The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP030150	Bacillus velezensis strain DSYZ chromosome, complete genome	4258978	689569	699460	4258978		Synechococcus_phage(50.0%)	9	NA	NA
AWX71140.1|689569_690862_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	4.5e-19
AWX71141.1|690937_691657_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.7	1.3e-47
AWX71142.1|691656_691911_+	phosphoribosylformylglycinamidine synthase, purS protein	NA	M4QPE7	Synechococcus_phage	33.3	4.7e-05
AWX71143.1|691907_692591_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AWX71144.1|692574_694803_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.7	9.4e-158
AWX71145.1|694778_696209_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	6.2e-54
AWX71146.1|696300_697341_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.9	3.7e-64
AWX71147.1|697337_697925_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.8	1.0e-26
AWX71148.1|697921_699460_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.8	6.7e-78
>prophage 2
CP030150	Bacillus velezensis strain DSYZ chromosome, complete genome	4258978	1157849	1191459	4258978	tRNA,coat	Planktothrix_phage(16.67%)	38	NA	NA
AWX71573.1|1157849_1158842_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AWX71574.1|1159585_1161220_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWX71575.1|1161326_1162262_+	ABC transporter permease	NA	NA	NA	NA	NA
AWX71576.1|1162265_1163183_+	ABC transporter permease	NA	NA	NA	NA	NA
AWX71577.1|1163195_1164272_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	2.3e-16
AWX71578.1|1164264_1165182_+	ABC transporter ATP-binding protein	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.5e-05
AWX71579.1|1165288_1166476_+	GTP-binding protein	NA	NA	NA	NA	NA
AWX71580.1|1166593_1167172_+	N-acetyltransferase	NA	NA	NA	NA	NA
AWX71581.1|1167349_1167745_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
AWX71582.1|1167802_1168459_-	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	41.0	9.9e-31
AWX71583.1|1168734_1169391_+	adaptor protein MecA	NA	NA	NA	NA	NA
AWX71584.1|1169541_1170729_+	competence protein CoiA	NA	NA	NA	NA	NA
AWX74472.1|1170931_1172761_+	oligoendopeptidase F	NA	NA	NA	NA	NA
AWX71585.1|1173251_1174154_-	DsbA family protein	NA	NA	NA	NA	NA
AWX71586.1|1174150_1174549_-	thiol management oxidoreductase	NA	NA	NA	NA	NA
AWX71587.1|1174777_1175464_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	72.6	2.3e-38
AWX71588.1|1175468_1176041_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
AWX71589.1|1176165_1176531_+	hypothetical protein	NA	NA	NA	NA	NA
AWX71590.1|1176558_1177194_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
AWX71591.1|1177211_1178012_+	NAD kinase	NA	NA	NA	NA	NA
AWX71592.1|1178026_1178920_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	31.2	1.4e-06
AWX71593.1|1178953_1179703_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	A0A1V0SJW2	Klosneuvirus	26.4	9.9e-11
AWX71594.1|1179719_1179905_+	hypothetical protein	NA	NA	NA	NA	NA
AWX71595.1|1179931_1181776_+	sodium:proton antiporter	NA	NA	NA	NA	NA
AWX74473.1|1182025_1182733_+	thiaminase II	NA	NA	NA	NA	NA
AWX74474.1|1182710_1183328_+	thiazole tautomerase TenI	NA	NA	NA	NA	NA
AWX71596.1|1183311_1184421_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
AWX71597.1|1184417_1184621_+	thiamine biosynthesis protein ThiS	NA	NA	NA	NA	NA
AWX71598.1|1184617_1185388_+	thiazole synthase	NA	NA	NA	NA	NA
AWX71599.1|1185384_1186395_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
AWX71600.1|1186417_1187230_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AWX71601.1|1187360_1188137_+	enoyl-[acyl-carrier-protein] reductase FabI	NA	NA	NA	NA	NA
AWX71602.1|1188234_1188843_+|coat	spore coat protein	coat	NA	NA	NA	NA
AWX71603.1|1188901_1189345_-|coat	spore coat protein	coat	NA	NA	NA	NA
AWX71604.1|1189492_1189975_-|coat	spore coat protein	coat	NA	NA	NA	NA
AWX71605.1|1190125_1190626_-|coat	spore coat protein	coat	NA	NA	NA	NA
AWX71606.1|1190718_1191033_-|coat	spore coat protein	coat	NA	NA	NA	NA
AWX71607.1|1191072_1191459_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 3
CP030150	Bacillus velezensis strain DSYZ chromosome, complete genome	4258978	1259837	1292268	4258978	portal,capsid,terminase,holin	Bacillus_phage(33.33%)	42	NA	NA
AWX71682.1|1259837_1260974_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.9	1.3e-94
AWX71683.1|1261240_1262194_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	69.3	1.1e-62
AWX71684.1|1262230_1262608_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	41.4	1.5e-15
AWX71685.1|1262717_1263320_+	hypothetical protein	NA	A0A0Y0AJU6	Bacillus_phage	48.3	7.9e-43
AWX71686.1|1263390_1264227_+	manganese catalase family protein	NA	NA	NA	NA	NA
