The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP030171	Klebsiella quasipneumoniae subsp. quasipneumoniae strain A708 chromosome, complete genome	5542544	1236951	1298678	5542544	portal,capsid,plate,holin,integrase,lysis,tRNA,terminase,tail,head	Escherichia_phage(27.66%)	67	1265867:1265882	1283063:1283078
AWX86251.1|1236951_1237719_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AWX86252.1|1237758_1238106_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AWX86253.1|1238265_1238484_-	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	84.7	7.8e-33
AWX86254.1|1238565_1239726_-	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	81.5	5.2e-176
AWX86255.1|1239725_1240205_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	78.3	4.8e-67
AWX86256.1|1240218_1242660_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	71.8	1.0e-290
AWX86257.1|1242652_1242790_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	91.1	2.2e-17
AWX86258.1|1242804_1243080_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	77.3	2.4e-31
AWX86259.1|1243140_1243656_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.6	3.2e-69
AWX86260.1|1243669_1244851_-|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	86.6	7.9e-196
AWX86261.1|1244960_1246121_-|tail	phage tail protein	tail	S4TP62	Salmonella_phage	50.7	5.1e-46
AWX86262.1|1246200_1246467_-	hypothetical protein	NA	A0A2H5BN44	Klebsiella_phage	81.8	6.2e-32
AWX86263.1|1246468_1248526_-	hypothetical protein	NA	A0A2H5BN52	Klebsiella_phage	90.0	2.6e-311
AWX86264.1|1248530_1249127_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	53.5	4.7e-48
AWX86265.1|1249119_1250028_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	71.5	2.6e-114
AWX86266.1|1250032_1250380_-|plate	baseplate assembly protein	plate	Q7Y4D7	Escherichia_virus	77.4	4.9e-45
AWX86267.1|1250376_1251012_-|plate	phage baseplate assembly protein V	plate	M1SV78	Escherichia_phage	83.9	6.9e-98
AWX86268.1|1251080_1251530_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	68.0	4.2e-49
AWX86269.1|1251522_1251990_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	74.8	8.2e-64
AWX86270.1|1252085_1252517_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	64.7	1.5e-40
AWX86271.1|1252513_1253011_-	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	86.7	1.3e-80
AWX86272.1|1252997_1253288_-|holin	holin	holin	A0A0M5M1H1	Salmonella_phage	79.6	5.0e-35
AWX86273.1|1253292_1253496_-|tail	phage tail protein	tail	S4TTA0	Salmonella_phage	79.1	9.5e-25
AWX86274.1|1253495_1254002_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	84.3	5.4e-61
AWX86275.1|1254098_1254842_-|terminase	terminase	terminase	Q94MJ2	Enterobacteria_phage	79.5	2.5e-99
AWX86276.1|1254845_1255904_-|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.8	4.9e-165
AWX86277.1|1255977_1256832_-|capsid	capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	81.3	1.3e-126
AWX86278.1|1256997_1258767_+	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	87.9	2.8e-306
AWX86279.1|1258766_1259810_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	82.4	6.8e-167
AWX86280.1|1260325_1260520_-	hypothetical protein	NA	S4TRZ0	Salmonella_phage	64.1	5.1e-12
AWX86281.1|1260518_1260950_+	hypothetical protein	NA	S4TUD6	Salmonella_phage	89.5	3.0e-68
AWX86282.1|1261022_1261253_-	DinI family protein	NA	A0A218M4I0	Erwinia_phage	77.6	2.7e-28
AWX86283.1|1261256_1261442_-	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	77.0	6.0e-18
AWX86284.1|1261563_1263789_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	91.0	0.0e+00
AWX86285.1|1263781_1264063_-	hypothetical protein	NA	A0A218M4I8	Erwinia_phage	90.3	1.4e-42
AWX86286.1|1264059_1264356_-	DUF3850 domain-containing protein	NA	A0A2D1GP44	Escherichia_phage	45.5	3.0e-11
AWX86287.1|1264356_1264578_-	TraR/DksA family transcriptional regulator	NA	A0A218M4I6	Erwinia_phage	86.3	5.3e-29
AWX86288.1|1264577_1264811_-	DUF2732 domain-containing protein	NA	Q6K1F6	Salmonella_virus	76.6	6.0e-23
AWX86289.1|1264874_1265162_-	hypothetical protein	NA	F1BUS4	Erwinia_phage	57.0	1.3e-24
AWX90110.1|1265242_1265443_-	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	82.0	1.9e-17
AWX86290.1|1265450_1265960_-	hypothetical protein	NA	Q6K1F8	Salmonella_virus	93.5	9.2e-85
1265867:1265882	attL	CTTTATCCGCCAGCTC	NA	NA	NA	NA
AWX86291.1|1265991_1266219_-	hypothetical protein	NA	NA	NA	NA	NA
AWX86292.1|1266343_1267201_+	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	56.0	4.0e-88
AWX86293.1|1267209_1267548_+	DUF2511 domain-containing protein	NA	A0A0M3ULF8	Salmonella_phage	63.4	1.7e-34
AWX86294.1|1267569_1268070_+	hypothetical protein	NA	A0A1D9C9Q4	Salinivibrio_phage	62.0	4.0e-48
AWX86295.1|1268153_1269185_+|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	86.7	1.3e-175
AWX86296.1|1269416_1269875_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
AWX86297.1|1269932_1271291_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
AWX86298.1|1271299_1271782_-	OmpA family protein	NA	NA	NA	NA	NA
AWX86299.1|1271795_1273019_-	diguanylate cyclase	NA	NA	NA	NA	NA
AWX86300.1|1273011_1273521_-	YfiR family protein	NA	NA	NA	NA	NA
AWX86301.1|1273863_1274934_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	3.7e-91
