The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP030173	Klebsiella variicola strain 13450 chromosome, complete genome	5511705	1220211	1226936	5511705		Enterobacteria_phage(100.0%)	9	NA	NA
AWX75883.1|1220211_1222545_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.8	0.0e+00
AWX75884.1|1222556_1222877_-	hypothetical protein	NA	NA	NA	NA	NA
AWX75885.1|1222873_1223134_-	hypothetical protein	NA	NA	NA	NA	NA
AWX75886.1|1223205_1223655_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	69.0	9.7e-46
AWX75887.1|1223647_1223947_-	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	67.4	1.7e-25
AWX75888.1|1223936_1224539_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	70.8	6.1e-43
AWX75889.1|1225372_1226110_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	60.1	3.8e-71
AWX75890.1|1226106_1226352_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	1.2e-18
AWX75891.1|1226369_1226936_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	8.2e-58
>prophage 2
CP030173	Klebsiella variicola strain 13450 chromosome, complete genome	5511705	1602917	1617343	5511705	holin,terminase,tail,head	Klebsiella_phage(42.86%)	23	NA	NA
AWX76219.1|1602917_1603376_+	hypothetical protein	NA	G8C7V8	Escherichia_phage	72.3	8.4e-45
AWX76220.1|1603362_1603644_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	72.0	2.9e-32
AWX76221.1|1603643_1604273_+	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	74.4	2.7e-86
AWX76222.1|1604275_1604551_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	50.6	4.1e-15
AWX76223.1|1604501_1604699_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	91.2	2.3e-23
AWX76224.1|1604787_1605129_+	hypothetical protein	NA	NA	NA	NA	NA
AWX76225.1|1605271_1605517_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	54.3	1.8e-14
AWX76226.1|1605594_1606134_+	hypothetical protein	NA	NA	NA	NA	NA
AWX79754.1|1606592_1608050_+	glycosyltransferase family 2 protein	NA	K7PKP3	Enterobacterial_phage	87.4	2.8e-259
AWX76227.1|1608211_1608799_+	hypothetical protein	NA	K7PGW6	Enterobacterial_phage	66.5	4.5e-75
AWX76228.1|1608791_1609160_+	HNH endonuclease	NA	S4TTG9	Salmonella_phage	79.8	1.8e-50
AWX76229.1|1609339_1609849_+|terminase	terminase small subunit	terminase	S4TNN3	Salmonella_phage	67.5	6.0e-52
AWX76230.1|1610608_1610935_+|head,tail	phage gp6-like head-tail connector protein	head,tail	S4TSQ3	Salmonella_phage	60.2	1.1e-27
AWX76231.1|1611006_1611219_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	60.0	1.5e-09
AWX76232.1|1611220_1611571_+|head,tail	head-tail adaptor protein	head,tail	A0A286S2A2	Klebsiella_phage	62.9	3.9e-34
AWX76233.1|1611563_1612049_+	hypothetical protein	NA	A0A0U3TGT7	Pseudomonas_phage	65.2	1.5e-52
AWX76234.1|1612045_1612408_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	77.7	3.7e-48
AWX76235.1|1612472_1612955_+|tail	phage tail protein	tail	Q9MCU9	Escherichia_phage	58.9	7.5e-52
AWX76236.1|1613134_1613665_+	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	89.7	7.3e-85
AWX76237.1|1613711_1614095_+|tail	phage tail protein	tail	A0A286S1N4	Klebsiella_phage	86.3	4.1e-53
AWX76238.1|1614097_1614361_+|tail	phage tail protein	tail	A0A286S1P2	Klebsiella_phage	89.7	7.9e-40
AWX76239.1|1614424_1614817_+	hypothetical protein	NA	A0A286S1N7	Klebsiella_phage	42.2	3.6e-20
AWX76240.1|1614886_1617343_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	87.9	0.0e+00
>prophage 3
CP030173	Klebsiella variicola strain 13450 chromosome, complete genome	5511705	1709113	1777154	5511705	head,lysis,portal,terminase,holin,plate,tRNA,tail,integrase,capsid	Escherichia_phage(40.48%)	66	1740597:1740620	1773083:1773106
AWX76316.1|1709113_1711147_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	24.4	7.8e-26
AWX76317.1|1711300_1712410_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
AWX76318.1|1712406_1712868_-	N-acetyltransferase	NA	NA	NA	NA	NA
AWX76319.1|1712842_1713160_-	nickel/cobalt homeostasis protein RcnB	NA	NA	NA	NA	NA