AWX71687.1|1264248_1264839_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	3.0e-39
AWX71688.1|1264839_1265037_+	hypothetical protein	NA	NA	NA	NA	NA
AWX71689.1|1264987_1265326_-	XRE family transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	8.4e-18
AWX71690.1|1265516_1265696_+	hypothetical protein	NA	NA	NA	NA	NA
AWX71691.1|1265685_1266513_+|portal	phage portal protein	portal	S6BFM4	Thermus_phage	49.0	2.2e-19
AWX71692.1|1266412_1267213_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	45.3	3.0e-58
AWX71693.1|1267477_1267819_+|portal	phage portal protein	portal	NA	NA	NA	NA
AWX71694.1|1267808_1268012_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	50.0	1.9e-12
AWX71695.1|1268125_1268638_+	Fis family transcriptional regulator	NA	A0A0K2CNQ1	Brevibacillus_phage	44.6	2.9e-22
AWX71696.1|1268750_1269548_+|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	49.8	4.0e-58
AWX71697.1|1269544_1270843_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	59.2	2.1e-149
AWX74477.1|1270891_1272283_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.8	3.0e-138
AWX71698.1|1272302_1273148_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	58.1	2.5e-55
AWX71699.1|1273174_1274110_+|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	62.8	3.3e-104
AWX71700.1|1274126_1274510_+	DUF3199 family protein	NA	NA	NA	NA	NA
AWX71701.1|1274506_1274863_+	DUF3599 family protein	NA	NA	NA	NA	NA
AWX71702.1|1274859_1275363_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	41.1	2.7e-36
AWX71703.1|1275359_1275806_+|portal	phage portal protein	portal	NA	NA	NA	NA
AWX71704.1|1275802_1276012_+	hypothetical protein	NA	NA	NA	NA	NA
AWX71705.1|1277409_1277853_+|portal	phage portal protein	portal	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
AWX71706.1|1277929_1278376_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	35.8	1.0e-10
AWX71707.1|1278417_1278570_+	hypothetical protein	NA	NA	NA	NA	NA
AWX71708.1|1278557_1283438_+|portal	phage portal protein	portal	A0A1L2JY60	Aeribacillus_phage	41.4	7.1e-41
AWX71709.1|1283430_1284090_+	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	45.3	1.8e-08
AWX71710.1|1284103_1285081_+|portal	phage portal protein	portal	A0A1L6BY20	Clostridium_phage	30.6	6.4e-34
AWX71711.1|1285080_1285347_+	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	38.6	1.2e-06
AWX71712.1|1285450_1285876_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	35.9	3.3e-11
AWX71713.1|1285868_1286915_+|portal	phage portal protein	portal	S6AVU3	Thermus_phage	43.8	1.7e-69
AWX71714.1|1286898_1287477_+	DUF2313 domain-containing protein	NA	A0A0A7RTT8	Clostridium_phage	28.9	3.1e-12
AWX71715.1|1287473_1287746_+	hypothetical protein	NA	NA	NA	NA	NA
AWX71716.1|1287748_1289380_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	33.5	3.5e-53
AWX71717.1|1289392_1289764_+	hypothetical protein	NA	NA	NA	NA	NA
AWX71718.1|1289768_1289966_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	63.6	2.5e-14
AWX71719.1|1290022_1290784_+|portal	phage portal protein	portal	NA	NA	NA	NA
AWX71720.1|1290835_1291099_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	63.1	8.8e-23
AWX71721.1|1291112_1291376_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	2.3e-23
AWX71722.1|1291389_1292268_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	60.5	3.7e-81
>prophage 4
CP030150	Bacillus velezensis strain DSYZ chromosome, complete genome	4258978	1895211	1901424	4258978		Bacillus_phage(50.0%)	7	NA	NA
AWX72207.1|1895211_1895604_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	59.1	3.8e-30
AWX72208.1|1895563_1897666_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	85.7	0.0e+00
AWX72209.1|1897683_1898673_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.0	1.1e-155
AWX72210.1|1898721_1899342_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	47.9	2.1e-46
AWX72211.1|1899390_1900149_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.0	3.1e-52
AWX72212.1|1900182_1900407_-	hypothetical protein	NA	NA	NA	NA	NA
AWX72213.1|1900455_1901424_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.9	8.0e-53
>prophage 5
CP030150	Bacillus velezensis strain DSYZ chromosome, complete genome	4258978	2097954	2143247	4258978	holin,portal,head,terminase,tRNA,capsid,plate,integrase,protease,tail	Bacillus_phage(80.0%)	58	2137084:2137099	2139061:2139076
AWX72337.1|2097954_2099781_+	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	41.0	9.9e-105
AWX72338.1|2099796_2100237_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
AWX72339.1|2100429_2101173_+	hypothetical protein	NA	NA	NA	NA	NA
AWX72340.1|2101217_2102231_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A1J0MS59	Bacillus_phage	95.3	2.3e-183
