The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	0	1005	2288482		Lactococcus_phage(100.0%)	1	NA	NA
AWZ39524.1|72_1005_-	cysteine synthase	NA	C3U2M1	Lactococcus_phage	43.3	1.8e-62
>prophage 2
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	8863	10232	2288482		Bacillus_phage(50.0%)	2	NA	NA
AWZ39535.1|8863_9379_+	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	33.9	7.5e-10
AWZ39536.1|9602_10232_+	hypothetical protein	NA	A0A2I6AZV9	Macacine_betaherpesvirus	40.9	1.2e-30
>prophage 3
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	18846	22126	2288482		Klosneuvirus(50.0%)	3	NA	NA
AWZ39544.1|18846_20184_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	3.1e-23
AWZ39545.1|20258_21422_+	MFS transporter	NA	NA	NA	NA	NA
AWZ39546.1|21598_22126_+	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	33.1	8.2e-12
>prophage 4
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	25810	43177	2288482	tRNA,transposase,bacteriocin	Paenibacillus_phage(28.57%)	19	NA	NA
AWZ39549.1|25810_27232_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	28.2	1.3e-40
AWZ39550.1|27354_28041_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWZ41532.1|28215_28554_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39551.1|28699_28927_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
AWZ39552.1|29176_29428_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
AWZ39553.1|29817_31977_-	peptide ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.8	4.4e-43
AWZ39554.1|32136_32919_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AWZ39555.1|32932_34210_-	ATPase	NA	NA	NA	NA	NA
AWZ39556.1|34493_35312_-|transposase	transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	32.1	3.6e-22
AWZ39557.1|35341_36115_-|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	36.6	3.7e-29
AWZ39558.1|36245_36638_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
AWZ39559.1|36651_37095_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
AWZ39560.1|37246_37999_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AWZ39561.1|38008_38803_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
AWZ39562.1|38795_39668_-	energy-coupling factor ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.4	5.0e-14
AWZ39563.1|39643_40483_-	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	35.4	2.0e-23
AWZ39564.1|40611_41145_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
AWZ39565.1|41189_41831_-	NAD-dependent dehydratase	NA	NA	NA	NA	NA
AWZ39566.1|41848_43177_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	55.3	1.8e-140
>prophage 5
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	60691	64494	2288482		Bacillus_virus(50.0%)	3	NA	NA
AWZ39598.1|60691_61240_+	isochorismatase	NA	G3MA16	Bacillus_virus	39.3	1.3e-23
AWZ39599.1|61476_62337_+	patatin family protein	NA	NA	NA	NA	NA
AWZ39600.1|62403_64494_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.4	2.7e-66
>prophage 6
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	67592	74926	2288482		Phaeocystis_globosa_virus(50.0%)	2	NA	NA
AWZ39605.1|67592_71264_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	25.2	9.7e-67
AWZ39606.1|71305_74926_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.7	6.0e-53
>prophage 7
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	79290	90098	2288482	protease	Salmonella_phage(50.0%)	10	NA	NA
AWZ39615.1|79290_81120_-	acyltransferase	NA	C6ZR20	Salmonella_phage	27.9	4.3e-23
AWZ39616.1|81116_81488_-	membrane-binding protein	NA	NA	NA	NA	NA
AWZ39617.1|82063_82366_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39618.1|82668_82914_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39619.1|83162_83729_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ39620.1|83947_85411_+	ABC-F type ribosomal protection protein	NA	Q6DMX7	Streptococcus_phage	25.9	1.1e-26
AWZ39621.1|85584_88077_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpC	protease	K4FB40	Cronobacter_phage	40.3	1.4e-122
AWZ39622.1|88095_88566_-	CtsR family transcriptional regulator	NA	NA	NA	NA	NA
AWZ39623.1|88677_89112_-	porin	NA	NA	NA	NA	NA
AWZ39624.1|89375_90098_+	nicotinamide mononucleotide transporter	NA	G3BLP7	Salmonella_phage	23.9	4.8e-10
>prophage 8
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	93643	101632	2288482		Staphylococcus_phage(25.0%)	8	NA	NA
AWZ39628.1|93643_94468_-	bacitracin ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.3	2.1e-30
AWZ39629.1|94436_96101_-	hypothetical protein	NA	W8CYL7	Bacillus_phage	21.4	4.2e-09
AWZ39630.1|96110_97349_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39631.1|97326_97740_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39632.1|97758_98325_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39633.1|98748_99219_-	nucleoside 2-deoxyribosyltransferase	NA	A0A0A7DMT2	Lactobacillus_phage	61.7	1.1e-52
AWZ39634.1|99299_99503_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39635.1|99814_101632_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q76DQ7	Chlorella_virus	38.1	1.9e-100
>prophage 9
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	118468	241563	2288482	integrase,transposase,bacteriocin	Bacillus_phage(19.35%)	113	171059:171075	233455:233471
AWZ41533.1|118468_118996_+	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	33.1	8.2e-12
AWZ39658.1|119016_119856_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ39659.1|120142_120961_-|transposase	transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	32.1	3.6e-22
AWZ39660.1|120990_121764_-|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	37.0	1.7e-29
AWZ39661.1|122239_122710_-	DNA repair protein RadC	NA	NA	NA	NA	NA
AWZ39662.1|123013_123463_+	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
AWZ39663.1|123482_125531_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	29.7	8.6e-57
AWZ39664.1|126925_128617_-|transposase	DDE transposase	transposase	A0ZS58	Staphylococcus_virus	39.4	3.6e-93
AWZ39665.1|128792_129479_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
AWZ39666.1|129561_130752_-	putative C-S lyase	NA	NA	NA	NA	NA
AWZ39667.1|130744_131803_-	AI-2E family transporter	NA	NA	NA	NA	NA
AWZ39668.1|131920_132958_-	galactose mutarotase	NA	NA	NA	NA	NA
AWZ39669.1|133279_133585_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ39670.1|133854_134850_-	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	38.9	3.4e-51
AWZ39671.1|135014_135752_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWZ39672.1|135935_136502_+	ABC transporter permease	NA	NA	NA	NA	NA
AWZ39673.1|136501_137902_+	energy-coupling factor ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AWZ39674.1|137898_138564_+	ABC transporter permease	NA	NA	NA	NA	NA
AWZ39675.1|138768_139995_+	acetate kinase	NA	NA	NA	NA	NA
AWZ39676.1|140109_142482_+	phosphoketolase	NA	NA	NA	NA	NA
AWZ39677.1|142580_143165_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
AWZ39678.1|143175_144075_+	prenyltransferase	NA	NA	NA	NA	NA
AWZ39679.1|144195_146106_-	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	38.0	5.3e-93
AWZ39680.1|146102_146477_-	copper-binding protein	NA	NA	NA	NA	NA
AWZ39681.1|146585_147326_-	ABC transporter permease	NA	NA	NA	NA	NA
AWZ39682.1|147319_148042_-	nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.7	1.5e-24
AWZ39683.1|148041_149073_-	NlpA lipoprotein	NA	NA	NA	NA	NA
AWZ39684.1|149433_151041_-	peptidoglycan biosynthesis protein	NA	NA	NA	NA	NA
AWZ39685.1|151402_152113_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
AWZ39686.1|152221_153013_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39687.1|153014_153581_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39688.1|153577_154681_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39689.1|154724_155516_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39690.1|155533_156070_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39691.1|156066_157260_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39692.1|157259_158390_-	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	29.8	5.1e-35
AWZ39693.1|158545_159316_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39694.1|159954_160827_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39695.1|160826_162167_-	MFS transporter	NA	NA	NA	NA	NA
AWZ39696.1|162491_163019_+	dihydroxyacetone kinase transcriptional activator DhaS	NA	NA	NA	NA	NA
AWZ39697.1|163012_163999_-	DhaKLM operon coactivator DhaQ	NA	NA	NA	NA	NA
AWZ39698.1|164132_165374_+	dihydroxyacetone kinase	NA	A0A1B1P776	Bacillus_phage	32.5	2.2e-10
AWZ39699.1|165564_166737_+|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	85.2	4.5e-119
AWZ39700.1|166786_167218_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39701.1|167380_168133_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39702.1|168122_168989_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39703.1|168972_170910_-	hypothetical protein	NA	NA	NA	NA	NA
171059:171075	attL	ACTTAATATATTTTCTT	NA	NA	NA	NA
AWZ39704.1|171060_171792_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39705.1|171795_172227_-	very short patch repair endonuclease	NA	V5UTF4	Oenococcus_phage	61.7	3.1e-33
AWZ39706.1|172350_173838_+	restriction endonuclease	NA	NA	NA	NA	NA
AWZ39707.1|173881_175183_-	DNA (cytosine-5-)-methyltransferase	NA	A0A1P8DJM9	Virus_Rctr41k	25.9	6.8e-23
AWZ39708.1|175414_176392_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39709.1|176552_177515_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
AWZ39710.1|177956_179231_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39711.1|179399_180305_-	abortive phage infection protein	NA	NA	NA	NA	NA
AWZ39712.1|180323_181562_-	restriction endonuclease	NA	NA	NA	NA	NA
AWZ39713.1|181561_182071_-	transcriptional regulator	NA	NA	NA	NA	NA
AWZ39714.1|182198_183752_+	DNA (cytosine-5-)-methyltransferase	NA	A0A0P0CCR5	Ostreococcus_mediterraneus_virus	34.0	8.9e-22
AWZ39715.1|183911_184775_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39716.1|184992_185811_-|transposase	transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	32.1	3.6e-22
AWZ39717.1|185840_186614_-|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	37.0	1.7e-29
AWZ39718.1|186621_186885_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39719.1|187278_187488_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39720.1|187728_188691_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
AWZ39721.1|188705_189992_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39722.1|189994_191764_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39723.1|191995_192631_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39724.1|193388_194231_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39725.1|194334_195153_-	RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AWZ39726.1|195308_196001_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
AWZ39727.1|196007_197507_+	PTS glucose transporter subunit IIBC	NA	NA	NA	NA	NA
AWZ39728.1|197509_197977_+	sugar permease	NA	NA	NA	NA	NA
AWZ39729.1|198039_198393_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AWZ39730.1|198415_199414_-	cell filamentation protein Fic	NA	D7RWK9	Brochothrix_phage	31.1	7.5e-06
AWZ39731.1|199596_200052_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ39732.1|200063_200882_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39733.1|200912_202133_+	permease	NA	NA	NA	NA	NA
AWZ39734.1|202180_203560_-	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	21.6	1.6e-06
AWZ39735.1|203735_204161_+	transcriptional regulator	NA	NA	NA	NA	NA
AWZ39736.1|205208_206030_+	alpha/beta hydrolase	NA	A0A1L7N183	Ralstonia_phage	27.2	4.1e-10
AWZ39737.1|206109_206985_+	sugar hydrolase	NA	NA	NA	NA	NA
AWZ39738.1|207082_207346_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39739.1|207517_208750_-	cell filamentation protein Fic	NA	A0A1V0E025	Clostridioides_phage	25.2	2.4e-09
AWZ39740.1|208805_209129_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39741.1|209265_210330_-	transcriptional regulator	NA	NA	NA	NA	NA
AWZ39742.1|210543_211488_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
AWZ39743.1|211510_212698_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
AWZ39744.1|212719_213859_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
AWZ41534.1|213871_214564_-	N-(5'-phosphoribosyl)anthranilate isomerase	NA	NA	NA	NA	NA
AWZ39745.1|214589_215522_-	carbohydrate kinase	NA	NA	NA	NA	NA
AWZ39746.1|216444_217071_-	haloacid dehalogenase	NA	NA	NA	NA	NA
AWZ39747.1|217074_217881_-	cell surface hydrolase	NA	NA	NA	NA	NA
AWZ39748.1|217877_218486_-	metallophosphatase	NA	L0LAH5	Bacillus_phage	37.4	4.1e-31
AWZ39749.1|218482_219826_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	28.3	3.8e-21
AWZ41535.1|219806_220472_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	38.1	1.0e-35
AWZ39750.1|220603_221143_+	peptidase	NA	NA	NA	NA	NA
AWZ39751.1|221518_222268_+	hypothetical protein	NA	A0A2H4UW38	Bodo_saltans_virus	39.8	9.6e-22
AWZ39752.1|222414_223182_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39753.1|223156_223513_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AWZ41536.1|224832_226140_-	MFS transporter	NA	NA	NA	NA	NA
AWZ39754.1|226262_227435_+|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.0	1.3e-121
AWZ39755.1|227792_228725_+|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	49.7	4.3e-80
AWZ39756.1|228806_229319_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39757.1|229703_230966_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AWZ39758.1|230984_232604_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	45.3	1.3e-108
AWZ39759.1|232701_233169_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ39760.1|233443_234616_-|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	87.6	3.7e-121
233455:233471	attR	ACTTAATATATTTTCTT	NA	NA	NA	NA
AWZ39761.1|235115_235721_+	maltose acetyltransferase	NA	NA	NA	NA	NA
AWZ39762.1|235862_237116_-|transposase	transposase	transposase	A0A288TXV8	Enterococcus_phage	38.9	1.3e-55
AWZ39763.1|237794_238259_-	hypothetical protein	NA	Q331V0	Clostridium_botulinum_C_phage	35.8	2.2e-24
AWZ41537.1|238364_238712_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWZ39764.1|238865_240143_+	MFS transporter	NA	NA	NA	NA	NA
AWZ39765.1|240162_241563_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	28.1	5.0e-32
>prophage 10
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	249926	252537	2288482		Hokovirus(50.0%)	2	NA	NA
AWZ41538.1|249926_251480_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	29.9	2.1e-18
