175_3453022_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.4	8.9e-44
>prophage 271
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3457216	3465818	4847638		Tupanvirus(40.0%)	7	NA	NA
AWX03348.1|3457216_3458311_+	porin	NA	Q1MVN1	Enterobacteria_phage	60.1	5.2e-117
AWX03349.1|3458425_3459481_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
AWX03350.1|3459553_3460612_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A2K9L698	Tupanvirus	48.0	3.7e-19
AWX03351.1|3460611_3461262_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	32.4	4.9e-06
AWX03352.1|3461338_3462982_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.0	8.3e-10
AWX03353.1|3463123_3464560_+	magnesium transporter	NA	NA	NA	NA	NA
AWX04745.1|3464522_3465818_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	49.3	3.5e-80
>prophage 272
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3471120	3478638	4847638		Vibrio_phage(50.0%)	7	NA	NA
AWX03359.1|3471120_3472128_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.6	1.0e-82
AWX03360.1|3472179_3472464_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
AWX03361.1|3472589_3474350_-	ATP-dependent helicase	NA	M4Q3N1	Vibrio_phage	42.0	4.9e-101
AWX03362.1|3474501_3475209_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
AWX03363.1|3475224_3476424_+	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	23.0	9.9e-21
AWX03364.1|3476700_3477045_+	hypothetical protein	NA	NA	NA	NA	NA
AWX03365.1|3477048_3478638_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.1	2.1e-18
>prophage 273
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3484330	3488639	4847638		Bacillus_phage(50.0%)	4	NA	NA
AWX03369.1|3484330_3484900_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	S5MM68	Bacillus_phage	36.8	1.8e-12
AWX03370.1|3485315_3486029_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AWX03371.1|3486062_3487049_-	GTP-binding protein	NA	NA	NA	NA	NA
AWX03372.1|3487172_3488639_-	fructuronate reductase	NA	E5EQS6	Micromonas_sp._RCC1109_virus	28.6	1.7e-38
>prophage 274
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3496495	3497353	4847638		Catovirus(100.0%)	1	NA	NA
AWX03380.1|3496495_3497353_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	32.7	4.8e-25
>prophage 275
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3501122	3506261	4847638		Acinetobacter_phage(50.0%)	4	NA	NA
AWX03384.1|3501122_3503108_-	ligand-gated channel protein	NA	A0A0P0I887	Acinetobacter_phage	31.9	2.2e-09
AWX03385.1|3503376_3504204_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AWX03386.1|3504341_3505490_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
AWX03387.1|3505592_3506261_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 276
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3509988	3511509	4847638		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AWX03391.1|3509988_3511509_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 277
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3523655	3524210	4847638		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AWX03405.1|3523655_3524210_-	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	37.2	7.3e-19
>prophage 278
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3530773	3538620	4847638	tRNA	Enterobacteria_phage(60.0%)	8	NA	NA
AWX03410.1|3530773_3531724_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	29.0	5.9e-08
AWX03411.1|3531707_3532445_+	ABC transporter permease	NA	NA	NA	NA	NA
AWX03412.1|3532419_3532533_-	hypothetical protein	NA	NA	NA	NA	NA
AWX03413.1|3532602_3533343_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	82.9	4.6e-93
AWX03414.1|3533561_3535247_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	88.2	5.3e-270
AWX03415.1|3535240_3535960_+	two-component system response regulator YehT	NA	NA	NA	NA	NA
AWX03416.1|3536006_3536477_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	78.7	9.8e-65
AWX03417.1|3536586_3538620_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	28.2	2.1e-55
>prophage 279
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3546515	3549887	4847638		Klosneuvirus(50.0%)	3	NA	NA
AWX03425.1|3546515_3547892_-	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.4	1.1e-26
AWX03426.1|3548203_3548647_-	hypothetical protein	NA	NA	NA	NA	NA
AWX03427.1|3548831_3549887_-	hypothetical protein	NA	S4TRP0	Salmonella_phage	32.1	1.2e-06
>prophage 280
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3560948	3565039	4847638		Bacillus_phage(66.67%)	3	NA	NA
AWX03438.1|3560948_3562310_-	U32 family peptidase	NA	Q6DW11	Phage_TP	91.0	4.7e-200
AWX03439.1|3562916_3563639_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.4	3.2e-30
AWX03440.1|3563635_3565039_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	27.9	2.5e-31
>prophage 281
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3580062	3589393	4847638		Catovirus(25.0%)	7	NA	NA
AWX03448.1|3580062_3580704_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.3	1.7e-35
AWX03449.1|3580795_3581377_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	43.2	1.4e-33
AWX03450.1|3581400_3583251_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
AWX03451.1|3583364_3584948_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.9	8.2e-39
AWX03452.1|3585641_3586778_+	polysaccharide export protein Wza	NA	NA	NA	NA	NA
AWX03453.1|3586784_3587228_+	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
AWX03454.1|3587230_3589393_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	29.8	3.2e-17
>prophage 282
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3594639	3601351	4847638		Synechococcus_phage(25.0%)	6	NA	NA
AWX03461.1|3594639_3595761_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	66.3	2.4e-133
AWX03462.1|3595763_3596729_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.6	1.4e-86
AWX03463.1|3596731_3597211_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
AWX03464.1|3597207_3598431_+	colanic acid biosynthesis glycosyltransferase WcaI	NA	NA	NA	NA	NA
AWX03465.1|3598434_3599871_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	31.6	1.4e-53
AWX03466.1|3599980_3601351_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.5	1.5e-33
>prophage 283
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3606872	3610567	4847638		Klebsiella_phage(33.33%)	3	NA	NA
AWX03471.1|3606872_3608264_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.2	4.4e-20
AWX03472.1|3608453_3609449_+	UDP-N-acetylglucosamine 4-epimerase	NA	A0A0K1L6Z1	Scale_drop_disease_virus	28.1	1.1e-09
AWX03473.1|3609664_3610567_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.6	1.8e-43
>prophage 284
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3615082	3625426	4847638		Catovirus(22.22%)	10	NA	NA
AWX03478.1|3615082_3615769_+	hypothetical protein	NA	A0A1V0SBR5	Catovirus	36.0	1.6e-10
AWX03479.1|3615770_3616784_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	48.3	1.2e-83
AWX03480.1|3616797_3617544_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	35.8	1.2e-11
AWX03481.1|3617680_3619087_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	5.2e-37
AWX03482.1|3619176_3620262_+	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	52.9	9.7e-100
AWX03483.1|3620262_3621144_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.7	9.0e-104
AWX03484.1|3621383_3622550_+	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	54.0	3.1e-112
AWX03485.1|3622598_3623603_-	protein CapI	NA	A0A2K9L0I7	Tupanvirus	28.7	1.9e-33
AWX03486.1|3623794_3624775_+	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
AWX03487.1|3624814_3625426_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	29.3	2.1e-14
>prophage 285
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3630936	3631836	4847638		Cellulophaga_phage(100.0%)	1	NA	NA
AWX03494.1|3630936_3631836_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	97.4	4.8e-12
>prophage 286
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3637385	3638552	4847638		Stx2-converting_phage(100.0%)	1	NA	NA
AWX03499.1|3637385_3638552_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	85.8	4.6e-196
>prophage 287
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3647595	3655388	4847638		Leptospira_phage(50.0%)	4	NA	NA
AWX03508.1|3647595_3650658_-	AcrB/AcrD/AcrF family protein	NA	S5VL66	Leptospira_phage	20.6	4.2e-23
AWX04748.1|3650657_3651653_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AWX03509.1|3652215_3652647_+	universal stress protein UspG	NA	NA	NA	NA	NA
AWX03510.1|3652694_3655388_+	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	26.5	1.5e-69
>prophage 288
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3671210	3672512	4847638		Burkholderia_virus(100.0%)	1	NA	NA
AWX03523.1|3671210_3672512_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.5	7.4e-62
>prophage 289
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3678876	3681657	4847638		Lactobacillus_phage(100.0%)	1	NA	NA
AWX03528.1|3678876_3681657_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	29.1	1.1e-65
>prophage 290
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3686062	3694185	4847638		Burkholderia_phage(40.0%)	8	NA	NA
AWX03533.1|3686062_3687229_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.3	3.0e-115
AWX03534.1|3687513_3688215_+	phosphohydrolase	NA	S4W232	Pandoravirus	28.5	1.1e-06
AWX03535.1|3688258_3689692_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.9	1.2e-102
AWX03536.1|3689672_3690164_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.0e-32
AWX03537.1|3690135_3691050_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AWX03538.1|3691228_3692140_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AWX03539.1|3692217_3692400_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AWX03540.1|3692484_3694185_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	32.8	2.1e-16
>prophage 291
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3718849	3719602	4847638		Bacillus_virus(100.0%)	1	NA	NA
AWX03570.1|3718849_3719602_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	35.4	2.2e-26
>prophage 292
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3727219	3727936	4847638		Planktothrix_phage(100.0%)	1	NA	NA
AWX03580.1|3727219_3727936_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	1.0e-12
>prophage 293
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3743813	3745328	4847638		Cedratvirus(100.0%)	1	NA	NA
AWX03598.1|3743813_3745328_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	28.7	3.1e-11
>prophage 294
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3762367	3768020	4847638		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
AWX03615.1|3762367_3764035_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.7	5.8e-11
AWX03616.1|3764079_3765681_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	77.3	2.2e-07
