The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP019611	Mycobacterium tuberculosis strain H83 chromosome, complete genome	4413214	1916425	1968357	4413214	integrase,transposase,tRNA,protease	Klosneuvirus(18.18%)	54	1924248:1924264	1973306:1973322
AWY76744.1|1916425_1917985_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	39.2	2.8e-100
AWY76745.1|1918070_1918865_+	DNAase	NA	NA	NA	NA	NA
AWY76746.1|1919072_1920161_+	resuscitation-promoting factor RpfB	NA	Q856D9	Mycobacterium_phage	59.4	8.2e-22
AWY76747.1|1920133_1921087_+	ribosomal RNA small subunit methyltransferase A	NA	NA	NA	NA	NA
AWY79040.1|1921172_1922093_+	4-diphosphocytidyl-2C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
AWY76748.1|1922109_1922403_+	hypothetical protein	NA	NA	NA	NA	NA
AWY79041.1|1922450_1922681_-	hypothetical protein	NA	NA	NA	NA	NA
AWY76749.1|1922606_1924241_+	polyketide synthase	NA	NA	NA	NA	NA
1924248:1924264	attL	CGAGCAGACGCAAAATC	NA	NA	NA	NA
AWY76750.1|1924314_1924890_-|tRNA	peptidyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AWY76751.1|1924902_1925550_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
AWY76752.1|1925766_1926447_-	hypothetical protein	NA	NA	NA	NA	NA
AWY76753.1|1926482_1927463_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	32.7	1.8e-44
AWY76754.1|1927554_1929042_-	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	NA	NA	NA	NA
AWY76755.1|1929296_1929890_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWY76756.1|1929948_1933653_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
AWY76757.1|1933652_1934630_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
AWY76758.1|1934717_1935449_+	hypothetical protein	NA	NA	NA	NA	NA
AWY76759.1|1935545_1936835_+	enolase	NA	W6LP63	Streptococcus_phage	56.6	2.1e-133
AWY76760.1|1936839_1937526_+	septation inhibitor protein	NA	NA	NA	NA	NA
AWY79042.1|1937542_1938010_+	hypothetical protein	NA	NA	NA	NA	NA
AWY76761.1|1938000_1938960_+	exopolyphosphatase	NA	NA	NA	NA	NA
AWY76762.1|1939199_1939412_+	hypothetical protein	NA	NA	NA	NA	NA
AWY76763.1|1939408_1940089_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	30.6	4.2e-24
AWY76764.1|1940085_1942668_-	sensor protein KdpD	NA	NA	NA	NA	NA
AWY76765.1|1942758_1942905_+	potassium transporter Trk	NA	NA	NA	NA	NA
AWY79043.1|1942901_1942994_+	K+-transporting ATPase subunit F	NA	NA	NA	NA	NA
AWY76766.1|1942993_1944709_+	K+-transporting ATPase subunit A	NA	NA	NA	NA	NA
AWY76767.1|1944705_1946835_+	potassium-transporting ATPase B chain	NA	M1HRW9	Paramecium_bursaria_Chlorella_virus	26.2	3.8e-23
AWY76768.1|1946834_1947404_+	potassium-transporting ATPase C chain	NA	NA	NA	NA	NA
AWY76769.1|1947407_1948937_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AWY76770.1|1948944_1949718_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.3	2.3e-34
AWY76771.1|1951525_1951810_-	ESAT-6-like protein EsxI	NA	NA	NA	NA	NA
AWY76772.1|1951836_1952133_-	ESAT-6-like protein EsxK	NA	NA	NA	NA	NA
AWY76773.1|1952278_1953454_-	PPE family protein	NA	NA	NA	NA	NA
AWY76774.1|1953530_1954358_-	PE family protein	NA	NA	NA	NA	NA
AWY76775.1|1954918_1955167_+	hypothetical protein	NA	NA	NA	NA	NA
AWY76776.1|1955145_1955385_-	hypothetical protein	NA	NA	NA	NA	NA
AWY76777.1|1955290_1955509_-	hypothetical protein	NA	NA	NA	NA	NA
AWY76778.1|1955553_1956417_-|transposase	IS5 family transposase	transposase	A0A1V0SLQ8	Klosneuvirus	28.7	1.1e-05
AWY79044.1|1956763_1957789_-|protease	serine protease	protease	NA	NA	NA	NA
AWY76779.1|1958035_1958659_+	hypothetical protein	NA	NA	NA	NA	NA
AWY76780.1|1958655_1959537_+	hypothetical protein	NA	NA	NA	NA	NA
AWY76781.1|1959618_1960407_-	hypothetical protein	NA	NA	NA	NA	NA
