The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP019610	Mycobacterium tuberculosis strain H54 chromosome, complete genome	4416938	1367154	1379957	4416938	protease,transposase,integrase	uncultured_Caudovirales_phage(25.0%)	15	1359261:1359277	1384424:1384440
1359261:1359277	attL	CGATCACCTGACGGCGG	NA	NA	NA	NA
AWY72165.1|1367154_1367349_-|integrase	integrase	integrase	A0A2H4JG32	uncultured_Caudovirales_phage	54.5	3.8e-07
AWY72166.1|1367285_1367600_-|integrase	integrase	integrase	Q854H9	Mycobacterium_phage	53.6	1.0e-09
AWY72167.1|1367623_1367962_-|integrase	integrase	integrase	NA	NA	NA	NA
AWY72168.1|1368657_1368861_-	hypothetical protein	NA	NA	NA	NA	NA
AWY74825.1|1368906_1369533_+	hypothetical protein	NA	NA	NA	NA	NA
AWY72169.1|1369827_1370583_+	hypothetical protein	NA	NA	NA	NA	NA
AWY74826.1|1370741_1371647_-	oxidoreductase	NA	NA	NA	NA	NA
AWY72170.1|1371695_1372142_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWY72171.1|1372214_1372418_+	hypothetical protein	NA	NA	NA	NA	NA
AWY72172.1|1372374_1373490_+	hypothetical protein	NA	NA	NA	NA	NA
AWY72173.1|1373857_1375105_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.1	3.1e-81
AWY72174.1|1375104_1375893_+	hypothetical protein	NA	NA	NA	NA	NA
AWY72175.1|1376851_1377475_-	hypothetical protein	NA	NA	NA	NA	NA
AWY74827.1|1377721_1378747_+|protease	serine protease	protease	NA	NA	NA	NA
AWY72176.1|1379093_1379957_+|transposase	IS5 family transposase	transposase	A0A1V0SLQ8	Klosneuvirus	28.7	8.5e-06
1384424:1384440	attR	CGATCACCTGACGGCGG	NA	NA	NA	NA
>prophage 2
CP019610	Mycobacterium tuberculosis strain H54 chromosome, complete genome	4416938	3075533	3110497	4416938	tRNA,protease,transposase,integrase	Mycobacterium_phage(25.0%)	35	3107153:3107174	3112576:3112597
AWY73565.1|3075533_3076427_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AWY73566.1|3076388_3078074_-	hypothetical protein	NA	NA	NA	NA	NA
AWY73567.1|3078048_3078288_-	hypothetical protein	NA	NA	NA	NA	NA
AWY75016.1|3078345_3079026_-	cutinase family protein	NA	NA	NA	NA	NA
AWY73568.1|3079072_3079861_-	cutinase	NA	NA	NA	NA	NA
AWY73569.1|3079981_3081394_+	type VII secretion protein EccB	NA	NA	NA	NA	NA
AWY75017.1|3081358_3082726_-|protease	type VII secretion-associated serine protease	protease	NA	NA	NA	NA
AWY73570.1|3082722_3084126_-	type VII secretion integral membrane protein EccD	NA	NA	NA	NA	NA
AWY73571.1|3084239_3087950_+	type VII secretion protein EccC	NA	V5UPA0	Mycobacterium_phage	27.1	2.7e-77
AWY73572.1|3087946_3089161_+	type VII secretion-associated protein	NA	NA	NA	NA	NA
AWY73573.1|3089213_3089531_+	type VII secretion protein EsxU	NA	NA	NA	NA	NA
AWY73574.1|3089551_3089854_+	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
AWY75018.1|3090086_3090530_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
AWY73575.1|3090526_3090982_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
AWY73576.1|3091106_3092453_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AWY73577.1|3092500_3092812_+	hypothetical protein	NA	NA	NA	NA	NA
AWY75019.1|3092814_3094218_+	hypothetical protein	NA	NA	NA	NA	NA