AWX03617.1|3765700_3766567_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
AWX03618.1|3766563_3767613_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.0	2.3e-05
AWX03619.1|3767630_3768020_+	two-component system response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	31.3	1.3e-06
>prophage 295
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3775458	3908579	4847638	holin,head,tRNA,tail,capsid,portal,terminase,protease,integrase	Enterobacteria_phage(26.89%)	164	3784624:3784656	3875736:3875768
AWX03625.1|3775458_3777192_-|tRNA	arginine--tRNA ligase	tRNA	A0A1V0SIS8	Klosneuvirus	37.0	4.0e-87
AWX03626.1|3777430_3777991_+	VOC family protein	NA	NA	NA	NA	NA
AWX03627.1|3778069_3778813_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AWX03628.1|3778793_3779177_+	hypothetical protein	NA	NA	NA	NA	NA
AWX03629.1|3779073_3780045_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AWX03630.1|3780041_3780785_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	A0A1S6L2V9	Erwinia_phage	30.2	6.1e-29
AWX03631.1|3780825_3781221_-	hypothetical protein	NA	NA	NA	NA	NA
AWX03632.1|3781272_3782046_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	80.3	8.6e-58
AWX03633.1|3782024_3783338_-|integrase	integrase	integrase	Q8W658	Enterobacteria_phage	86.2	1.1e-222
AWX04750.1|3783393_3783630_-	excisionase	NA	Q8W657	Enterobacteria_phage	85.9	4.8e-36
AWX03634.1|3783783_3783981_-	hypothetical protein	NA	NA	NA	NA	NA
AWX03635.1|3784013_3784283_-	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	73.0	2.6e-30
AWX03636.1|3784343_3784628_-	DUF4752 domain-containing protein	NA	Q76H46	Enterobacteria_phage	48.3	1.8e-21
3784624:3784656	attL	TCCATCACTTCACCTCCTGCTGCGGCGCTGCTG	NA	NA	NA	NA
AWX03637.1|3784627_3785464_-	hypothetical protein	NA	M9NZE4	Enterobacteria_phage	34.4	1.4e-26
AWX03638.1|3785460_3786288_-	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	85.9	8.1e-123
AWX04751.1|3786287_3786701_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	83.9	1.4e-54
AWX03639.1|3786971_3787196_-	hypothetical protein	NA	NA	NA	NA	NA
AWX04752.1|3787711_3788359_-	LexA family transcriptional repressor	NA	H9C160	Pectobacterium_phage	63.0	3.8e-75
AWX03640.1|3788463_3788661_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	66.1	2.7e-16
AWX03641.1|3788686_3789157_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	94.9	1.2e-75
AWX03642.1|3789397_3789583_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	69.2	5.2e-14
AWX03643.1|3789566_3790520_+	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	93.7	1.4e-171
AWX03644.1|3790516_3791011_+	hypothetical protein	NA	NA	NA	NA	NA
AWX03645.1|3791353_3792010_+	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	52.7	3.4e-55
AWX03646.1|3792006_3792996_+	hypothetical protein	NA	K7PJS6	Enterobacterial_phage	83.6	8.7e-164
AWX03647.1|3793008_3793839_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	46.9	3.9e-56
AWX03648.1|3794038_3794434_+	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
AWX03649.1|3794420_3794702_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	95.7	1.9e-44
AWX03650.1|3794701_3795331_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	87.6	3.0e-101
AWX03651.1|3795548_3795821_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	42.9	1.1e-07
AWX04753.1|3796491_3796683_+	hypothetical protein	NA	K7PM01	Enterobacterial_phage	83.3	1.4e-17
AWX03652.1|3796712_3796937_+	hypothetical protein	NA	A0A2H4J182	uncultured_Caudovirales_phage	56.8	8.6e-19
AWX03653.1|3797175_3797640_-	hypothetical protein	NA	NA	NA	NA	NA
AWX04754.1|3798148_3798796_+	DUF1983 domain-containing protein	NA	G8C7Q4	Escherichia_phage	74.8	2.0e-60
AWX03654.1|3798807_3800265_+	glycosyltransferase family 2 protein	NA	K7PKP3	Enterobacterial_phage	92.2	1.2e-273
AWX03655.1|3800308_3800827_+	HNH endonuclease	NA	K7PJS8	Enterobacterial_phage	53.2	5.0e-46
AWX03656.1|3800807_3801398_+	hypothetical protein	NA	S4TR53	Salmonella_phage	90.3	4.6e-104
AWX03657.1|3801397_3801748_+	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	81.0	1.0e-50
AWX03658.1|3801905_3802379_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	98.7	1.3e-85
AWX03659.1|3802378_3804115_+|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	99.8	0.0e+00
AWX03660.1|3804114_3805419_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	84.1	1.9e-211
AWX03661.1|3805427_3806279_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	63.5	1.1e-90
AWX03662.1|3806288_3807497_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	74.6	2.0e-162
AWX04755.1|3807540_3807867_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	88.0	9.5e-51
AWX03663.1|3807875_3808214_+|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	74.1	2.1e-40
AWX03664.1|3808210_3808660_+	hypothetical protein	NA	K7P6X4	Enterobacteria_phage	98.7	5.8e-75
AWX03665.1|3808656_3809004_+	DUF3168 domain-containing protein	NA	Q9MCS8	Enterobacteria_phage	82.6	1.6e-48
AWX03666.1|3809063_3809507_+	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	93.8	6.0e-72
AWX03667.1|3809515_3809899_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	92.9	1.7e-62
AWX03668.1|3809907_3810186_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	93.4	9.9e-41
AWX03669.1|3810206_3810626_-	hypothetical protein	NA	NA	NA	NA	NA
AWX03670.1|3810712_3814177_+|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	87.8	0.0e+00
AWX03671.1|3814179_3814518_+|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	59.8	7.3e-38
AWX03672.1|3814514_3815273_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	63.6	3.9e-95
AWX03673.1|3815275_3815986_+	peptidase P60	NA	F1C573	Cronobacter_phage	69.4	8.6e-97
AWX03674.1|3815985_3816570_+|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	53.1	4.3e-54
AWX03675.1|3816623_3820505_+	host specificity protein	NA	Q9MCR7	Enterobacteria_phage	61.0	0.0e+00
AWX03676.1|3820506_3821472_+	hypothetical protein	NA	G1CSU0	Cronobacter_virus	39.6	6.3e-58
AWX03677.1|3821532_3822810_+|tail	phage tail protein	tail	K7P6I4	Enterobacteria_phage	53.9	4.5e-120
AWX03678.1|3823133_3823511_-	hypothetical protein	NA	NA	NA	NA	NA
AWX03679.1|3823850_3824114_-	DinI family protein	NA	K7P797	Enterobacteria_phage	92.0	2.2e-37
AWX03680.1|3824478_3825045_-	hydrolase	NA	NA	NA	NA	NA
AWX03681.1|3825307_3827080_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AWX03682.1|3827081_3827525_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
AWX03683.1|3827552_3828293_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AWX03684.1|3828327_3828849_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
AWX03685.1|3828929_3829544_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AWX03686.1|3829552_3830563_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.9	2.4e-07
AWX03687.1|3830615_3831401_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
AWX03688.1|3831397_3832153_-	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.2	2.3e-15
AWX03689.1|3832215_3833175_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
AWX03690.1|3833190_3834510_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
AWX03691.1|3834627_3835599_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
AWX03692.1|3835642_3837085_-	pyruvate kinase	NA	NA	NA	NA	NA
AWX03693.1|3837199_3838069_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AWX03694.1|3838425_3839901_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.2	6.0e-76
AWX03695.1|3840134_3841946_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
AWX03696.1|3841985_3842627_+	keto-hydroxyglutarate-aldolase/keto-deoxy- phosphogluconate aldolase	NA	NA	NA	NA	NA
AWX03697.1|3842960_3845474_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.8	2.2e-14
AWX03698.1|3845470_3847585_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	29.5	3.9e-20
AWX04756.1|3847609_3848302_+	hypothetical protein	NA	A0A077K9W3	Ralstonia_phage	58.1	3.4e-05
AWX03699.1|3848305_3849013_+	hypothetical protein	NA	A0A077K9W3	Ralstonia_phage	29.7	3.5e-05
AWX03700.1|3849016_3849724_+	hypothetical protein	NA	A0A077K9W3	Ralstonia_phage	29.7	5.9e-05
AWX03701.1|3849727_3850435_+	hypothetical protein	NA	A0A077K9W3	Ralstonia_phage	31.1	1.1e-06
AWX03702.1|3850438_3851146_+	hypothetical protein	NA	A0A077K9W3	Ralstonia_phage	31.1	1.8e-06
AWX03703.1|3851158_3851416_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
AWX03704.1|3852873_3854052_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
AWX03705.1|3854223_3854874_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
AWX03706.1|3854949_3857025_+	oligopeptidase B	NA	NA	NA	NA	NA
AWX03707.1|3857006_3857669_-	exodeoxyribonuclease X	NA	NA	NA	NA	NA
AWX03708.1|3857693_3858344_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
AWX03709.1|3858455_3858686_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.0e-15
AWX03710.1|3858823_3859195_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AWX03711.1|3859196_3860066_+	hypothetical protein	NA	NA	NA	NA	NA
AWX03712.1|3860082_3860421_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AWX03713.1|3860743_3861829_-|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	68.4	1.6e-147
AWX03714.1|3861797_3862070_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	64.4	2.9e-29
AWX03715.1|3862258_3862915_+	DUF4145 domain-containing protein	NA	V5URE2	Shigella_phage	49.1	8.0e-57
AWX03716.1|3862946_3863165_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	63.6	2.3e-16
AWX03717.1|3863231_3863768_-	HNH endonuclease	NA	A0A1I9SEX5	Klebsiella_phage	51.0	9.2e-35
AWX03718.1|3863764_3863965_-	hypothetical protein	NA	NA	NA	NA	NA
AWX03719.1|3863961_3864234_-	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	57.5	4.2e-20
AWX03720.1|3864230_3864449_-	hypothetical protein	NA	NA	NA	NA	NA
AWX03721.1|3864445_3864997_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	60.0	5.2e-57
AWX03722.1|3865157_3865586_-	regulator	NA	M9NYX4	Enterobacteria_phage	93.7	2.2e-71
AWX03723.1|3865582_3866206_-	YqaJ-like viral recombinase	NA	S0A2A9	Cellulophaga_phage	49.5	7.2e-47
AWX03724.1|3866202_3866706_-	hypothetical protein	NA	A0A0F7L7F5	uncultured_marine_virus	29.5	2.7e-12
AWX03725.1|3866717_3867002_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	94.7	1.9e-47
AWX03726.1|3867136_3867451_+	hypothetical protein	NA	NA	NA	NA	NA
AWX03727.1|3867455_3867659_-	cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	76.6	4.4e-22
AWX03728.1|3867816_3868086_-	hypothetical protein	NA	NA	NA	NA	NA
AWX04757.1|3868249_3868687_-	hypothetical protein	NA	K7P7N6	Enterobacteria_phage	97.2	3.9e-76
AWX03729.1|3869478_3870231_-	LexA family transcriptional repressor	NA	A0A286S2B2	Klebsiella_phage	64.0	7.0e-73
AWX03730.1|3870272_3870506_+	transcriptional regulator	NA	A0A0P0ZDD7	Stx2-converting_phage	62.3	2.6e-18
AWX03731.1|3870523_3871066_+	regulator	NA	M9NZI6	Enterobacteria_phage	78.9	4.6e-74