AWX72341.1|2102273_2102696_-|holin	holin	holin	D6R405	Bacillus_phage	87.1	1.0e-57
AWX72342.1|2102746_2102935_-	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	95.2	1.5e-29
AWX72343.1|2102931_2103294_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	92.4	2.4e-55
AWX72344.1|2103290_2104568_-|plate	phage baseplate upper protein	plate	D6R402	Bacillus_phage	76.7	9.3e-142
AWX72345.1|2104585_2107147_-	peptidase G2	NA	D6R401	Bacillus_phage	95.8	0.0e+00
AWX72346.1|2107186_2108890_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	98.6	7.6e-309
AWX72347.1|2108901_2109741_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	94.6	6.9e-154
AWX72348.1|2109740_2113616_-|tail	phage tail tape measure protein	tail	D6R3Z8	Bacillus_phage	97.7	0.0e+00
AWX72349.1|2113628_2113820_-	hypothetical protein	NA	D6R3Z7	Bacillus_phage	94.4	9.2e-22
AWX72350.1|2113816_2114155_-	hypothetical protein	NA	Q9ZXE8	Bacillus_phage	90.2	2.6e-51
AWX72351.1|2114206_2114815_-|tail	phage tail protein	tail	Q9ZXE9	Bacillus_phage	81.7	1.1e-92
AWX72352.1|2114815_2115196_-	DUF3168 domain-containing protein	NA	Q9ZXF0	Bacillus_phage	96.8	9.0e-61
AWX72353.1|2115192_2115576_-	hypothetical protein	NA	Q9ZXF1	Bacillus_phage	97.6	3.2e-66
AWX72354.1|2115568_2115928_-|head,tail	head-tail adaptor protein	head,tail	Q9ZXF2	Bacillus_phage	96.6	8.0e-59
AWX72355.1|2115860_2116208_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q9ZXF3	Bacillus_phage	99.1	3.5e-59
AWX72356.1|2116222_2116768_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	99.4	2.0e-45
AWX72357.1|2116795_2117107_-	hypothetical protein	NA	Q9ZXF5	Bacillus_phage	96.2	2.3e-46
AWX72358.1|2117119_2118313_-|capsid	phage major capsid protein	capsid	Q9ZXF6	Bacillus_phage	99.7	2.5e-221
AWX72359.1|2118352_2118979_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	99.5	1.5e-113
AWX72360.1|2118968_2120219_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	99.3	2.4e-243
AWX72361.1|2120224_2120443_-	hypothetical protein	NA	Q9ZXF9	Bacillus_phage	100.0	4.3e-31
AWX72362.1|2120455_2122165_-|terminase	terminase large subunit	terminase	D6R3Y4	Bacillus_phage	99.6	0.0e+00
AWX72363.1|2122164_2122671_-|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	95.2	7.0e-85
AWX72364.1|2122757_2123084_-	transglycosylase	NA	Q9T203	Bacillus_phage	96.3	1.1e-54
AWX72365.1|2123052_2123427_-	HNH endonuclease	NA	Q38456	Bacillus_phage	94.4	8.9e-69
AWX72366.1|2123603_2124080_-	hypothetical protein	NA	NA	NA	NA	NA
AWX72367.1|2124191_2124611_-	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
AWX72368.1|2124638_2124821_-	hypothetical protein	NA	NA	NA	NA	NA
AWX72369.1|2125387_2126023_-	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
AWX72370.1|2126179_2126722_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	65.0	2.6e-61
AWX72371.1|2126718_2127171_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	55.9	3.7e-37
AWX72372.1|2127182_2127695_-	Fis family transcriptional regulator	NA	A0A2H4J6J3	uncultured_Caudovirales_phage	39.4	2.2e-30
AWX72373.1|2128338_2129028_-	dUTPase	NA	R9TQ23	Paenibacillus_phage	43.7	3.3e-37
AWX72374.1|2129183_2129441_-	hypothetical protein	NA	F8WQ54	Bacillus_phage	42.3	1.6e-05
AWX72375.1|2129437_2129665_-	hypothetical protein	NA	NA	NA	NA	NA
AWX72376.1|2129661_2129892_-	hypothetical protein	NA	J9PL10	Bacillus_phage	41.6	1.5e-10
AWX72377.1|2129888_2130293_-	hypothetical protein	NA	NA	NA	NA	NA
AWX72378.1|2130406_2130610_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	55.4	7.5e-14
AWX72379.1|2130857_2130998_-	BH0509 family protein	NA	NA	NA	NA	NA
AWX72380.1|2131105_2131654_-	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	36.5	2.0e-05
AWX72381.1|2131947_2132805_-	AAA family ATPase	NA	A0A2H4JH61	uncultured_Caudovirales_phage	29.8	1.9e-21
AWX72382.1|2132755_2133616_-	replication protein	NA	V5UQV4	Oenococcus_phage	44.7	4.9e-46
AWX72383.1|2133602_2133827_-	hypothetical protein	NA	NA	NA	NA	NA
AWX72384.1|2133844_2134168_-	DUF771 domain-containing protein	NA	Q9MBW7	Lactococcus_phage	39.8	2.0e-13
AWX72385.1|2134231_2134438_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWX72386.1|2134602_2135001_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWX72387.1|2135432_2136533_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWX72388.1|2136772_2137885_+|integrase	site-specific integrase	integrase	Q5YAA6	Bacillus_phage	58.3	1.9e-111
2137084:2137099	attL	TCAAGAGTTTTTAAAT	NA	NA	NA	NA
AWX72389.1|2138158_2138704_-|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	48.6	2.1e-42
AWX72390.1|2139018_2139249_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
2139061:2139076	attR	ATTTAAAAACTCTTGA	NA	NA	NA	NA
AWX72391.1|2139492_2141268_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