AWY76782.1|1960406_1961654_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.1	3.1e-81
AWY76783.1|1962021_1963137_-	hypothetical protein	NA	NA	NA	NA	NA
AWY76784.1|1963093_1963297_-	hypothetical protein	NA	NA	NA	NA	NA
AWY76785.1|1963369_1963816_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWY79045.1|1963864_1964770_+	oxidoreductase	NA	NA	NA	NA	NA
AWY76786.1|1964928_1965684_-	hypothetical protein	NA	NA	NA	NA	NA
AWY79046.1|1965978_1966605_-	hypothetical protein	NA	NA	NA	NA	NA
AWY76787.1|1966650_1966854_+	hypothetical protein	NA	NA	NA	NA	NA
AWY76788.1|1967549_1967888_+|integrase	integrase	integrase	NA	NA	NA	NA
AWY76789.1|1967911_1968226_+|integrase	integrase	integrase	Q854H9	Mycobacterium_phage	53.6	1.0e-09
AWY76790.1|1968162_1968357_+|integrase	integrase	integrase	A0A2H4JG32	uncultured_Caudovirales_phage	54.5	3.8e-07
1973306:1973322	attR	CGAGCAGACGCAAAATC	NA	NA	NA	NA
>prophage 2
CP019611	Mycobacterium tuberculosis strain H83 chromosome, complete genome	4413214	3721475	3762804	4413214	integrase,protease,transposase,tRNA,capsid	Mycobacterium_phage(27.27%)	53	3750276:3750303	3759900:3759927
AWY78241.1|3721475_3723554_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
AWY78242.1|3723662_3723890_+	hypothetical protein	NA	NA	NA	NA	NA
AWY78243.1|3723886_3725272_-	PE family protein	NA	NA	NA	NA	NA
AWY78244.1|3725616_3726117_+	hypothetical protein	NA	NA	NA	NA	NA
AWY78245.1|3726133_3726574_-	hypothetical protein	NA	NA	NA	NA	NA
AWY79235.1|3726720_3727398_+	transcriptional regulator	NA	NA	NA	NA	NA
AWY78246.1|3727382_3727736_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AWY78247.1|3727748_3728174_-	hypothetical protein	NA	NA	NA	NA	NA
AWY78248.1|3728170_3728845_-	transcriptional regulator	NA	NA	NA	NA	NA
AWY78249.1|3728922_3729744_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWY78250.1|3729879_3730773_+	universal stress protein	NA	NA	NA	NA	NA
AWY78251.1|3730775_3731594_-	universal stress protein	NA	NA	NA	NA	NA
AWY78252.1|3731608_3732790_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
AWY78253.1|3732848_3733280_-	hypoxic response protein 1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
AWY78254.1|3733793_3735035_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWY79236.1|3735344_3735707_+	hypothetical protein	NA	NA	NA	NA	NA
AWY78255.1|3736053_3737178_+	hypothetical protein	NA	NA	NA	NA	NA
AWY78256.1|3737179_3737719_+	archease	NA	NA	NA	NA	NA
AWY78257.1|3737858_3739157_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
AWY78258.1|3739195_3739477_-	hypothetical protein	NA	NA	NA	NA	NA
AWY78259.1|3739621_3740107_-	hypothetical protein	NA	NA	NA	NA	NA
AWY78260.1|3740133_3740391_-	hypothetical protein	NA	NA	NA	NA	NA
AWY78261.1|3740391_3742728_-	PE family protein	NA	NA	NA	NA	NA
AWY78262.1|3742756_3742999_+	hypothetical protein	NA	NA	NA	NA	NA
AWY78263.1|3742999_3743677_+	hypothetical protein	NA	NA	NA	NA	NA
AWY78264.1|3743872_3744529_+	protein DedA	NA	NA	NA	NA	NA
AWY78265.1|3744691_3745138_+	anti-anti-sigma factor	NA	NA	NA	NA	NA
AWY78266.1|3745312_3745645_-	hypothetical protein	NA	NA	NA	NA	NA
AWY78267.1|3745764_3746124_-	transcriptional regulator	NA	NA	NA	NA	NA
AWY78268.1|3746225_3746684_+	cadmium-induced protein CadI	NA	NA	NA	NA	NA
AWY78269.1|3746819_3747200_+	transcriptional regulator	NA	NA	NA	NA	NA
AWY78270.1|3747196_3748693_+	arsenic-transport integral membrane protein ArsC	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
AWY79237.1|3748927_3749119_+	antitoxin MazE	NA	NA	NA	NA	NA
3750276:3750303	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
AWY78271.1|3750409_3750841_+	hypothetical protein	NA	NA	NA	NA	NA