AWX03732.1|3871294_3872191_+	DNA replication protein	NA	F1C5C3	Cronobacter_phage	60.1	2.6e-98
AWX03733.1|3872180_3873608_+	helicase DnaB	NA	Q9MCT4	Escherichia_phage	62.1	1.4e-170
AWX03734.1|3873607_3873952_+	transcriptional regulator	NA	G8C7U7	Escherichia_phage	94.7	1.9e-54
AWX03735.1|3874816_3875098_+	hypothetical protein	NA	A0A077KAZ4	Edwardsiella_phage	79.3	2.7e-30
AWX03736.1|3875101_3875764_+	DUF551 domain-containing protein	NA	M9NZE4	Enterobacteria_phage	47.3	9.4e-21
AWX03737.1|3875763_3876009_+	hypothetical protein	NA	A0A1I9KF90	Aeromonas_phage	51.4	7.0e-14
3875736:3875768	attR	CAGCAGCGCCGCAGCAGGAGGTGAAGTGATGGA	NA	NA	NA	NA
AWX03738.1|3876114_3876345_+	hypothetical protein	NA	NA	NA	NA	NA
AWX03739.1|3876518_3876968_+	recombination protein NinB	NA	I6R9D0	Salmonella_phage	45.1	4.7e-32
AWX03740.1|3876960_3877131_+	hypothetical protein	NA	G8C7V4	Escherichia_phage	78.6	7.2e-18
AWX03741.1|3877123_3877762_+	hypothetical protein	NA	S4TSR3	Salmonella_phage	75.5	8.0e-86
AWX03742.1|3877758_3877875_+	hypothetical protein	NA	NA	NA	NA	NA
AWX03743.1|3877871_3878561_+	antiterminator	NA	I6PDF8	Cronobacter_phage	52.7	1.1e-56
AWX03744.1|3878633_3878921_-	hypothetical protein	NA	NA	NA	NA	NA
AWX03745.1|3879234_3879606_+|holin	holin	holin	A0A2D1GNJ3	Pseudomonas_phage	32.4	1.3e-06
AWX03746.1|3879589_3880234_+	glycoside hydrolase family 19 protein	NA	F1C5D2	Cronobacter_phage	43.3	1.5e-36
AWX03747.1|3880221_3880698_+	Rz lytic protein	NA	NA	NA	NA	NA
AWX03748.1|3881151_3881670_+	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	98.8	2.1e-92
AWX03749.1|3881999_3882218_+	hypothetical protein	NA	NA	NA	NA	NA
AWX03750.1|3882283_3882508_-	hypothetical protein	NA	NA	NA	NA	NA
AWX03751.1|3882530_3883103_+|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	72.6	2.2e-71
AWX03752.1|3883089_3884568_+	DNA-packaging protein	NA	G0ZND4	Cronobacter_phage	87.6	1.5e-257
AWX03753.1|3884583_3885933_+	DUF1073 domain-containing protein	NA	A0A1V0E5Q5	Salmonella_phage	87.3	7.8e-232
AWX03754.1|3885892_3886819_+|head	phage head morphogenesis protein	head	Q5G8Y3	Enterobacteria_phage	92.9	4.0e-163
AWX03755.1|3886821_3888090_+	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	91.9	2.2e-220
AWX03756.1|3888102_3888564_+	hypothetical protein	NA	G0ZND8	Cronobacter_phage	81.1	2.6e-62
AWX03757.1|3888576_3889674_+	hypothetical protein	NA	G0ZND9	Cronobacter_phage	84.4	8.7e-181
AWX03758.1|3889684_3889969_+	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	75.3	1.7e-32
AWX03759.1|3890031_3890433_+	hypothetical protein	NA	I6S619	Salmonella_phage	75.9	2.7e-55
AWX03760.1|3890432_3890612_+	DUF551 domain-containing protein	NA	Q5G8X7	Enterobacteria_phage	89.8	2.6e-26
AWX03761.1|3890604_3890967_+	hypothetical protein	NA	Q5G8X6	Enterobacteria_phage	92.5	2.7e-62
AWX03762.1|3890956_3891448_-	HNH endonuclease	NA	J7HXG5	Pseudomonas_phage	57.1	1.6e-46
AWX03763.1|3891569_3891965_+	hypothetical protein	NA	I6RSK8	Salmonella_phage	96.2	1.5e-66
AWX03764.1|3891961_3892348_+	hypothetical protein	NA	A0A1V0E5P4	Salmonella_phage	94.5	2.1e-65
AWX03765.1|3892365_3893100_+	hypothetical protein	NA	H6WRU1	Salmonella_phage	85.6	2.1e-114
AWX04758.1|3893137_3893791_+	hypothetical protein	NA	I6R0Q2	Salmonella_phage	92.2	7.9e-113
AWX03766.1|3894404_3894680_+	cor protein	NA	Q5G8V7	Enterobacteria_phage	72.5	1.8e-26
AWX03767.1|3894797_3895202_+	hypothetical protein	NA	NA	NA	NA	NA
AWX03768.1|3895266_3898671_+	hypothetical protein	NA	R9TMK1	Aeromonas_phage	50.4	5.6e-186
AWX03769.1|3898699_3898927_-	hypothetical protein	NA	NA	NA	NA	NA
AWX03770.1|3899002_3899350_+|tail	phage tail protein	tail	H6WRV8	Salmonella_phage	93.0	5.9e-59
AWX03771.1|3899505_3899703_-	hypothetical protein	NA	NA	NA	NA	NA
AWX03772.1|3899868_3900573_+|tail	phage minor tail protein L	tail	A0A1V0E5N2	Salmonella_phage	99.1	1.9e-136
AWX04759.1|3900572_3901292_+|tail	phage tail protein	tail	A0A1V0E5M9	Salmonella_phage	82.7	6.0e-122
AWX03773.1|3901234_3901768_+|tail	tail assembly protein	tail	H6WRW3	Salmonella_phage	67.6	4.0e-54
AWX03774.1|3901777_3905605_+	hypothetical protein	NA	I6R9B3	Salmonella_phage	60.5	0.0e+00
AWX03775.1|3905606_3906572_+	hypothetical protein	NA	G1CSU0	Cronobacter_virus	40.2	3.3e-59
AWX03776.1|3906632_3907934_+|tail	phage tail protein	tail	G8C7R8	Escherichia_phage	56.2	5.4e-121
AWX03777.1|3908016_3908256_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	72.2	7.0e-27
AWX03778.1|3908255_3908579_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.4	2.2e-23
>prophage 296
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3917451	3919494	4847638		Bacillus_phage(50.0%)	2	NA	NA
AWX03785.1|3917451_3918750_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.5	3.6e-16
AWX03786.1|3919074_3919494_-	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	38.9	2.8e-15
>prophage 297
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3931086	3931602	4847638		Streptococcus_phage(100.0%)	1	NA	NA
AWX03797.1|3931086_3931602_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	56.9	3.2e-24
>prophage 298
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3937963	3946769	4847638		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
AWX03803.1|3937963_3939625_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.3	1.4e-09
AWX03804.1|3939770_3940637_+	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
AWX03805.1|3940683_3940884_-	hypothetical protein	NA	NA	NA	NA	NA
AWX04760.1|3941209_3941629_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	54.3	6.7e-33
AWX03806.1|3941976_3944406_+	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
AWX03807.1|3944492_3946769_-	pyrroloquinoline quinone biosynthesis protein PqqF	NA	A0A2P1EIE5	Megavirus	26.6	5.0e-05
>prophage 299
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3951249	3952515	4847638		Salmonella_phage(100.0%)	1	NA	NA
AWX03813.1|3951249_3952515_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	81.5	5.3e-206
>prophage 300
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3966358	3967507	4847638		Planktothrix_phage(100.0%)	1	NA	NA
AWX03829.1|3966358_3967507_-	osmoprotectant ABC transporter ATP-binding protein OsmV	NA	G9BWD6	Planktothrix_phage	32.6	8.3e-25
>prophage 301
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3971835	3975242	4847638		Escherichia_phage(100.0%)	5	NA	NA
AWX03835.1|3971835_3972513_+	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	63.1	4.2e-77
AWX03836.1|3972688_3973000_-	DNA damage-inducible SOS regulon protein	NA	NA	NA	NA	NA
AWX03837.1|3973109_3973724_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	34.7	1.9e-28
AWX03838.1|3973768_3974623_-	dimethylsulfoxide reductase	NA	A0A077SK59	Escherichia_phage	34.6	7.6e-23
AWX03839.1|3974624_3975242_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.1	1.0e-74
>prophage 302
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	3982840	4001765	4847638		Escherichia_phage(10.0%)	21	NA	NA
AWX03847.1|3982840_3984310_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.5	7.2e-122
AWX03848.1|3984440_3984746_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AWX03849.1|3984848_3985703_-	benzoate transporter	NA	M1I711	Paramecium_bursaria_Chlorella_virus	33.2	8.1e-25
AWX03850.1|3985895_3986606_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
AWX03851.1|3986623_3987184_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AWX03852.1|3987183_3987522_-	DUF1283 family protein	NA	NA	NA	NA	NA
AWX03853.1|3987672_3987999_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	7.1e-22
AWX03854.1|3988110_3989325_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	30.0	3.3e-48
AWX03855.1|3989339_3990359_+	Zn-dependent oxidoreductase	NA	NA	NA	NA	NA
AWX03856.1|3990432_3991812_+	MFS transporter	NA	NA	NA	NA	NA
AWX03857.1|3992035_3993499_+	D-mannonate oxidoreductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.5	2.2e-46
AWX03858.1|3993543_3993747_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	56.7	4.4e-14
AWX03859.1|3994034_3994466_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	34.5	4.5e-16
AWX03860.1|3994501_3995188_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWX03861.1|3995278_3996025_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
AWX03862.1|3996168_3998202_+	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	21.1	1.3e-20
AWX04762.1|3998328_3999120_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
AWX03863.1|3999229_4000033_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWX03864.1|4000141_4000633_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
AWX03865.1|4000692_4001376_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.0	1.4e-80
AWX03866.1|4001525_4001765_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	91.1	5.0e-33
>prophage 303
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4009458	4010448	4847638		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AWX03873.1|4009458_4010448_-	2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	44.7	1.6e-69
>prophage 304
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4035400	4037377	4847638		Tetraselmis_virus(100.0%)	1	NA	NA
AWX03897.1|4035400_4037377_+	alkyl/aryl-sulfatase	NA	A0A2P0VMX1	Tetraselmis_virus	45.2	2.4e-157
>prophage 305
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4041771	4042992	4847638		Orpheovirus(100.0%)	1	NA	NA
AWX03904.1|4041771_4042992_+	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	31.6	4.1e-38
>prophage 306
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4049198	4054687	4847638		Bodo_saltans_virus(50.0%)	3	NA	NA
AWX03913.1|4049198_4049885_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	31.1	8.5e-09
AWX03914.1|4049975_4050581_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
AWX03915.1|4050784_4054687_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.4	5.0e-53
>prophage 307
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4061640	4064036	4847638		Escherichia_phage(100.0%)	3	NA	NA
AWX03920.1|4061640_4062171_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	43.0	1.0e-17
AWX03921.1|4062211_4063279_-	oxidoreductase	NA	NA	NA	NA	NA
AWX03922.1|4063292_4064036_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.1	8.6e-15
>prophage 308
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4084460	4086626	4847638		Bacillus_phage(100.0%)	1	NA	NA
AWX03925.1|4084460_4086626_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	27.4	1.0e-31
>prophage 309
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4094431	4095550	4847638		Prochlorococcus_phage(100.0%)	1	NA	NA
AWX03936.1|4094431_4095550_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	29.1	4.7e-33
>prophage 310
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4099979	4101473	4847638		Pandoravirus(100.0%)	1	NA	NA
AWX03940.1|4099979_4101473_+	carboxylesterase/lipase family protein	NA	S4VZJ7	Pandoravirus	30.6	2.2e-33
>prophage 311