AWX86302.1|1274943_1276065_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AWX86303.1|1276127_1277000_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
AWX86304.1|1276996_1278157_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AWX86305.1|1278411_1278747_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AWX86306.1|1279018_1279756_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AWX86307.1|1279887_1280868_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AWX86308.1|1280864_1281596_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AWX86309.1|1281724_1284298_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
1283063:1283078	attR	GAGCTGGCGGATAAAG	NA	NA	NA	NA
AWX86310.1|1290366_1291665_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.7	1.4e-44
AWX86311.1|1291668_1291992_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
AWX86312.1|1292033_1293389_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AWX86313.1|1293509_1296161_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AWX86314.1|1296195_1296894_-	DTW domain-containing protein	NA	NA	NA	NA	NA
AWX86315.1|1296963_1297389_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
AWX86316.1|1297592_1298678_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 2
CP030171	Klebsiella quasipneumoniae subsp. quasipneumoniae strain A708 chromosome, complete genome	5542544	1470679	1568376	5542544	portal,transposase,plate,holin,integrase,protease,terminase,tRNA,tail	Klebsiella_phage(26.0%)	96	1499957:1499980	1545532:1545555
AWX86466.1|1470679_1472029_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AWX86467.1|1472025_1472715_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AWX86468.1|1472714_1474394_+	OmpA family protein	NA	NA	NA	NA	NA
AWX86469.1|1474396_1474888_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AWX86470.1|1476172_1478530_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
AWX86471.1|1479155_1479626_+	hypothetical protein	NA	NA	NA	NA	NA
AWX86472.1|1482556_1483357_+	hypothetical protein	NA	NA	NA	NA	NA
AWX86473.1|1483445_1484030_+	hypothetical protein	NA	NA	NA	NA	NA
AWX86474.1|1484581_1484845_+	PAAR domain-containing protein	NA	R9U4D0	Rhizobium_phage	50.0	1.2e-06
AWX86475.1|1484847_1486056_+	hypothetical protein	NA	NA	NA	NA	NA
AWX86476.1|1486048_1489420_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
AWX86477.1|1489439_1491047_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AWX86478.1|1491080_1492850_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AWX86479.1|1492813_1493896_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AWX86480.1|1493931_1494456_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AWX86481.1|1494460_1496932_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
AWX86482.1|1496932_1497817_+	glycine zipper family protein	NA	NA	NA	NA	NA
AWX86483.1|1498166_1498364_-	hypothetical protein	NA	NA	NA	NA	NA
1499957:1499980	attL	TATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
AWX86484.1|1500174_1501350_+|integrase	integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	86.1	1.9e-202
AWX86485.1|1501390_1502200_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
AWX86486.1|1502240_1502423_-	DNA-binding protein	NA	G3CFG7	Escherichia_phage	65.5	6.1e-15
AWX86487.1|1502430_1503096_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	66.7	6.7e-51
AWX86488.1|1503096_1503351_-	hypothetical protein	NA	NA	NA	NA	NA
AWX86489.1|1503343_1503568_-	hypothetical protein	NA	S4TVX5	Salmonella_phage	53.8	1.3e-14
AWX86490.1|1503564_1503693_-|integrase	integrase	integrase	NA	NA	NA	NA
AWX86491.1|1503882_1504743_-	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	52.7	2.6e-71
AWX86492.1|1504824_1505637_-	hypothetical protein	NA	NA	NA	NA	NA
AWX86493.1|1505680_1506040_-	hypothetical protein	NA	NA	NA	NA	NA
AWX86494.1|1506464_1506644_+	hypothetical protein	NA	S5FM78	Shigella_phage	66.1	1.7e-14
AWX86495.1|1507605_1508316_-	LexA family transcriptional regulator	NA	K7P8B2	Enterobacteria_phage	67.5	4.0e-86
AWX86496.1|1508423_1508618_+	Cro/Cl family transcriptional regulator	NA	K7PLQ6	Enterobacteria_phage	79.4	3.6e-21
AWX86497.1|1508695_1509211_+	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	63.4	5.2e-59
AWX86498.1|1509249_1509528_+	hypothetical protein	NA	NA	NA	NA	NA
AWX86499.1|1509689_1509965_+	hypothetical protein	NA	NA	NA	NA	NA
AWX86500.1|1509957_1511487_+	ATP-dependent helicase	NA	A0A286N2P9	Klebsiella_phage	66.7	3.3e-202
AWX86501.1|1511483_1512455_+	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	61.1	1.2e-109
AWX90119.1|1512424_1513069_+	NinG family protein	NA	A0A1W6JNX3	Morganella_phage	57.4	1.5e-39
AWX86502.1|1513065_1513710_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	68.2	2.0e-84
AWX86503.1|1513699_1514104_+	antitermination protein	NA	S5M7R9	Escherichia_phage	53.2	5.5e-32
AWX86504.1|1514283_1514475_+	TrmB family transcriptional regulator	NA	Q8SBE3	Shigella_phage	87.3	5.8e-24
AWX86505.1|1514625_1515678_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	80.4	4.6e-171
AWX86506.1|1515822_1516170_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	70.1	5.7e-38
AWX86507.1|1516172_1516712_+	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	99.4	6.7e-102
AWX86508.1|1516708_1517056_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.9	8.0e-40