AWX72392.1|2141312_2142488_-	MFS transporter	NA	NA	NA	NA	NA
AWX72393.1|2142631_2142934_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AWX72394.1|2142980_2143247_-|tRNA	threonyl-tRNA synthetase	tRNA	NA	NA	NA	NA
>prophage 6
CP030150	Bacillus velezensis strain DSYZ chromosome, complete genome	4258978	2245480	2254589	4258978		Bacillus_phage(100.0%)	10	NA	NA
AWX72503.1|2245480_2245855_+	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	52.0	1.2e-28
AWX72504.1|2246088_2246541_-	hypothetical protein	NA	O64117	Bacillus_phage	78.0	5.7e-62
AWX72505.1|2246938_2248054_+	tetratricopeptide repeat protein	NA	D6R410	Bacillus_phage	48.4	6.3e-94
AWX72506.1|2248050_2248173_+	phosphatase RapK inhibitor	NA	NA	NA	NA	NA
AWX72507.1|2248226_2248559_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWX72508.1|2248654_2249251_-	SMI1/KNR4 family protein	NA	O64025	Bacillus_phage	81.9	1.7e-85
AWX72509.1|2249252_2251004_-	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	67.1	6.8e-228
AWX74508.1|2251040_2251475_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
AWX72510.1|2251739_2252705_+	endonuclease	NA	A0A1P8CWK6	Bacillus_phage	75.4	4.9e-79
AWX72511.1|2252921_2254589_+	recombinase family protein	NA	O64015	Bacillus_phage	91.0	6.4e-276
>prophage 7
CP030150	Bacillus velezensis strain DSYZ chromosome, complete genome	4258978	2289470	2362546	4258978	tRNA,integrase	Bacillus_phage(94.52%)	109	2330837:2330861	2364171:2364195
AWX72552.1|2289470_2290025_-	hypothetical protein	NA	O64195	Bacillus_phage	89.9	1.5e-88
AWX72553.1|2290122_2290362_+	XRE family transcriptional regulator	NA	A0A1P8CX60	Bacillus_phage	65.8	6.5e-25
AWX72554.1|2290351_2290558_-	hypothetical protein	NA	O64193	Bacillus_phage	69.0	1.8e-15
AWX72555.1|2290753_2291017_-	hypothetical protein	NA	NA	NA	NA	NA
AWX72556.1|2291184_2291733_-	hypothetical protein	NA	NA	NA	NA	NA
AWX72557.1|2291781_2292120_-	hypothetical protein	NA	NA	NA	NA	NA
AWX72558.1|2292116_2292533_-	hypothetical protein	NA	A0A1P8CX53	Bacillus_phage	72.3	4.5e-37
AWX72559.1|2292507_2292921_-	hypothetical protein	NA	NA	NA	NA	NA
AWX72560.1|2293306_2293546_-	hypothetical protein	NA	NA	NA	NA	NA
AWX72561.1|2293775_2293955_-	hypothetical protein	NA	A0A1P8CWU9	Bacillus_phage	86.4	3.5e-23
AWX72562.1|2293989_2294547_-	hypothetical protein	NA	A0A140HLT6	Bacillus_phage	57.2	1.9e-59
AWX72563.1|2294568_2294787_-	hypothetical protein	NA	NA	NA	NA	NA
AWX72564.1|2295619_2296567_-	HNH endonuclease	NA	A0A1B1P765	Bacillus_phage	43.4	3.4e-16
AWX72565.1|2297052_2297394_-	hypothetical protein	NA	Q9ZXC6	Bacillus_phage	71.2	7.4e-22
AWX72566.1|2297521_2297869_-	hypothetical protein	NA	R4JGJ3	Bacillus_phage	37.9	3.0e-10
AWX72567.1|2297882_2298428_-	hypothetical protein	NA	NA	NA	NA	NA
AWX72568.1|2298424_2299603_-	hypothetical protein	NA	R4JEY6	Bacillus_phage	39.6	1.1e-56
AWX72569.1|2299820_2300192_-	hypothetical protein	NA	NA	NA	NA	NA
AWX72570.1|2300251_2300617_-	hypothetical protein	NA	NA	NA	NA	NA
AWX72571.1|2300745_2301252_-	dihydrofolate reductase	NA	A0A0H3UYW4	Geobacillus_virus	41.5	3.7e-33
AWX72572.1|2301251_2302091_-	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	88.9	2.7e-150
AWX72573.1|2302105_2302498_-	hypothetical protein	NA	A0A1P8CX52	Bacillus_phage	60.2	6.7e-35
AWX72574.1|2302866_2303166_-	hypothetical protein	NA	A0A1P8CX63	Bacillus_phage	54.7	1.4e-19
AWX72575.1|2303158_2303467_-	hypothetical protein	NA	NA	NA	NA	NA
AWX72576.1|2303888_2304503_-	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	42.7	4.7e-43
AWX74511.1|2304549_2304906_-|tRNA	peptidyl-tRNA hydrolase	tRNA	A0A1V0SFB5	Hokovirus	29.8	9.8e-09
AWX72577.1|2304901_2305141_-	hypothetical protein	NA	NA	NA	NA	NA
AWX72578.1|2305133_2305376_-	thioredoxin	NA	A0A1P8CX24	Bacillus_phage	74.7	5.8e-29
AWX72579.1|2305372_2306371_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A076G7U1	Bacillus_phage	79.9	2.7e-149
AWX72580.1|2306371_2306614_-	hypothetical protein	NA	NA	NA	NA	NA
AWX72581.1|2306601_2308701_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A1P8CX40	Bacillus_phage	61.4	0.0e+00
AWX74512.1|2308663_2309053_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A1P8CX56	Bacillus_phage	82.2	1.3e-54
AWX72582.1|2309055_2309406_-	hypothetical protein	NA	O64171	Bacillus_phage	45.8	1.4e-20
AWX72583.1|2309607_2309919_-	hypothetical protein	NA	NA	NA	NA	NA
AWX72584.1|2309972_2310326_-	hypothetical protein	NA	NA	NA	NA	NA
AWX72585.1|2310371_2310743_-	hypothetical protein	NA	Q5YA89	Bacillus_phage	33.6	9.6e-07
AWX74513.1|2310769_2311075_-	hypothetical protein	NA	NA	NA	NA	NA
AWX72586.1|2311120_2311468_-	hypothetical protein	NA	O64164	Bacillus_phage	88.7	5.9e-51
AWX72587.1|2311482_2311887_-	hypothetical protein	NA	A0A1P8CX27	Bacillus_phage	61.9	3.4e-34