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4109581	4110811	4847638		Brevibacillus_phage(100.0%)	1	NA	NA
AWX03949.1|4109581_4110811_-	peptidase T	NA	A0A0K2CPK3	Brevibacillus_phage	39.1	2.1e-05
>prophage 312
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4117150	4122841	4847638		Phage_TP(50.0%)	6	NA	NA
AWX03956.1|4117150_4119115_+	U32 family peptidase	NA	Q6DW11	Phage_TP	28.5	2.7e-23
AWX03957.1|4119111_4119345_-	DUF2554 family protein	NA	NA	NA	NA	NA
AWX03958.1|4119588_4119951_+	hypothetical protein	NA	NA	NA	NA	NA
AWX04768.1|4120098_4121097_-	transcriptional regulator FtrA	NA	NA	NA	NA	NA
AWX03959.1|4121170_4121581_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AWX03960.1|4121737_4122841_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	48.1	2.4e-101
>prophage 313
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4126982	4128488	4847638		Brazilian_cedratvirus(50.0%)	2	NA	NA
AWX03964.1|4126982_4127780_+	urea ABC transporter ATP-binding protein UrtD	NA	A0A2R8FG22	Brazilian_cedratvirus	26.8	1.2e-11
AWX03965.1|4127789_4128488_+	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	25.7	5.2e-14
>prophage 314
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4131821	4132208	4847638		Streptococcus_phage(100.0%)	1	NA	NA
AWX03970.1|4131821_4132208_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	33.3	2.1e-09
>prophage 315
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4142099	4143065	4847638		Bacillus_phage(100.0%)	1	NA	NA
AWX03980.1|4142099_4143065_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	30.9	8.9e-12
>prophage 316
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4149312	4151345	4847638		Bacillus_phage(100.0%)	2	NA	NA
AWX03988.1|4149312_4150053_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.5	2.5e-30
AWX03989.1|4150049_4151345_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	24.2	3.0e-15
>prophage 317
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4188238	4189123	4847638		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AWX04027.1|4188238_4189123_+	SDR family NAD(P)-dependent oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	56.5	9.7e-82
>prophage 318
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4197326	4201424	4847638		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
AWX04037.1|4197326_4198877_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	21.8	3.1e-06
AWX04038.1|4198972_4199989_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AWX04039.1|4200017_4201424_-	glycosyl hydrolase family 32	NA	F8WPR5	Bacillus_phage	23.2	4.4e-12
>prophage 319
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4213499	4216151	4847638		Planktothrix_phage(66.67%)	3	NA	NA
AWX04050.1|4213499_4214486_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.6	3.2e-17
AWX04051.1|4214478_4215405_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.3	3.1e-14
AWX04052.1|4215401_4216151_-	SDR family NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.7	3.2e-17
>prophage 320
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4222989	4225916	4847638		Tupanvirus(100.0%)	2	NA	NA
AWX04060.1|4222989_4224699_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	25.3	9.4e-41
AWX04061.1|4224905_4225916_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.8	1.7e-26
>prophage 321
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4236370	4238980	4847638		Enterobacteria_phage(50.0%)	2	NA	NA
AWX04070.1|4236370_4237444_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	70.4	6.6e-149
AWX04071.1|4237489_4238980_-	methyl viologen resistance protein SmvA	NA	A0A0M3UL24	Mycobacterium_phage	31.3	5.7e-34
>prophage 322
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4245073	4246618	4847638		Escherichia_phage(100.0%)	1	NA	NA
AWX04075.1|4245073_4246618_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.5	1.1e-19
>prophage 323
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4249718	4257773	4847638		Acinetobacter_phage(25.0%)	10	NA	NA
AWX04080.1|4249718_4250081_+	CHAP domain-containing protein	NA	I3WW63	Acinetobacter_phage	30.0	3.0e-05
AWX04081.1|4250080_4250506_+	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
AWX04082.1|4250573_4252676_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.0	2.4e-62
AWX04083.1|4252837_4253137_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AWX04084.1|4253129_4253771_-	DNA-binding protein	NA	NA	NA	NA	NA
AWX04085.1|4253862_4254864_-	lipid A biosynthesis lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	40.2	3.3e-54
AWX04086.1|4255050_4255281_-	tautomerase PptA	NA	NA	NA	NA	NA
AWX04087.1|4255318_4255936_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
AWX04088.1|4256102_4256990_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWX04089.1|4256999_4257773_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.5	2.4e-20
>prophage 324
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4263720	4264260	4847638		Leuconostoc_phage(100.0%)	1	NA	NA
AWX04096.1|4263720_4264260_-	adenylate kinase	NA	A0A097BYE2	Leuconostoc_phage	34.7	3.4e-13
>prophage 325
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4268958	4271076	4847638		Salmonella_phage(100.0%)	1	NA	NA
AWX04101.1|4268958_4271076_+	TonB-dependent siderophore receptor	NA	A0A1B0VCF0	Salmonella_phage	67.4	6.7e-137
>prophage 326
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4297030	4300436	4847638		Enterobacteria_phage(33.33%)	5	NA	NA
AWX04125.1|4297030_4298158_+	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	60.6	3.0e-120
AWX04126.1|4298192_4298615_-	GFA family protein	NA	NA	NA	NA	NA
AWX04127.1|4298618_4298816_-	hypothetical protein	NA	NA	NA	NA	NA
AWX04128.1|4299236_4299437_+	hypothetical protein	NA	A0A0U2JGI6	Escherichia_phage	71.7	1.1e-20
AWX04129.1|4299764_4300436_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.5	4.2e-77
>prophage 327
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4303868	4307795	4847638	transposase,tRNA	Shigella_phage(33.33%)	3	NA	NA
AWX04133.1|4303868_4304925_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	74.7	4.8e-128
AWX04134.1|4305442_4306378_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	95.7	3.0e-142
AWX04135.1|4306421_4307795_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.9	3.6e-51
>prophage 328
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4324560	4334385	4847638		Ralstonia_phage(50.0%)	8	NA	NA
AWX04151.1|4324560_4324947_-	hypothetical protein	NA	A0A077K801	Ralstonia_phage	41.2	1.3e-09
AWX04152.1|4324985_4325189_-	hypothetical protein	NA	NA	NA	NA	NA
AWX04153.1|4325191_4326241_-	hypothetical protein	NA	NA	NA	NA	NA
AWX04154.1|4326242_4326866_-	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
AWX04155.1|4326804_4327065_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
AWX04156.1|4327065_4328997_-	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	29.8	1.3e-59
AWX04157.1|4329250_4331743_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.1	8.7e-19
AWX04158.1|4331739_4334385_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.4	1.9e-96
>prophage 329
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4351879	4352962	4847638		Indivirus(100.0%)	1	NA	NA
AWX04173.1|4351879_4352962_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.3	3.1e-13
>prophage 330
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4370040	4379524	4847638		Bacillus_virus(50.0%)	8	NA	NA
AWX04190.1|4370040_4371033_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	26.1	2.3e-07
AWX04191.1|4371034_4371841_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	26.8	1.8e-13
AWX04192.1|4371837_4372428_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AWX04193.1|4372560_4372962_+	RidA family protein	NA	NA	NA	NA	NA
AWX04194.1|4373839_4375180_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	30.0	1.2e-17
AWX04195.1|4375573_4376362_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
AWX04196.1|4376514_4377501_+	CMD domain-containing protein	NA	NA	NA	NA	NA
AWX04197.1|4377589_4379524_+	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	23.3	5.5e-05
>prophage 331
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4388180	4388771	4847638		Staphylococcus_phage(100.0%)	1	NA	NA
AWX04205.1|4388180_4388771_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.4	1.3e-42
>prophage 332
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4393695	4398025	4847638	protease	Tupanvirus(50.0%)	3	NA	NA
AWX04209.1|4393695_4396293_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	34.0	4.6e-87
AWX04210.1|4396691_4396943_+	DUF2498 family protein	NA	NA	NA	NA	NA
AWX04211.1|4396978_4398025_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	29.2	1.3e-19
>prophage 333
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4403974	4406932	4847638		Acinetobacter_phage(100.0%)	2	NA	NA
AWX04218.1|4403974_4405570_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	37.0	1.8e-49
AWX04219.1|4405573_4406932_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.0	5.0e-37
>prophage 334
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4421206	4424103	4847638		Lactobacillus_phage(33.33%)	3	NA	NA
AWX04236.1|4421206_4422043_-	transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	39.8	6.1e-09
AWX04237.1|4422088_4423093_-	oligopeptide ABC transporter ATP-binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	8.9e-15
AWX04238.1|4423089_4424103_-	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	29.4	1.8e-15
>prophage 335
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4432318	4442516	4847638		Citrobacter_phage(25.0%)	10	NA	NA
AWX04778.1|4432318_4432933_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	54.7	1.7e-56
AWX04244.1|4433483_4433897_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
AWX04245.1|4434099_4435005_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.2	2.6e-58
AWX04246.1|4435204_4436218_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
AWX04247.1|4436307_4437210_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
AWX04248.1|4437323_4437788_+	YchJ family protein	NA	NA	NA	NA	NA
AWX04249.1|4437829_4438672_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	49.3	2.7e-12
AWX04250.1|4439596_4440274_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
AWX04251.1|4440273_4440984_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
AWX04252.1|4440980_4442516_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	42.2	1.7e-20
>prophage 336
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4458851	4459640	4847638		Bacillus_virus(100.0%)	1	NA	NA
AWX04260.1|4458851_4459640_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.9	3.5e-30
>prophage 337
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4463711	4472544	4847638		uncultured_Caudovirales_phage(25.0%)	10	NA	NA
AWX04265.1|4463711_4465496_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.6	3.5e-14