AWY73578.1|3094237_3095080_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWY73579.1|3095089_3095566_-	hypothetical protein	NA	NA	NA	NA	NA
AWY73580.1|3095587_3097462_+	glutamine--fructose-6-phosphate aminotransferase	NA	Q84421	Paramecium_bursaria_Chlorella_virus	36.1	4.6e-97
AWY73581.1|3097683_3098538_+	DUF4436 domain-containing protein	NA	NA	NA	NA	NA
AWY73582.1|3098548_3099262_+	hypothetical protein	NA	NA	NA	NA	NA
AWY73583.1|3099263_3100685_+	bifunctional ADP-dependent (S)-NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
AWY73584.1|3100722_3102105_+	glutamate decarboxylase	NA	NA	NA	NA	NA
AWY73585.1|3102337_3103183_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	53.2	2.7e-73
AWY73586.1|3103477_3103633_+	hypothetical protein	NA	NA	NA	NA	NA
AWY73587.1|3103671_3104835_+|transposase	transposase	transposase	U5P429	Shigella_phage	27.6	3.2e-08
AWY73588.1|3104775_3105312_-	PPE family protein	NA	NA	NA	NA	NA
AWY73589.1|3105474_3105837_+	hypothetical protein	NA	NA	NA	NA	NA
AWY75020.1|3106304_3106571_+|transposase	transposase	transposase	NA	NA	NA	NA
AWY73590.1|3106719_3107115_-	hypothetical protein	NA	NA	NA	NA	NA
3107153:3107174	attL	TGTGAAACGCCTGATTCATCTG	NA	NA	NA	NA
AWY73591.1|3107205_3107748_-	PPE family protein	NA	NA	NA	NA	NA
AWY75021.1|3107833_3108133_-	PE family protein	NA	NA	NA	NA	NA
AWY73592.1|3108648_3108846_+|integrase	integrase	integrase	NA	NA	NA	NA
AWY73593.1|3108928_3110497_+|transposase	transposase	transposase	NA	NA	NA	NA
3112576:3112597	attR	TGTGAAACGCCTGATTCATCTG	NA	NA	NA	NA
>prophage 3
CP019610	Mycobacterium tuberculosis strain H54 chromosome, complete genome	4416938	3155410	3203119	4416938	tRNA,transposase	Burkholderia_virus(25.0%)	43	NA	NA
AWY75027.1|3155410_3156088_-|transposase	transposase	transposase	NA	NA	NA	NA
AWY75028.1|3156077_3156782_-|transposase	transposase	transposase	NA	NA	NA	NA
AWY73635.1|3156930_3157239_+	antitoxin VapB46	NA	NA	NA	NA	NA
AWY73636.1|3157238_3157631_+	ribonuclease VapC46	NA	NA	NA	NA	NA
AWY73637.1|3158384_3159065_+	polyprenyl synthetase	NA	NA	NA	NA	NA
AWY75031.1|3159091_3159928_-|transposase	transposase	transposase	Q8W6R2	Burkholderia_virus	59.0	2.9e-83
AWY73638.1|3160026_3160353_-	hypothetical protein	NA	A0A1B3AZF8	Gordonia_phage	46.1	4.4e-16
AWY75030.1|3160794_3161784_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase 2	NA	NA	NA	NA	NA
AWY75029.1|3161813_3163619_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AWY73639.1|3163627_3164518_+	diterpene synthase	NA	NA	NA	NA	NA
AWY73640.1|3164522_3166028_+	cyclase	NA	NA	NA	NA	NA
AWY75032.1|3166066_3166720_-	haloacid dehalogenase	NA	NA	NA	NA	NA
AWY73641.1|3166827_3168255_-	amidase	NA	NA	NA	NA	NA
AWY73642.1|3168259_3168508_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AWY73643.1|3168508_3169150_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AWY73644.1|3169228_3169333_-	PE family protein	NA	NA	NA	NA	NA
AWY73645.1|3169386_3170562_-	trehalose-phosphatase	NA	NA	NA	NA	NA
AWY73646.1|3170603_3171944_-	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
AWY73647.1|3172135_3175375_+	error-prone DNA polymerase	NA	A0A1C9LWS4	Streptomyces_phage	32.4	1.6e-118
AWY73648.1|3175463_3175898_-	PPOX class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