AWZ39768.1|251616_252537_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	37.5	1.9e-35
>prophage 11
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	263114	269222	2288482	transposase	Clostridium_botulinum_C_phage(25.0%)	4	NA	NA
AWZ39775.1|263114_263573_+	hypothetical protein	NA	Q331V0	Clostridium_botulinum_C_phage	36.3	2.5e-25
AWZ39776.1|263514_264669_+|transposase	transposase	transposase	C1KFS0	Lactobacillus_virus	46.9	9.4e-93
AWZ39777.1|265421_266144_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.5	4.9e-15
AWZ39778.1|266708_269222_-	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	32.8	3.3e-135
>prophage 12
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	278734	279487	2288482		Escherichia_phage(100.0%)	1	NA	NA
AWZ39790.1|278734_279487_-	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	26.9	3.0e-15
>prophage 13
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	285141	289947	2288482		Bifidobacterium_phage(25.0%)	6	NA	NA
AWZ39800.1|285141_286023_-	chromosome partitioning protein ParB	NA	I3NLC2	Bifidobacterium_phage	34.3	1.8e-19
AWZ39801.1|286012_286780_-	sporulation initiation inhibitor Soj	NA	Q8JL10	Natrialba_phage	37.1	1.0e-23
AWZ39802.1|286791_287628_-	nucleoid occlusion protein	NA	S5VTK0	Leptospira_phage	38.5	8.2e-14
AWZ39803.1|287630_288374_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
AWZ39804.1|288511_289291_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWZ39805.1|289305_289947_+	2-deoxy-D-gluconate 3-dehydrogenase	NA	S4W232	Pandoravirus	28.7	6.7e-08
>prophage 14
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	293120	307770	2288482		Pandoravirus(28.57%)	15	NA	NA
AWZ39810.1|293120_293780_+	ABC transporter ATP-binding protein	NA	A0A2H4UUX5	Bodo_saltans_virus	22.8	2.6e-07
AWZ39811.1|293779_294580_+	metal ABC transporter permease	NA	NA	NA	NA	NA
AWZ39812.1|294744_295374_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39813.1|295351_296101_-	lantibiotic ABC transporter permease	NA	NA	NA	NA	NA
AWZ39814.1|296093_296783_-	lantibiotic ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	45.2	9.7e-45
AWZ39815.1|296919_298275_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AWZ39816.1|298264_298954_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	29.5	1.6e-18
AWZ39817.1|299152_299806_-	phosphohydrolase	NA	S4W232	Pandoravirus	26.1	1.1e-10
AWZ39818.1|299973_300222_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39819.1|300540_301074_+	ECF transporter S component	NA	NA	NA	NA	NA
AWZ39820.1|301160_301736_-	uracil-DNA glycosylase	NA	NA	NA	NA	NA
AWZ39821.1|301861_302962_-	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	45.7	5.3e-85
AWZ39822.1|303514_304810_+	peptidoglycan endopeptidase	NA	D2KRB9	Lactobacillus_phage	42.7	5.0e-18
AWZ39823.1|304951_306721_-	neopullulanase / cyclomaltodextrinase / maltogenic alpha-amylase	NA	NA	NA	NA	NA
AWZ39824.1|306822_307770_-	peroxidase	NA	S4VXK8	Pandoravirus	28.4	3.8e-15
>prophage 15
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	311453	312395	2288482		Enterobacteria_phage(100.0%)	1	NA	NA
AWZ39827.1|311453_312395_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.6	1.5e-11
>prophage 16
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	322241	324748	2288482		Bacillus_phage(50.0%)	2	NA	NA
AWZ39836.1|322241_323738_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	27.7	7.8e-23
AWZ39837.1|323752_324748_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	29.7	3.7e-21
>prophage 17
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	327971	329534	2288482		Bacillus_phage(100.0%)	1	NA	NA
AWZ39840.1|327971_329534_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.5	4.6e-10
>prophage 18
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	348324	350037	2288482		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AWZ39852.1|348324_350037_+	2-octaprenylphenol hydroxylase	NA	H8ZJ56	Ostreococcus_tauri_virus	28.7	1.7e-37
>prophage 19
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	357698	359601	2288482		Mycoplasma_phage(100.0%)	2	NA	NA
AWZ39862.1|357698_358502_-	spermidine/putrescine ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	27.2	9.3e-15
AWZ39863.1|358512_359601_-	spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	42.5	9.9e-36
>prophage 20
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	370372	372223	2288482		Streptococcus_phage(100.0%)	1	NA	NA
AWZ39875.1|370372_372223_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.1	8.2e-99
>prophage 21
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	375343	434113	2288482	tRNA,transposase,bacteriocin	Bacillus_phage(20.0%)	59	NA	NA
AWZ39878.1|375343_376276_-	glycine/betaine ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	37.4	7.2e-19
AWZ39879.1|376531_378313_-	multidrug ABC transporter permease	NA	W8CYL7	Bacillus_phage	28.4	8.3e-48
AWZ39880.1|378314_380048_-	multidrug ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	20.4	1.7e-05
AWZ39881.1|380204_380513_+	transcriptional regulator	NA	NA	NA	NA	NA
AWZ39882.1|380622_381114_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39883.1|381194_381836_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39884.1|381848_382289_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39885.1|382448_383267_-|transposase	transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	32.1	3.6e-22
AWZ39886.1|383296_384070_-|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	36.6	3.7e-29
AWZ39887.1|384107_384377_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39888.1|384405_385443_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39889.1|385426_386065_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39890.1|386057_386411_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AWZ39891.1|386567_387008_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWZ39892.1|387009_387441_-	response regulator	NA	NA	NA	NA	NA
AWZ39893.1|387705_387969_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39894.1|387980_388358_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39895.1|388357_388792_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AWZ39896.1|388945_390433_+	MFS transporter	NA	NA	NA	NA	NA
AWZ39897.1|390433_391177_+	DUF4811 domain-containing protein	NA	NA	NA	NA	NA
AWZ39898.1|391235_392198_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
AWZ39899.1|392317_392566_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ39900.1|392678_392993_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41540.1|392986_393151_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
AWZ39901.1|393947_395198_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.3	2.8e-58
AWZ39902.1|395671_396115_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39903.1|396120_396876_-	transcriptional regulator	NA	NA	NA	NA	NA
AWZ39904.1|396949_398290_-	6-phospho-alpha-glucosidase	NA	NA	NA	NA	NA
AWZ39905.1|398304_399900_-	alpha-glucoside-specific phosphotransferase enzyme IIB component	NA	NA	NA	NA	NA
AWZ39906.1|400212_400683_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWZ39907.1|400698_401406_-	RNA-binding protein	NA	NA	NA	NA	NA
AWZ39908.1|401672_402524_+	2,5-diketo-D-gluconic acid reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.9	9.1e-53
AWZ39909.1|402544_404461_+	peptidase M13	NA	E3T4I7	Cafeteria_roenbergensis_virus	30.0	3.2e-69
AWZ39910.1|404578_406150_-	sodium:proton antiporter	NA	NA	NA	NA	NA
AWZ39911.1|406198_406681_-	ECF transporter S component	NA	NA	NA	NA	NA
AWZ39912.1|406670_407507_-	pyridoxal kinase	NA	NA	NA	NA	NA
AWZ39913.1|407664_408450_+	acetoin reductase	NA	NA	NA	NA	NA
AWZ39914.1|408514_409186_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ39915.1|409223_410966_-	oligopeptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWZ39916.1|410993_411743_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39917.1|411814_413413_-	oligopeptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWZ41541.1|413576_415223_-	oligopeptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWZ39918.1|415343_416213_-	peptide ABC transporter permease	NA	NA	NA	NA	NA
AWZ39919.1|416226_417186_-	peptide ABC transporter permease	NA	NA	NA	NA	NA
AWZ39920.1|417208_418147_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	3.6e-18
AWZ39921.1|418139_419147_-	dipeptide/oligopeptide/nickel ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.2	1.3e-18
AWZ39922.1|419810_421184_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
AWZ39923.1|421262_422636_-	amino acid permease	NA	NA	NA	NA	NA
AWZ39924.1|423064_423526_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
AWZ39925.1|423616_425530_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
AWZ39926.1|425540_426932_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
AWZ39927.1|427301_427721_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWZ39928.1|427780_429265_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AWZ39929.1|429284_429839_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
AWZ39930.1|430045_431833_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39931.1|432031_432712_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ39932.1|432718_433393_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ39933.1|433562_433874_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39934.1|433885_434113_-|bacteriocin	ComC/BlpC family peptide pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
>prophage 22
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	437874	440031	2288482		Bacillus_phage(100.0%)	1	NA	NA
AWZ39939.1|437874_440031_-	peptide ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.9	3.2e-46
>prophage 23
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	445011	555175	2288482	transposase,bacteriocin	Streptococcus_phage(22.22%)	93	NA	NA
AWZ39948.1|445011_445206_-|bacteriocin	bacteriocin leader domain-containing protein	bacteriocin	NA	NA	NA	NA
AWZ39949.1|445195_445477_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
AWZ39950.1|445709_447020_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ39951.1|447016_447760_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AWZ39952.1|447941_448097_-	plantaricin NC8 alpha peptide precursor	NA	NA	NA	NA	NA
AWZ39953.1|448491_448692_+	DUF1659 domain-containing protein	NA	NA	NA	NA	NA
AWZ39954.1|448710_448947_+	DUF2922 domain-containing protein	NA	NA	NA	NA	NA
AWZ39955.1|449168_449474_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AWZ39956.1|449487_449670_-|bacteriocin	ComC/BlpC family peptide pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
AWZ39957.1|450180_451659_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AWZ39958.1|451671_453558_-	PTS beta-glucoside transporter subunit EIIBCA	NA	NA	NA	NA	NA
AWZ39959.1|453681_454377_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWZ39960.1|454493_455156_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
AWZ39961.1|455230_456451_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39962.1|456592_458293_+|transposase	DDE transposase	transposase	A0ZS58	Staphylococcus_virus	39.2	2.8e-93
AWZ39963.1|458421_459192_-	ABC transporter permease	NA	NA	NA	NA	NA
AWZ39964.1|459188_459968_-	ABC transporter permease	NA	NA	NA	NA	NA
AWZ39965.1|459964_460891_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.2	5.1e-17
AWZ39966.1|461530_463507_-	DNA adenine methylase	NA	A0A1P8BMM5	Lactococcus_phage	40.3	1.7e-62
AWZ39967.1|463655_465434_+	restriction endonuclease	NA	NA	NA	NA	NA
AWZ39968.1|465732_466824_-	phosphoesterase	NA	NA	NA	NA	NA
AWZ39969.1|466952_467621_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
AWZ39970.1|467721_467976_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ39971.1|468035_469271_-	peptidase S8/S53 subtilisin kexin sedolisin	NA	NA	NA	NA	NA
AWZ39972.1|469396_470677_-	permease	NA	NA	NA	NA	NA
AWZ39973.1|471040_472357_-	accessory Sec system glycosylation chaperone GtfB	NA	NA	NA	NA	NA
AWZ39974.1|472349_473867_-	accessory Sec system glycosyltransferase GtfA	NA	NA	NA	NA	NA
AWZ39975.1|476239_477172_-	accessory Sec system protein Asp3	NA	NA	NA	NA	NA
AWZ39976.1|477113_478643_-	accessory Sec system protein Asp2	NA	NA	NA	NA	NA
AWZ39977.1|478654_480181_-	accessory Sec system protein Asp1	NA	NA	NA	NA	NA
AWZ39978.1|480201_481464_-	accessory Sec system protein translocase subunit SecY2	NA	NA	NA	NA	NA
AWZ41542.1|481697_488030_-	accessory Sec-dependent LPXTG-anchored adhesin	NA	NA	NA	NA	NA
AWZ39979.1|488501_489422_+	FMN reductase	NA	A0A2P0ZL82	Lactobacillus_phage	44.1	3.2e-51
AWZ39980.1|489421_490393_+	thiamine biosynthesis protein ApbE	NA	NA	NA	NA	NA
AWZ41543.1|490494_491280_-	protein translocase component YidC	NA	NA	NA	NA	NA
AWZ39981.1|491339_491696_-	ribonuclease P protein component	NA	NA	NA	NA	NA
AWZ39982.1|491761_491896_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
AWZ39983.1|492413_493760_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
AWZ39984.1|493934_495074_+	DNA polymerase III subunit beta	NA	A0A0A8IL17	Aurantimonas_phage	26.9	9.7e-34
AWZ39985.1|495322_495547_+	RNA-binding protein	NA	NA	NA	NA	NA
AWZ39986.1|495555_496773_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
AWZ39987.1|496793_498752_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	46.4	4.0e-144
AWZ39988.1|498849_501312_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	36.8	1.7e-112
AWZ39989.1|502387_502678_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
AWZ39990.1|502714_503269_+	single-stranded DNA-binding protein	NA	A0A218MNB4	uncultured_virus	60.5	8.6e-44
AWZ39991.1|503290_503527_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
AWZ39992.1|504106_504637_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39993.1|504797_505004_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ39994.1|505202_505730_+	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	33.1	8.2e-12
AWZ39995.1|505845_506286_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ39996.1|506458_506734_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ39997.1|506801_507764_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
AWZ39998.1|508024_508471_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ39999.1|508501_508822_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ40000.1|510177_512337_+	peptide ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.8	5.2e-44
AWZ40001.1|512350_513433_+	hemolysin D	NA	NA	NA	NA	NA