AWX76320.1|1713343_1714243_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWX76321.1|1714232_1715576_-	NCS2 family permease	NA	NA	NA	NA	NA
AWX76322.1|1715578_1717390_-	adenine deaminase	NA	NA	NA	NA	NA
AWX76323.1|1717513_1718437_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWX76324.1|1718519_1720496_-	alkyl/aryl-sulfatase	NA	A0A2P0VMX1	Tetraselmis_virus	45.1	4.4e-159
AWX76325.1|1720699_1721335_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AWX76326.1|1721402_1723379_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.0	1.1e-160
AWX76327.1|1723741_1724515_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
AWX76328.1|1724511_1725312_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AWX76329.1|1725459_1726512_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
AWX76330.1|1726593_1727535_-	cytochrome C biogenesis protein CcdA	NA	NA	NA	NA	NA
AWX76331.1|1727741_1729109_+	mannitol dehydrogenase family protein	NA	NA	NA	NA	NA
AWX76332.1|1729118_1730582_+	xylulokinase	NA	NA	NA	NA	NA
AWX76333.1|1730652_1731930_+	MFS transporter	NA	NA	NA	NA	NA
AWX76334.1|1731978_1732641_+	HAD family hydrolase	NA	NA	NA	NA	NA
AWX76335.1|1732938_1734093_+	enolase	NA	NA	NA	NA	NA
AWX76336.1|1734212_1735835_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWX76337.1|1735831_1736869_+	ABC transporter permease	NA	NA	NA	NA	NA
AWX76338.1|1736865_1737771_+	ABC transporter permease	NA	NA	NA	NA	NA
AWX79760.1|1737742_1738606_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.0	1.7e-09
AWX76339.1|1738616_1739390_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	1.0e-26
AWX79761.1|1739629_1740523_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	3.6e-15
1740597:1740620	attL	CAAAAAAATAAGCCCGCGTAAGGG	NA	NA	NA	NA
AWX76340.1|1740704_1741718_-|integrase	integrase	integrase	Q83VS6	Escherichia_phage	82.8	8.1e-165
AWX76341.1|1741832_1742132_-	XRE family transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	69.7	5.7e-34
AWX76342.1|1742254_1742530_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	85.7	4.0e-42
AWX76343.1|1742696_1743197_+	replication protein B	NA	M1SV55	Escherichia_phage	85.5	1.4e-80
AWX76344.1|1743261_1743477_+	DUF2732 family protein	NA	NA	NA	NA	NA
AWX76345.1|1743493_1743769_+	hypothetical protein	NA	S4TP00	Salmonella_phage	62.8	7.5e-25
AWX76346.1|1743758_1746062_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	73.7	0.0e+00
AWX76347.1|1746135_1747383_+	hypothetical protein	NA	NA	NA	NA	NA
AWX76348.1|1747369_1749184_+	ATP-binding protein	NA	NA	NA	NA	NA
AWX76349.1|1749518_1750562_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	81.8	7.5e-166
AWX76350.1|1750561_1752331_-	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	87.9	8.2e-306
AWX76351.1|1752496_1753351_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	80.3	9.6e-127
AWX76352.1|1753424_1754483_+|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.0	1.3e-162
AWX76353.1|1754486_1755230_+|terminase	terminase	terminase	Q94MJ2	Enterobacteria_phage	79.5	4.3e-99
AWX76354.1|1755326_1755833_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	82.8	2.7e-60
AWX76355.1|1755832_1756036_+|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	80.6	5.5e-25
AWX76356.1|1756040_1756331_+|holin	holin	holin	O80308	Escherichia_phage	83.7	2.0e-36
AWX76357.1|1756317_1756815_+	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	85.8	7.4e-79
AWX76358.1|1756811_1757243_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	66.2	2.1e-42
AWX76359.1|1757338_1757806_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	74.2	2.4e-63
AWX76360.1|1757798_1758254_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	66.0	5.2e-47
AWX76361.1|1758255_1759785_+	hypothetical protein	NA	NA	NA	NA	NA
AWX76362.1|1759873_1760515_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	76.5	1.8e-90
AWX76363.1|1760511_1760859_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	75.7	1.2e-43
AWX76364.1|1760863_1761772_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	71.5	4.9e-113