AWX04266.1|4465690_4465930_+	hypothetical protein	NA	NA	NA	NA	NA
AWX04267.1|4465960_4466656_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
AWX04268.1|4466832_4467063_-	putative cation transport regulator ChaB	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	45.3	1.0e-06
AWX04269.1|4467331_4468432_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
AWX04270.1|4468538_4469393_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.5	4.4e-47
AWX04271.1|4469429_4470239_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
AWX04272.1|4470242_4470635_-	SirB family protein	NA	NA	NA	NA	NA
AWX04273.1|4470631_4471462_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AWX04274.1|4471461_4472544_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
>prophage 338
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4475646	4478398	4847638		Tupanvirus(50.0%)	2	NA	NA
AWX04779.1|4475646_4476594_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
AWX04278.1|4476718_4478398_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	24.0	6.7e-23
>prophage 339
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4488371	4489124	4847638		Streptomyces_phage(100.0%)	1	NA	NA
AWX04290.1|4488371_4489124_-	Appr-1-p processing protein	NA	A0A2L1IVW3	Streptomyces_phage	34.6	3.8e-18
>prophage 340
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4495693	4506691	4847638		Serratia_phage(50.0%)	7	NA	NA
AWX04295.1|4495693_4500118_-	type IV secretion protein Rhs	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	50.8	9.6e-29
AWX04296.1|4500121_4500562_-	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
AWX04297.1|4500770_4501289_-	hypothetical protein	NA	NA	NA	NA	NA
AWX04298.1|4501278_4503861_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.0	9.6e-45
AWX04299.1|4504020_4505121_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	42.8	7.9e-57
AWX04300.1|4505159_4505540_-	hypothetical protein	NA	NA	NA	NA	NA
AWX04301.1|4505620_4506691_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	42.6	1.8e-58
>prophage 341
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4510117	4518952	4847638		Ralstonia_phage(33.33%)	6	NA	NA
AWX04305.1|4510117_4512076_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.2	1.6e-44
AWX04306.1|4512159_4512615_-	hypothetical protein	NA	NA	NA	NA	NA
AWX04307.1|4512628_4513390_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
AWX04308.1|4513386_4514853_-	phospholipase	NA	NA	NA	NA	NA
AWX04309.1|4514878_4516312_-	serine/threonine protein kinase	NA	M1HKB5	Acanthocystis_turfacea_Chlorella_virus	27.0	6.1e-09
AWX04310.1|4516336_4518952_-	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	31.3	3.2e-80
>prophage 342
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4527367	4528357	4847638		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AWX04318.1|4527367_4528357_-	hypothetical protein	NA	A0A2H4JEI9	uncultured_Caudovirales_phage	32.6	3.2e-41
>prophage 343
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4564997	4572240	4847638	tRNA	Staphylococcus_phage(33.33%)	6	NA	NA
AWX04350.1|4564997_4566716_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.7e-34
AWX04351.1|4566886_4567468_-	hypothetical protein	NA	NA	NA	NA	NA
AWX04352.1|4567505_4568201_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AWX04353.1|4568267_4570178_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.0	8.0e-89
AWX04354.1|4570661_4570844_-	YoaH family protein	NA	NA	NA	NA	NA
AWX04355.1|4570905_4572240_+	aminodeoxychorismate synthase component 1	NA	S4VNU7	Pandoravirus	41.9	6.4e-45
>prophage 344
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4576098	4577658	4847638		Moraxella_phage(100.0%)	1	NA	NA
AWX04359.1|4576098_4577658_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.4	6.0e-42
>prophage 345
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4585090	4585300	4847638		Morganella_phage(100.0%)	1	NA	NA
AWX04367.1|4585090_4585300_-	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 346
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4590564	4592613	4847638		Moraxella_phage(100.0%)	1	NA	NA
AWX04375.1|4590564_4592613_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	32.6	7.8e-82
>prophage 347
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4599831	4648875	4847638	holin,tail,terminase,head	Salmonella_phage(27.12%)	72	NA	NA
AWX04380.1|4599831_4600476_-	protein-serine/threonine phosphatase	NA	S4TNS0	Salmonella_phage	45.0	6.2e-54
AWX04381.1|4600643_4601624_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
AWX04382.1|4602053_4603322_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	4.4e-229
AWX04383.1|4603321_4603627_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	41.6	5.6e-13
AWX04384.1|4603738_4604101_+	GtrA family protein	NA	U5P0S6	Shigella_phage	84.2	2.0e-49
AWX04385.1|4604097_4605015_+	glycosyltransferase	NA	U5P087	Shigella_phage	91.4	1.3e-158
AWX04386.1|4605014_4606622_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	31.4	1.7e-60
AWX04387.1|4608656_4611134_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	93.1	0.0e+00
AWX04388.1|4611120_4611486_-	peptidoglycan endopeptidase	NA	F1C5F2	Cronobacter_phage	90.8	1.6e-62
AWX04389.1|4611499_4611970_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	80.1	1.0e-66
AWX04390.1|4611969_4612467_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	91.5	2.1e-89
AWX04391.1|4612466_4614791_-|tail	phage tail tape measure protein	tail	A0A1B1W284	Salmonella_phage	52.2	1.7e-146
AWX04392.1|4614848_4615223_-	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	53.4	5.1e-24
AWX04393.1|4615295_4616039_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	52.6	7.7e-64
AWX04394.1|4616089_4616845_-	DNA breaking-rejoining protein	NA	G0ZNE6	Cronobacter_phage	53.4	9.9e-59
AWX04395.1|4616903_4617287_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	57.5	4.9e-38
AWX04396.1|4617283_4617652_-	HK97 gp10 family phage protein	NA	F1C5E3	Cronobacter_phage	75.4	1.8e-45
AWX04397.1|4617694_4617883_-	hypothetical protein	NA	NA	NA	NA	NA
AWX04398.1|4617896_4618247_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	67.0	8.9e-39
AWX04399.1|4618246_4618420_-	50S ribosomal protein L13	NA	I6R0P9	Salmonella_phage	49.1	6.0e-12
AWX04400.1|4618419_4618821_-	hypothetical protein	NA	G0ZNE1	Cronobacter_phage	79.7	1.4e-56
AWX04401.1|4618883_4619177_-	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	89.7	1.9e-42
AWX04402.1|4619186_4620263_-	hypothetical protein	NA	Q5G8Y0	Enterobacteria_phage	88.0	1.6e-179
AWX04403.1|4620280_4620730_-	hypothetical protein	NA	A0A1V0E5Q8	Salmonella_phage	85.2	2.7e-64
AWX04404.1|4620742_4622008_-	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	91.4	1.7e-220
AWX04405.1|4622010_4622937_-|head	phage head morphogenesis protein	head	Q5G8Y3	Enterobacteria_phage	92.9	4.0e-163
AWX04406.1|4622896_4624246_-	DUF1073 domain-containing protein	NA	A0A1V0E5Q5	Salmonella_phage	87.3	7.8e-232
AWX04407.1|4624261_4625740_-	DNA-packaging protein	NA	G0ZND4	Cronobacter_phage	87.6	1.5e-257
AWX04408.1|4625726_4626299_-|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	72.6	2.2e-71
AWX04409.1|4626321_4626546_+	hypothetical protein	NA	NA	NA	NA	NA
AWX04410.1|4626611_4626830_-	hypothetical protein	NA	NA	NA	NA	NA
AWX04411.1|4627159_4627678_-	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	97.7	2.3e-91
AWX04412.1|4627950_4628121_-	rz1 lytic protein	NA	U5P461	Shigella_phage	56.6	2.1e-09
AWX04413.1|4628101_4628488_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	38.1	2.1e-12
AWX04414.1|4628484_4628925_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	81.9	9.5e-62
AWX04415.1|4628928_4629204_-|holin	phage holin family protein	holin	S4TNV9	Salmonella_phage	41.0	5.8e-09
AWX04416.1|4629200_4629602_-	hypothetical protein	NA	NA	NA	NA	NA
AWX04417.1|4629875_4630376_-	antiterminator	NA	G8C7V7	Escherichia_phage	95.7	5.5e-90
AWX04418.1|4630375_4630492_-	hypothetical protein	NA	NA	NA	NA	NA
AWX04419.1|4630488_4631133_-	hypothetical protein	NA	S4TSR3	Salmonella_phage	69.6	2.1e-73
AWX04420.1|4631126_4631627_-	HNH endonuclease	NA	A0A1I9SEX5	Klebsiella_phage	50.7	2.3e-35
AWX04421.1|4631590_4631761_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	86.8	2.5e-18
AWX04422.1|4631753_4632203_-	recombination protein NinB	NA	I6R9D0	Salmonella_phage	47.2	1.9e-33
AWX04423.1|4633157_4633439_-	hypothetical protein	NA	A0A077KAZ4	Edwardsiella_phage	73.9	5.2e-29
AWX04424.1|4633441_4633801_-	ead/Ea22-like family protein	NA	K7PLZ3	Enterobacterial_phage	46.3	6.0e-06
AWX04425.1|4633797_4633995_-	hypothetical protein	NA	NA	NA	NA	NA
AWX04426.1|4633991_4634180_-	hypothetical protein	NA	NA	NA	NA	NA
AWX04427.1|4634176_4634482_-	hypothetical protein	NA	A0A0F6N6A6	Escherichia_phage	53.1	1.7e-14
AWX04428.1|4634478_4634727_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWX04429.1|4634723_4635038_-	protein ren	NA	M1FPD5	Enterobacteria_phage	48.4	1.4e-14
AWX04430.1|4635027_4636401_-	replicative DNA helicase	NA	E5AGF0	Erwinia_phage	63.1	8.4e-165
AWX04431.1|4636397_4637483_-	DNA replication protein	NA	E5AGE9	Erwinia_phage	45.4	1.5e-84
AWX04432.1|4637711_4638278_-	hypothetical protein	NA	NA	NA	NA	NA
AWX04433.1|4638308_4638524_-	XRE family transcriptional regulator	NA	K7PMD5	Enterobacterial_phage	81.7	1.7e-27
AWX04434.1|4638627_4639269_+	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	76.8	5.2e-93
AWX04435.1|4639500_4640319_+	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	46.8	2.0e-36
AWX04436.1|4640456_4640654_-	hypothetical protein	NA	G8C7T7	Escherichia_phage	92.2	4.6e-24
AWX04437.1|4641073_4641298_+	hypothetical protein	NA	NA	NA	NA	NA
AWX04438.1|4641587_4641785_+	DUF1482 family protein	NA	NA	NA	NA	NA
AWX04439.1|4641856_4642141_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	94.7	3.2e-47
AWX04440.1|4642159_4643005_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	55.4	4.5e-68
AWX04441.1|4643001_4643682_+	exonuclease	NA	M9NZE1	Enterobacteria_phage	95.6	6.9e-128
AWX04442.1|4643678_4644107_+	regulator	NA	M9NYX4	Enterobacteria_phage	95.8	1.5e-72
AWX04443.1|4644267_4644927_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	93.2	2.7e-121
AWX04444.1|4644923_4645142_+	hypothetical protein	NA	NA	NA	NA	NA
AWX04445.1|4645138_4645435_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	66.7	2.4e-29
AWX04446.1|4645431_4645623_+	hypothetical protein	NA	A0A0P0ZC60	Stx2-converting_phage	62.7	4.6e-13
AWX04447.1|4645714_4646224_+	hypothetical protein	NA	A0A1W6DY33	Salmonella_phage	48.8	6.5e-38
AWX04448.1|4646440_4646932_+	HNH endonuclease	NA	Q7Y5G7	Xanthomonas_virus	49.0	4.9e-35
AWX04449.1|4646974_4647205_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	98.7	8.8e-35
AWX04450.1|4647313_4647562_+	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	8.3e-15