AWZ40002.1|513454_514213_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ40003.1|514389_514530_+|bacteriocin	ComC/BlpC family peptide pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
AWZ40004.1|515005_515824_-|transposase	transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	32.1	3.6e-22
AWZ40005.1|515853_516627_-|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	36.6	3.7e-29
AWZ40006.1|516722_517706_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ40007.1|517985_518756_+	nicotinamide mononucleotide transporter	NA	A0A0A7NTY4	Lactobacillus_phage	35.2	4.4e-30
AWZ40008.1|518997_521013_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ40009.1|521040_521490_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
AWZ40010.1|521974_522859_-	transcriptional regulator	NA	NA	NA	NA	NA
AWZ40011.1|522981_523902_+	EamA family transporter	NA	NA	NA	NA	NA
AWZ40012.1|524124_524547_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ40013.1|524630_525248_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ40014.1|525280_525904_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ40015.1|526071_527460_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	53.8	3.5e-126
AWZ40016.1|527527_529405_+	asparagine synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
AWZ40017.1|530174_530741_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ40018.1|530703_531042_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ40019.1|531057_531513_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.0	7.3e-33
AWZ40020.1|531586_532837_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.3	2.8e-58
AWZ40021.1|533158_534517_-	aspartate kinase	NA	NA	NA	NA	NA
AWZ40022.1|534546_536034_-	threonine synthase	NA	NA	NA	NA	NA
AWZ40023.1|536200_537484_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
AWZ40024.1|537487_538360_+	homoserine kinase	NA	NA	NA	NA	NA
AWZ40025.1|538687_539902_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ40026.1|540032_541127_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41544.1|542020_543556_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
AWZ40027.1|543555_544812_+	carboxylate--amine ligase	NA	NA	NA	NA	NA
AWZ40028.1|544818_545535_+	aspartate racemase	NA	NA	NA	NA	NA
AWZ40029.1|546263_546542_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ40030.1|546623_547562_+	ferrochelatase	NA	NA	NA	NA	NA
AWZ40031.1|547677_548325_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ40032.1|548442_550248_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	40.1	2.7e-123
AWZ40033.1|550410_551238_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
AWZ40034.1|551251_552175_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	61.7	7.2e-104
AWZ40035.1|552310_553210_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ40036.1|553448_554135_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ40037.1|554212_555175_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 24
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	562609	563785	2288482		Pandoravirus(100.0%)	1	NA	NA
AWZ40046.1|562609_563785_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	31.3	2.2e-33
>prophage 25
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	568638	576542	2288482		Tetraselmis_virus(50.0%)	6	NA	NA
AWZ40052.1|568638_569937_+	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	35.6	6.2e-69
AWZ40053.1|570161_572423_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.0	1.7e-167
AWZ40054.1|572462_573293_+	pyruvate formate-lyase 1-activating enzyme	NA	A0A2P0VNQ0	Tetraselmis_virus	28.5	4.9e-27
AWZ40055.1|573440_573941_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ40056.1|574009_574840_-	cobalt ABC transporter permease	NA	NA	NA	NA	NA
AWZ40057.1|574832_576542_-	heme ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.8	1.9e-17
>prophage 26
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	579651	582315	2288482		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AWZ40060.1|579651_582315_-	magnesium-transporting ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	27.7	6.1e-63
>prophage 27
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	588530	637971	2288482	transposase,protease	Bacillus_phage(20.0%)	30	NA	NA
AWZ40066.1|588530_589244_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	40.2	8.5e-44
AWZ40067.1|589245_591111_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	35.0	2.6e-36
AWZ40068.1|591100_592468_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ40069.1|592457_593270_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ40070.1|593291_594098_+	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	38.5	1.5e-36
AWZ40071.1|594212_595517_+|protease	serine protease	protease	W5SAB9	Pithovirus	32.5	1.2e-14
AWZ40072.1|595732_596212_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
AWZ40073.1|596499_596748_+	signal peptide protein	NA	NA	NA	NA	NA
AWZ40074.1|599764_600220_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.7	1.9e-33
AWZ40075.1|600293_601544_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.3	2.8e-58
AWZ40076.1|601748_601943_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ40077.1|601995_602865_-	YitT family protein	NA	NA	NA	NA	NA
AWZ40078.1|603182_608765_+	YSIRK signal domain/LPXTG anchor domain surface protein	NA	NA	NA	NA	NA
AWZ40079.1|609319_615889_+	YSIRK signal domain/LPXTG anchor domain surface protein	NA	NA	NA	NA	NA
AWZ41547.1|616014_616488_-	universal stress protein	NA	NA	NA	NA	NA
AWZ40080.1|616560_617448_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWZ40081.1|617505_618252_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	56.7	1.9e-70
AWZ40082.1|618471_618948_+	nucleoside 2-deoxyribosyltransferase	NA	A0A1D3SPR3	Enterococcus_phage	37.4	3.2e-15
AWZ40083.1|619092_619320_+	transcriptional regulator	NA	NA	NA	NA	NA
AWZ40084.1|619479_621627_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	37.8	2.6e-120
AWZ40085.1|621730_622279_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
AWZ40086.1|622369_623815_-	glutamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWZ40087.1|623976_624732_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
AWZ40088.1|624772_625957_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ40089.1|626252_627542_+	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
AWZ40090.1|627541_628441_+	PEP phosphonomutase	NA	NA	NA	NA	NA
AWZ40091.1|628452_628770_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
AWZ40092.1|628781_629099_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
AWZ40093.1|629182_636133_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ40094.1|636315_637971_+|transposase	DDE transposase	transposase	A0ZS58	Staphylococcus_virus	39.2	2.7e-93
>prophage 28
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	647912	652754	2288482		Mycobacterium_phage(50.0%)	4	NA	NA
AWZ40106.1|647912_649271_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	22.6	2.4e-10
AWZ40107.1|650201_650468_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ40108.1|650479_651823_+	PFL family protein	NA	NA	NA	NA	NA
AWZ40109.1|651998_652754_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	33.8	2.8e-21
>prophage 29
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	662950	663883	2288482		Oenococcus_phage(100.0%)	1	NA	NA
AWZ40116.1|662950_663883_+	glycosyltransferase	NA	V5USA4	Oenococcus_phage	51.8	7.1e-83
>prophage 30
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	667452	668568	2288482		Streptococcus_phage(100.0%)	1	NA	NA
AWZ40119.1|667452_668568_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	78.3	2.8e-171
>prophage 31
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	675935	686943	2288482		Enterobacteria_phage(50.0%)	11	NA	NA
AWZ41550.1|675935_676931_+	glycosyl transferase family 2	NA	A0A1V0SAH6	Catovirus	41.7	2.0e-14
AWZ40126.1|676942_677866_+	glycosyl transferase family 2	NA	NA	NA	NA	NA
AWZ40127.1|677882_678875_+	L-Rha 1,3-L-rhamnosyltransferase	NA	NA	NA	NA	NA
AWZ40128.1|678972_679725_-	family 2 glycosyl transferase	NA	NA	NA	NA	NA
AWZ40129.1|679784_681587_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	30.1	5.8e-65
AWZ40130.1|681864_682728_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	43.8	1.9e-21
AWZ40131.1|682845_683577_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ40132.1|683859_684372_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ40133.1|684496_685366_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	61.1	2.0e-103
AWZ40134.1|685382_685952_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	44.1	4.0e-36
AWZ40135.1|685956_686943_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	45.7	4.0e-76
>prophage 32
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	698764	758177	2288482	transposase,bacteriocin	Lactobacillus_phage(15.0%)	50	NA	NA
AWZ40148.1|698764_699583_-|transposase	transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	32.1	3.6e-22
AWZ40149.1|700506_702162_+|transposase	DDE transposase	transposase	A0ZS58	Staphylococcus_virus	39.0	2.3e-92
AWZ40150.1|702167_702980_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWZ40151.1|702995_703742_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	38.7	3.7e-26
AWZ40152.1|703755_704454_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWZ41551.1|704661_705078_+	XRE family transcriptional regulator	NA	A0A0H4ITV7	Staphylococcus_phage	40.0	1.7e-07
AWZ41552.1|705070_705907_+	membrane protein	NA	NA	NA	NA	NA
AWZ40153.1|706298_707672_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
AWZ40154.1|707756_708485_+	DUF475 domain-containing protein	NA	A0A068EP98	Bacillus_phage	42.9	1.2e-40
AWZ40155.1|708496_709021_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWZ40156.1|709042_709354_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	35.8	3.0e-14
AWZ40157.1|709435_710284_+	fatty acid-binding protein DegV	NA	NA	NA	NA	NA
AWZ40158.1|710413_711178_-	SDR family oxidoreductase	NA	A0A0G2Y924	Acanthamoeba_polyphaga_mimivirus	34.7	9.8e-06
AWZ40159.1|711177_711405_-	DUF2829 domain-containing protein	NA	NA	NA	NA	NA
AWZ40160.1|711419_711908_-	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	35.9	6.2e-14
AWZ40161.1|712106_715130_+	hypothetical protein	NA	L0P6H6	Lactobacillus_phage	38.7	5.8e-09
AWZ40162.1|715630_724372_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ40163.1|724455_725097_-|bacteriocin	bacteriocin ABC transporter ATP-binding protein	bacteriocin	G9BWD6	Planktothrix_phage	36.5	1.2e-25
AWZ40164.1|725086_727174_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ40165.1|727445_727871_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ40166.1|727840_729520_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ40167.1|729755_730472_-	transcriptional regulator	NA	NA	NA	NA	NA
AWZ40168.1|730787_731927_+	thiamine biosynthesis protein ThiF	NA	A0A1V0SCZ9	Indivirus	30.8	2.3e-11
AWZ40169.1|731904_732630_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	35.3	3.0e-28
AWZ40170.1|732829_733594_+	ABC transporter permease	NA	NA	NA	NA	NA
AWZ40171.1|733637_734015_-	VOC family virulence protein	NA	NA	NA	NA	NA
AWZ40172.1|734020_735343_-	MATE family efflux transporter	NA	NA	NA	NA	NA
AWZ40173.1|735611_736484_+	fructokinase	NA	NA	NA	NA	NA
AWZ40174.1|736554_737280_-	cobalt ABC transporter	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.2	1.2e-16
AWZ40175.1|737301_738105_-	cobalt transport protein	NA	NA	NA	NA	NA
AWZ40176.1|738088_739108_-	cobalamin biosynthesis protein CbiM	NA	NA	NA	NA	NA
AWZ40177.1|739494_740703_+	ammonium transporter	NA	NA	NA	NA	NA
AWZ40178.1|740749_741268_+	acid-activated urea channel	NA	NA	NA	NA	NA
AWZ40179.1|741299_741602_+	urease subunit gamma	NA	NA	NA	NA	NA
AWZ40180.1|741622_741967_+	urease subunit beta	NA	NA	NA	NA	NA
AWZ40181.1|741983_743705_+	urease subunit alpha	NA	NA	NA	NA	NA
AWZ40182.1|743807_744263_+	urease accessory protein UreE	NA	NA	NA	NA	NA
AWZ40183.1|744252_744966_+	urease accessory protein UreF	NA	NA	NA	NA	NA
AWZ40184.1|744978_745608_+	urease accessory protein UreG	NA	NA	NA	NA	NA
AWZ40185.1|745618_746464_+	urease accessory protein	NA	NA	NA	NA	NA
AWZ40186.1|746484_746868_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	40.5	1.7e-06
AWZ40187.1|746887_747283_+	CrcB family protein	NA	NA	NA	NA	NA
AWZ40188.1|747372_747828_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.0	7.3e-33
AWZ40189.1|747901_749152_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.3	3.6e-58
AWZ40190.1|749413_750130_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWZ40191.1|751081_752044_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
AWZ40192.1|753457_755134_-|transposase	DDE transposase	transposase	A0ZS58	Staphylococcus_virus	39.3	1.8e-92
AWZ40193.1|755243_755723_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	53.5	1.6e-33
AWZ40194.1|755796_757047_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.3	2.8e-58
AWZ40195.1|757238_758177_+	linear amide C-N hydrolase	NA	M1HVK5	Paramecium_bursaria_Chlorella_virus	31.5	2.3e-28
>prophage 33
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	784808	797928	2288482		Planktothrix_phage(25.0%)	12	NA	NA
AWZ40218.1|784808_785897_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.5	1.7e-19
AWZ40219.1|785914_786868_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.3	6.1e-21
AWZ40220.1|787010_788324_-	guanine permease	NA	A0A0R6PHV4	Moraxella_phage	30.3	4.5e-43
AWZ40221.1|788480_789788_+	cellobiose PTS, EIIC	NA	NA	NA	NA	NA
AWZ40222.1|789774_790635_+	acyltransferase	NA	NA	NA	NA	NA
AWZ40223.1|790686_791496_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.0	3.8e-40
AWZ40224.1|791495_792740_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	51.4	7.5e-104
AWZ40225.1|792884_793640_+	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
AWZ40226.1|793774_794488_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ40227.1|794580_795270_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	37.6	4.4e-37
AWZ40228.1|795291_796440_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.7	2.1e-28
AWZ40229.1|796590_797928_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	31.6	3.3e-25
>prophage 34
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	801274	803677	2288482		Streptococcus_phage(50.0%)	3	NA	NA
AWZ40231.1|801274_802105_-	fatty acid-binding protein DegV	NA	A0A1X9I5J4	Streptococcus_phage	39.2	1.1e-50
AWZ40232.1|802263_802767_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ40233.1|802777_803677_+	sodium ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.3	6.7e-22
>prophage 35