AWX76365.1|1761764_1762373_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	53.6	3.8e-53
AWX76366.1|1762369_1764415_+	hypothetical protein	NA	A0A159B7I7	Klebsiella_phage	56.9	2.0e-194
AWX76367.1|1764424_1765180_+	hypothetical protein	NA	A0A159B7L2	Klebsiella_phage	75.3	6.7e-108
AWX76368.1|1765222_1766293_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	44.7	5.2e-29
AWX76369.1|1766402_1767584_+|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	86.9	2.7e-196
AWX76370.1|1767597_1768113_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	76.7	8.5e-70
AWX76371.1|1768172_1768448_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	76.1	9.2e-31
AWX76372.1|1768480_1768600_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	89.7	2.6e-14
AWX76373.1|1768592_1771031_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	75.1	2.7e-307
AWX79762.1|1771042_1771522_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	77.1	2.0e-65
AWX76374.1|1771521_1772679_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	78.4	1.5e-170
AWX76375.1|1772763_1772985_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	72.6	2.9e-27
AWX76376.1|1773254_1774616_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.0e-207
1773083:1773106	attR	CAAAAAAATAAGCCCGCGTAAGGG	NA	NA	NA	NA
AWX76377.1|1774932_1775655_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AWX76378.1|1775651_1777154_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.6e-30
>prophage 4
CP030173	Klebsiella variicola strain 13450 chromosome, complete genome	5511705	2858621	2869501	5511705		Escherichia_phage(87.5%)	10	NA	NA
AWX77348.1|2858621_2861729_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.5	0.0e+00
AWX77349.1|2861783_2863049_+	MFS transporter	NA	NA	NA	NA	NA
AWX77350.1|2863077_2864166_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	98.3	1.1e-207
AWX77351.1|2864252_2864513_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	95.3	3.0e-39
AWX77352.1|2864807_2865668_+	class A beta-lactamase	NA	A0A077SL40	Escherichia_phage	96.2	3.3e-151
AWX77353.1|2865685_2866447_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AWX77354.1|2866437_2866671_+	hypothetical protein	NA	NA	NA	NA	NA
AWX77355.1|2866708_2867611_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	4.5e-159
AWX77356.1|2867622_2868888_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.0	1.9e-232
AWX77357.1|2868880_2869501_+	aldolase	NA	A0A077SK32	Escherichia_phage	99.0	1.2e-113
>prophage 5
CP030173	Klebsiella variicola strain 13450 chromosome, complete genome	5511705	3330516	3450632	5511705	head,portal,terminase,protease,holin,tRNA,tail,integrase,transposase,capsid	Klebsiella_phage(21.05%)	149	3357440:3357456	3451215:3451231
AWX77768.1|3330516_3331017_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
AWX77769.1|3331134_3331581_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
AWX79840.1|3331564_3332356_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWX77770.1|3332456_3333641_+	cyanate MFS transporter	NA	NA	NA	NA	NA
AWX77771.1|3333672_3334365_-	hypothetical protein	NA	NA	NA	NA	NA
AWX77772.1|3334510_3335020_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
AWX79841.1|3335006_3335363_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AWX77773.1|3335352_3335592_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AWX77774.1|3335893_3336907_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.9	3.2e-12
AWX77775.1|3336964_3337066_+	hypothetical protein	NA	NA	NA	NA	NA
AWX79842.1|3337023_3337140_+	hypothetical protein	NA	NA	NA	NA	NA
AWX77776.1|3337259_3337385_+	hypothetical protein	NA	NA	NA	NA	NA
AWX77777.1|3337444_3337708_-	DUF2534 family protein	NA	NA	NA	NA	NA
AWX77778.1|3337838_3338477_-	leucine efflux protein	NA	NA	NA	NA	NA
AWX77779.1|3338566_3339481_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.0	3.2e-72
AWX77780.1|3340137_3341181_-	type II asparaginase	NA	NA	NA	NA	NA
AWX77781.1|3341489_3342698_+	HD domain-containing protein	NA	NA	NA	NA	NA
AWX77782.1|3342771_3344556_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