AWX04451.1|4647594_4648875_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	50.9	1.1e-123
>prophage 348
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4665182	4666457	4847638	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
AWX04467.1|4665182_4666457_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	43.0	5.5e-86
>prophage 349
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4669754	4671119	4847638		Bacillus_phage(100.0%)	1	NA	NA
AWX04472.1|4669754_4671119_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.6	9.0e-18
>prophage 350
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4674893	4675412	4847638		Salmonella_phage(100.0%)	1	NA	NA
AWX04475.1|4674893_4675412_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	56.6	3.7e-49
>prophage 351
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4682271	4693432	4847638		Bacillus_phage(16.67%)	11	NA	NA
AWX04484.1|4682271_4683030_+	peptidoglycan endopeptidase	NA	A0A217EQL1	Bacillus_phage	38.7	9.4e-17
AWX04485.1|4683152_4683734_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	45.3	6.2e-45
AWX04486.1|4683771_4684938_-	MFS transporter	NA	NA	NA	NA	NA
AWX04487.1|4685099_4685189_-	YnhF family membrane protein	NA	NA	NA	NA	NA
AWX04488.1|4685486_4686512_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	32.2	1.3e-32
AWX04489.1|4686529_4687441_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWX04490.1|4687553_4688753_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
AWX04491.1|4689051_4690200_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	44.8	3.6e-84
AWX04492.1|4690231_4690873_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	37.3	3.9e-24
AWX04493.1|4691098_4692472_+	multidrug transporter MdtK	NA	NA	NA	NA	NA
AWX04494.1|4692961_4693432_-	heat-shock protein	NA	A0A1D7SNF0	Cyanophage	31.8	5.8e-09
>prophage 352
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4704815	4709025	4847638		Burkholderia_phage(50.0%)	3	NA	NA
AWX04502.1|4704815_4705082_-	PAAR domain-containing protein	NA	E5E3Y0	Burkholderia_phage	37.8	1.3e-05
AWX04503.1|4706237_4707011_-	hypothetical protein	NA	NA	NA	NA	NA
AWX04504.1|4707003_4709025_-	lipase family protein	NA	A0A2R8FER2	Brazilian_cedratvirus	30.6	2.1e-07
>prophage 353
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4712875	4715506	4847638		Cronobacter_phage(100.0%)	1	NA	NA
AWX04508.1|4712875_4715506_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.4	1.9e-96
>prophage 354
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4728787	4729603	4847638		Planktothrix_phage(100.0%)	1	NA	NA
AWX04520.1|4728787_4729603_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.4	2.8e-35
>prophage 355
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4732814	4735608	4847638		Staphylococcus_phage(50.0%)	2	NA	NA
AWX04526.1|4732814_4733837_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.7e-14
AWX04794.1|4734237_4735608_+	CBS domain-containing protein	NA	A0A1W6JHY1	Lactococcus_phage	36.8	5.4e-47
>prophage 356
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4740717	4747952	4847638		environmental_halophage(25.0%)	9	NA	NA
AWX04532.1|4740717_4741938_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.9	1.3e-92
AWX04533.1|4741934_4743206_-	signal peptide peptidase SppA	NA	NA	NA	NA	NA
AWX04534.1|4743180_4743927_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.3	3.3e-06
AWX04535.1|4743936_4745427_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
AWX04536.1|4745435_4745804_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	42.2	2.9e-16
AWX04537.1|4745792_4746059_+	hypothetical protein	NA	NA	NA	NA	NA
AWX04538.1|4746300_4746660_+	CHAP domain-containing protein	NA	NA	NA	NA	NA
AWX04539.1|4746661_4747114_+	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
AWX04540.1|4747223_4747952_-	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.8	2.1e-50
>prophage 357
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4770136	4774881	4847638		Hokovirus(50.0%)	3	NA	NA
AWX04560.1|4770136_4772515_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	5.5e-172
AWX04561.1|4772850_4773684_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
AWX04562.1|4773834_4774881_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.4	6.1e-83
>prophage 358
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4780201	4793621	4847638	tRNA	Tupanvirus(25.0%)	15	NA	NA
AWX04567.1|4780201_4780981_+	heme ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.1	1.4e-12
AWX04568.1|4780977_4782420_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	34.7	5.7e-55
AWX04569.1|4782481_4783195_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AWX04570.1|4783488_4783953_-	endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	36.7	2.3e-13
AWX04571.1|4784025_4784781_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2K9L407	Tupanvirus	26.2	1.7e-10
AWX04572.1|4784780_4785332_-	glutathione peroxidase	NA	NA	NA	NA	NA
AWX04573.1|4785365_4786346_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
AWX04574.1|4786449_4786749_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AWX04575.1|4786753_4789141_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AWX04576.1|4789156_4790140_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	43.2	9.9e-35
AWX04577.1|4790133_4790340_+	hypothetical protein	NA	NA	NA	NA	NA
AWX04578.1|4790444_4790801_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AWX04579.1|4790851_4791049_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AWX04580.1|4791146_4791689_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	2.8e-15
AWX04581.1|4791692_4793621_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	3.9e-128
>prophage 359
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4799736	4805444	4847638		Trichoplusia_ni_ascovirus(50.0%)	5	NA	NA
AWX04590.1|4799736_4800498_+	2-deoxy-D-gluconate 3-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.3	1.9e-17
AWX04591.1|4800593_4801184_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AWX04592.1|4801311_4802703_+	L-cystine transporter	NA	NA	NA	NA	NA
AWX04593.1|4802751_4803006_-	cell division activator CedA	NA	NA	NA	NA	NA
AWX04594.1|4803194_4805444_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.0	8.4e-138
>prophage 360
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4811638	4812466	4847638		Bacillus_virus(100.0%)	1	NA	NA
AWX04602.1|4811638_4812466_+	NAD(+) synthase	NA	G3MA24	Bacillus_virus	54.2	1.9e-71
>prophage 361
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4819796	4821017	4847638		Klosneuvirus(100.0%)	1	NA	NA
AWX04610.1|4819796_4821017_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.5	8.8e-25
>prophage 362
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4825624	4826245	4847638		Bacillus_phage(100.0%)	1	NA	NA
AWX04615.1|4825624_4826245_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	28.4	3.8e-08
>prophage 363
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4831166	4833074	4847638		Streptococcus_phage(100.0%)	1	NA	NA
AWX04622.1|4831166_4833074_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.5	5.2e-40
>prophage 364
CP030076	Enterobacter hormaechei strain 20710 chromosome, complete genome	4847638	4837902	4840020	4847638		Tupanvirus(50.0%)	2	NA	NA
AWX04626.1|4837902_4838544_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.6	3.6e-17
AWX04627.1|4838763_4840020_+	chitinase	NA	W5VKF1	Buzura_suppressaria_nuclear_polyhedrosis_virus	27.6	1.5e-22
>prophage 1
CP030077	Enterobacter hormaechei strain 20710 plasmid p3-20710, complete sequence	170955	30184	48571	170955	integrase,transposase	Escherichia_phage(33.33%)	19	40376:40390	52279:52293
AWX04842.1|30184_30538_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	9.9e-62
AWX04843.1|30574_31279_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWX04990.1|32462_32675_+	hypothetical protein	NA	NA	NA	NA	NA
AWX04844.1|32821_33691_-	23S ribosomal RNA methyltransferase Erm	NA	NA	NA	NA	NA
AWX04845.1|34325_34559_+	hypothetical protein	NA	NA	NA	NA	NA
AWX04846.1|34621_34867_+	XRE family transcriptional regulator	NA	A0A1S5SFA6	Streptococcus_phage	41.0	5.3e-06
AWX04847.1|35591_35783_-	hypothetical protein	NA	NA	NA	NA	NA
AWX04848.1|35836_36496_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
AWX04849.1|36696_37074_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWX04850.1|37384_38389_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AWX04851.1|38467_41434_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
40376:40390	attL	GGCCTCGATGGCGGC	NA	NA	NA	NA
AWX04852.1|41436_41997_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AWX04853.1|42122_42737_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AWX04854.1|42675_43689_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AWX04991.1|43846_44320_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
AWX04855.1|44450_45239_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
AWX04856.1|45444_45792_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AWX04857.1|45785_46625_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AWX04858.1|47029_48571_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
52279:52293	attR	GCCGCCATCGAGGCC	NA	NA	NA	NA
>prophage 1
CP030078	Enterobacter hormaechei strain 20710 plasmid p4-20710, complete sequence	108358	0	107614	108358	tail,terminase,integrase,capsid	Salmonella_phage(94.74%)	127	1067:1089	108237:108259
AWX04998.1|0_1065_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	100.0	1.5e-190
1067:1089	attL	CCAACCACTGTAGAGAGTAGAAA	NA	NA	NA	NA
AWX04999.1|1633_1846_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	100.0	8.1e-35
AWX05000.1|1845_2181_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	99.1	1.6e-56
AWX05001.1|2177_2357_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	98.3	7.3e-21
AWX05002.1|2397_2673_-	hypothetical protein	NA	J9Q738	Salmonella_phage	96.7	5.4e-47
AWX05003.1|2741_3152_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.8	1.1e-75
AWX05004.1|3668_4499_-	SPFH/Band 7/PHB domain protein	NA	J9Q7Z4	Salmonella_phage	99.3	1.1e-127
AWX05005.1|4502_4703_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	93.9	9.3e-25
AWX05006.1|4794_5871_-	recombinase	NA	J9Q736	Salmonella_phage	99.7	5.5e-204
AWX05007.1|5873_6140_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
AWX05008.1|6139_7084_-	exonuclease	NA	J9Q7S6	Salmonella_phage	99.4	8.8e-182
AWX05009.1|7144_8173_-	regulator	NA	J9Q7Z3	Salmonella_phage	99.7	1.3e-165
AWX05010.1|8292_8766_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	99.3	1.3e-72
AWX05011.1|8944_9196_+	hypothetical protein	NA	NA	NA	NA	NA
AWX05012.1|9268_9832_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	65.1	9.9e-64
AWX05013.1|9861_10305_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	100.0	7.8e-72
AWX05014.1|10301_13820_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.4	0.0e+00