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	819071	819272	2288482		Lactococcus_phage(100.0%)	1	NA	NA
AWZ40250.1|819071_819272_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	72.3	2.8e-21
>prophage 36
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	829805	831092	2288482	tRNA	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AWZ40261.1|829805_831092_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.5	4.1e-97
>prophage 37
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	839711	844544	2288482		Tupanvirus(33.33%)	5	NA	NA
AWZ40265.1|839711_840728_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.2	2.1e-24
AWZ40266.1|840905_842273_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AWZ40267.1|842558_843212_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AWZ40268.1|843284_843599_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	45.0	2.3e-17
AWZ40269.1|843617_844544_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	52.1	2.0e-85
>prophage 38
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	847690	849103	2288482		Staphylococcus_phage(100.0%)	1	NA	NA
AWZ41555.1|847690_849103_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	34.1	8.6e-64
>prophage 39
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	857653	858658	2288482		Enterobacteria_phage(100.0%)	1	NA	NA
AWZ40278.1|857653_858658_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	29.8	2.9e-05
>prophage 40
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	867417	869649	2288482		uncultured_virus(100.0%)	1	NA	NA
AWZ40286.1|867417_869649_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.9	3.6e-109
>prophage 41
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	885646	886750	2288482		uncultured_virus(100.0%)	1	NA	NA
AWZ40301.1|885646_886750_-	hypothetical protein	NA	A0A218MNE0	uncultured_virus	43.6	2.3e-72
>prophage 42
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	894363	894792	2288482		Moumouvirus(100.0%)	1	NA	NA
AWZ40308.1|894363_894792_+	nucleoside-diphosphate kinase	NA	M1PH31	Moumouvirus	31.6	1.4e-14
>prophage 43
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	901540	901951	2288482		Caulobacter_phage(100.0%)	1	NA	NA
AWZ40315.1|901540_901951_-	peptide deformylase	NA	A0A067XQZ3	Caulobacter_phage	41.8	3.3e-08
>prophage 44
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	914652	921062	2288482	tRNA	uncultured_virus(33.33%)	5	NA	NA
AWZ40329.1|914652_915195_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	26.4	2.1e-10
AWZ40330.1|915274_917395_+	cell division protein FtsH	NA	M4QMW8	Micromonas_pusilla_virus	47.8	9.7e-104
AWZ40331.1|917507_918395_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
AWZ40332.1|918465_919461_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
AWZ40333.1|919565_921062_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	36.9	1.0e-86
>prophage 45
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	927508	930196	2288482		Acinetobacter_phage(50.0%)	2	NA	NA
AWZ40334.1|927508_928978_+	peptide ABC transporter permease	NA	A0A0P0IY73	Acinetobacter_phage	38.4	2.7e-76
AWZ40335.1|929395_930196_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	34.6	2.7e-30
>prophage 46
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	934740	938935	2288482		Bacillus_virus(66.67%)	3	NA	NA
AWZ40341.1|934740_936210_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	46.6	1.1e-111
AWZ40342.1|936224_937052_+	NAD(+) synthase	NA	G3MA24	Bacillus_virus	55.8	9.7e-76
AWZ40343.1|937159_938935_-	DNA helicase RecQ	NA	A0A2K9L3P7	Tupanvirus	35.9	2.6e-70
>prophage 47
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	948363	952944	2288482		Bacillus_phage(66.67%)	6	NA	NA
AWZ40351.1|948363_948891_+	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	32.5	9.1e-11
AWZ40352.1|948911_949751_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ40353.1|949801_951136_-	aminopeptidase	NA	R4TV59	Phaeocystis_globosa_virus	33.9	4.0e-71
AWZ40354.1|951272_951959_-	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
AWZ40355.1|951983_952271_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWZ40356.1|952407_952944_+	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	50.8	2.0e-42
>prophage 48
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	957585	958995	2288482	tRNA	Moumouvirus(100.0%)	1	NA	NA
AWZ40360.1|957585_958995_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	31.2	4.4e-52
>prophage 49
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	974572	975124	2288482		Bacillus_virus(100.0%)	1	NA	NA
AWZ40371.1|974572_975124_+	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	30.9	3.9e-12
>prophage 50
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	984550	991506	2288482		Enterococcus_phage(66.67%)	7	NA	NA
AWZ40380.1|984550_985501_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	67.1	5.5e-123
AWZ40381.1|985516_987688_-	ribonucleotide-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	61.8	2.5e-256
AWZ40382.1|987677_988052_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A1W6JK40	Lactococcus_phage	42.0	2.4e-13
AWZ40383.1|988048_988279_-	NrdH-redoxin	NA	X2KRY7	Enterococcus_phage	39.0	8.0e-12
AWZ40384.1|988447_989041_-	peptidoglycan-binding protein LysM	NA	A0A288TY55	Enterococcus_phage	57.5	3.2e-28
AWZ40385.1|989280_990456_+	acetate kinase	NA	NA	NA	NA	NA
AWZ40386.1|990534_991506_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	35.9	3.4e-43
>prophage 51
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	995126	1003870	2288482		Bacillus_phage(33.33%)	3	NA	NA
AWZ40388.1|995126_998870_+	helicase-exonuclease AddAB subunit AddA	NA	S5MMD7	Bacillus_phage	23.7	3.8e-10
AWZ40389.1|999099_1001754_-	ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	27.6	7.5e-61
AWZ40390.1|1002325_1003870_+	ABC transporter ATP-binding protein	NA	A0A1V0SKJ1	Klosneuvirus	25.2	3.1e-43
>prophage 52
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1009143	1010184	2288482		Planktothrix_phage(100.0%)	1	NA	NA
AWZ40396.1|1009143_1010184_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.4	4.1e-31
>prophage 53
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1013714	1018983	2288482		Enterococcus_phage(33.33%)	3	NA	NA
AWZ40401.1|1013714_1016561_+	NgoFVII family restriction endonuclease	NA	A0A097BY72	Enterococcus_phage	27.6	3.6e-29
AWZ40402.1|1016683_1018171_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.3	9.2e-101
AWZ40403.1|1018308_1018983_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.2	6.1e-36
>prophage 54
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1026907	1030761	2288482		Enterococcus_phage(50.0%)	5	NA	NA
AWZ40412.1|1026907_1027558_+	peptidoglycan-binding protein LysM	NA	A0A0E3XCL7	Enterococcus_phage	72.6	3.1e-24
AWZ40413.1|1027713_1027896_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ40414.1|1027978_1028209_+	cytochrome B5	NA	NA	NA	NA	NA
AWZ40415.1|1028254_1029490_-	aminopeptidase	NA	NA	NA	NA	NA
AWZ40416.1|1029618_1030761_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	31.9	3.4e-26
>prophage 55
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1035684	1040372	2288482		Bacillus_phage(50.0%)	5	NA	NA
AWZ40420.1|1035684_1036557_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	50.9	1.1e-77
AWZ40421.1|1036616_1037129_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
AWZ40422.1|1037139_1038060_+	ribonuclease BN	NA	NA	NA	NA	NA
AWZ40423.1|1038096_1038894_-	recombination regulator RecX	NA	NA	NA	NA	NA
AWZ40424.1|1038980_1040372_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	38.5	5.6e-84
>prophage 56
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1044295	1044823	2288482		Bacillus_phage(100.0%)	1	NA	NA
AWZ40429.1|1044295_1044823_-	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	33.1	8.2e-12
>prophage 57
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1048425	1053983	2288482	protease	Streptococcus_phage(50.0%)	4	NA	NA
AWZ40433.1|1048425_1050003_+	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	26.5	1.6e-31
AWZ40434.1|1050095_1051247_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ40435.1|1051392_1051668_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ40436.1|1051820_1053983_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	39.5	3.6e-122
>prophage 58
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1061480	1063544	2288482		Streptococcus_phage(100.0%)	1	NA	NA
AWZ40445.1|1061480_1063544_+	glycerol phosphate lipoteichoic acid synthase	NA	W6LM83	Streptococcus_phage	46.9	7.6e-154
>prophage 59
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1077853	1081471	2288482	tRNA	Pandoravirus(50.0%)	5	NA	NA
AWZ41558.1|1077853_1078561_+	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	43.7	4.5e-45
AWZ40452.1|1078561_1079539_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
AWZ40453.1|1079540_1079993_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
AWZ40454.1|1080140_1080680_-	exonuclease	NA	NA	NA	NA	NA
AWZ40455.1|1080709_1081471_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	45.7	5.8e-59
>prophage 60
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1088718	1089246	2288482		Bacillus_phage(100.0%)	1	NA	NA
AWZ40463.1|1088718_1089246_-	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	33.1	8.2e-12
>prophage 61
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1095345	1097778	2288482		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
AWZ40467.1|1095345_1097778_+	glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	2.0e-12
>prophage 62
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1102441	1104026	2288482		Planktothrix_phage(100.0%)	2	NA	NA
AWZ40472.1|1102441_1103251_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.8	8.8e-13
AWZ40473.1|1103264_1104026_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.1	6.5e-18
>prophage 63
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1114329	1115951	2288482	transposase	Paenibacillus_phage(100.0%)	2	NA	NA
AWZ40484.1|1114329_1115148_-|transposase	transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	32.1	3.6e-22
AWZ40485.1|1115177_1115951_-|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	37.0	1.7e-29
>prophage 64
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1132409	1139739	2288482	transposase	Amsacta_moorei_entomopoxvirus(33.33%)	5	NA	NA
AWZ40488.1|1132409_1133159_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	26.1	4.3e-06
AWZ40489.1|1133155_1134052_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWZ40490.1|1134048_1135038_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWZ40491.1|1135941_1137612_+|transposase	DDE transposase	transposase	A0ZS58	Staphylococcus_virus	39.2	2.7e-93
AWZ40492.1|1137594_1139739_-	alkaline phosphatase	NA	W6LM83	Streptococcus_phage	48.4	2.2e-172
>prophage 65
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1143375	1144113	2288482		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AWZ40496.1|1143375_1144113_-	aquaporin family protein	NA	M1HBN0	Acanthocystis_turfacea_Chlorella_virus	35.7	1.7e-31
>prophage 66
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1161246	1162969	2288482		Streptococcus_phage(50.0%)	2	NA	NA
AWZ40519.1|1161246_1162254_-	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	44.4	1.6e-19
AWZ40520.1|1162396_1162969_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	43.3	2.1e-29
>prophage 67
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1170915	1177866	2288482	tRNA	Staphylococcus_phage(66.67%)	4	NA	NA
AWZ40522.1|1170915_1172109_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	69.4	4.9e-145
AWZ41560.1|1172460_1172646_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ40523.1|1172862_1175148_+	N-acetylmuramoyl-L-alanine amidase	NA	M1HNA7	Bacillus_virus	45.6	1.7e-13
AWZ40524.1|1175454_1177866_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	70.2	0.0e+00
>prophage 68
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1188131	1209560	2288482	tRNA,transposase	Staphylococcus_virus(12.5%)	16	NA	NA
AWZ40536.1|1188131_1189823_-|transposase	DDE transposase	transposase	A0ZS58	Staphylococcus_virus	39.4	3.6e-93
AWZ40537.1|1189994_1190555_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ40538.1|1190719_1191169_+	universal stress protein	NA	NA	NA	NA	NA
AWZ40539.1|1191300_1191504_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ40540.1|1191668_1194281_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	24.3	7.9e-39
AWZ40541.1|1194296_1196276_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	29.6	5.0e-62
AWZ40542.1|1196347_1196953_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AWZ40543.1|1196972_1197980_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	29.4	1.5e-09
AWZ40544.1|1197994_1199038_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
AWZ40545.1|1199166_1200312_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	43.8	3.8e-86
AWZ40546.1|1200393_1200741_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
AWZ40547.1|1200859_1201774_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
AWZ40548.1|1201900_1204897_-	glycoside hydrolase family 2	NA	L0N6M2	Herpes_simplex_virus	34.0	5.9e-147
AWZ40549.1|1205191_1207120_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AWZ40550.1|1207251_1208490_+	serine hydroxymethyltransferase	NA	A0A219YB23	Aeromonas_phage	54.2	1.2e-106
AWZ40551.1|1208549_1209560_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.6	3.8e-13
>prophage 69
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1222450	1227449	2288482		Synechococcus_phage(50.0%)	4	NA	NA
AWZ40561.1|1222450_1223929_+	glucose-6-phosphate dehydrogenase	NA	A0A1D8KIX9	Synechococcus_phage	33.2	6.4e-70
AWZ40562.1|1224003_1225089_+	DNA polymerase IV	NA	NA	NA	NA	NA
AWZ40563.1|1225152_1226103_+	DHH family phosphoesterase	NA	NA	NA	NA	NA
AWZ40564.1|1226117_1227449_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.5	3.9e-50
>prophage 70
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1231890	1250049	2288482	integrase,tRNA	Streptococcus_phage(37.5%)	21	1227427:1227449	1238086:1238108
1227427:1227449	attL	AACGTAAAAATCAACGTTCGTAA	NA	NA	NA	NA
AWZ40566.1|1231890_1232805_+	transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	24.3	4.5e-05
AWZ40567.1|1232875_1233490_+	glutamine amidotransferase	NA	NA	NA	NA	NA
AWZ40568.1|1234665_1234914_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AWZ41562.1|1235294_1235498_+	excisionase	NA	A0A1S5SF07	Streptococcus_phage	82.1	2.5e-25