AWX86509.1|1517052_1517328_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	47.2	2.7e-14
AWX86510.1|1517278_1517470_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	88.1	4.9e-23
AWX86511.1|1517501_1517702_+	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	68.3	9.3e-17
AWX86512.1|1517766_1518012_+	hypothetical protein	NA	A0A286N2R1	Klebsiella_phage	96.3	1.8e-33
AWX90120.1|1518237_1518498_+	hypothetical protein	NA	NA	NA	NA	NA
AWX86513.1|1518564_1518750_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	61.1	1.9e-11
AWX86514.1|1519070_1519562_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	84.0	6.4e-67
AWX86515.1|1519561_1521670_+|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	83.5	0.0e+00
AWX86516.1|1521666_1521882_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	77.1	1.3e-24
AWX86517.1|1521878_1523378_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.6	1.1e-247
AWX86518.1|1523322_1525338_+|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	85.4	0.0e+00
AWX86519.1|1525418_1525745_+	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	67.3	4.7e-34
AWX86520.1|1525737_1526031_+	ATP-binding protein	NA	NA	NA	NA	NA
AWX86521.1|1526020_1526572_+|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	67.9	5.3e-54
AWX86522.1|1526568_1526967_+|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	57.8	3.2e-40
AWX86523.1|1526974_1527457_+|tail	phage tail protein	tail	M9NYX0	Enterobacteria_phage	68.6	5.7e-60
AWX86524.1|1527499_1527895_+|tail	phage tail protein	tail	M9NZD7	Enterobacteria_phage	28.4	3.7e-09
AWX86525.1|1527915_1528233_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	51.5	1.4e-19
AWX86526.1|1529697_1530621_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.4	5.6e-173
AWX86527.1|1531975_1532449_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	63.5	3.9e-53
AWX86528.1|1532435_1532918_+	ArsR family transcriptional regulator	NA	A0A286S2B1	Klebsiella_phage	68.4	1.1e-55
AWX86529.1|1532925_1533312_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	50.8	4.7e-33
AWX86530.1|1533308_1536377_+	kinase	NA	A0A286S259	Klebsiella_phage	66.5	0.0e+00
AWX86531.1|1536454_1538206_+	GDSL family lipase	NA	A0A286S1P0	Klebsiella_phage	53.3	1.4e-23
AWX86532.1|1538208_1538967_+	hypothetical protein	NA	NA	NA	NA	NA
AWX90121.1|1539057_1542192_-	SGNH/GDSL hydrolase family protein	NA	A0A1I9SEN3	Klebsiella_phage	32.0	1.1e-103
AWX86533.1|1542304_1542853_+	DNA-invertase	NA	A0A286S1P7	Klebsiella_phage	95.1	3.2e-91
AWX86534.1|1543057_1543309_+	hypothetical protein	NA	NA	NA	NA	NA
AWX86535.1|1543308_1544793_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AWX86536.1|1544869_1545109_+	DNA polymerase V	NA	I6PD82	Cronobacter_phage	55.7	6.8e-22
AWX86537.1|1545065_1545437_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.9	9.2e-26
AWX86538.1|1545643_1546573_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	83.4	1.6e-135
1545532:1545555	attR	TATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
AWX86539.1|1546862_1547624_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AWX86540.1|1547681_1549010_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
AWX86541.1|1549377_1549662_+	DUF406 family protein	NA	NA	NA	NA	NA
AWX86542.1|1549819_1551130_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AWX86543.1|1551129_1553274_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
AWX86544.1|1553483_1553969_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
AWX86545.1|1553987_1554539_-	endonuclease SmrB	NA	NA	NA	NA	NA
AWX86546.1|1554706_1555639_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AWX86547.1|1555681_1556767_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.9	1.7e-88
AWX86548.1|1556769_1557594_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AWX86549.1|1557593_1558403_+	hypothetical protein	NA	NA	NA	NA	NA
AWX86550.1|1558402_1558951_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AWX86551.1|1558982_1559264_+	YfcL family protein	NA	NA	NA	NA	NA
AWX90122.1|1559423_1561412_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AWX86552.1|1561570_1562791_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
AWX86553.1|1563000_1564176_+	MFS transporter	NA	NA	NA	NA	NA
AWX86554.1|1564262_1565240_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
AWX90123.1|1565374_1566487_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.9	1.6e-20
AWX86555.1|1566550_1567564_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AWX86556.1|1567563_1568376_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 3
CP030171	Klebsiella quasipneumoniae subsp. quasipneumoniae strain A708 chromosome, complete genome	5542544	1829245	1839296	5542544		Enterobacteria_phage(28.57%)	8	NA	NA
AWX86772.1|1829245_1830652_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.5	8.0e-38
AWX86773.1|1830875_1831940_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	2.9e-104
AWX86774.1|1831966_1832836_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	66.3	3.7e-110
AWX86775.1|1832867_1833758_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.2	1.4e-27
AWX86776.1|1833772_1834327_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	5.0e-52
AWX86777.1|1834507_1835674_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.5	7.0e-112