AWX05015.1|13794_13998_-	hypothetical protein	NA	J9Q6I7	Salmonella_phage	100.0	5.5e-33
AWX05016.1|14000_15236_-	porphyrin biosynthesis protein	NA	J9Q733	Salmonella_phage	99.8	6.0e-239
AWX05017.1|15332_17723_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	92.7	0.0e+00
AWX05018.1|17832_18045_-	hypothetical protein	NA	NA	NA	NA	NA
AWX05019.1|18308_18695_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWX05020.1|18686_19793_-|integrase	integrase	integrase	A0A1P8DTG6	Proteus_phage	32.6	5.6e-26
AWX05021.1|19964_20381_-	hypothetical protein	NA	NA	NA	NA	NA
AWX05022.1|20371_20896_-	hypothetical protein	NA	NA	NA	NA	NA
AWX05023.1|20992_21238_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	43.6	2.9e-12
AWX05024.1|21237_21603_-	hypothetical protein	NA	K7PH35	Enterobacteria_phage	65.6	1.5e-36
AWX05025.1|21618_21822_-	hypothetical protein	NA	A0A0B6VT64	Edwardsiella_phage	49.2	4.4e-06
AWX05026.1|21832_22666_-	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	65.1	7.0e-90
AWX05027.1|22813_24046_+	hypothetical protein	NA	NA	NA	NA	NA
AWX05028.1|25051_25357_-	C-type natriuretic protein	NA	J9Q7S1	Salmonella_phage	98.0	1.2e-47
AWX05029.1|25353_25506_-	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	100.0	4.0e-20
AWX05120.1|25505_25712_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	100.0	2.8e-32
AWX05030.1|25701_25878_-	hypothetical protein	NA	J9Q729	Salmonella_phage	93.1	1.3e-22
AWX05031.1|25877_27200_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	99.3	2.8e-258
AWX05121.1|27234_27492_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	96.5	1.2e-35
AWX05122.1|27402_27744_+	hypothetical protein	NA	NA	NA	NA	NA
AWX05032.1|27792_28587_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	76.5	2.1e-112
AWX05033.1|28773_30027_+	sel1 repeat family protein	NA	NA	NA	NA	NA
AWX05034.1|30018_31230_-	DNA primase	NA	J9Q720	Salmonella_phage	93.8	3.7e-209
AWX05035.1|31292_32633_-	DNA helicase	NA	J9Q7G4	Salmonella_phage	99.8	1.3e-247
AWX05036.1|32693_33419_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	98.3	5.4e-139
AWX05037.1|33683_34481_+	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	26.4	7.3e-12
AWX05038.1|34521_34881_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	100.0	2.3e-45
AWX05039.1|34880_35546_-	plasmid stability protein	NA	J9Q7R7	Salmonella_phage	95.0	4.7e-113
AWX05040.1|35902_36172_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AWX05041.1|36175_36700_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWX05042.1|36726_37068_-	hypothetical protein	NA	J9Q7G2	Salmonella_phage	80.6	6.9e-28
AWX05043.1|37136_37829_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	96.1	3.9e-126
AWX05044.1|37842_38166_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	97.2	8.0e-50
AWX05045.1|39386_39818_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	53.8	1.5e-16
AWX05046.1|48690_49281_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	91.8	9.0e-100
AWX05047.1|49268_50066_-|tail	phage tail protein	tail	J9Q7R4	Salmonella_phage	95.1	3.5e-155
AWX05048.1|50058_50790_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	100.0	3.9e-137
AWX05049.1|50846_51182_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	99.1	5.2e-60
AWX05050.1|51223_55807_-|tail	phage tail tape measure protein	tail	J9Q712	Salmonella_phage	91.4	0.0e+00
AWX05051.1|55814_56084_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	8.4e-37
AWX05052.1|56164_56482_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
AWX05053.1|56541_57288_-	hypothetical protein	NA	J9Q7Y4	Salmonella_phage	98.4	6.8e-129
AWX05054.1|57362_57746_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	100.0	1.7e-67
AWX05055.1|57747_58221_-	hypothetical protein	NA	J9Q711	Salmonella_phage	100.0	2.3e-82
AWX05056.1|58211_58556_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
AWX05057.1|58653_59487_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	99.6	1.3e-152
AWX05058.1|59486_59921_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	99.3	8.1e-74
AWX05059.1|59964_60888_-	hypothetical protein	NA	J9Q6D6	Salmonella_phage	99.7	9.6e-157
AWX05060.1|60962_61838_-|capsid	phage major capsid protein	capsid	J9Q710	Salmonella_phage	99.7	8.5e-163
AWX05061.1|61864_62758_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	91.6	3.3e-138
AWX05062.1|62780_64355_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	98.9	3.5e-300
AWX05063.1|64388_65645_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	100.0	1.8e-251
AWX05064.1|65647_66289_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	98.1	3.4e-108
AWX05065.1|66484_66751_-	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
AWX05066.1|66760_67660_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.7	8.2e-169
AWX05067.1|67656_67911_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	98.8	4.1e-41
AWX05068.1|67903_68542_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	100.0	3.8e-112
AWX05069.1|68538_69207_-	chromosome partitioning protein ParB	NA	J9Q6L1	Salmonella_phage	99.1	4.3e-114
AWX05070.1|69206_69905_-	chromosome partitioning protein ParB	NA	J9Q756	Salmonella_phage	99.1	2.5e-125
AWX05071.1|69969_71529_+	ATP-dependent helicase	NA	J9Q7I4	Salmonella_phage	99.2	2.8e-294
AWX05072.1|71531_71810_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	98.9	1.3e-40
AWX05073.1|71875_72400_+	hypothetical protein	NA	NA	NA	NA	NA
AWX05074.1|72443_73244_-	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	39.0	1.2e-06
AWX05075.1|73358_73871_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	68.2	3.1e-56
AWX05076.1|74188_74839_+	hypothetical protein	NA	J9Q754	Salmonella_phage	98.6	3.5e-113
AWX05077.1|74889_75093_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	97.0	8.3e-29
AWX05078.1|75734_76217_-	hypothetical protein	NA	J9Q805	Salmonella_phage	96.9	7.1e-87
AWX05079.1|76229_76463_-	hypothetical protein	NA	NA	NA	NA	NA
AWX05123.1|76422_76710_-	ABC transporter	NA	J9Q753	Salmonella_phage	97.8	6.6e-48
AWX05080.1|76830_77226_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	66.2	1.2e-42
AWX05081.1|77354_77666_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	96.1	7.9e-47
AWX05082.1|77806_78025_-	hypothetical protein	NA	J9Q804	Salmonella_phage	97.2	9.2e-34
AWX05083.1|78029_78251_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	98.6	1.4e-34
AWX05084.1|79829_80135_+	hypothetical protein	NA	NA	NA	NA	NA
AWX05124.1|80172_80490_-	hypothetical protein	NA	J9Q750	Salmonella_phage	83.8	3.9e-49
AWX05085.1|80489_80726_-	DUF1380 domain-containing protein	NA	J9Q7H8	Salmonella_phage	97.4	1.6e-39
AWX05086.1|80811_81078_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	70.5	3.1e-31
AWX05087.1|81264_81468_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	97.0	6.8e-31
AWX05088.1|81523_82222_-	DUF1311 domain-containing protein	NA	J9Q6K3	Salmonella_phage	91.8	2.0e-114
AWX05089.1|82260_82812_-	hypothetical protein	NA	J9Q748	Salmonella_phage	92.3	2.3e-97
AWX05090.1|82808_83450_-	HD domain-containing protein	NA	J9Q7H7	Salmonella_phage	99.1	1.4e-114
AWX05091.1|83541_83913_-	hypothetical protein	NA	J9Q7T4	Salmonella_phage	99.2	7.2e-63
AWX05092.1|83915_84197_-	hypothetical protein	NA	J9Q801	Salmonella_phage	97.8	3.6e-46
AWX05093.1|84193_84883_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	96.9	8.8e-123
AWX05094.1|84941_86645_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	98.8	0.0e+00
AWX05095.1|86768_87341_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	97.9	5.3e-97
AWX05096.1|87449_88292_-	hypothetical protein	NA	J9Q7T3	Salmonella_phage	71.1	2.1e-70
AWX05097.1|88400_88589_-	hypothetical protein	NA	J9Q800	Salmonella_phage	100.0	1.2e-26
AWX05098.1|88598_89093_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	98.2	2.1e-81
AWX05099.1|89234_89843_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	99.0	1.4e-116
AWX05100.1|90438_90669_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	100.0	2.1e-36
AWX05101.1|90867_91461_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	100.0	2.1e-112
AWX05102.1|91646_92573_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	92.5	1.4e-107
AWX05103.1|92617_93175_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	99.5	7.0e-102
AWX05104.1|93184_93604_-	hypothetical protein	NA	J9Q743	Salmonella_phage	97.8	6.4e-68
AWX05105.1|93667_94312_-	hypothetical protein	NA	J9Q7H4	Salmonella_phage	100.0	5.2e-117
AWX05106.1|94311_94788_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	100.0	1.4e-90
AWX05107.1|94784_95198_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	97.1	1.8e-70
AWX05108.1|95199_96315_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	98.9	2.4e-218
AWX05109.1|96492_97362_-	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	97.9	8.7e-160
AWX05110.1|97444_98587_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	100.0	1.7e-219
AWX05111.1|98694_101010_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	99.7	0.0e+00
AWX05112.1|101087_101657_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	100.0	5.8e-104
AWX05113.1|101668_102415_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	98.0	1.3e-135
AWX05114.1|102404_104321_-	exonuclease	NA	J9Q741	Salmonella_phage	94.4	0.0e+00
AWX05115.1|104317_104554_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	98.4	1.1e-29
AWX05116.1|104550_105636_-	exonuclease SbcCD subunit D	NA	J9Q7S9	Salmonella_phage	97.8	4.2e-204
AWX05117.1|105864_106368_+	hypothetical protein	NA	J9Q7Z6	Salmonella_phage	97.6	2.1e-89
AWX05118.1|106399_106894_-	GNAT family N-acetyltransferase	NA	J9Q6J3	Salmonella_phage	98.2	7.8e-89
AWX05119.1|106969_107614_-	hypothetical protein	NA	J9Q739	Salmonella_phage	99.1	2.2e-123
108237:108259	attR	CCAACCACTGTAGAGAGTAGAAA	NA	NA	NA	NA
>prophage 1
CP030079	Enterobacter hormaechei strain 20710 plasmid p5-20710, complete sequence	91816	3436	46373	91816	transposase,integrase	Escherichia_phage(29.41%)	53	NA	NA
AWX05126.1|3436_4141_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	2.0e-138
AWX05127.1|4086_4272_-	hypothetical protein	NA	NA	NA	NA	NA
AWX05128.1|4640_5429_+	winged helix family transcriptional regulator	NA	NA	NA	NA	NA
AWX05129.1|5428_5947_+	hypothetical protein	NA	NA	NA	NA	NA
AWX05130.1|5951_6368_-	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
AWX05131.1|6753_7458_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWX05132.1|7579_8485_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AWX05133.1|8481_9720_+	MFS transporter	NA	NA	NA	NA	NA
AWX05134.1|9719_10304_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AWX05135.1|10249_10606_+	hypothetical protein	NA	NA	NA	NA	NA
AWX05136.1|10796_11561_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AWX05137.1|11730_12435_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWX05138.1|12471_13452_-	hypothetical protein	NA	NA	NA	NA	NA