AWY73649.1|3175896_3176541_+	oxidoreductase	NA	NA	NA	NA	NA
AWY75033.1|3176541_3178317_-	PE family protein	NA	NA	NA	NA	NA
AWY73650.1|3178683_3179148_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
AWY73651.1|3179383_3182014_+	ATP-binding protein	NA	NA	NA	NA	NA
AWY73652.1|3182010_3182403_+	dynein regulation protein LC7	NA	NA	NA	NA	NA
AWY73653.1|3182380_3182749_+	hypothetical protein	NA	NA	NA	NA	NA
AWY73654.1|3182729_3183311_+	ATP/GTP-binding protein	NA	NA	NA	NA	NA
AWY73655.1|3183317_3183869_+	pentapeptide repeat protein MfpA	NA	NA	NA	NA	NA
AWY73656.1|3183865_3184234_-	hypothetical protein	NA	NA	NA	NA	NA
AWY73657.1|3184350_3185541_-	oxidoreductase	NA	NA	NA	NA	NA
AWY73658.1|3185582_3185840_-	toxin YoeB	NA	NA	NA	NA	NA
AWY73659.1|3185836_3186112_-	antitoxin	NA	NA	NA	NA	NA
AWY73660.1|3186235_3187081_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	NA	NA	NA	NA
AWY73661.1|3187077_3187371_+	hypothetical protein	NA	NA	NA	NA	NA
AWY73662.1|3187384_3187774_-	hypothetical protein	NA	NA	NA	NA	NA
AWY73663.1|3187888_3188149_+	oxidoreductase	NA	NA	NA	NA	NA
AWY73664.1|3188291_3188663_+	oxidoreductase	NA	A0A0B5JBT9	Pandoravirus	56.4	3.3e-15
AWY73665.1|3188744_3189539_+	oxidoreductase	NA	NA	NA	NA	NA
AWY73666.1|3189782_3195983_+	PPE family protein	NA	NA	NA	NA	NA
AWY73667.1|3195877_3200932_+	hypothetical protein	NA	NA	NA	NA	NA
AWY73668.1|3201319_3201556_+|transposase	transposase	transposase	NA	NA	NA	NA
AWY75034.1|3201850_3202591_+|transposase	transposase	transposase	NA	NA	NA	NA
AWY73669.1|3202627_3203119_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 4
CP019610	Mycobacterium tuberculosis strain H54 chromosome, complete genome	4416938	3817754	3865606	4416938	tRNA,transposase	Burkholderia_virus(25.0%)	55	NA	NA
AWY74151.1|3817754_3819503_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AWY74152.1|3819503_3819992_-	hypothetical protein	NA	NA	NA	NA	NA
AWY74153.1|3819988_3820534_-	hypothetical protein	NA	NA	NA	NA	NA
AWY74154.1|3820728_3821280_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
AWY74155.1|3821276_3822320_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
AWY74156.1|3822446_3822746_+	hypothetical protein	NA	NA	NA	NA	NA
AWY74157.1|3822831_3825534_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.1	1.6e-21
AWY74158.1|3825533_3826085_+	ribosome-binding factor A	NA	NA	NA	NA	NA
AWY74159.1|3826059_3827070_+	phosphoesterase	NA	NA	NA	NA	NA
AWY74160.1|3827076_3828396_+	DNA-damage-inducible protein DinF	NA	NA	NA	NA	NA
AWY75105.1|3828482_3829394_+	sn-glycerol-3-phosphate ABC transporter permease UgpA	NA	NA	NA	NA	NA
AWY74161.1|3829390_3830218_+	glycerol-3-phosphate ABC transporter permease	NA	NA	NA	NA	NA
AWY74162.1|3830220_3831531_+	sn-glycerol-3-phosphate ABC transporter substrate-binding lipoprotein UgpB	NA	NA	NA	NA	NA
AWY74163.1|3831523_3832606_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.9	6.9e-21
AWY74164.1|3832684_3833434_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AWY75106.1|3833480_3833696_+	prevent-host-death family protein	NA	NA	NA	NA	NA
AWY74165.1|3833692_3834085_+	ribonuclease VapC22	NA	NA	NA	NA	NA