AWX86778.1|1835997_1837002_+	acyltransferase	NA	NA	NA	NA	NA
AWX86779.1|1838291_1839296_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.2	1.8e-31
>prophage 4
CP030171	Klebsiella quasipneumoniae subsp. quasipneumoniae strain A708 chromosome, complete genome	5542544	2846519	2857402	5542544		Escherichia_phage(87.5%)	9	NA	NA
AWX87693.1|2846519_2849627_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.3	0.0e+00
AWX87694.1|2849681_2850947_+	MFS transporter	NA	NA	NA	NA	NA
AWX87695.1|2850976_2852065_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	96.7	5.0e-205
AWX90185.1|2852149_2852410_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
AWX87696.1|2852706_2853567_+	class A beta-lactamase	NA	A0A077SL40	Escherichia_phage	88.5	3.4e-140
AWX87697.1|2853586_2854348_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	99.2	2.1e-133
AWX87698.1|2854609_2855512_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	98.3	4.2e-157
AWX87699.1|2855523_2856789_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	92.4	1.2e-218
AWX87700.1|2856781_2857402_+	aldolase	NA	A0A077SK32	Escherichia_phage	94.7	5.9e-110
>prophage 5
CP030171	Klebsiella quasipneumoniae subsp. quasipneumoniae strain A708 chromosome, complete genome	5542544	3157354	3189137	5542544	integrase,transposase	Salmonella_phage(21.88%)	41	3161893:3161909	3189799:3189815
AWX87959.1|3157354_3157624_-	hypothetical protein	NA	A0A2H5BN44	Klebsiella_phage	86.5	3.0e-34
AWX87960.1|3159792_3162861_-	kinase	NA	A0A286S259	Klebsiella_phage	96.6	0.0e+00
3161893:3161909	attL	CCCCAGCGTCACCGGCA	NA	NA	NA	NA
AWX87961.1|3162857_3163238_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	95.2	1.2e-68
AWX87962.1|3163247_3163730_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	92.5	6.5e-80
AWX87963.1|3163910_3165185_-|transposase	IS481 family transposase	transposase	A0A286S298	Klebsiella_phage	71.4	4.0e-28
AWX87964.1|3165366_3165813_+	hypothetical protein	NA	NA	NA	NA	NA
AWX90200.1|3165718_3165976_-	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	100.0	1.3e-42
AWX87965.1|3166129_3166912_-	antitermination protein	NA	F1C595	Cronobacter_phage	78.7	3.2e-113
AWX87966.1|3166908_3167277_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	63.8	3.5e-41
AWX87967.1|3167273_3167570_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.8	2.3e-35
AWX87968.1|3167572_3167779_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	72.7	1.1e-23
AWX87969.1|3167778_3168378_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	79.4	1.3e-90
AWX90201.1|3168451_3168676_-	hypothetical protein	NA	NA	NA	NA	NA
AWX87970.1|3170047_3170347_-	hypothetical protein	NA	NA	NA	NA	NA
AWX87971.1|3170442_3170871_-	hypothetical protein	NA	NA	NA	NA	NA
AWX87972.1|3170874_3171096_-	hypothetical protein	NA	A9YWV3	Burkholderia_phage	49.4	1.3e-11
AWX87973.1|3171092_3171347_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	50.6	1.4e-09
AWX87974.1|3171339_3171543_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	84.8	1.3e-26
AWX87975.1|3171539_3172325_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.5	3.6e-64
AWX87976.1|3172317_3172653_-	hypothetical protein	NA	H6WRX9	Salmonella_phage	43.0	7.6e-11
AWX87977.1|3172645_3173359_-	Replication protein P	NA	A0A0M3ULE2	Salmonella_phage	58.4	9.0e-70
AWX87978.1|3173355_3174276_-	hypothetical protein	NA	K7PGZ0	Enterobacteria_phage	60.7	4.8e-92
AWX87979.1|3174627_3175164_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	67.8	7.0e-59
AWX87980.1|3175166_3175397_-	hypothetical protein	NA	H6WRX5	Salmonella_phage	45.3	2.1e-12
AWX87981.1|3175508_3175922_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AWX87982.1|3176109_3176208_+	hypothetical protein	NA	NA	NA	NA	NA
AWX87983.1|3176314_3176506_+	DUF1482 family protein	NA	NA	NA	NA	NA
AWX87984.1|3176514_3176670_+	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	71.2	2.0e-14
AWX87985.1|3176807_3179903_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	56.8	4.1e-292
AWX87986.1|3179915_3181004_+	enterohemolysin	NA	H6WRX0	Salmonella_phage	56.2	3.7e-107
AWX87987.1|3181038_3181383_+	hypothetical protein	NA	NA	NA	NA	NA
AWX87988.1|3181375_3181987_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	76.3	4.1e-39
AWX87989.1|3181983_3182292_+	hypothetical protein	NA	I6PD68	Cronobacter_phage	56.9	4.2e-24
AWX90202.1|3182299_3182539_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	70.1	8.0e-23
AWX87990.1|3182548_3182863_+	hypothetical protein	NA	K7PM28	Enterobacteria_phage	50.8	1.6e-10
AWX87991.1|3182759_3183947_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.2	2.4e-120
AWX87992.1|3184123_3185014_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
AWX87993.1|3185013_3186006_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
AWX87994.1|3186007_3186817_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	33.7	1.2e-14
AWX87995.1|3186846_3188346_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	33.6	2.5e-61
AWX87996.1|3188342_3189137_-	histidine/lysine/arginine/ornithine ABC transporter ATP-binding protein HisP	NA	G9BWD6	Planktothrix_phage	37.4	6.6e-29
3189799:3189815	attR	CCCCAGCGTCACCGGCA	NA	NA	NA	NA
>prophage 6
CP030171	Klebsiella quasipneumoniae subsp. quasipneumoniae strain A708 chromosome, complete genome	5542544	3313125	3325735	5542544	tail,tRNA	Enterobacteria_phage(62.5%)	16	NA	NA