AWZ40569.1|1235576_1236767_+|integrase	site-specific integrase	integrase	A0A1S5SEW7	Streptococcus_phage	67.5	3.1e-155
AWZ40570.1|1237295_1237640_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ40571.1|1237741_1238053_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ40572.1|1238381_1241027_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.0	7.2e-64
1238086:1238108	attR	AACGTAAAAATCAACGTTCGTAA	NA	NA	NA	NA
AWZ40573.1|1241201_1241465_+	DUF965 domain-containing protein	NA	NA	NA	NA	NA
AWZ41563.1|1241476_1241905_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
AWZ40574.1|1241924_1242212_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ40575.1|1242357_1242609_+	cell division protein ZapA	NA	NA	NA	NA	NA
AWZ40576.1|1242616_1243135_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ40577.1|1243124_1245485_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	49.6	3.6e-22
AWZ40578.1|1245565_1245877_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	44.0	6.1e-15
AWZ40579.1|1245972_1246458_-	DUF2507 domain-containing protein	NA	NA	NA	NA	NA
AWZ40580.1|1246592_1247195_+	non-canonical purine NTP pyrophosphatase	NA	A0A2H4UUV7	Bodo_saltans_virus	29.2	3.1e-07
AWZ40581.1|1247196_1247730_+	YfcE family phosphodiesterase	NA	NA	NA	NA	NA
AWZ40582.1|1248187_1248511_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ40583.1|1248661_1249501_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ40584.1|1249521_1250049_-	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	33.1	8.2e-12
>prophage 71
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1254366	1255107	2288482		Planktothrix_phage(100.0%)	1	NA	NA
AWZ40588.1|1254366_1255107_+	peptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.2	4.4e-35
>prophage 72
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1267345	1272161	2288482		Mycobacterium_phage(50.0%)	2	NA	NA
AWZ40599.1|1267345_1271761_+	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	23.2	4.9e-33
AWZ40600.1|1271693_1272161_+	hypothetical protein	NA	A0A1X9I6T6	Streptococcus_phage	38.1	1.2e-06
>prophage 73
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1286566	1290130	2288482		Lactobacillus_virus(33.33%)	4	NA	NA
AWZ40619.1|1286566_1287157_+	thymidine kinase	NA	C1KFH3	Lactobacillus_virus	49.5	2.0e-46
AWZ40620.1|1287167_1288253_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	42.2	6.9e-05
AWZ40621.1|1288245_1289082_+	protein-(glutamine-N5) methyltransferase, release factor-specific	NA	NA	NA	NA	NA
AWZ40622.1|1289101_1290130_+	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	41.7	1.1e-57
>prophage 74
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1300468	1310574	2288482		Staphylococcus_phage(16.67%)	12	NA	NA
AWZ40635.1|1300468_1300726_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	48.8	2.1e-16
AWZ40636.1|1300747_1300969_+	DUF2969 domain-containing protein	NA	NA	NA	NA	NA
AWZ40637.1|1301061_1302264_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
AWZ40638.1|1302275_1302629_+	arsenate reductase	NA	M1PLC0	Streptococcus_phage	37.0	3.5e-14
AWZ40639.1|1302690_1303431_-	gamma-glutamyl hydrolase	NA	NA	NA	NA	NA
AWZ40640.1|1303545_1304325_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	28.4	3.9e-10
AWZ40641.1|1304337_1305627_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
AWZ40642.1|1305607_1306834_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	47.3	1.9e-107
AWZ40643.1|1306830_1307283_+	SUF system NifU family Fe-S cluster assembly protein	NA	A0A2H4N7M4	Lake_Baikal_phage	28.5	1.1e-07
AWZ40644.1|1307275_1308679_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
AWZ40645.1|1308809_1309637_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ40646.1|1309725_1310574_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.1	1.1e-16
>prophage 75
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1314973	1315816	2288482		Staphylococcus_phage(100.0%)	1	NA	NA
AWZ40651.1|1314973_1315816_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.9	8.5e-19
>prophage 76
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1324270	1328175	2288482		Bacillus_phage(100.0%)	5	NA	NA
AWZ40659.1|1324270_1324798_+	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	32.5	4.1e-11
AWZ40660.1|1324818_1325658_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ40661.1|1325720_1326209_-	universal stress protein	NA	NA	NA	NA	NA
AWZ40662.1|1326278_1326578_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ40663.1|1326906_1328175_-	recombinase RarA	NA	A0A127AWE7	Bacillus_phage	50.1	2.6e-104
>prophage 77
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1335981	1344258	2288482	tRNA	Faustovirus(33.33%)	7	NA	NA
AWZ40671.1|1335981_1337130_+	aminotransferase	NA	A0A0H3TPH2	Faustovirus	29.1	2.0e-34
AWZ40672.1|1337148_1338366_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
AWZ40673.1|1338666_1341330_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.8	1.3e-161
AWZ40674.1|1341424_1342696_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AWZ40675.1|1342712_1343369_+	HAD family phosphatase	NA	NA	NA	NA	NA
AWZ40676.1|1343418_1344042_+	DNA repair protein	NA	NA	NA	NA	NA
AWZ40677.1|1344051_1344258_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	51.5	5.5e-12
>prophage 78
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1349545	1350184	2288482		Bacillus_virus(100.0%)	1	NA	NA
AWZ40684.1|1349545_1350184_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.1	9.0e-29
>prophage 79
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1367645	1370441	2288482	tRNA	Klosneuvirus(100.0%)	1	NA	NA
AWZ40702.1|1367645_1370441_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.9	1.0e-84
>prophage 80
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1376231	1378625	2288482		Brevibacillus_phage(100.0%)	1	NA	NA
AWZ40710.1|1376231_1378625_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	26.9	7.7e-57
>prophage 81
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1382639	1383194	2288482		Synechococcus_phage(100.0%)	1	NA	NA
AWZ40715.1|1382639_1383194_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.0	1.3e-12
>prophage 82
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1394687	1396417	2288482		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
AWZ40726.1|1394687_1395158_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	40.5	2.4e-23
AWZ40727.1|1395220_1395502_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ40728.1|1395572_1395869_+	competence protein ComE	NA	NA	NA	NA	NA
AWZ40729.1|1395928_1396417_+	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	56.7	4.2e-34
>prophage 83
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1403658	1411686	2288482	protease	Bacillus_phage(40.0%)	6	NA	NA
AWZ40736.1|1403658_1404846_+	elongation factor Tu	NA	A0A076FFS6	Aureococcus_anophage	29.7	8.0e-31
AWZ40737.1|1405014_1406301_+	trigger factor	NA	NA	NA	NA	NA
AWZ40738.1|1406470_1407706_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	60.8	3.3e-136
AWZ40739.1|1407786_1409211_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.5	3.9e-40
AWZ40740.1|1409470_1410157_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	31.1	3.6e-31
AWZ40741.1|1410156_1411686_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.6	1.5e-21
>prophage 84
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1424752	1428761	2288482		Streptococcus_phage(33.33%)	3	NA	NA
AWZ40752.1|1424752_1426582_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.0	1.0e-24
AWZ40753.1|1426782_1427802_+	dipeptide/oligopeptide/nickel ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.7	5.5e-20
AWZ40754.1|1427798_1428761_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.7	2.0e-16
>prophage 85
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1432483	1439896	2288482	transposase	Streptococcus_phage(33.33%)	9	NA	NA
AWZ40758.1|1432483_1433845_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.0	1.4e-42
AWZ40759.1|1434590_1435562_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
AWZ40760.1|1435894_1436395_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	35.2	7.6e-15
AWZ40761.1|1436427_1436628_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AWZ40762.1|1436774_1437134_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AWZ40763.1|1437273_1437807_+	YqeG family HAD IIIA-type phosphatase	NA	NA	NA	NA	NA
AWZ40764.1|1437799_1438915_+	ribosome biogenesis GTPase YqeH	NA	NA	NA	NA	NA
AWZ40765.1|1438930_1439242_+	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
AWZ40766.1|1439254_1439896_+	nicotinate-nucleotide adenylyltransferase	NA	G3MA22	Bacillus_virus	29.1	3.2e-18
>prophage 86
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1444379	1447285	2288482		Listeria_phage(50.0%)	3	NA	NA
AWZ40774.1|1444379_1444679_+	nucleotide pyrophosphohydrolase	NA	A0A1S7FYY8	Listeria_phage	48.5	2.5e-21
AWZ40775.1|1445088_1446558_+	ABC transporter permease	NA	NA	NA	NA	NA
AWZ40776.1|1446550_1447285_+	glutamine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-31
>prophage 87
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1450667	1461964	2288482		Pseudomonas_phage(40.0%)	11	NA	NA
AWZ40779.1|1450667_1452551_+	acetyltransferase	NA	B5WZU0	Pseudomonas_phage	28.6	2.3e-32
AWZ40780.1|1452586_1452862_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ40781.1|1453103_1454054_+	ribonuclease Z	NA	NA	NA	NA	NA
AWZ40782.1|1454053_1454863_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AWZ40783.1|1454882_1455197_+	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
AWZ40784.1|1455218_1457525_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	33.6	9.0e-87
AWZ40785.1|1457547_1458066_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	42.9	1.1e-32
AWZ40786.1|1458217_1458886_+	potassium transporter Trk	NA	NA	NA	NA	NA
AWZ40787.1|1459074_1459224_+	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
AWZ40788.1|1459235_1460768_+	D-alanine--poly(phosphoribitol) ligase subunit 1	NA	A0A2K9L3I8	Tupanvirus	27.6	7.9e-39
AWZ40789.1|1460767_1461964_+	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	32.8	2.3e-25
>prophage 88
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1477908	1487351	2288482	tRNA	Mollivirus(25.0%)	8	NA	NA
AWZ40807.1|1477908_1478523_+	guanylate kinase	NA	A0A0M5KCK5	Mollivirus	30.3	2.4e-10
AWZ40808.1|1478650_1478860_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AWZ40809.1|1478973_1480164_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.8	4.0e-46
AWZ40810.1|1480163_1482584_+	primosomal protein N'	NA	NA	NA	NA	NA
AWZ40811.1|1482611_1483577_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	31.5	6.8e-12
AWZ40812.1|1483557_1484907_+	16S rRNA (cytosine(967)-C(5))-methyltransferase	NA	NA	NA	NA	NA
AWZ40813.1|1484910_1485660_+	protein phosphatase	NA	NA	NA	NA	NA
AWZ40814.1|1485656_1487351_+	serine/threonine protein kinase	NA	A0A1E1EXF7	Acanthamoeba_castellanii_mimivirus	33.9	1.1e-20
>prophage 89
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1494169	1498330	2288482		Bacillus_phage(33.33%)	4	NA	NA
AWZ40822.1|1494169_1496215_+	ATP-dependent DNA helicase RecG	NA	A0A024B0Z9	Bacillus_phage	39.4	4.1e-06
AWZ40823.1|1496231_1497263_+	phosphate acyltransferase	NA	NA	NA	NA	NA
AWZ40824.1|1497311_1497554_+	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	57.7	1.5e-05
AWZ40825.1|1497634_1498330_+	ribonuclease III	NA	A0A1V0SDK0	Indivirus	37.0	2.2e-20
>prophage 90
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1507090	1520077	2288482	tRNA	Bacillus_phage(50.0%)	15	NA	NA
AWZ40834.1|1507090_1507654_+	phosphinothricin acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	35.4	3.6e-21
AWZ40835.1|1507771_1508125_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AWZ40836.1|1508178_1509018_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ40837.1|1509038_1509566_-	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	33.1	8.2e-12
AWZ40838.1|1510135_1510441_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ40839.1|1510650_1511160_+	HAD family hydrolase	NA	NA	NA	NA	NA
AWZ40840.1|1511258_1511594_+	transcriptional regulator	NA	NA	NA	NA	NA
AWZ40841.1|1511912_1512959_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	33.5	1.2e-27
AWZ40842.1|1512966_1515378_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AWZ40843.1|1515454_1515982_+	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	32.5	4.1e-11
AWZ40844.1|1516002_1516842_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ40845.1|1517181_1518279_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWZ40846.1|1518303_1518951_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	40.6	9.1e-37
AWZ40847.1|1518999_1519473_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
AWZ40848.1|1519549_1520077_+	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	33.1	8.2e-12
>prophage 91
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1525372	1527595	2288482		Salmonella_phage(100.0%)	1	NA	NA
AWZ40855.1|1525372_1527595_+	GTP pyrophosphokinase	NA	S4TRQ0	Salmonella_phage	41.0	2.3e-07
>prophage 92
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1533015	1535207	2288482		Enterococcus_phage(50.0%)	2	NA	NA
AWZ40864.1|1533015_1533864_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	44.0	1.4e-37
AWZ40865.1|1533863_1535207_+	exodeoxyribonuclease VII large subunit	NA	A0A160DEV2	Gordonia_phage	31.7	3.2e-28
>prophage 93
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1539559	1543997	2288482	tRNA	Bacillus_phage(33.33%)	7	NA	NA
AWZ40871.1|1539559_1540183_-	transcriptional repressor LexA	NA	A0A1B1P7Q3	Bacillus_phage	52.8	8.0e-14
AWZ40872.1|1540348_1540645_+	DUF896 family protein	NA	NA	NA	NA	NA
AWZ40873.1|1540725_1540950_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ40874.1|1540998_1541625_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AWZ41569.1|1541839_1542589_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
AWZ40875.1|1542572_1542860_+	hypothetical protein	NA	S6DF82	Invertebrate_iridovirus	35.4	3.3e-07
AWZ40876.1|1542884_1543997_+	lactate dehydrogenase	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	28.7	5.8e-23
>prophage 94
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1548016	1550662	2288482		uncultured_Mediterranean_phage(66.67%)	4	NA	NA
AWZ40881.1|1548016_1548907_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	34.4	3.9e-38
AWZ40882.1|1548974_1549334_+	N-acetyltransferase	NA	NA	NA	NA	NA
AWZ40883.1|1549323_1550091_+	rifampin ADP-ribosyl transferase	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	33.3	3.6e-08