AWX77783.1|3344562_3345453_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWX77784.1|3345573_3347076_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
AWX77785.1|3347151_3347562_-	hypothetical protein	NA	NA	NA	NA	NA
AWX77786.1|3347691_3348378_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AWX77787.1|3349012_3349645_-	DNA-binding protein	NA	NA	NA	NA	NA
AWX77788.1|3350216_3350414_+	hypothetical protein	NA	NA	NA	NA	NA
AWX77789.1|3350471_3351266_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWX77790.1|3351343_3353395_+	FUSC family protein	NA	NA	NA	NA	NA
AWX77791.1|3353387_3353600_+	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
AWX77792.1|3353596_3354517_+	HlyD family secretion protein	NA	NA	NA	NA	NA
AWX77793.1|3354510_3355521_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AWX77794.1|3355517_3356924_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AWX77795.1|3356979_3357867_-	manganese catalase family protein	NA	NA	NA	NA	NA
3357440:3357456	attL	TCGGCGGTGGGTTCGCC	NA	NA	NA	NA
AWX77796.1|3357883_3358390_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AWX77797.1|3358416_3358911_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AWX77798.1|3359000_3359186_-	stress-induced acidophilic repeat motif-containing protein	NA	NA	NA	NA	NA
AWX77799.1|3359796_3360990_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
AWX77800.1|3361097_3361325_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
AWX77801.1|3361379_3361925_-	cysteine hydrolase	NA	NA	NA	NA	NA
AWX77802.1|3362215_3362857_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWX77803.1|3363029_3363503_+	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AWX77804.1|3363639_3363963_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AWX77805.1|3363955_3364348_+	amino acid-binding protein	NA	NA	NA	NA	NA
AWX77806.1|3364344_3365058_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AWX77807.1|3365395_3365869_-	hypothetical protein	NA	NA	NA	NA	NA
AWX77808.1|3365865_3366204_-	hypothetical protein	NA	NA	NA	NA	NA
AWX77809.1|3366601_3366754_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
AWX77810.1|3367086_3367410_-	hypothetical protein	NA	NA	NA	NA	NA
AWX77811.1|3367415_3368108_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AWX77812.1|3368463_3369522_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.2	9.4e-15
AWX77813.1|3369944_3371369_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	49.2	4.1e-98
AWX77814.1|3371430_3380130_-	hypothetical protein	NA	Q6UAW1	Klebsiella_phage	83.9	1.6e-03
AWX77815.1|3380207_3381128_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
AWX77816.1|3381164_3382424_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.8	1.8e-222
AWX77817.1|3382423_3382603_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	3.1e-11
AWX77818.1|3383994_3384870_+	hypothetical protein	NA	NA	NA	NA	NA
AWX79843.1|3384910_3385501_-|tail	tail assembly protein	tail	Q6UAW2	Klebsiella_phage	73.4	1.2e-72
AWX77819.1|3385567_3387229_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	96.9	0.0e+00
AWX77820.1|3387212_3387569_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	97.4	1.6e-59
AWX77821.1|3387526_3387718_-|terminase	terminase	terminase	NA	NA	NA	NA
AWX77822.1|3387844_3388288_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	63.3	4.9e-50
AWX77823.1|3388287_3388581_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	82.5	4.2e-42
AWX77824.1|3388573_3388912_-|head,tail	head-tail adaptor	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	46.8	1.3e-21
AWX77825.1|3388908_3390144_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	95.9	1.0e-233
AWX77826.1|3390145_3390706_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	96.8	1.9e-99
AWX77827.1|3390756_3391923_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	91.5	3.7e-198
AWX77828.1|3392164_3392932_+	hypothetical protein	NA	NA	NA	NA	NA
AWX79844.1|3392935_3393445_+	hypothetical protein	NA	NA	NA	NA	NA