AWX88111.1|3313125_3313626_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
AWX88112.1|3313743_3314190_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
AWX90209.1|3314173_3314965_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWX88113.1|3315066_3316251_+	cyanate MFS transporter	NA	NA	NA	NA	NA
AWX88114.1|3316282_3316975_-	hypothetical protein	NA	NA	NA	NA	NA
AWX88115.1|3317120_3317630_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
AWX90210.1|3317616_3317973_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AWX88116.1|3317962_3318202_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AWX88117.1|3318468_3318720_-	hypothetical protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
AWX88118.1|3318763_3319903_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	71.0	9.4e-146
AWX88119.1|3320057_3321230_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.7	1.0e-158
AWX88120.1|3321229_3321745_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	2.2e-57
AWX88121.1|3321790_3322108_+|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	54.8	1.0e-17
AWX90211.1|3322107_3322266_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	3.5e-11
AWX88122.1|3322252_3325228_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.7	1.8e-220
AWX88123.1|3325243_3325735_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.7	7.3e-55
>prophage 7
CP030171	Klebsiella quasipneumoniae subsp. quasipneumoniae strain A708 chromosome, complete genome	5542544	3329286	3361000	5542544	portal,capsid,transposase,plate,integrase,terminase,tail	Enterobacteria_phage(58.33%)	38	3318355:3318371	3357266:3357282
3318355:3318371	attL	CCCGACGGGGCTTTTTT	NA	NA	NA	NA
AWX88125.1|3329286_3330318_-|transposase	IS630-like element ISSpu2 family transposase	transposase	NA	NA	NA	NA
AWX88126.1|3330338_3331169_+	hypothetical protein	NA	NA	NA	NA	NA
AWX88127.1|3331388_3332486_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	29.0	3.2e-10
AWX88128.1|3332485_3332698_-	hypothetical protein	NA	NA	NA	NA	NA
AWX88129.1|3334795_3335719_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.4	5.6e-173
AWX88130.1|3336776_3337700_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	43.6	7.6e-53
AWX88131.1|3337701_3338052_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	60.4	3.6e-24
AWX88132.1|3338048_3338636_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	61.0	1.7e-61
AWX88133.1|3338632_3339268_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.4	1.0e-56
AWX88134.1|3339264_3339732_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	59.2	9.1e-47
AWX90212.1|3339913_3340243_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
AWX88135.1|3340254_3340800_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	44.1	1.3e-31
AWX88136.1|3340796_3341081_-|tail	phage tail protein	tail	NA	NA	NA	NA
AWX88137.1|3341071_3341272_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
AWX88138.1|3341271_3341787_-|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	49.4	4.1e-40
AWX88139.1|3341899_3342757_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	61.3	3.7e-70
AWX88140.1|3342806_3343841_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	8.1e-96
AWX88141.1|3343852_3344692_-|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.9	2.1e-94
AWX88142.1|3344848_3346576_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	68.1	1.5e-232
AWX88143.1|3346569_3347631_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.4	3.1e-143
AWX88144.1|3348218_3349562_-	hypothetical protein	NA	NA	NA	NA	NA
AWX88145.1|3352387_3353344_-	DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	53.3	3.9e-84
AWX90213.1|3353340_3353568_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	41.0	1.9e-05
AWX88146.1|3353576_3354143_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	32.1	3.6e-13
AWX88147.1|3354139_3354364_-	hypothetical protein	NA	NA	NA	NA	NA
AWX88148.1|3354432_3354705_-	hypothetical protein	NA	NA	NA	NA	NA
AWX88149.1|3354720_3355098_-	hypothetical protein	NA	NA	NA	NA	NA
AWX88150.1|3355113_3355332_-	DUF4761 domain-containing protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
AWX88151.1|3355352_3355631_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
AWX88152.1|3355751_3356051_+	XRE family transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	6.5e-38
AWX88153.1|3356166_3357150_+|integrase	integrase	integrase	Q83VS6	Escherichia_phage	80.1	4.9e-151
AWX88154.1|3357413_3358427_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	33.1	9.3e-12
3357266:3357282	attR	CCCGACGGGGCTTTTTT	NA	NA	NA	NA
AWX88155.1|3358484_3358586_+	hypothetical protein	NA	NA	NA	NA	NA
AWX90214.1|3358543_3358660_+	hypothetical protein	NA	NA	NA	NA	NA
AWX88156.1|3358778_3358904_+	hypothetical protein	NA	NA	NA	NA	NA
AWX88157.1|3358963_3359227_-	DUF2534 family protein	NA	NA	NA	NA	NA
AWX88158.1|3359357_3359996_-	leucine efflux protein	NA	NA	NA	NA	NA
AWX88159.1|3360085_3361000_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	49.6	1.2e-71
>prophage 8
CP030171	Klebsiella quasipneumoniae subsp. quasipneumoniae strain A708 chromosome, complete genome	5542544	3388126	3440369	5542544	portal,capsid,transposase,holin,integrase,terminase,tail,head	Klebsiella_phage(48.78%)	54	3381735:3381750	3448484:3448499