AWZ40884.1|1550080_1550662_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	34.3	7.2e-17
>prophage 95
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1555274	1556717	2288482		Tupanvirus(100.0%)	1	NA	NA
AWZ40889.1|1555274_1556717_+	ATP-dependent DNA helicase	NA	A0A2K9L021	Tupanvirus	33.6	1.4e-56
>prophage 96
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1561412	1565379	2288482	bacteriocin	Geobacillus_virus(50.0%)	5	NA	NA
AWZ40894.1|1561412_1561688_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	67.4	1.8e-26
AWZ40895.1|1561916_1562819_+	magnesium transporter CorA	NA	NA	NA	NA	NA
AWZ40896.1|1562828_1563521_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AWZ40897.1|1563504_1564485_+	ATP-binding protein	NA	NA	NA	NA	NA
AWZ40898.1|1564623_1565379_+|bacteriocin	bacteriocin ABC transporter ATP-binding protein	bacteriocin	G9BWD6	Planktothrix_phage	37.9	3.4e-27
>prophage 97
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1579453	1581988	2288482		Acinetobacter_phage(100.0%)	1	NA	NA
AWZ40913.1|1579453_1581988_-	peptidase	NA	A0A0P0IY26	Acinetobacter_phage	27.2	1.4e-64
>prophage 98
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1586525	1593178	2288482	tRNA	Streptococcus_phage(33.33%)	5	NA	NA
AWZ40918.1|1586525_1589321_+	ATP-dependent DNA helicase DinG	NA	A0A1X9I5C8	Streptococcus_phage	33.7	1.0e-55
AWZ40919.1|1589367_1589865_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ40920.1|1589883_1591071_+	aspartate aminotransferase	NA	NA	NA	NA	NA
AWZ40921.1|1591089_1592391_+|tRNA	asparagine--tRNA ligase	tRNA	M1PB22	Moumouvirus	30.2	3.2e-57
AWZ40922.1|1592458_1593178_+	DNA replication protein DnaD	NA	A0A0N7AE27	Bacillus_phage	38.1	3.2e-14
>prophage 99
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1597923	1598526	2288482		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AWZ40925.1|1597923_1598526_-	Holliday junction resolvase RecU	NA	A0A2H4J3A4	uncultured_Caudovirales_phage	40.0	3.2e-28
>prophage 100
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1606649	1613075	2288482		Bodo_saltans_virus(25.0%)	6	NA	NA
AWZ40936.1|1606649_1607555_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.0	6.0e-10
AWZ40937.1|1607712_1608255_+	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AWZ40938.1|1608392_1609673_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.9	6.6e-63
AWZ40939.1|1609781_1610714_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	31.2	3.1e-22
AWZ40940.1|1610710_1611988_+	dihydroorotase	NA	NA	NA	NA	NA
AWZ40941.1|1611989_1613075_+	carbamoyl phosphate synthase small subunit	NA	R4TGJ8	Halovirus	37.0	5.2e-53
>prophage 101
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1628588	1694699	2288482	integrase,tRNA,protease,transposase	Bacillus_phage(15.79%)	54	1625327:1625342	1673339:1673354
1625327:1625342	attL	CGATCGTGATCGCTTG	NA	NA	NA	NA
AWZ40956.1|1628588_1629512_+|integrase	integrase	integrase	NA	NA	NA	NA
AWZ40957.1|1629857_1631138_+	MFS transporter permease	NA	NA	NA	NA	NA
AWZ41573.1|1631534_1632584_+	MFS transporter permease	NA	NA	NA	NA	NA
AWZ40958.1|1632765_1633728_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
AWZ40959.1|1634348_1634786_+	DNA mismatch repair protein MutT	NA	NA	NA	NA	NA
AWZ40960.1|1634852_1636826_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	42.4	2.1e-121
AWZ40961.1|1636843_1639279_+	DNA topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	30.4	2.9e-91
AWZ40962.1|1639329_1641015_-	hypothetical protein	NA	A0A2K9R799	Dishui_lake_phycodnavirus	39.6	7.2e-09
AWZ40963.1|1641237_1642101_+	fatty acid-binding protein DegV	NA	NA	NA	NA	NA
AWZ40964.1|1642167_1643001_+	xylose isomerase	NA	NA	NA	NA	NA
AWZ40965.1|1642987_1643572_+	signal peptidase I	NA	NA	NA	NA	NA
AWZ40966.1|1646097_1646391_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ41574.1|1646485_1647088_+	acyl-phosphate glycerol 3-phosphate acyltransferase	NA	NA	NA	NA	NA
AWZ40967.1|1647153_1647681_+	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	33.1	8.2e-12
AWZ40968.1|1647701_1648541_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ40969.1|1648636_1649509_+	galactose mutarotase	NA	NA	NA	NA	NA
AWZ40970.1|1649665_1651090_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IDZ7	Erwinia_phage	26.4	4.8e-30
AWZ40971.1|1651661_1652204_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
AWZ40972.1|1652220_1653120_-	tyrosine recombinase XerC	NA	T2KT84	uncultured_phage	36.7	5.4e-11
AWZ40973.1|1653348_1654662_-|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
AWZ40974.1|1654677_1656792_-	DNA topoisomerase 1	NA	A0A1V0SCS0	Indivirus	37.9	1.7e-100
AWZ40975.1|1656941_1657802_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	31.8	1.6e-20
AWZ40976.1|1657844_1658609_-	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	37.1	4.0e-23
AWZ40977.1|1658673_1659528_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
AWZ40978.1|1659580_1660108_-	signal peptidase I	NA	NA	NA	NA	NA
AWZ40979.1|1660210_1661665_-	peptidase S41	NA	A0A0R6PIZ1	Moraxella_phage	29.9	3.1e-24
AWZ40980.1|1661665_1661887_-	YozE family protein	NA	NA	NA	NA	NA
AWZ40981.1|1661901_1662504_-	DUF2140 domain-containing protein	NA	NA	NA	NA	NA
AWZ40982.1|1662505_1663450_-	lipase	NA	NA	NA	NA	NA
AWZ40983.1|1663590_1664193_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ40984.1|1664237_1664738_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	42.2	4.4e-31
AWZ40985.1|1664754_1665711_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	62.4	2.4e-118
AWZ40986.1|1665759_1667640_-	multidrug ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	30.6	2.4e-53
AWZ40987.1|1667640_1668852_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	49.8	9.3e-43
AWZ40988.1|1669134_1670007_-	hypothetical protein	NA	M1Q1P6	Streptococcus_phage	36.4	7.9e-52
AWZ40989.1|1670216_1671050_+|integrase	integrase	integrase	NA	NA	NA	NA
AWZ40990.1|1671085_1672345_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ40991.1|1672427_1673504_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
1673339:1673354	attR	CGATCGTGATCGCTTG	NA	NA	NA	NA
AWZ40992.1|1673521_1674301_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
AWZ40993.1|1674297_1675221_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
AWZ40994.1|1675220_1676384_-	N-acetyldiaminopimelate deacetylase	NA	NA	NA	NA	NA
AWZ40995.1|1676389_1677100_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	NA	NA	NA	NA	NA
AWZ40996.1|1677145_1678438_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
AWZ40997.1|1678923_1679916_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
AWZ40998.1|1680072_1681833_-	pyruvate kinase	NA	NA	NA	NA	NA
AWZ40999.1|1681946_1682909_-	6-phosphofructokinase	NA	NA	NA	NA	NA
AWZ41000.1|1683037_1686343_-	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	31.5	1.1e-133
AWZ41001.1|1686561_1686759_+	DUF2929 domain-containing protein	NA	NA	NA	NA	NA
AWZ41002.1|1686794_1689392_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	37.3	2.9e-126
AWZ41003.1|1689445_1690690_-	peptidase T	NA	NA	NA	NA	NA
AWZ41004.1|1690708_1691824_-	Nif3-like dinuclear metal center hexameric protein	NA	A0A167RQW5	Powai_lake_megavirus	42.7	3.3e-18
AWZ41005.1|1691816_1692515_-|tRNA	tRNA (adenine(22)-N(1))-methyltransferase TrmK	tRNA	NA	NA	NA	NA
AWZ41006.1|1692928_1694215_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
AWZ41007.1|1694171_1694699_+	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	32.5	5.3e-11
>prophage 102
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1703487	1712811	2288482	transposase	Enterobacteria_phage(40.0%)	6	NA	NA
AWZ41021.1|1703487_1704612_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	36.2	4.2e-37
AWZ41576.1|1704626_1706474_-	DNA primase	NA	S5M810	Pseudoalteromonas_phage	52.0	1.0e-16
AWZ41022.1|1706753_1709732_-	type III restriction-modification system endonuclease	NA	Q71TG1	Escherichia_phage	29.2	8.6e-90
AWZ41577.1|1709733_1710723_-	hypothetical protein	NA	Q1MVP0	Enterobacteria_phage	31.6	9.0e-28
AWZ41023.1|1710944_1711907_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
AWZ41024.1|1711965_1712811_-	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	42.7	1.3e-51
>prophage 103
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1719909	1740512	2288482	tRNA,transposase	Tupanvirus(20.0%)	21	NA	NA
AWZ41029.1|1719909_1721643_-	oxalyl-CoA decarboxylase	NA	G9E525	Ostreococcus_lucimarinus_virus	26.0	1.3e-18
AWZ41030.1|1721994_1722783_-	DNA repair protein RecO	NA	NA	NA	NA	NA
AWZ41031.1|1722838_1723741_-	GTPase Era	NA	NA	NA	NA	NA
AWZ41032.1|1723764_1724175_-	UDP kinase	NA	NA	NA	NA	NA
AWZ41033.1|1724158_1724638_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
AWZ41034.1|1724640_1725624_-	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	48.8	2.1e-48
AWZ41035.1|1725747_1726194_-	hypothetical protein	NA	A0A0K2FLI9	Brevibacillus_phage	34.8	1.6e-11
AWZ41036.1|1726215_1726401_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AWZ41037.1|1726680_1727496_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
AWZ41038.1|1727554_1728457_-	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	34.6	4.0e-22
AWZ41039.1|1728472_1729423_-	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	29.1	2.1e-05
AWZ41040.1|1729423_1730200_-	glycosyl transferase	NA	A0A1V0SBR5	Catovirus	35.6	2.3e-10
AWZ41041.1|1730196_1731216_-	beta-1,6-galactofuranosyltransferase	NA	NA	NA	NA	NA
AWZ41042.1|1731232_1732105_-	YitT family protein	NA	NA	NA	NA	NA
AWZ41043.1|1732332_1734099_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	23.3	3.3e-12
AWZ41044.1|1734114_1735392_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	26.7	1.6e-24
AWZ41045.1|1735680_1735881_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41046.1|1735880_1736375_-	lipid hydroperoxide peroxidase	NA	NA	NA	NA	NA
AWZ41047.1|1736652_1738335_+|transposase	DDE transposase	transposase	A0ZS58	Staphylococcus_virus	39.4	3.6e-93
AWZ41048.1|1738660_1738987_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41049.1|1739225_1740512_-	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	53.4	1.4e-116
>prophage 104
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1744828	1799804	2288482	integrase,tRNA,protease,transposase	Lactobacillus_phage(32.14%)	61	1736493:1736518	1785619:1785644
1736493:1736518	attL	ACAAAAAGAGGCTGTGACATAAGTCT	NA	NA	NA	NA
AWZ41055.1|1744828_1745356_+	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	33.9	1.4e-11
AWZ41056.1|1745376_1746216_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ41057.1|1746239_1746449_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41058.1|1746821_1747640_-|transposase	transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	32.1	4.7e-22
AWZ41059.1|1747669_1748443_-|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	37.0	1.7e-29
AWZ41060.1|1748442_1748655_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41061.1|1748908_1749280_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41062.1|1749255_1749708_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41063.1|1749855_1750023_-	hypothetical protein	NA	A0A2H4J069	uncultured_Caudovirales_phage	56.9	7.3e-07
AWZ41064.1|1750446_1750911_-	ArpU family transcriptional regulator	NA	O03925	Lactobacillus_phage	31.4	8.0e-11
AWZ41065.1|1750975_1751362_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41066.1|1751898_1752303_-	Holliday junction resolvase	NA	A0A0P0IXM5	Lactobacillus_phage	43.0	8.2e-28
AWZ41579.1|1752299_1752497_-	transcriptional regulator	NA	Q6SE98	Lactobacillus_prophage	44.1	3.6e-05
AWZ41067.1|1752909_1753176_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41068.1|1753172_1754120_-	hypothetical protein	NA	A0A2H4JAA4	uncultured_Caudovirales_phage	47.0	5.8e-32
AWZ41580.1|1754339_1755161_-	hypothetical protein	NA	E9LUM4	Lactobacillus_phage	55.9	9.6e-84
AWZ41069.1|1755165_1756212_-	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	57.8	5.4e-71
AWZ41070.1|1756204_1756417_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41071.1|1756413_1756638_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41072.1|1756641_1756956_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41073.1|1757034_1757214_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41074.1|1757220_1757403_-	transcriptional regulator	NA	NA	NA	NA	NA
AWZ41075.1|1757692_1757902_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ41076.1|1758042_1758411_-	hypothetical protein	NA	B8R678	Lactobacillus_phage	41.4	1.2e-14
AWZ41077.1|1758413_1759133_-	oxidoreductase	NA	A0A141E1D3	Streptococcus_phage	55.5	2.0e-69
AWZ41078.1|1759120_1759441_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41079.1|1759444_1759654_-	hypothetical protein	NA	A0A1B0YC38	Lactobacillus_phage	38.5	9.2e-07
AWZ41080.1|1759896_1760259_+	transcriptional regulator	NA	M1I9X0	Streptococcus_phage	38.9	1.2e-14
AWZ41081.1|1760259_1761366_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ41082.1|1761465_1761900_+	hypothetical protein	NA	A0A0S2MYH2	Enterococcus_phage	44.9	2.5e-22
AWZ41083.1|1761902_1762484_+	molecular chaperone Tir	NA	A0A0S2MYG4	Enterococcus_phage	59.9	4.5e-59
AWZ41084.1|1762473_1762668_-	hypothetical protein	NA	A0A0A7NNT6	Lactobacillus_phage	68.9	9.7e-19
AWZ41085.1|1762807_1763770_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ41086.1|1764247_1765255_+	cell filamentation protein Fic	NA	Q9JMN3	Wolbachia_phage	44.7	5.0e-74
AWZ41087.1|1765319_1766234_+	hypothetical protein	NA	J7KDP1	Streptococcus_phage	26.6	7.9e-10
AWZ41088.1|1766463_1767561_+|integrase	site-specific integrase	integrase	E9LUS1	Lactobacillus_phage	49.2	2.0e-92
AWZ41089.1|1767853_1768981_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	24.6	1.5e-23
AWZ41090.1|1769109_1770954_-	molecular chaperone DnaK	NA	A0A2P1EIW2	Megavirus	48.6	8.7e-141
AWZ41091.1|1770977_1771553_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AWZ41092.1|1771582_1772611_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
AWZ41093.1|1772699_1773647_-	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
AWZ41094.1|1773661_1774567_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
AWZ41095.1|1774652_1775018_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
AWZ41096.1|1775042_1777358_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.3	3.2e-23
AWZ41097.1|1777430_1777745_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41098.1|1777734_1778034_-	DUF448 domain-containing protein	NA	NA	NA	NA	NA
AWZ41099.1|1778045_1779203_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