AWX72588.1|2311887_2312340_-	hypothetical protein	NA	NA	NA	NA	NA
AWX72589.1|2312357_2312537_-	hypothetical protein	NA	NA	NA	NA	NA
AWX72590.1|2312569_2313043_-	hypothetical protein	NA	O64162	Bacillus_phage	66.9	1.6e-59
AWX72591.1|2313361_2313547_-	hypothetical protein	NA	A0A1P8CX22	Bacillus_phage	66.7	3.2e-19
AWX72592.1|2313840_2314599_-	hypothetical protein	NA	NA	NA	NA	NA
AWX72593.1|2314783_2314981_-	hypothetical protein	NA	NA	NA	NA	NA
AWX72594.1|2314995_2315223_-	hypothetical protein	NA	O64157	Bacillus_phage	80.0	9.3e-29
AWX72595.1|2315260_2315479_-	hypothetical protein	NA	O64155	Bacillus_phage	55.7	2.3e-13
AWX72596.1|2315529_2317008_-	nicotinate phosphoribosyltransferase	NA	A0A218KC49	Bacillus_phage	65.1	5.6e-191
AWX72597.1|2317054_2317888_-	ribose-phosphate pyrophosphokinase	NA	A0A218KC69	Bacillus_phage	54.7	1.5e-76
AWX72598.1|2317932_2318430_-	hypothetical protein	NA	A0A1P8CX28	Bacillus_phage	79.9	8.2e-70
AWX72599.1|2318589_2318793_-	hypothetical protein	NA	O64150	Bacillus_phage	79.1	2.3e-26
AWX72600.1|2318804_2319512_-	hypothetical protein	NA	O64147	Bacillus_phage	34.0	3.9e-25
AWX72601.1|2319538_2323468_-	DNA polymerase III subunit alpha	NA	A0A1P8CX14	Bacillus_phage	84.9	0.0e+00
AWX72602.1|2323480_2325208_-	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1P8CX07	Bacillus_phage	80.6	6.8e-273
AWX72603.1|2325207_2326344_-	hypothetical protein	NA	A0A1P8CX05	Bacillus_phage	89.7	1.1e-205
AWX72604.1|2326359_2327874_-	hypothetical protein	NA	A0A1P8CWZ7	Bacillus_phage	95.0	2.9e-275
AWX72605.1|2327888_2328359_-	hypothetical protein	NA	A0A1P8CX08	Bacillus_phage	91.0	4.4e-81
AWX72606.1|2328400_2329372_-	hypothetical protein	NA	A0A1P8CX29	Bacillus_phage	95.7	5.9e-173
AWX72607.1|2329460_2330375_-	hypothetical protein	NA	O64140	Bacillus_phage	89.8	3.1e-155
AWX72608.1|2330397_2330778_-	hypothetical protein	NA	A0A1P8CX10	Bacillus_phage	79.2	6.3e-54
2330837:2330861	attL	TCAATAACTATTTTATTTTTATTCT	NA	NA	NA	NA
AWX72609.1|2331307_2331685_-	hypothetical protein	NA	A0A1P8CX06	Bacillus_phage	76.2	9.9e-52
AWX74514.1|2331757_2331994_+	hypothetical protein	NA	NA	NA	NA	NA
AWX72610.1|2332024_2332549_-	hypothetical protein	NA	NA	NA	NA	NA
AWX72611.1|2332661_2334404_-	right-handed parallel beta-helix repeat-containing protein	NA	O64135	Bacillus_phage	68.6	7.2e-222
AWX72612.1|2334400_2335225_-	hypothetical protein	NA	O64134	Bacillus_phage	62.7	1.0e-88
AWX72613.1|2335398_2335839_-	hypothetical protein	NA	A0A1S5SCZ9	Streptococcus_phage	35.6	2.4e-12
AWX72614.1|2335844_2336051_-	hypothetical protein	NA	A0A1P8CWZ9	Bacillus_phage	77.1	1.6e-11
AWX72615.1|2336025_2336292_-	hypothetical protein	NA	O64132	Bacillus_phage	89.9	4.9e-29
AWX72616.1|2336364_2337039_+	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	96.5	2.5e-77
AWX72617.1|2337108_2337921_+	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	87.8	3.6e-139
AWX72618.1|2338445_2338949_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	D2XR49	Bacillus_phage	52.1	4.6e-36
AWX72619.1|2338989_2339298_-	hypothetical protein	NA	NA	NA	NA	NA
AWX72620.1|2339309_2339834_-	hypothetical protein	NA	A0A1Z1DA37	Bacillus_phage	56.1	4.6e-47
AWX72621.1|2340202_2340577_+	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	61.8	1.4e-34
AWX72622.1|2340590_2340806_-	hypothetical protein	NA	A0A1P8CX01	Bacillus_phage	97.2	1.1e-31
AWX72623.1|2341008_2341626_-	hypothetical protein	NA	NA	NA	NA	NA
AWX72624.1|2341952_2342228_-	hypothetical protein	NA	NA	NA	NA	NA
AWX72625.1|2342271_2342595_-	hypothetical protein	NA	A0A1P8CWY4	Bacillus_phage	95.2	6.5e-52
AWX72626.1|2342642_2344841_-	phosphatase	NA	Q4Z932	Staphylococcus_phage	43.1	1.4e-158
AWX74515.1|2344889_2345297_-	hypothetical protein	NA	A0A1P8CWY3	Bacillus_phage	91.9	1.1e-67
AWX72627.1|2345469_2345673_-	hypothetical protein	NA	NA	NA	NA	NA
AWX72628.1|2345669_2346092_-	hypothetical protein	NA	NA	NA	NA	NA
AWX72629.1|2346125_2346350_-	hypothetical protein	NA	A0A1P8CWW8	Bacillus_phage	53.2	5.2e-16
AWX72630.1|2346457_2346703_-	hypothetical protein	NA	A0A1P8CWW5	Bacillus_phage	52.0	5.7e-16
AWX72631.1|2346777_2347077_-	hypothetical protein	NA	A0A1P8CWX3	Bacillus_phage	50.0	1.0e-19
AWX72632.1|2347242_2347464_+	XRE family transcriptional regulator	NA	A0A1P8CWW6	Bacillus_phage	79.5	2.2e-27
AWX72633.1|2347684_2348668_-|integrase	integrase	integrase	A0A1P8CWX4	Bacillus_phage	78.0	1.9e-139
AWX72634.1|2348688_2350038_-	hypothetical protein	NA	A0A1P8CWX1	Bacillus_phage	75.2	4.8e-189
AWX72635.1|2350114_2351173_-|integrase	integrase	integrase	A0A1P8CWW9	Bacillus_phage	76.0	1.8e-154
AWX72636.1|2351385_2351616_-	hypothetical protein	NA	A0A1P8CWW1	Bacillus_phage	72.3	5.5e-21
AWX72637.1|2351630_2351843_-	hypothetical protein	NA	A0A1P8CWW7	Bacillus_phage	78.5	1.6e-22