AWX77829.1|3393479_3393740_-	hypothetical protein	NA	NA	NA	NA	NA
AWX77830.1|3393954_3395319_-	hypothetical protein	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	91.2	1.4e-244
AWX77831.1|3395315_3395684_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	92.6	9.1e-58
AWX77832.1|3395680_3395935_-	hypothetical protein	NA	NA	NA	NA	NA
AWX77833.1|3395927_3396206_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
AWX77834.1|3396339_3396534_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
AWX77835.1|3396560_3397382_-	hypothetical protein	NA	NA	NA	NA	NA
AWX79845.1|3397618_3397849_-	transcriptional regulator	NA	NA	NA	NA	NA
AWX77836.1|3397908_3398127_-	hypothetical protein	NA	NA	NA	NA	NA
AWX79846.1|3398119_3399355_-|integrase	integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	45.9	1.5e-104
AWX77837.1|3400164_3400599_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
AWX77838.1|3400846_3401278_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	62.0	1.1e-41
AWX77839.1|3401274_3401598_-	hypothetical protein	NA	NA	NA	NA	NA
AWX77840.1|3401549_3401912_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
AWX77841.1|3402238_3402463_+	hypothetical protein	NA	NA	NA	NA	NA
AWX77842.1|3402501_3402954_-	hypothetical protein	NA	NA	NA	NA	NA
AWX77843.1|3403888_3404239_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	38.1	7.9e-11
AWX77844.1|3404235_3404733_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.6	1.1e-77
AWX77845.1|3404732_3404948_-|holin	holin	holin	A5LH82	Enterobacteria_phage	88.7	2.7e-30
AWX77846.1|3405267_3406476_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
AWX77847.1|3408538_3409141_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.1	4.2e-76
AWX77848.1|3409157_3410189_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.3	2.4e-95
AWX77849.1|3410188_3410392_-	hypothetical protein	NA	NA	NA	NA	NA
AWX77850.1|3410388_3410781_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	35.6	6.8e-11
AWX77851.1|3410821_3411112_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	60.9	1.0e-16
AWX77852.1|3411123_3411357_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	1.7e-25
AWX79847.1|3411760_3413005_+	hypothetical protein	NA	NA	NA	NA	NA
AWX77853.1|3413298_3413508_-	hypothetical protein	NA	NA	NA	NA	NA
AWX77854.1|3413721_3414204_-	hypothetical protein	NA	NA	NA	NA	NA
AWX77855.1|3414448_3414889_-	hypothetical protein	NA	NA	NA	NA	NA
AWX77856.1|3414902_3415367_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	72.2	3.1e-63
AWX79848.1|3415359_3416364_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	45.3	8.6e-34
AWX77857.1|3416423_3416978_-	hypothetical protein	NA	NA	NA	NA	NA
AWX77858.1|3416980_3417205_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	62.5	1.3e-19
AWX77859.1|3417293_3417731_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	62.2	1.3e-39
AWX77860.1|3418052_3418367_-	hypothetical protein	NA	NA	NA	NA	NA
AWX77861.1|3418528_3418747_+	hypothetical protein	NA	NA	NA	NA	NA
AWX77862.1|3418756_3418951_+	DUF1482 family protein	NA	NA	NA	NA	NA
AWX77863.1|3418993_3419338_+	transcriptional regulator	NA	NA	NA	NA	NA
AWX77864.1|3422449_3422830_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	92.1	2.9e-67
AWX77865.1|3422840_3423323_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	97.5	3.3e-84
AWX77866.1|3423309_3423783_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	61.5	7.8e-54
AWX77867.1|3423782_3426479_-|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	62.7	5.8e-202
AWX77868.1|3426459_3426777_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	51.5	1.4e-19
AWX77869.1|3426797_3427193_-|tail	phage tail protein	tail	M9NZD7	Enterobacteria_phage	28.4	3.7e-09
AWX77870.1|3427235_3427718_-|tail	phage tail protein	tail	M9NYX0	Enterobacteria_phage	68.6	5.7e-60
AWX77871.1|3427725_3428124_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	57.8	3.2e-40
AWX77872.1|3428120_3428672_-|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	67.9	9.1e-54