AWZ41100.1|1779232_1779703_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
AWZ41101.1|1779917_1780394_-	chromosome partitioning protein ParB	NA	L0P6I1	Lactobacillus_phage	47.6	4.1e-34
AWZ41102.1|1780475_1785233_-	peptidase	NA	NA	NA	NA	NA
AWZ41103.1|1785559_1787272_-|transposase	DDE transposase	transposase	A0ZS58	Staphylococcus_virus	39.2	2.8e-93
1785619:1785644	attR	ACAAAAAGAGGCTGTGACATAAGTCT	NA	NA	NA	NA
AWZ41104.1|1787513_1791854_-	PolC-type DNA polymerase III	NA	A0A1X9SH08	Bradyrhizobium_phage	30.2	7.3e-13
AWZ41105.1|1791923_1793645_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AWZ41106.1|1793672_1794947_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
AWZ41107.1|1794980_1795769_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
AWZ41108.1|1795768_1796545_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	49.6	8.7e-26
AWZ41109.1|1796650_1797214_-	ribosome-recycling factor	NA	NA	NA	NA	NA
AWZ41110.1|1797222_1797945_-	UMP kinase	NA	NA	NA	NA	NA
AWZ41111.1|1798158_1799037_+	N-acetylmuramoyl-L-alanine amidase	NA	Q0H257	Geobacillus_phage	34.4	2.9e-17
AWZ41112.1|1799173_1799455_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
AWZ41113.1|1799477_1799804_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
>prophage 105
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1805865	1806831	2288482		Rhodococcus_phage(100.0%)	1	NA	NA
AWZ41118.1|1805865_1806831_-	ADP-ribosylglycohydrolase	NA	A0A1I9SA26	Rhodococcus_phage	30.3	9.2e-17
>prophage 106
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1814739	1880308	2288482	integrase,tRNA,transposase	Streptococcus_phage(14.29%)	59	1861892:1861908	1872130:1872146
AWZ41125.1|1814739_1816359_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	45.3	1.3e-108
AWZ41126.1|1816377_1817652_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41127.1|1818039_1818555_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AWZ41128.1|1818636_1819569_-|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	49.7	3.3e-80
AWZ41129.1|1819710_1820541_-	excinuclease ABC subunit A	NA	NA	NA	NA	NA
AWZ41130.1|1820617_1821580_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
AWZ41131.1|1821886_1822159_-	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
AWZ41132.1|1822161_1822434_-	type II toxin-antitoxin system antitoxin, RelB/DinJ family	NA	NA	NA	NA	NA
AWZ41133.1|1822738_1822921_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41134.1|1822952_1823150_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41135.1|1823214_1823712_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41136.1|1823772_1824141_-	ACT domain-containing protein	NA	NA	NA	NA	NA
AWZ41137.1|1824278_1824746_-	DNA starvation/stationary phase protection protein	NA	A0A291I9P0	Lactobacillus_phage	33.1	7.5e-17
AWZ41138.1|1825158_1826247_-	restriction endonuclease	NA	A0A1V0SII8	Klosneuvirus	28.2	4.1e-21
AWZ41139.1|1826212_1829446_-	helicase	NA	NA	NA	NA	NA
AWZ41140.1|1829447_1830323_-	restriction endonuclease	NA	NA	NA	NA	NA
AWZ41141.1|1830426_1831023_-|integrase	site-specific integrase	integrase	A0A1S5SFL0	Streptococcus_phage	34.6	9.6e-17
AWZ41142.1|1831171_1832011_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41143.1|1833439_1835134_-	oleate hydratase	NA	NA	NA	NA	NA
AWZ41144.1|1835263_1836595_-	acetylornithine deacetylase	NA	NA	NA	NA	NA
AWZ41145.1|1836856_1837294_+	transcriptional regulator	NA	NA	NA	NA	NA
AWZ41581.1|1837789_1838191_-	HicB family protein	NA	F0PIL2	Enterococcus_phage	52.3	4.5e-34
AWZ41146.1|1838251_1838440_-	type II toxin-antitoxin system HicA family toxin	NA	F0PIL1	Enterococcus_phage	67.7	3.7e-15
AWZ41147.1|1838692_1838950_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41148.1|1838990_1839245_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41149.1|1839559_1840042_-	hypothetical protein	NA	A0A1S5S7K9	Streptococcus_phage	32.2	1.6e-06
AWZ41150.1|1840087_1840267_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41151.1|1840855_1845574_-	helicase	NA	A0A2H4UTW8	Bodo_saltans_virus	27.0	3.1e-49
AWZ41152.1|1845738_1846266_+	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	33.1	8.2e-12
AWZ41153.1|1846286_1847126_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ41154.1|1847405_1847666_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41155.1|1847924_1848188_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41156.1|1848193_1849060_-	hypothetical protein	NA	A0A1P8BLD7	Lactococcus_phage	35.1	1.1e-45
AWZ41157.1|1849259_1849505_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41158.1|1849629_1850448_-	hypothetical protein	NA	A0A1P8BLD7	Lactococcus_phage	35.6	1.2e-38
AWZ41159.1|1850660_1850927_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41160.1|1851259_1851517_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41161.1|1851910_1852873_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
AWZ41162.1|1852874_1853099_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41163.1|1855155_1857108_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	35.4	1.0e-107
AWZ41164.1|1857402_1858332_-	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	37.4	6.3e-31
AWZ41165.1|1858348_1859716_-	chromosome replication initiation protein	NA	NA	NA	NA	NA
AWZ41166.1|1859733_1860204_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
AWZ41167.1|1860221_1860827_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
AWZ41168.1|1860823_1861654_-	DNA-formamidopyrimidine glycosylase	NA	F8WPX6	Bacillus_phage	29.0	1.5e-28
AWZ41169.1|1861673_1864346_-	DNA polymerase I	NA	A0A0C5K9B9	Enterococcus_phage	31.5	9.6e-40
1861892:1861908	attL	TGATGATATCAGCTGCA	NA	NA	NA	NA
AWZ41170.1|1864415_1865798_+	type I restriction endonuclease	NA	E3T4D5	Cafeteria_roenbergensis_virus	28.7	7.0e-10
AWZ41171.1|1865760_1866252_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41172.1|1866392_1867391_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ41173.1|1867541_1868351_-|integrase	integrase	integrase	A0A0H4TI16	Erysipelothrix_phage	27.4	1.5e-17
AWZ41174.1|1868400_1868976_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ41175.1|1868935_1870372_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41176.1|1870368_1871856_-	SAM-dependent methyltransferase	NA	J7I0U9	Acinetobacter_phage	27.9	5.2e-27
AWZ41177.1|1871833_1875076_-	type I restriction-modification system endonuclease	NA	NA	NA	NA	NA
1872130:1872146	attR	TGATGATATCAGCTGCA	NA	NA	NA	NA
AWZ41178.1|1875391_1875667_+	cell division protein	NA	NA	NA	NA	NA
AWZ41179.1|1875775_1877137_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.0	1.0e-42
AWZ41180.1|1877224_1877926_-	BAX inhibitor (BI)-1/YccA family protein	NA	NA	NA	NA	NA
AWZ41181.1|1877969_1878413_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AWZ41182.1|1878574_1880308_+	glycerophosphodiester phosphodiesterase	NA	A0A076G4Q2	Staphylococcus_phage	24.1	2.2e-05
>prophage 107
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1884949	1887112	2288482		Mycobacterium_phage(100.0%)	1	NA	NA
AWZ41187.1|1884949_1887112_-	DNA translocase FtsK	NA	G1FGP1	Mycobacterium_phage	50.9	5.9e-88
>prophage 108
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1891123	1894824	2288482		Staphylococcus_phage(33.33%)	5	NA	NA
AWZ41193.1|1891123_1891864_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	9.5e-22
AWZ41194.1|1892412_1892841_+	HIT family protein	NA	D7NW73	Streptomyces_phage	35.4	1.6e-10
AWZ41195.1|1892846_1893152_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ41196.1|1893242_1894139_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AWZ41197.1|1894224_1894824_-	ribonuclease HI	NA	A0A2H4JH24	uncultured_Caudovirales_phage	33.2	3.8e-21
>prophage 109
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1901604	1903302	2288482	tRNA	Orpheovirus(100.0%)	1	NA	NA
AWZ41204.1|1901604_1903302_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	33.2	2.7e-80
>prophage 110
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	1906411	2033764	2288482	holin,transposase,tRNA,integrase,capsid,tail	Lactobacillus_phage(25.0%)	127	2018482:2018541	2024865:2024935
AWZ41208.1|1906411_1907950_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/inosine monophosphate cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	43.6	2.7e-63
AWZ41209.1|1907952_1908531_-	phosphoribosylglycinamide formyltransferase	NA	R9S626	Prochlorococcus_phage	35.6	1.9e-22
AWZ41210.1|1908542_1909583_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	40.6	3.0e-58
AWZ41211.1|1909579_1911034_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.4	3.2e-58
AWZ41212.1|1911009_1913235_-	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.4	3.7e-146
AWZ41213.1|1913234_1913918_-	phosphoribosylformylglycinamidine synthase I	NA	NA	NA	NA	NA
AWZ41214.1|1913917_1914166_-	phosphoribosylformylglycinamidine synthase	NA	NA	NA	NA	NA
AWZ41215.1|1914165_1914885_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	37.8	3.1e-38
AWZ41216.1|1915233_1916529_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	31.6	2.2e-18
AWZ41217.1|1916552_1917710_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AWZ41218.1|1917672_1918161_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	43.0	2.4e-21
AWZ41219.1|1918477_1920502_-	potassium transporter Kup	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	34.6	8.5e-65
AWZ41220.1|1920677_1921406_+	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	60.0	6.1e-74
AWZ41221.1|1921463_1923014_-	ribonuclease Y	NA	NA	NA	NA	NA
AWZ41222.1|1923192_1924299_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	67.1	5.1e-120
AWZ41223.1|1924516_1925104_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
AWZ41224.1|1925211_1926138_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AWZ41225.1|1926177_1926906_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
AWZ41226.1|1926902_1928210_-	peptidase M16	NA	A0A2H4UVM3	Bodo_saltans_virus	28.7	3.1e-07
AWZ41582.1|1928209_1929445_-	peptidase M16	NA	A0A1X9I714	Streptococcus_phage	35.5	1.4e-57
AWZ41227.1|1929659_1931903_-	cell division protein FtsK	NA	S5VNE3	Mycobacterium_phage	48.3	1.6e-80
AWZ41228.1|1933387_1934350_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
AWZ41229.1|1934960_1935473_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
AWZ41230.1|1935665_1936523_-	23S rRNA methyltransferase	NA	NA	NA	NA	NA
AWZ41231.1|1936531_1937041_-|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
AWZ41232.1|1937262_1938240_+	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	74.4	1.2e-144
AWZ41233.1|1938294_1938657_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
AWZ41234.1|1938850_1939873_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
AWZ41235.1|1939887_1940523_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AWZ41236.1|1940601_1941618_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41237.1|1941629_1942997_-	magnesium transporter	NA	NA	NA	NA	NA
AWZ41238.1|1943012_1943909_-	RNA pseudouridine synthase	NA	NA	NA	NA	NA
AWZ41239.1|1943886_1944705_-	NAD kinase	NA	NA	NA	NA	NA
AWZ41240.1|1944741_1945371_-	GTP pyrophosphokinase	NA	NA	NA	NA	NA
AWZ41241.1|1945575_1946205_+	dithiol-disulfide isomerase	NA	NA	NA	NA	NA
AWZ41242.1|1946250_1948059_-	oligoendopeptidase F	NA	NA	NA	NA	NA
AWZ41243.1|1948097_1949072_-	competence protein	NA	NA	NA	NA	NA
AWZ41244.1|1949163_1949913_-	adaptor protein MecA	NA	NA	NA	NA	NA
AWZ41245.1|1950047_1950446_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
AWZ41246.1|1950802_1951480_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A0C5K925	Enterococcus_phage	61.6	9.8e-58
AWZ41247.1|1951469_1953635_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	61.5	7.3e-256
AWZ41248.1|1953969_1954563_+	TIGR01440 family protein	NA	NA	NA	NA	NA
AWZ41249.1|1954670_1955138_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	62.0	5.0e-45
AWZ41250.1|1955160_1957551_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	40.1	2.2e-88
AWZ41251.1|1957650_1957887_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
AWZ41252.1|1957974_1959540_-	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
AWZ41253.1|1959662_1960988_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	72.0	1.2e-171
AWZ41254.1|1961106_1961862_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
AWZ41255.1|1961946_1963140_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AWZ41256.1|1963242_1964256_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AWZ41257.1|1964314_1965343_-	SorC family transcriptional regulator	NA	NA	NA	NA	NA
AWZ41258.1|1965688_1966975_-	RNA polymerase sigma-54 factor	NA	NA	NA	NA	NA
AWZ41259.1|1967647_1967764_-	XkdX family protein	NA	NA	NA	NA	NA
AWZ41260.1|1967756_1968041_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41261.1|1968045_1969071_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41262.1|1969080_1970340_-	1,4-beta-N-acetylmuramidase	NA	V5UQT2	Oenococcus_phage	58.5	2.0e-133
AWZ41263.1|1970336_1970684_-|holin	holin	holin	A0A0P0IQR4	Lactobacillus_phage	43.9	5.8e-14
AWZ41264.1|1970674_1970866_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41265.1|1970872_1971247_-	hypothetical protein	NA	A0A0A1ENR5	Lactobacillus_phage	49.6	7.1e-26
AWZ41266.1|1971284_1972274_-	hypothetical protein	NA	X2KUF9	Streptococcus_phage	38.5	4.3e-22
AWZ41267.1|1972279_1972789_-|tail	phage tail protein	tail	A0A1P8BL30	Lactococcus_phage	42.0	7.7e-07
AWZ41268.1|1972804_1972936_-	XkdX family protein	NA	NA	NA	NA	NA
AWZ41269.1|1972937_1973315_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41270.1|1973333_1973801_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41271.1|1973817_1974705_-	hypothetical protein	NA	A0A1X9IGH6	Lactococcus_phage	40.1	1.2e-18
AWZ41583.1|1974719_1976621_-	hypothetical protein	NA	A0A1B2APX2	Phage_Wrath	36.1	1.1e-69
AWZ41272.1|1976671_1977391_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41584.1|1977377_1980593_-	hypothetical protein	NA	Q6SE70	Lactobacillus_prophage	46.0	5.2e-56
AWZ41273.1|1981785_1982430_-	hypothetical protein	NA	O03936	Lactobacillus_phage	41.0	2.3e-32
AWZ41274.1|1982435_1982894_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41275.1|1982946_1983510_-|capsid	capsid protein	capsid	O03972	Lactobacillus_phage	50.6	2.1e-37
AWZ41276.1|1983525_1983927_-|capsid	capsid protein	capsid	NA	NA	NA	NA
AWZ41277.1|1983923_1984280_-|capsid	capsid protein	capsid	O03933	Lactobacillus_phage	39.7	2.3e-13
AWZ41278.1|1984279_1984645_-|capsid	capsid protein	capsid	O03932	Lactobacillus_phage	41.6	1.1e-20