AWX72638.1|2352437_2353583_-	hypothetical protein	NA	NA	NA	NA	NA
AWX72639.1|2353738_2354830_-	hypothetical protein	NA	A0A1P8CWW3	Bacillus_phage	25.7	6.9e-13
AWX72640.1|2355253_2355385_-	hypothetical protein	NA	A0A1P8CWV9	Bacillus_phage	90.7	9.4e-18
AWX72641.1|2355396_2355612_-	hypothetical protein	NA	A0A1P8CWW0	Bacillus_phage	52.1	1.1e-12
AWX72642.1|2355614_2355866_-	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	63.4	5.4e-22
AWX72643.1|2355936_2356119_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	89.7	1.0e-25
AWX72644.1|2356133_2356358_-	hypothetical protein	NA	NA	NA	NA	NA
AWX72645.1|2356388_2356616_-	hypothetical protein	NA	NA	NA	NA	NA
AWX72646.1|2356658_2357210_-	hypothetical protein	NA	NA	NA	NA	NA
AWX72647.1|2357312_2357690_-	hypothetical protein	NA	NA	NA	NA	NA
AWX72648.1|2357721_2357913_-	hypothetical protein	NA	NA	NA	NA	NA
AWX74516.1|2358024_2358240_-	hypothetical protein	NA	NA	NA	NA	NA
AWX72649.1|2358318_2358546_-	XRE family transcriptional regulator	NA	O64085	Bacillus_phage	40.8	4.8e-09
AWX72650.1|2358593_2358806_-	XRE family transcriptional regulator	NA	A0A1P8CWU2	Bacillus_phage	73.9	1.2e-22
AWX72651.1|2358899_2359337_-	hypothetical protein	NA	NA	NA	NA	NA
AWX72652.1|2359416_2359689_-	hypothetical protein	NA	NA	NA	NA	NA
AWX72653.1|2360169_2361261_+	acyltransferase	NA	NA	NA	NA	NA
AWX72654.1|2361628_2362546_-	restriction endonuclease	NA	A0A1P8CWV0	Bacillus_phage	83.2	5.8e-138
2364171:2364195	attR	TCAATAACTATTTTATTTTTATTCT	NA	NA	NA	NA
>prophage 8
CP030150	Bacillus velezensis strain DSYZ chromosome, complete genome	4258978	2371063	2383592	4258978		Bacillus_phage(60.0%)	13	NA	NA
AWX72662.1|2371063_2372176_-	cell division protein FtsZ	NA	G3MBK4	Bacillus_virus	29.8	2.2e-30
AWX72663.1|2372175_2372460_-	hypothetical protein	NA	NA	NA	NA	NA
AWX72664.1|2372638_2372875_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWX72665.1|2372994_2373174_+	hypothetical protein	NA	A0A1P8CWT4	Bacillus_phage	71.2	1.5e-18
AWX72666.1|2373214_2375740_+	hypothetical protein	NA	O64076	Bacillus_phage	84.6	0.0e+00
AWX72667.1|2375993_2376269_+	HU family DNA-binding protein	NA	A0A1P8CWT5	Bacillus_phage	95.6	9.2e-39
AWX72668.1|2376863_2377154_+	hypothetical protein	NA	NA	NA	NA	NA
AWX72669.1|2377207_2377870_+	hypothetical protein	NA	K7PJU1	Enterobacteria_phage	39.9	5.5e-29
AWX72670.1|2378147_2378339_+	hypothetical protein	NA	A0A1P8CWT3	Bacillus_phage	98.4	5.6e-27
AWX72671.1|2378351_2379569_+	hypothetical protein	NA	A0A1P8CWS1	Bacillus_phage	99.5	3.3e-229
AWX72672.1|2380202_2380733_+	hypothetical protein	NA	U5J9P3	Bacillus_phage	32.8	5.7e-13
AWX72673.1|2380836_2381844_+	hypothetical protein	NA	Q331V7	Clostridium_botulinum_C_phage	24.2	1.6e-08
AWX72674.1|2381843_2383592_+	hypothetical protein	NA	A0A0K2FLD6	Brevibacillus_phage	30.8	8.7e-66
>prophage 9
CP030150	Bacillus velezensis strain DSYZ chromosome, complete genome	4258978	2388896	2436296	4258978	coat,holin,integrase,tail	Bacillus_phage(85.19%)	46	2386918:2386933	2436295:2436310
2386918:2386933	attL	ATGCTAAATCCCCTCT	NA	NA	NA	NA
AWX72681.1|2388896_2389562_+	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	50.0	5.3e-48
AWX72682.1|2389558_2390065_+	hypothetical protein	NA	O64060	Bacillus_phage	69.0	2.3e-64
AWX72683.1|2390061_2390787_+	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	33.2	1.9e-27
AWX72684.1|2390825_2391617_+	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	37.5	1.8e-18
AWX72685.1|2391637_2392105_+	hypothetical protein	NA	NA	NA	NA	NA
AWX72686.1|2392176_2392533_+	hypothetical protein	NA	O64055	Bacillus_phage	79.7	8.2e-48
AWX72687.1|2392532_2393864_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	53.5	5.0e-21
AWX72688.1|2393877_2394153_+	hypothetical protein	NA	M4ZR44	Bacillus_phage	37.2	4.0e-10
AWX72689.1|2394153_2394306_+	XkdX family protein	NA	NA	NA	NA	NA
AWX72690.1|2394324_2395173_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
AWX72691.1|2395255_2395741_+	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	68.4	9.5e-55
AWX72692.1|2395740_2396157_+	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	66.9	1.4e-46
AWX72693.1|2396170_2397190_+|integrase	integrase	integrase	A0A0E3U2P3	Fusobacterium_phage	35.8	3.0e-50
AWX72694.1|2397810_2398347_+	hypothetical protein	NA	NA	NA	NA	NA
AWX72695.1|2398422_2398851_+	hypothetical protein	NA	O64047	Bacillus_phage	37.4	1.4e-14
AWX72696.1|2398936_2399563_+	hypothetical protein	NA	A0A0H3UZD5	Geobacillus_virus	31.7	2.1e-22
AWX72697.1|2399626_2406505_+|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	78.8	0.0e+00
AWX72698.1|2406562_2407321_+|tail	phage tail protein	tail	O64045	Bacillus_phage	84.1	1.9e-126