3381735:3381750	attL	CGGCGGGATCCCCGGC	NA	NA	NA	NA
AWX88188.1|3388126_3389191_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.2	2.7e-14
AWX88189.1|3389615_3391052_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	53.7	2.4e-98
AWX88190.1|3391113_3402330_-	hypothetical protein	NA	Q6UAW1	Klebsiella_phage	50.0	0.0e+00
AWX90215.1|3402392_3402986_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	75.6	2.2e-77
AWX88191.1|3403426_3404350_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	5.1e-166
AWX88192.1|3404482_3405193_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	89.8	9.4e-136
AWX88193.1|3405194_3405950_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.1	5.1e-124
AWX88194.1|3405946_3406285_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	2.4e-57
AWX88195.1|3406284_3409620_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	88.5	0.0e+00
AWX88196.1|3409619_3409838_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	90.5	5.4e-34
AWX88197.1|3409852_3410218_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
AWX88198.1|3410275_3410737_-|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
AWX88199.1|3410768_3411170_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	1.7e-62
AWX88200.1|3411166_3411556_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
AWX88201.1|3411536_3411875_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	90.2	2.8e-53
AWX88202.1|3411871_3412189_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
AWX88203.1|3412169_3412430_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	63.9	1.5e-22
AWX88204.1|3412488_3413775_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.0	9.8e-216
AWX88205.1|3413852_3414773_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
AWX88206.1|3414809_3416069_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	90.0	1.4e-222
AWX88207.1|3416068_3416248_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	3.1e-11
AWX88208.1|3416241_3417963_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.6	6.5e-191
AWX88209.1|3417962_3418397_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
AWX88210.1|3418646_3419078_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.3	1.8e-41
AWX88211.1|3419074_3419392_-	hypothetical protein	NA	NA	NA	NA	NA
AWX88212.1|3419343_3419706_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	81.7	3.4e-57
AWX88213.1|3419859_3420081_-	DNA gyrase subunit B	NA	NA	NA	NA	NA
AWX88214.1|3420187_3420376_-	hypothetical protein	NA	NA	NA	NA	NA
AWX88215.1|3421455_3421806_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	39.8	1.8e-10
AWX88216.1|3421802_3422300_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	85.8	1.9e-79
AWX88217.1|3422299_3422515_-|holin	holin	holin	A5LH82	Enterobacteria_phage	87.3	7.9e-30
AWX88218.1|3423938_3424541_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.1	2.4e-76
AWX88219.1|3424557_3425589_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	2.1e-96
AWX88220.1|3425588_3425792_-	hypothetical protein	NA	NA	NA	NA	NA
AWX88221.1|3425788_3426181_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	1.0e-11
AWX88222.1|3426221_3426512_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	6.1e-17
AWX88223.1|3426523_3426757_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	1.7e-25
AWX88224.1|3426924_3427146_+	hypothetical protein	NA	NA	NA	NA	NA
AWX88225.1|3427146_3428244_-	DNA (cytosine-5-)-methyltransferase	NA	A0A0R6PG08	Moraxella_phage	38.3	1.8e-53
AWX88226.1|3428236_3430348_-	hypothetical protein	NA	NA	NA	NA	NA
AWX88227.1|3430638_3431079_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AWX88228.1|3431092_3431557_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	70.9	1.2e-62
AWX90216.1|3431549_3432554_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	35.6	2.1e-32
AWX88229.1|3432613_3433168_-	hypothetical protein	NA	NA	NA	NA	NA
AWX88230.1|3433170_3433392_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	75.3	1.2e-28
AWX90217.1|3433662_3433917_+	hypothetical protein	NA	H6WRX4	Salmonella_phage	54.8	1.6e-13
AWX88231.1|3434190_3434370_+	hypothetical protein	NA	NA	NA	NA	NA
AWX88232.1|3434505_3434724_+	hypothetical protein	NA	NA	NA	NA	NA
AWX88233.1|3434733_3434928_+	DUF1482 family protein	NA	NA	NA	NA	NA
AWX88234.1|3434970_3435315_+	transcriptional regulator	NA	NA	NA	NA	NA
AWX88235.1|3435456_3437595_+	exonuclease	NA	S4TNL0	Salmonella_phage	43.1	2.1e-98
AWX90218.1|3437647_3437893_+	excisionase	NA	NA	NA	NA	NA
AWX88236.1|3437873_3439001_+|integrase	integrase	integrase	O21925	Phage_21	58.4	4.4e-119
AWX88237.1|3439118_3440369_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
3448484:3448499	attR	GCCGGGGATCCCGCCG	NA	NA	NA	NA
>prophage 9
CP030171	Klebsiella quasipneumoniae subsp. quasipneumoniae strain A708 chromosome, complete genome	5542544	3707800	3717261	5542544	protease,tRNA	Brazilian_cedratvirus(16.67%)	8	NA	NA
AWX88459.1|3707800_3709522_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	33.0	6.4e-13
AWX90233.1|3709561_3710263_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AWX88460.1|3710616_3710835_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AWX88461.1|3710957_3713237_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	6.2e-165