AWY74166.1|3834105_3834375_+	hypothetical protein	NA	NA	NA	NA	NA
AWY74167.1|3834371_3834917_+	hypothetical protein	NA	NA	NA	NA	NA
AWY75107.1|3835221_3836109_+	hypothetical protein	NA	NA	NA	NA	NA
AWY74168.1|3836111_3836996_+	hypothetical protein	NA	NA	NA	NA	NA
AWY75108.1|3837267_3837813_+	hypothetical protein	NA	NA	NA	NA	NA
AWY74169.1|3837990_3838935_+	CRISPR-associated endoribonuclease Cas6	NA	NA	NA	NA	NA
AWY74170.1|3838931_3841370_+	type III-A CRISPR-associated protein Cas10/Csm1	NA	NA	NA	NA	NA
AWY74171.1|3841366_3841741_+	type III-A CRISPR-associated protein Csm2	NA	NA	NA	NA	NA
AWY74172.1|3841750_3842461_+	CRISPR type III-associated RAMP protein Csm3	NA	NA	NA	NA	NA
AWY74173.1|3842441_3842798_+	type III-A CRISPR-associated RAMP protein Csm4	NA	NA	NA	NA	NA
AWY75109.1|3842824_3843661_-|transposase	transposase	transposase	Q8W6R2	Burkholderia_virus	59.0	2.9e-83
AWY74174.1|3843759_3844086_-	hypothetical protein	NA	A0A1B3AZF8	Gordonia_phage	46.1	4.4e-16
AWY74175.1|3845413_3846226_-	AAA family ATPase	NA	NA	NA	NA	NA
AWY74176.1|3846222_3847632_-|transposase	transposase	transposase	NA	NA	NA	NA
AWY74177.1|3847702_3848311_-	hypothetical protein	NA	NA	NA	NA	NA
AWY74178.1|3848730_3849042_-	hypothetical protein	NA	NA	NA	NA	NA
AWY74179.1|3849146_3849404_-	hypothetical protein	NA	NA	NA	NA	NA
AWY74180.1|3849736_3850063_+	hypothetical protein	NA	A0A1B3AZF8	Gordonia_phage	46.1	4.4e-16
AWY75110.1|3850161_3850998_+|transposase	transposase	transposase	Q8W6R2	Burkholderia_virus	59.0	2.9e-83
AWY74181.1|3851037_3852150_-|transposase	transposase	transposase	NA	NA	NA	NA
AWY74182.1|3852348_3852540_-	hypothetical protein	NA	NA	NA	NA	NA
AWY75111.1|3852536_3852941_-	hypothetical protein	NA	NA	NA	NA	NA
AWY75112.1|3853013_3853169_-	histone acetyltransferase	NA	NA	NA	NA	NA
AWY75113.1|3853151_3853343_+	hypothetical protein	NA	NA	NA	NA	NA
AWY74183.1|3853518_3853986_-	hypothetical protein	NA	NA	NA	NA	NA
AWY74184.1|3853984_3855028_+	hypothetical protein	NA	NA	NA	NA	NA
AWY74185.1|3855070_3855301_+	antitoxin MazE	NA	NA	NA	NA	NA
AWY74186.1|3855284_3855641_+	mRNA interferase MazF9	NA	NA	NA	NA	NA
AWY74187.1|3855742_3857392_-	hydrolase	NA	NA	NA	NA	NA
AWY74188.1|3857410_3858040_-	DUF3558 domain-containing protein	NA	NA	NA	NA	NA
AWY74189.1|3858170_3858497_+	hypothetical protein	NA	NA	NA	NA	NA
AWY74190.1|3858500_3860189_+	hypothetical protein	NA	NA	NA	NA	NA
AWY74191.1|3860188_3860752_+	hypothetical protein	NA	NA	NA	NA	NA
AWY74192.1|3860896_3861871_+	metallophosphoesterase	NA	NA	NA	NA	NA
AWY74193.1|3861867_3862551_+	4'-phosphopantetheinyl transferase	NA	NA	NA	NA	NA
AWY74194.1|3862547_3863444_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
AWY74195.1|3863645_3864227_+|transposase	IS607 family transposase	transposase	F9VHY9	Thermus_phage	30.6	5.0e-18
AWY74196.1|3864226_3865606_+|transposase	transposase	transposase	A0A7P9	Microcystis_virus	30.3	9.3e-31
>prophage 5
CP019610	Mycobacterium tuberculosis strain H54 chromosome, complete genome	4416938	3982073	4013268	4416938	protease,capsid,transposase,integrase	Mycobacterium_phage(30.0%)	42	3984950:3984977	3994574:3994601
AWY74302.1|3982073_3982877_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	46.4	3.5e-46