AWX72699.1|2410635_2411454_+	hypothetical protein	NA	A0A1P8CWP7	Bacillus_phage	70.5	3.5e-110
AWX72700.1|2411495_2414021_+	hypothetical protein	NA	D6R401	Bacillus_phage	38.3	2.1e-145
AWX72701.1|2414193_2415237_+	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A1J0MS59	Bacillus_phage	56.1	6.1e-91
AWX74517.1|2415343_2415715_+	hypothetical protein	NA	NA	NA	NA	NA
AWX72702.1|2415727_2415979_+|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	86.7	5.2e-33
AWX72703.1|2416039_2416321_+	hypothetical protein	NA	NA	NA	NA	NA
AWX74518.1|2416335_2416596_+	hypothetical protein	NA	NA	NA	NA	NA
AWX72704.1|2416747_2417908_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	26.3	3.8e-33
AWX72705.1|2418071_2419322_-	UV damage repair protein UvrX	NA	O64031	Bacillus_phage	91.1	1.5e-221
AWX72706.1|2419314_2419647_-	YolD-like family protein	NA	A0A1P8CWP2	Bacillus_phage	74.5	6.3e-42
AWX72707.1|2419874_2420648_-	sporulation protein YunB	NA	NA	NA	NA	NA
AWX72708.1|2420776_2420980_-	hypothetical protein	NA	NA	NA	NA	NA
AWX72709.1|2421223_2421313_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
AWX74519.1|2421609_2422083_-	SMI1/KNR4 family protein	NA	A0A1P8CWM6	Bacillus_phage	65.8	2.5e-60
AWX72710.1|2422184_2422673_-	DUF600 family protein	NA	NA	NA	NA	NA
AWX72711.1|2422662_2423151_-	SMI1/KNR4 family protein	NA	O64024	Bacillus_phage	89.4	5.2e-85
AWX72712.1|2423159_2424875_-	hypothetical protein	NA	O64023	Bacillus_phage	77.1	5.4e-254
AWX72713.1|2425051_2426032_+	endonuclease	NA	A0A1P8CWK6	Bacillus_phage	76.8	3.5e-80
AWX72714.1|2426281_2427823_+	recombinase family protein	NA	I3VYZ3	Thermoanaerobacterium_phage	32.1	6.3e-36
AWX72715.1|2428237_2428822_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
AWX72716.1|2429156_2430659_-	carboxypeptidase M32	NA	NA	NA	NA	NA
AWX72717.1|2430770_2432690_-	ATP-dependent DNA helicase	NA	A0A2P1N0K5	Streptomyces_phage	21.8	1.8e-11
AWX72718.1|2432793_2432985_-	hypothetical protein	NA	NA	NA	NA	NA
AWX72719.1|2433150_2433303_+	YpzG family protein	NA	NA	NA	NA	NA
AWX72720.1|2433343_2434510_-	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
AWX72721.1|2435043_2435343_-	cell division regulator GpsB	NA	NA	NA	NA	NA
AWX72722.1|2435422_2435971_-	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
AWX72723.1|2436059_2436296_-|coat	spore coat protein	coat	NA	NA	NA	NA
2436295:2436310	attR	ATGCTAAATCCCCTCT	NA	NA	NA	NA
>prophage 10
CP030150	Bacillus velezensis strain DSYZ chromosome, complete genome	4258978	2527857	2534110	4258978		Staphylococcus_phage(66.67%)	10	NA	NA
AWX72817.1|2527857_2528451_-	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.6	2.6e-14
AWX72818.1|2528440_2529196_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.7	2.9e-10
AWX72819.1|2529403_2529493_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
AWX72820.1|2529580_2530102_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
AWX72821.1|2530046_2530262_+	hypothetical protein	NA	NA	NA	NA	NA
AWX72822.1|2530167_2530542_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWX72823.1|2530658_2531123_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.3	1.2e-43
AWX72824.1|2531155_2532352_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	9.6e-117
AWX72825.1|2532366_2533014_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	2.6e-39
AWX72826.1|2532994_2534110_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.6	1.7e-54
>prophage 11
CP030150	Bacillus velezensis strain DSYZ chromosome, complete genome	4258978	3201226	3224872	4258978	transposase,coat,portal,tail	Bacillus_phage(62.5%)	22	NA	NA
AWX73447.1|3201226_3208105_-|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	56.1	0.0e+00
AWX73448.1|3208182_3208521_-	hypothetical protein	NA	NA	NA	NA	NA
AWX73449.1|3208531_3208849_-	hypothetical protein	NA	NA	NA	NA	NA
AWX73450.1|3209056_3209875_-|coat	P22 coat protein - protein 5 domain protein	coat	E5DV53	Deep-sea_thermophilic_phage	43.3	3.8e-56
AWX73451.1|3209903_3210503_-	DUF4355 domain-containing protein	NA	A0A2H4J4P4	uncultured_Caudovirales_phage	44.5	4.0e-31
AWX73452.1|3210610_3211945_-|portal	phage portal protein	portal	I1TJV4	Clostridium_phage	31.1	2.3e-42
AWX73453.1|3211959_3213717_-	hypothetical protein	NA	A0A1V0DZW7	Clostridioides_phage	46.5	3.5e-147
AWX73454.1|3214069_3214633_+	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	50.5	3.7e-42
AWX73455.1|3214649_3215057_-|transposase	transposase	transposase	NA	NA	NA	NA
AWX73456.1|3215139_3215352_-	DNA-binding protein	NA	A0A1Z1LZP5	Bacillus_phage	51.6	4.5e-09
AWX73457.1|3215344_3215527_-	hypothetical protein	NA	NA	NA	NA	NA
AWX73458.1|3215928_3216402_-	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	38.7	2.9e-24
AWX73459.1|3216398_3216569_-	XkdX family protein	NA	A0A1W6JQ64	Staphylococcus_phage	53.5	6.3e-06