AWX88462.1|3713267_3713585_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AWX88463.1|3713910_3714132_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AWX88464.1|3714208_3716149_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	40.5	1.4e-37
AWX88465.1|3716145_3717261_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 10
CP030171	Klebsiella quasipneumoniae subsp. quasipneumoniae strain A708 chromosome, complete genome	5542544	4201220	4247334	5542544	holin,integrase,terminase,lysis,tRNA,tail,head	uncultured_Caudovirales_phage(28.3%)	64	4201019:4201065	4244404:4244450
4201019:4201065	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AWX88883.1|4201220_4201538_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.0	1.1e-22
AWX88884.1|4201537_4201777_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	51.9	3.6e-15
AWX88885.1|4202646_4204449_-	GDSL family lipase	NA	A0A286S1P0	Klebsiella_phage	43.5	2.6e-17
AWX88886.1|4204700_4205582_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	60.2	7.3e-29
AWX88887.1|4205581_4206355_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.1	1.1e-76
AWX88888.1|4206351_4207548_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.6	2.5e-157
AWX88889.1|4207547_4207901_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	79.5	8.7e-50
AWX88890.1|4207902_4208556_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	50.8	2.4e-61
AWX88891.1|4209181_4209532_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	41.6	5.5e-20
AWX88892.1|4209528_4210557_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.0	1.3e-98
AWX88893.1|4210559_4210862_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.6e-26
AWX88894.1|4210862_4211462_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	58.1	5.8e-54
AWX88895.1|4211461_4213387_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	71.3	7.3e-183
AWX90264.1|4213376_4213529_-	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	82.0	2.4e-17
AWX88896.1|4213570_4213990_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	66.7	1.0e-41
AWX88897.1|4213993_4214437_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.0	1.2e-61
AWX88898.1|4214446_4215592_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	77.4	2.2e-166
AWX88899.1|4215595_4216036_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
AWX88900.1|4216130_4216517_-|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	79.0	2.8e-49
AWX88901.1|4216516_4217023_-	hypothetical protein	NA	NA	NA	NA	NA
AWX88902.1|4217019_4217439_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	4.4e-40
AWX88903.1|4217407_4217689_-	hypothetical protein	NA	NA	NA	NA	NA
AWX88904.1|4217728_4218670_-	hypothetical protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	74.8	5.2e-134
AWX88905.1|4218681_4219176_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
AWX88906.1|4219179_4220382_-	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	54.6	9.1e-107
AWX88907.1|4220391_4220586_-	hypothetical protein	NA	NA	NA	NA	NA
AWX90265.1|4220631_4221180_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.9	1.0e-49
AWX88908.1|4221235_4222687_-	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	1.1e-191
AWX88909.1|4222924_4224325_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.1	1.2e-187
AWX88910.1|4224275_4225052_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	46.5	3.9e-10
AWX88911.1|4225260_4225728_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	72.3	4.1e-55
AWX90266.1|4225724_4226222_-	lysozyme	NA	K7P7Q3	Enterobacteria_phage	84.2	1.3e-78
AWX88912.1|4226199_4226469_-|holin	holin	holin	K7P6H9	Enterobacteria_phage	78.3	2.1e-32
AWX90267.1|4227381_4228071_-	antiterminator	NA	I6PDF8	Cronobacter_phage	55.4	8.1e-60
AWX88913.1|4228070_4228211_-	YlcG family protein	NA	NA	NA	NA	NA
AWX90268.1|4228851_4229448_-	hypothetical protein	NA	A0A0U2RT94	Escherichia_phage	54.3	9.5e-57
AWX88914.1|4229568_4229838_-	hypothetical protein	NA	H6WRY4	Salmonella_phage	83.0	2.4e-36
AWX88915.1|4229884_4230280_-	hypothetical protein	NA	A0A193GYM6	Enterobacter_phage	80.8	6.1e-52
AWX88916.1|4231276_4231504_-	hypothetical protein	NA	NA	NA	NA	NA
AWX88917.1|4232005_4232257_-	hypothetical protein	NA	NA	NA	NA	NA
AWX88918.1|4232253_4232724_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	56.5	2.3e-34
AWX88919.1|4232720_4233023_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWX88920.1|4233022_4234453_-	helicase DnaB	NA	Q9MCT4	Escherichia_phage	66.7	2.2e-184
AWX88921.1|4234442_4235342_-	DNA replication protein	NA	F1C5C3	Cronobacter_phage	54.5	7.8e-87
AWX88922.1|4235567_4235888_-	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	68.9	3.8e-36
AWX88923.1|4235927_4236149_-	helix-turn-helix domain-containing protein	NA	Q716D6	Shigella_phage	55.1	1.8e-13
AWX88924.1|4236251_4236947_+	phage repressor protein	NA	K7P7I4	Enterobacteria_phage	62.4	8.2e-76
AWX88925.1|4237760_4237976_+	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	47.1	8.2e-11
AWX88926.1|4238075_4238270_+	hypothetical protein	NA	NA	NA	NA	NA
AWX88927.1|4238358_4239330_+	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	89.1	1.4e-65
AWX88928.1|4239337_4239622_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	77.7	1.6e-38