AWX77873.1|3428661_3428955_-	ATP-binding protein	NA	NA	NA	NA	NA
AWX77874.1|3428947_3429274_-	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	65.4	4.0e-33
AWX77875.1|3429354_3430710_-	hypothetical protein	NA	K7PKX4	Enterobacterial_phage	60.1	5.0e-202
AWX77876.1|3430654_3432154_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.2	9.5e-247
AWX77877.1|3432150_3432366_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	77.1	7.7e-25
AWX77878.1|3432362_3434471_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	83.6	0.0e+00
AWX77879.1|3434470_3434962_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	84.0	6.4e-67
AWX77880.1|3435282_3435468_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	61.1	1.9e-11
AWX79849.1|3435534_3435795_-	hypothetical protein	NA	NA	NA	NA	NA
AWX77881.1|3436020_3436266_-	hypothetical protein	NA	A0A286N2R1	Klebsiella_phage	97.5	3.2e-35
AWX77882.1|3436408_3436750_-	hypothetical protein	NA	NA	NA	NA	NA
AWX77883.1|3436838_3437033_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	86.0	6.7e-20
AWX77884.1|3436986_3437259_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	69.2	5.0e-05
AWX77885.1|3437255_3437603_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	78.3	1.5e-38
AWX77886.1|3437599_3438139_-	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	98.3	3.3e-101
AWX77887.1|3438141_3438489_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	72.0	3.0e-39
AWX77888.1|3438743_3439223_+	hypothetical protein	NA	F1C594	Cronobacter_phage	56.8	1.3e-40
AWX77889.1|3439305_3439884_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.1	9.3e-49
AWX77890.1|3439897_3440878_-	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	67.2	1.9e-134
AWX77891.1|3440890_3441268_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	75.2	6.7e-48
AWX77892.1|3441277_3442087_-	DNA methylase	NA	A0A1C9II58	Salmonella_phage	68.5	6.5e-109
AWX77893.1|3442083_3442998_-	transcriptional regulator	NA	H2DE83	Erwinia_phage	60.6	1.4e-30
AWX77894.1|3442954_3443167_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	70.9	1.1e-15
AWX77895.1|3443404_3443866_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	87.5	3.8e-69
AWX77896.1|3443900_3444143_-	XRE family transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	80.3	1.3e-25
AWX77897.1|3444240_3444936_+	transcriptional regulator	NA	Q8HAA0	Salmonella_phage	71.3	2.1e-87
AWX77898.1|3445298_3445598_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	46.7	3.6e-12
AWX77899.1|3445597_3446383_+	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.2	3.8e-61
AWX77900.1|3446510_3446855_+	hypothetical protein	NA	NA	NA	NA	NA
AWX77901.1|3446847_3447330_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	81.3	1.4e-71
AWX77902.1|3447326_3447602_+	hypothetical protein	NA	NA	NA	NA	NA
AWX77903.1|3447598_3447871_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	47.1	1.7e-13
AWX77904.1|3447900_3448137_+	excisionase	NA	NA	NA	NA	NA
AWX77905.1|3448126_3449269_+|integrase	integrase	integrase	Q77Z02	Phage_21	81.6	4.5e-172
AWX77906.1|3449381_3450632_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
3451215:3451231	attR	GGCGAACCCACCGCCGA	NA	NA	NA	NA
>prophage 6
CP030173	Klebsiella variicola strain 13450 chromosome, complete genome	5511705	3696858	3706305	5511705	protease,tRNA	Brazilian_cedratvirus(16.67%)	8	NA	NA
AWX78114.1|3696858_3698580_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	32.8	1.5e-14
AWX78115.1|3698619_3699324_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AWX78116.1|3699674_3699893_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AWX78117.1|3700011_3702291_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	3.7e-165
AWX78118.1|3702321_3702639_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AWX78119.1|3702964_3703186_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AWX78120.1|3703252_3705193_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.0	2.9e-38
AWX78121.1|3705189_3706305_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