AWY78272.1|3750837_3751836_+|integrase	integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
AWY78273.1|3751849_3752314_+	hypothetical protein	NA	NA	NA	NA	NA
AWY78274.1|3752301_3752553_+	hypothetical protein	NA	NA	NA	NA	NA
AWY78275.1|3752723_3754163_-|capsid	major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
AWY78276.1|3754170_3754704_-|protease	prophage protease	protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
AWY78277.1|3754856_3755483_-	hypothetical protein	NA	V9H0V4	Actinophage	47.2	1.6e-17
AWY79238.1|3755514_3755838_-	toxin	NA	NA	NA	NA	NA
AWY78278.1|3755917_3756163_-	antitoxin	NA	NA	NA	NA	NA
AWY78279.1|3756159_3757587_-	hypothetical protein	NA	NA	NA	NA	NA
AWY78280.1|3757588_3757981_-	hypothetical protein	NA	NA	NA	NA	NA
AWY78281.1|3757977_3758238_-	hypothetical protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	3.0e-15
AWY79239.1|3758254_3758617_-	hypothetical protein	NA	NA	NA	NA	NA
AWY78282.1|3758619_3759747_-|integrase	integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
AWY79240.1|3759891_3760119_-	hypothetical protein	NA	NA	NA	NA	NA
3759900:3759927	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
AWY79241.1|3760115_3760505_-	hypothetical protein	NA	NA	NA	NA	NA
AWY78283.1|3760410_3760683_+	hypothetical protein	NA	NA	NA	NA	NA
AWY78284.1|3760781_3761015_+	hypothetical protein	NA	NA	NA	NA	NA
AWY78285.1|3761025_3761280_+	hypothetical protein	NA	NA	NA	NA	NA
AWY79242.1|3762000_3762804_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	46.4	3.5e-46
>prophage 3
CP019611	Mycobacterium tuberculosis strain H83 chromosome, complete genome	4413214	3879339	3901969	4413214	transposase,tRNA	Burkholderia_virus(40.0%)	27	NA	NA
AWY78394.1|3879339_3880719_-|transposase	transposase	transposase	A0A7P9	Microcystis_virus	30.3	9.3e-31
AWY78395.1|3880718_3881300_-|transposase	IS607 family transposase	transposase	F9VHY9	Thermus_phage	30.6	5.0e-18
AWY78396.1|3881501_3882398_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
AWY78397.1|3882394_3883078_-	4'-phosphopantetheinyl transferase	NA	NA	NA	NA	NA
AWY78398.1|3883074_3884049_-	metallophosphoesterase	NA	NA	NA	NA	NA
AWY78399.1|3884193_3884757_-	hypothetical protein	NA	NA	NA	NA	NA
AWY78400.1|3884756_3886445_-	hypothetical protein	NA	NA	NA	NA	NA
AWY79264.1|3886448_3886775_-	hypothetical protein	NA	NA	NA	NA	NA
AWY78401.1|3886905_3887535_+	DUF3558 domain-containing protein	NA	NA	NA	NA	NA
AWY78402.1|3887553_3889203_+	hydrolase	NA	NA	NA	NA	NA
AWY78403.1|3889304_3889661_-	mRNA interferase MazF9	NA	NA	NA	NA	NA
AWY78404.1|3889644_3889875_-	antitoxin MazE	NA	NA	NA	NA	NA
AWY78405.1|3889917_3890961_-	hypothetical protein	NA	NA	NA	NA	NA
AWY78406.1|3890959_3891427_+	hypothetical protein	NA	NA	NA	NA	NA
AWY78407.1|3891602_3891794_-	hypothetical protein	NA	NA	NA	NA	NA
AWY78408.1|3891776_3891932_+	histone acetyltransferase	NA	NA	NA	NA	NA
AWY79265.1|3892004_3892409_+	hypothetical protein	NA	NA	NA	NA	NA
AWY78409.1|3892405_3892597_+	hypothetical protein	NA	NA	NA	NA	NA
AWY78410.1|3892795_3893950_+|transposase	transposase	transposase	NA	NA	NA	NA
AWY78411.1|3894183_3894441_+	hypothetical protein	NA	NA	NA	NA	NA
AWY78412.1|3894545_3894857_+	hypothetical protein	NA	NA	NA	NA	NA
AWY78413.1|3895276_3895885_+	hypothetical protein	NA	NA	NA	NA	NA
AWY78414.1|3895955_3897365_+|transposase	transposase	transposase	NA	NA	NA	NA
AWY78415.1|3897361_3898174_+	AAA family ATPase	NA	NA	NA	NA	NA
AWY79266.1|3899278_3900115_-|transposase	transposase	transposase	Q8W6R2	Burkholderia_virus	59.0	2.9e-83
AWY78416.1|3900213_3900540_-	hypothetical protein	NA	A0A1B3AZF8	Gordonia_phage	43.1	4.2e-14
AWY79267.1|3901132_3901969_-|transposase	transposase	transposase	Q8W6R2	Burkholderia_virus	59.0	2.9e-83