AWX88929.1|4239638_4240385_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	67.7	5.3e-65
AWX88930.1|4240381_4241005_+	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	60.2	5.3e-58
AWX90269.1|4241033_4241561_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	60.4	9.3e-56
AWX88931.1|4241557_4242328_+	dcm methylase	NA	D5LH17	Escherichia_phage	51.6	5.5e-65
AWX88932.1|4242324_4242543_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	8.4e-11
AWX88933.1|4242544_4242763_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	58.6	1.9e-15
AWX88934.1|4242762_4243002_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	43.6	3.9e-09
AWX90270.1|4243014_4243350_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AWX90271.1|4243346_4244390_+|integrase	integrase	integrase	G8C7S0	Escherichia_phage	85.6	8.5e-178
AWX88935.1|4244459_4244684_-	hypothetical protein	NA	NA	NA	NA	NA
4244404:4244450	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AWX88936.1|4244822_4245689_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
AWX88937.1|4245690_4245903_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
AWX88938.1|4245948_4247334_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 11
CP030171	Klebsiella quasipneumoniae subsp. quasipneumoniae strain A708 chromosome, complete genome	5542544	4920748	4981330	5542544	integrase,tRNA,transposase	Enterobacteria_phage(40.0%)	46	4914158:4914174	4990151:4990167
4914158:4914174	attL	CCGGCAGCATCGCCACC	NA	NA	NA	NA
AWX89536.1|4920748_4921756_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AWX89537.1|4922061_4923129_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AWX89538.1|4923125_4925870_+	ABC transporter ATP-binding protein/permease	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	5.1e-20
AWX89539.1|4925869_4926994_+	hypothetical protein	NA	NA	NA	NA	NA
AWX89540.1|4927035_4927353_-	hypothetical protein	NA	NA	NA	NA	NA
AWX89541.1|4927675_4927873_-	DUF2574 family protein	NA	NA	NA	NA	NA
AWX89542.1|4933846_4934968_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AWX89543.1|4935021_4936464_-	Cu(+)/Ag(+) sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	27.6	5.4e-13
AWX89544.1|4936453_4937137_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.0	1.0e-30
AWX90303.1|4937309_4938695_+	copper transporter	NA	NA	NA	NA	NA
AWX89545.1|4938712_4939057_+	copper-binding protein	NA	NA	NA	NA	NA
AWX89546.1|4939101_4940367_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AWX89547.1|4940378_4943528_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.1	9.8e-60
AWX89548.1|4943600_4943948_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
AWX89549.1|4943957_4944491_-	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	59.6	8.2e-52
AWX89550.1|4944607_4945336_+	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	47.4	1.4e-46
AWX89551.1|4945567_4946002_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
AWX89552.1|4945998_4946718_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AWX89553.1|4946714_4947974_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AWX89554.1|4947975_4948698_+	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
AWX89555.1|4948694_4949915_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWX89556.1|4949911_4950397_+	DUF2878 domain-containing protein	NA	NA	NA	NA	NA
AWX89557.1|4950393_4950918_+	hypothetical protein	NA	NA	NA	NA	NA
AWX89558.1|4950914_4951466_+	DUF3833 domain-containing protein	NA	NA	NA	NA	NA
AWX89559.1|4951462_4952422_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
AWX89560.1|4952456_4952870_+	hypothetical protein	NA	NA	NA	NA	NA
AWX89561.1|4953095_4954478_-	carbohydrate porin	NA	NA	NA	NA	NA
AWX89562.1|4954808_4956128_-	xylose isomerase	NA	NA	NA	NA	NA
AWX89563.1|4956675_4957599_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.4	5.6e-173
AWX89564.1|4957635_4959060_+	MFS transporter	NA	NA	NA	NA	NA
AWX89565.1|4959118_4960798_+	glycoside hydrolase 43 family protein	NA	NA	NA	NA	NA
AWX89566.1|4960880_4961519_-	HNH endonuclease	NA	NA	NA	NA	NA
AWX89567.1|4961698_4962568_+	HNH endonuclease	NA	NA	NA	NA	NA
AWX89568.1|4963431_4964355_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.4	5.6e-173
AWX89569.1|4964421_4965542_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	89.6	3.5e-137
AWX89570.1|4966466_4967498_+|transposase	IS630-like element ISSpu2 family transposase	transposase	NA	NA	NA	NA
AWX89571.1|4967714_4969019_+	hypothetical protein	NA	NA	NA	NA	NA
AWX89572.1|4969062_4969584_-	hypothetical protein	NA	NA	NA	NA	NA
AWX89573.1|4969929_4973160_+	DEAD/DEAH box helicase	NA	Q6NDX2	Leptospira_phage	25.7	2.9e-14
AWX89574.1|4973201_4974125_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.4	5.6e-173
AWX89575.1|4974229_4974424_+	hypothetical protein	NA	NA	NA	NA	NA
AWX89576.1|4974510_4976133_+	SAM-dependent DNA methyltransferase	NA	J7I0U9	Acinetobacter_phage	29.7	8.1e-34
AWX89577.1|4976129_4977308_+	restriction endonuclease	NA	E3T4D5	Cafeteria_roenbergensis_virus	28.1	2.3e-14
AWX89578.1|4977304_4979095_+	hypothetical protein	NA	Q2P9X8	Enterobacteria_phage	29.4	2.6e-09
AWX89579.1|4979094_4979994_+	hypothetical protein	NA	NA	NA	NA	NA
AWX89580.1|4980076_4981330_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	39.4	7.6e-80
4990151:4990167	attR	GGTGGCGATGCTGCCGG	NA	NA	NA	NA