AWX05139.1|13451_13712_-	hypothetical protein	NA	NA	NA	NA	NA
AWX05140.1|13815_14019_+	hypothetical protein	NA	NA	NA	NA	NA
AWX05141.1|14326_14596_+	hypothetical protein	NA	NA	NA	NA	NA
AWX05142.1|14647_15034_+	hypothetical protein	NA	NA	NA	NA	NA
AWX05143.1|15069_15579_+	hypothetical protein	NA	NA	NA	NA	NA
AWX05144.1|15583_16360_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	85.1	3.6e-48
AWX05145.1|16453_16738_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
AWX05146.1|16785_17439_-	chromosome partitioning protein ParA	NA	E5FFJ3	Burkholderia_phage	45.4	7.0e-45
AWX05147.1|17716_18688_+	plasmid segregation protein parM	NA	A0A222YXF2	Escherichia_phage	44.5	1.4e-68
AWX05148.1|18692_19082_+	plasmid stability protein	NA	NA	NA	NA	NA
AWX05149.1|19085_20357_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.0	3.5e-157
AWX05212.1|20356_20785_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	51.2	2.3e-28
AWX05150.1|21239_21983_+	hypothetical protein	NA	NA	NA	NA	NA
AWX05151.1|22337_22799_+	hypothetical protein	NA	NA	NA	NA	NA
AWX05152.1|22798_23137_+	hypothetical protein	NA	NA	NA	NA	NA
AWX05153.1|23521_24280_+	hypothetical protein	NA	NA	NA	NA	NA
AWX05154.1|24687_25197_+	antirestriction protein ArdA	NA	A0A222ZHP3	Rhodococcus_phage	30.8	6.3e-09
AWX05155.1|25239_25428_+	hypothetical protein	NA	NA	NA	NA	NA
AWX05156.1|26250_26583_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AWX05157.1|26650_28639_+	hypothetical protein	NA	G8DH78	Emiliania_huxleyi_virus	30.2	1.7e-25
AWX05158.1|28640_29108_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
AWX05159.1|29104_29839_+	hypothetical protein	NA	NA	NA	NA	NA
AWX05160.1|29835_30072_+	hypothetical protein	NA	NA	NA	NA	NA
AWX05161.1|30303_30462_+	type I toxin-antitoxin system hok family toxin	NA	NA	NA	NA	NA
AWX05213.1|31369_31726_+	hypothetical protein	NA	NA	NA	NA	NA
AWX05162.1|31768_32587_+	SAM-dependent DNA methyltransferase	NA	H7BVT3	unidentified_phage	34.4	4.0e-13
AWX05163.1|32666_33158_+	antirestriction protein	NA	NA	NA	NA	NA
AWX05164.1|33202_33505_+	hypothetical protein	NA	NA	NA	NA	NA
AWX05165.1|33501_33759_-	XRE family transcriptional regulator	NA	A0A248SLB9	Klebsiella_phage	48.3	2.3e-07
AWX05166.1|33809_34022_+	hypothetical protein	NA	NA	NA	NA	NA
AWX05167.1|34514_34661_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
AWX05168.1|34715_35285_+	hypothetical protein	NA	NA	NA	NA	NA
AWX05169.1|35692_36526_+	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.6	3.3e-47
AWX05170.1|37255_37591_+	nikA protein	NA	NA	NA	NA	NA
AWX05171.1|37612_40312_+	relaxase NikB	NA	NA	NA	NA	NA
AWX05172.1|40407_41559_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	28.4	1.5e-29
AWX05173.1|41684_42461_+	hypothetical protein	NA	NA	NA	NA	NA
AWX05174.1|42491_42761_-	hypothetical protein	NA	NA	NA	NA	NA
AWX05175.1|42833_45134_-	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
AWX05176.1|45242_46373_+|transposase	transposase	transposase	Q9G0F2	Phage_Gifsy-1	85.9	2.0e-188
>prophage 1
CP030080	Enterobacter hormaechei strain 20710 plasmid pIMP-20710, complete sequence	286652	95981	111910	286652	transposase	Rhodobacter_phage(33.33%)	22	NA	NA
AWX05304.1|95981_96986_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AWX05305.1|96948_97089_-	NTP-binding protein	NA	NA	NA	NA	NA
AWX05306.1|97135_98818_+|transposase	transposase	transposase	M4T586	Rhodobacter_phage	24.7	3.7e-05
AWX05307.1|98820_99729_+|transposase	transposase	transposase	NA	NA	NA	NA
AWX05308.1|99725_100943_+|transposase	transposase	transposase	NA	NA	NA	NA
AWX05309.1|101003_101618_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.0	5.1e-37
AWX05310.1|101656_101977_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AWX05311.1|101992_102229_-	mercury resistance protein	NA	NA	NA	NA	NA
AWX05312.1|102225_102591_-	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
AWX05313.1|102702_103341_-	organomercurial lyase MerB	NA	NA	NA	NA	NA
AWX05314.1|103355_103709_-	hypothetical protein	NA	NA	NA	NA	NA
AWX05315.1|103638_104073_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AWX05316.1|104151_105156_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AWX05503.1|105729_105942_+	hypothetical protein	NA	NA	NA	NA	NA
AWX05317.1|106032_106380_-	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
AWX05318.1|106376_107015_-	organomercurial lyase MerB	NA	NA	NA	NA	NA
AWX05319.1|107095_107749_-	sel1 repeat family protein	NA	NA	NA	NA	NA
AWX05320.1|107784_109494_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.3e-34
AWX05321.1|109681_109957_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
AWX05322.1|109970_110321_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
AWX05323.1|110392_110827_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AWX05324.1|110905_111910_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP030080	Enterobacter hormaechei strain 20710 plasmid pIMP-20710, complete sequence	286652	237379	268413	286652	transposase,protease	uncultured_Caudovirales_phage(50.0%)	37	NA	NA
AWX05444.1|237379_238294_+|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	98.4	3.6e-172
AWX05445.1|238332_238461_-	ABC transporter	NA	NA	NA	NA	NA
AWX05446.1|238459_238777_+	hypothetical protein	NA	NA	NA	NA	NA
AWX05447.1|238827_239235_-	hypothetical protein	NA	NA	NA	NA	NA
AWX05448.1|239692_240364_-|protease	serine protease	protease	NA	NA	NA	NA
AWX05449.1|240408_240714_-	hypothetical protein	NA	NA	NA	NA	NA
AWX05450.1|240736_241054_-	hypothetical protein	NA	NA	NA	NA	NA
AWX05451.1|241267_242671_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
AWX05508.1|242699_243332_-	hypothetical protein	NA	NA	NA	NA	NA
AWX05452.1|243528_244932_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AWX05453.1|244964_245669_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.9	8.8e-86
AWX05454.1|245755_246076_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	53.7	1.7e-20
AWX05455.1|246121_247411_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.4	9.9e-168
AWX05456.1|247423_247849_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.6e-50
AWX05457.1|247908_248736_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	37.2	4.9e-43
AWX05458.1|248754_250233_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.4	7.3e-199
AWX05459.1|250724_251000_-	hypothetical protein	NA	NA	NA	NA	NA
AWX05509.1|251140_251338_-	hypothetical protein	NA	NA	NA	NA	NA
AWX05460.1|251407_251695_-	hypothetical protein	NA	NA	NA	NA	NA
AWX05461.1|251732_251987_-	hypothetical protein	NA	NA	NA	NA	NA
AWX05462.1|252032_252266_-	hypothetical protein	NA	NA	NA	NA	NA
AWX05463.1|252324_252582_-	hypothetical protein	NA	NA	NA	NA	NA
AWX05464.1|253016_253913_-	hypothetical protein	NA	NA	NA	NA	NA
AWX05465.1|253915_254431_-	nuclease	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
AWX05466.1|254645_256073_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
AWX05467.1|256323_257643_+	DUF1173 family protein	NA	NA	NA	NA	NA
AWX05468.1|257655_257859_+	hypothetical protein	NA	NA	NA	NA	NA
AWX05469.1|257922_259128_-	ATP/GTP-binding protein	NA	NA	NA	NA	NA
AWX05470.1|259124_259943_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AWX05471.1|260408_260681_-	transcriptional repressor RcnR	NA	NA	NA	NA	NA
AWX05472.1|260803_261919_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
AWX05473.1|262176_262611_-	copper-binding protein	NA	NA	NA	NA	NA
AWX05474.1|262828_264175_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.6	8.8e-18
AWX05475.1|264258_265182_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	8.4e-177
AWX05476.1|265370_266990_+	phosphoethanolamine--lipid A transferase	NA	NA	NA	NA	NA
AWX05477.1|267066_267543_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AWX05478.1|267708_268413_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 1
CP030081	Enterobacter hormaechei strain 20710 plasmid pVIM-20710, complete sequence	39601	0	31135	39601	integrase,transposase	Acanthamoeba_polyphaga_mimivirus(11.11%)	34	9583:9601	36998:37016
AWX05510.1|2221_4159_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
AWX05511.1|4124_5156_-	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
AWX05512.1|5136_6363_-	type IV secretion protein	NA	NA	NA	NA	NA
AWX05513.1|6362_7199_-	P-type conjugative transfer protein VirB9	NA	NA	NA	NA	NA
AWX05514.1|7200_7941_-	Type IV secretory pathway component	NA	NA	NA	NA	NA
AWX05515.1|7940_8162_-	hypothetical protein	NA	NA	NA	NA	NA
AWX05516.1|8322_9333_-	type IV secretion protein	NA	NA	NA	NA	NA
AWX05517.1|9344_9605_-	hypothetical protein	NA	NA	NA	NA	NA
9583:9601	attL	TTTCGTGCGCACGAAAAAT	NA	NA	NA	NA
AWX05518.1|9614_10247_-	type IV secretion protein	NA	NA	NA	NA	NA
AWX05519.1|10243_12802_-	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
AWX05520.1|12699_13017_-	conjugal transfer protein	NA	NA	NA	NA	NA
AWX05551.1|13029_13350_-	type IV secretion protein	NA	NA	NA	NA	NA
AWX05552.1|13312_13621_-	hypothetical protein	NA	NA	NA	NA	NA
AWX05521.1|13767_15738_-	type I DNA topoisomerase	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	34.2	1.2e-76
AWX05522.1|15734_16475_-	cell wall hydrolase	NA	NA	NA	NA	NA
AWX05523.1|16484_16973_-	conjugal transfer protein TraL	NA	NA	NA	NA	NA
AWX05524.1|17397_17655_+	hypothetical protein	NA	NA	NA	NA	NA
AWX05525.1|17946_18270_+	hypothetical protein	NA	NA	NA	NA	NA
AWX05526.1|18279_19344_+	TraN	NA	A0A0R6PHM5	Moraxella_phage	34.9	5.3e-34
AWX05527.1|19344_19992_-	resolvase	NA	NA	NA	NA	NA
AWX05528.1|19991_20723_-	hypothetical protein	NA	A0A1D6ZIU7	Xanthomonas_phage	33.9	1.9e-06
AWX05529.1|20712_21579_-	3'-5' exonuclease	NA	K7RFY5	Vibrio_phage	40.9	1.1e-26
AWX05530.1|21888_22653_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AWX05531.1|22719_22899_-	hypothetical protein	NA	NA	NA	NA	NA
AWX05532.1|23006_23807_-	subclass B1 metallo-beta-lactamase VIM-1	NA	NA	NA	NA	NA
AWX05533.1|23973_24987_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AWX05534.1|24925_25213_+|transposase	transposase	transposase	NA	NA	NA	NA
AWX05535.1|25273_25585_+	addiction module antidote protein, HigA family	NA	NA	NA	NA	NA
AWX05536.1|25769_27122_+	replication protein	NA	A0A1B1P892	Bacillus_phage	25.4	3.1e-10
AWX05553.1|27768_28191_+	antirestriction protein	NA	A0A1S5R3R9	Pseudomonas_phage	33.0	1.6e-05
AWX05537.1|28300_29296_+	hypothetical protein	NA	NA	NA	NA	NA
AWX05538.1|29483_29864_+	hypothetical protein	NA	NA	NA	NA	NA
AWX05539.1|30064_30379_+	transcriptional regulator	NA	NA	NA	NA	NA
AWX05540.1|30382_31135_+	ParA family protein	NA	H7BUL8	unidentified_phage	29.9	4.3e-14
36998:37016	attR	TTTCGTGCGCACGAAAAAT	NA	NA	NA	NA
>prophage 2
CP030081	Enterobacter hormaechei strain 20710 plasmid pVIM-20710, complete sequence	39601	37107	38637	39601		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AWX05548.1|37107_38637_-	conjugal transfer protein TraC	NA	A0A1B1IRD0	uncultured_Mediterranean_phage	33.9	6.9e-35