AWX73460.1|3216569_3216953_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	69.2	2.9e-38
AWX73461.1|3216949_3217978_-	hypothetical protein	NA	Q9ZXE1	Bacillus_phage	82.7	2.5e-60
AWX73462.1|3218009_3218237_-	hypothetical protein	NA	NA	NA	NA	NA
AWX73463.1|3218236_3218824_-	hypothetical protein	NA	A0A1P8CWQ5	Bacillus_phage	47.8	9.7e-38
AWX73464.1|3218832_3219618_-	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	48.4	1.1e-36
AWX73465.1|3219641_3220355_-	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	42.4	5.7e-48
AWX73466.1|3220354_3220831_-	hypothetical protein	NA	O64060	Bacillus_phage	45.5	1.7e-32
AWX73467.1|3221419_3221638_-	transcriptional regulator	NA	NA	NA	NA	NA
AWX73468.1|3221965_3224872_-	hypothetical protein	NA	O64076	Bacillus_phage	45.8	4.9e-223
>prophage 12
CP030150	Bacillus velezensis strain DSYZ chromosome, complete genome	4258978	3919232	3964347	4258978	coat,protease	Cafeteria_roenbergensis_virus(11.11%)	47	NA	NA
AWX74112.1|3919232_3919892_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
AWX74113.1|3919997_3920186_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
AWX74114.1|3920223_3920643_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWX74115.1|3921028_3922408_+	amino acid permease	NA	NA	NA	NA	NA
AWX74116.1|3922473_3922974_-	YwgA family protein	NA	NA	NA	NA	NA
AWX74117.1|3923013_3924315_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	29.5	1.0e-23
AWX74118.1|3924474_3924699_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
AWX74119.1|3924901_3925675_+	RsfA family transcriptional regulator	NA	NA	NA	NA	NA
AWX74120.1|3925974_3926250_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AWX74121.1|3926250_3926805_+	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
AWX74122.1|3926902_3927823_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.6	1.3e-36
AWX74123.1|3927819_3928773_+	ABC transporter permease	NA	NA	NA	NA	NA
AWX74124.1|3928762_3929599_-	hypothetical protein	NA	NA	NA	NA	NA
AWX74125.1|3929589_3930387_-	hypothetical protein	NA	NA	NA	NA	NA
AWX74126.1|3930355_3931279_-	hypothetical protein	NA	NA	NA	NA	NA
AWX74127.1|3931327_3931507_-	hypothetical protein	NA	NA	NA	NA	NA
AWX74128.1|3931660_3932524_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
AWX74129.1|3932570_3933470_-	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	40.2	2.1e-07
AWX74130.1|3933585_3934563_+	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
AWX74131.1|3934600_3935572_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
AWX74132.1|3935833_3936598_+	heme-binding protein	NA	NA	NA	NA	NA
AWX74133.1|3936717_3937497_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AWX74134.1|3937513_3938713_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AWX74135.1|3938725_3939907_-	MFS transporter	NA	NA	NA	NA	NA
AWX74136.1|3939903_3941322_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
AWX74137.1|3941339_3942101_-	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.1	4.8e-21
AWX74138.1|3942097_3942808_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AWX74139.1|3942797_3943412_-	bacilysin biosynthesis protein BacA	NA	NA	NA	NA	NA
AWX74140.1|3943573_3944812_-	MFS transporter	NA	NA	NA	NA	NA
AWX74141.1|3945034_3946237_+	MFS transporter	NA	S4TR35	Salmonella_phage	25.9	1.2e-26
AWX74142.1|3946269_3947688_-	amino acid permease	NA	NA	NA	NA	NA
AWX74143.1|3947712_3949395_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
AWX74144.1|3949466_3951014_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AWX74145.1|3951221_3952508_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
AWX74146.1|3952692_3953154_-	hypothetical protein	NA	NA	NA	NA	NA
AWX74147.1|3953369_3953825_-|coat	spore coat protein	coat	NA	NA	NA	NA
AWX74148.1|3953821_3954670_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.3	5.4e-37
AWX74149.1|3954690_3955638_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	42.9	5.9e-69
AWX74150.1|3955640_3956378_-	glucose-1-phosphate thymidylyltransferase	NA	G3MA50	Bacillus_virus	42.7	5.0e-47
AWX74151.1|3956405_3957410_-|coat	spore coat protein	coat	NA	NA	NA	NA
AWX74152.1|3957411_3958155_-|coat	spore coat protein	coat	NA	NA	NA	NA
AWX74153.1|3958144_3959266_-|coat	spore coat protein	coat	NA	NA	NA	NA
AWX74154.1|3959265_3960129_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWX74155.1|3960129_3961299_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
AWX74156.1|3961321_3962746_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
AWX74157.1|3962750_3963521_-	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	26.3	4.4e-06
AWX74158.1|3963801_3964347_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