AWY74303.1|3982876_3983368_+	hypothetical protein	NA	NA	NA	NA	NA
AWY74304.1|3983596_3983851_-	hypothetical protein	NA	NA	NA	NA	NA
AWY74305.1|3983861_3984095_-	hypothetical protein	NA	NA	NA	NA	NA
AWY74306.1|3984193_3984466_-	hypothetical protein	NA	NA	NA	NA	NA
AWY74307.1|3984371_3984761_+	hypothetical protein	NA	NA	NA	NA	NA
AWY74308.1|3984757_3984985_+	hypothetical protein	NA	NA	NA	NA	NA
3984950:3984977	attL	TGGTGCGCGATACTGGGATTGAACCAGT	NA	NA	NA	NA
AWY74309.1|3985129_3986257_+|integrase	integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
AWY75137.1|3986259_3986622_+	hypothetical protein	NA	NA	NA	NA	NA
AWY74310.1|3986638_3986899_+	hypothetical protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	3.0e-15
AWY74311.1|3986895_3987288_+	hypothetical protein	NA	NA	NA	NA	NA
AWY74312.1|3987289_3988717_+	hypothetical protein	NA	NA	NA	NA	NA
AWY74313.1|3988713_3988959_+	antitoxin	NA	NA	NA	NA	NA
AWY75138.1|3989038_3989362_+	toxin	NA	NA	NA	NA	NA
AWY74314.1|3989393_3990020_+	hypothetical protein	NA	V9H0V4	Actinophage	47.2	1.6e-17
AWY75139.1|3990172_3990706_+|protease	prophage protease	protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
AWY74315.1|3990713_3992153_+|capsid	major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
AWY74316.1|3992323_3992575_-	hypothetical protein	NA	NA	NA	NA	NA
AWY74317.1|3992562_3993027_-	hypothetical protein	NA	NA	NA	NA	NA
AWY74318.1|3993040_3994039_-|integrase	integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
AWY74319.1|3994035_3994467_-	hypothetical protein	NA	NA	NA	NA	NA
AWY75140.1|3995757_3995949_-	antitoxin MazE	NA	NA	NA	NA	NA
3994574:3994601	attR	TGGTGCGCGATACTGGGATTGAACCAGT	NA	NA	NA	NA
AWY74320.1|3996183_3997680_-	arsenic-transport integral membrane protein ArsC	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
AWY74321.1|3997676_3998057_-	transcriptional regulator	NA	NA	NA	NA	NA
AWY74322.1|3998192_3998651_-	cadmium-induced protein CadI	NA	NA	NA	NA	NA
AWY74323.1|3998752_3999112_+	transcriptional regulator	NA	NA	NA	NA	NA
AWY74324.1|3999231_3999564_+	hypothetical protein	NA	NA	NA	NA	NA
AWY74325.1|3999738_4000185_-	anti-anti-sigma factor	NA	NA	NA	NA	NA
AWY74326.1|4000347_4001004_-	protein DedA	NA	NA	NA	NA	NA
AWY74327.1|4001199_4001877_-	hypothetical protein	NA	NA	NA	NA	NA
AWY74328.1|4001877_4002120_-	hypothetical protein	NA	NA	NA	NA	NA
AWY74329.1|4002148_4004485_+	PE family protein	NA	NA	NA	NA	NA
AWY74330.1|4004485_4004743_+	hypothetical protein	NA	NA	NA	NA	NA
AWY74331.1|4004769_4005255_+	hypothetical protein	NA	NA	NA	NA	NA
AWY74332.1|4005399_4005681_+	hypothetical protein	NA	NA	NA	NA	NA
AWY74333.1|4005719_4007018_-	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
AWY74334.1|4007157_4007697_-	archease	NA	NA	NA	NA	NA
AWY74335.1|4007698_4008823_-	hypothetical protein	NA	NA	NA	NA	NA
AWY75141.1|4009169_4009532_-	hypothetical protein	NA	NA	NA	NA	NA
AWY74336.1|4009841_4011083_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWY74337.1|4011596_4012028_+	hypoxic response protein 1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
AWY74338.1|4012086_4013268_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