AWZ41279.1|1984638_1985028_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41280.1|1985044_1985920_-|capsid	capsid protein	capsid	U3PDP8	Lactobacillus_phage	62.5	8.1e-97
AWZ41281.1|1985931_1986567_-	scaffolding protein	NA	NA	NA	NA	NA
AWZ41282.1|1986621_1986822_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41283.1|1986875_1988111_-|capsid	capsid protein	capsid	O03929	Lactobacillus_phage	51.1	1.9e-91
AWZ41284.1|1988113_1989649_-|capsid	capsid protein	capsid	Q38341	Lactococcus_phage	45.2	2.8e-116
AWZ41285.1|1989850_1991104_+|transposase	transposase	transposase	A0A288TXV8	Enterococcus_phage	38.9	1.3e-55
AWZ41286.1|1991312_1991540_+	hypothetical protein	NA	A0A0N7IRA0	Lactobacillus_phage	61.3	9.6e-18
AWZ41287.1|1992260_1993514_+|transposase	transposase	transposase	A0A288TXV8	Enterococcus_phage	38.9	1.3e-55
AWZ41288.1|1994105_1994960_-	hypothetical protein	NA	A0A0P0I3L9	Lactobacillus_phage	33.6	1.2e-33
AWZ41289.1|1994963_1995806_-	hypothetical protein	NA	A0A0E3Y6I4	Fusobacterium_phage	56.0	1.0e-27
AWZ41290.1|1996027_1996861_-	hypothetical protein	NA	E9LUM4	Lactobacillus_phage	56.3	2.4e-82
AWZ41291.1|1996853_1997831_-	recombinase RecT	NA	A0A0P0IJP1	Lactobacillus_phage	50.4	2.3e-63
AWZ41292.1|1997831_1998104_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41293.1|1998100_1998421_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41294.1|1998499_1998679_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41295.1|1998662_1998854_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41585.1|1998950_1999292_-	hypothetical protein	NA	X2CYF0	Lactobacillus_phage	46.8	5.7e-14
AWZ41296.1|1999313_2000042_-	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	46.8	2.4e-46
AWZ41297.1|2000077_2000278_-	transcriptional regulator	NA	Q6SEA0	Lactobacillus_prophage	56.5	4.1e-12
AWZ41298.1|2000438_2000786_+	transcriptional regulator	NA	A8ATX5	Listeria_phage	42.1	5.1e-10
AWZ41299.1|2000800_2001211_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
AWZ41300.1|2001269_2002004_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ41301.1|2002156_2003245_+|integrase	site-specific integrase	integrase	E9LUS1	Lactobacillus_phage	51.5	4.0e-101
AWZ41586.1|2003967_2004096_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41302.1|2004112_2004475_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41303.1|2004635_2005226_+	ATP-dependent Clp endopeptidase, proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.5	4.0e-55
AWZ41304.1|2005287_2006340_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41305.1|2006496_2007450_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	38.8	1.6e-50
AWZ41306.1|2008477_2009365_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	32.8	7.6e-10
AWZ41307.1|2009474_2010365_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
AWZ41587.1|2010378_2011038_-	serine dehydratase	NA	NA	NA	NA	NA
AWZ41308.1|2011204_2011678_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
AWZ41309.1|2011744_2014591_-	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.4	4.5e-306
AWZ41310.1|2014609_2016610_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AWZ41311.1|2016734_2018462_-	phosphoglucomutase	NA	A0A1X9I671	Streptococcus_phage	57.2	3.8e-191
2018482:2018541	attL	ATTCAAATCTAGTATACTATCAATCGGCAAAACTTGCTATAACAAGCCCTTTTACGCTTA	NA	NA	NA	NA
AWZ41312.1|2018571_2019711_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	33.9	1.7e-54
AWZ41588.1|2020209_2020395_+	toxin HicA	NA	D6PSW1	Lactobacillus_phage	44.4	4.4e-05
AWZ41589.1|2020446_2020836_+	HicB family protein	NA	NA	NA	NA	NA
AWZ41313.1|2021473_2021899_+	ArpU family transcriptional regulator	NA	NA	NA	NA	NA
AWZ41590.1|2022107_2022881_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	37.0	1.7e-29
AWZ41314.1|2022910_2023729_+|transposase	transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	32.1	4.7e-22
AWZ41315.1|2024133_2024241_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ41316.1|2024985_2025912_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	54.1	3.4e-85
2024865:2024935	attR	ATTCAAATCTAGTATACTATCAATCGGCAAAACTTGCTATAACAAGCCCTTTTACGCTTACAAAAAATTTA	NA	NA	NA	NA
AWZ41317.1|2025985_2026828_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AWZ41318.1|2026838_2027783_-	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
AWZ41319.1|2027987_2028344_-|holin	phage holin family protein	holin	NA	NA	NA	NA
AWZ41320.1|2028345_2028669_-	PspC domain-containing protein	NA	NA	NA	NA	NA
AWZ41321.1|2028694_2030074_-	histidine kinase	NA	A0A1V0SGX0	Hokovirus	27.9	1.5e-12
AWZ41591.1|2030066_2030780_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.4	1.1e-35
AWZ41322.1|2030825_2031968_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
AWZ41323.1|2032200_2033088_-	cell division protein FtsX	NA	NA	NA	NA	NA
AWZ41324.1|2033068_2033764_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	34.2	5.4e-27
>prophage 111
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	2038868	2041016	2288482		Streptococcus_phage(100.0%)	2	NA	NA
AWZ41329.1|2038868_2040215_-	DNA/RNA helicase	NA	A0A1X9I5S6	Streptococcus_phage	36.5	5.7e-57
AWZ41330.1|2040368_2041016_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	49.0	4.7e-49
>prophage 112
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	2044323	2051485	2288482	tRNA,protease	uncultured_virus(50.0%)	6	NA	NA
AWZ41333.1|2044323_2045940_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	54.0	1.2e-157
AWZ41334.1|2045987_2046272_-	co-chaperone GroES	NA	A0A221S386	uncultured_virus	49.5	1.1e-15
AWZ41335.1|2046479_2047118_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWZ41336.1|2047155_2047785_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
AWZ41337.1|2047954_2049913_+	multidrug ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.9	1.4e-48
AWZ41338.1|2050453_2051485_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.8	6.9e-63
>prophage 113
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	2054768	2068475	2288482	transposase	Streptococcus_phage(57.14%)	16	NA	NA
AWZ41343.1|2054768_2055650_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	54.3	1.0e-78
AWZ41344.1|2055649_2056000_-	DUF972 domain-containing protein	NA	M1PFV3	Streptococcus_phage	37.8	4.2e-12
AWZ41345.1|2056021_2057014_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	35.9	5.0e-42
AWZ41346.1|2057136_2057460_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41347.1|2057470_2058103_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	48.8	9.5e-47
AWZ41348.1|2058227_2058467_-	DUF2508 domain-containing protein	NA	NA	NA	NA	NA
AWZ41349.1|2058481_2059081_-	recombination protein RecR	NA	NA	NA	NA	NA
AWZ41350.1|2059101_2059416_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AWZ41351.1|2059434_2061171_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	41.5	1.7e-58
AWZ41352.1|2061397_2061850_-	nucleoside deaminase	NA	NA	NA	NA	NA
AWZ41353.1|2061851_2062457_-	16S rRNA methyltransferase	NA	NA	NA	NA	NA
AWZ41354.1|2064087_2064519_-	PH domain-containing protein	NA	A5GZ63	Lactococcus_phage	46.8	1.6e-29
AWZ41355.1|2064722_2065694_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
AWZ41356.1|2065720_2065945_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41357.1|2066739_2067153_-	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
AWZ41358.1|2067218_2068475_-	helicase	NA	A0A1B1IS59	uncultured_Mediterranean_phage	30.6	8.2e-42
>prophage 114
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	2072562	2092536	2288482	transposase,protease	Lactobacillus_phage(22.22%)	23	NA	NA
AWZ41363.1|2072562_2073453_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.9	2.7e-15
AWZ41364.1|2073584_2074460_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWZ41365.1|2074686_2074998_-	MazG-like protein	NA	NA	NA	NA	NA
AWZ41366.1|2074997_2075834_-	DNA-entry nuclease	NA	NA	NA	NA	NA
AWZ41367.1|2075893_2076901_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	44.5	9.8e-62
AWZ41368.1|2077089_2077737_+	nitrobenzoate reductase	NA	NA	NA	NA	NA
AWZ41369.1|2077907_2078333_-	N-acetyltransferase	NA	A0A1X9I6I8	Streptococcus_phage	42.8	1.9e-27
AWZ41370.1|2078400_2078787_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ41371.1|2079555_2079822_-	Na+-transporting malonate decarboxylase, carboxybiotin decarboxylase subunit, madB	NA	NA	NA	NA	NA
AWZ41372.1|2080149_2080446_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41373.1|2080648_2081863_-	NADPH-dependent FMN reductase	NA	A0A2P0ZL82	Lactobacillus_phage	53.4	5.7e-56
AWZ41374.1|2081887_2082493_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	54.7	1.8e-55
AWZ41375.1|2082634_2083729_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41376.1|2083799_2084996_-	MFS transporter	NA	NA	NA	NA	NA
AWZ41377.1|2085335_2086109_-	appr-1-p processing enzyme family domain-containing protein	NA	A0A2K9L8X2	Tupanvirus	40.6	1.3e-34
AWZ41378.1|2086159_2086471_-	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AWZ41379.1|2086473_2086800_-	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AWZ41380.1|2088730_2088922_-	transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	57.9	5.2e-09
AWZ41381.1|2088918_2089413_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41382.1|2089412_2089910_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41383.1|2090037_2090547_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41384.1|2090914_2091733_-|transposase	transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	32.1	3.6e-22
AWZ41385.1|2091762_2092536_-|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	36.6	3.7e-29
>prophage 115
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	2098454	2107521	2288482		uncultured_Caudovirales_phage(20.0%)	9	NA	NA
AWZ41392.1|2098454_2099456_-	ferrichrome ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	28.3	2.5e-17
AWZ41393.1|2099465_2100383_-	ferrichrome ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWZ41394.1|2100395_2101181_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.3	2.6e-14
AWZ41395.1|2101314_2102355_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41396.1|2102518_2103043_-	metal-binding protein	NA	NA	NA	NA	NA
AWZ41397.1|2103058_2104438_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	49.6	1.1e-124
AWZ41398.1|2104512_2104917_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWZ41399.1|2105002_2106319_-	AAA family ATPase	NA	G3MBE0	Bacillus_virus	42.6	3.0e-87
AWZ41400.1|2106498_2107521_-	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	27.6	1.0e-18
>prophage 116
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	2111975	2116202	2288482		Serratia_phage(50.0%)	2	NA	NA
AWZ41405.1|2111975_2113988_-	DNA ligase (NAD(+)) LigA	NA	A0A289ZTZ3	Serratia_phage	36.6	7.8e-95
AWZ41593.1|2114003_2116202_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.5	3.0e-132
>prophage 117
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	2119792	2120392	2288482		Clostridium_phage(100.0%)	1	NA	NA
AWZ41408.1|2119792_2120392_-	mannosyl-glycoprotein endo-beta-N-acetylglucosamidase	NA	A0A0A7RUS8	Clostridium_phage	47.0	2.3e-26
>prophage 118
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	2124888	2127381	2288482		Bodo_saltans_virus(50.0%)	2	NA	NA
AWZ41412.1|2124888_2125302_+	calpastatin	NA	A0A2H4UVK5	Bodo_saltans_virus	40.8	7.1e-11
AWZ41413.1|2125392_2127381_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.0	3.9e-30
>prophage 119
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	2130656	2133132	2288482		Bacillus_phage(66.67%)	4	NA	NA
AWZ41420.1|2130656_2131088_+	transcriptional regulator	NA	A8ATX5	Listeria_phage	50.8	7.4e-11
AWZ41421.1|2131138_2131978_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41422.1|2131998_2132526_-	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	32.5	9.1e-11
AWZ41423.1|2132652_2133132_+	ImmA/IrrE family metallo-endopeptidase	NA	D2XR38	Bacillus_phage	41.5	5.2e-13
>prophage 120
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	2144274	2150977	2288482		Only_Syngen_Nebraska_virus(33.33%)	6	NA	NA
AWZ41428.1|2144274_2145873_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	48.8	1.5e-144
AWZ41429.1|2146044_2146617_-	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
AWZ41430.1|2146661_2147072_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41431.1|2147191_2148505_+	hypothetical protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	30.9	1.9e-25
AWZ41432.1|2148648_2149521_-	MutR family transcriptional regulator	NA	NA	NA	NA	NA
AWZ41433.1|2149921_2150977_+	MccB-like protein	NA	A0A1V0SAV8	Catovirus	26.6	5.9e-09
>prophage 121
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	2157258	2162646	2288482		Tupanvirus(100.0%)	5	NA	NA
AWZ41440.1|2157258_2158881_-	ABC-F family ATPase	NA	A0A2K9L3Z8	Tupanvirus	26.6	5.8e-48
AWZ41441.1|2158943_2159615_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41442.1|2159877_2160102_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ41443.1|2160176_2161151_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L8D8	Tupanvirus	36.0	1.1e-41
AWZ41444.1|2161245_2162646_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L140	Tupanvirus	31.7	8.3e-27
>prophage 122
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	2170263	2171670	2288482		Erysipelothrix_phage(100.0%)	1	NA	NA
AWZ41451.1|2170263_2171670_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.1	2.7e-49
>prophage 123
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	2179679	2182334	2288482	tRNA	Klosneuvirus(50.0%)	2	NA	NA
AWZ41459.1|2179679_2181710_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	36.4	1.3e-92
AWZ41460.1|2181836_2182334_-	phosphatidylglycerophosphatase A	NA	A0A291I9Q0	Lactobacillus_phage	55.0	1.7e-43
>prophage 124
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	2201500	2202610	2288482		Planktothrix_phage(100.0%)	1	NA	NA
AWZ41473.1|2201500_2202610_-	sugar ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.8	3.1e-24
>prophage 125
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	2207531	2208239	2288482		Planktothrix_phage(100.0%)	1	NA	NA
AWZ41597.1|2207531_2208239_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	4.8e-31
>prophage 126
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	2215403	2216114	2288482		Streptococcus_phage(100.0%)	1	NA	NA
AWZ41483.1|2215403_2216114_+	hypothetical protein	NA	A0A1S5SBP9	Streptococcus_phage	34.1	5.9e-21
>prophage 127
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	2221989	2223246	2288482	tRNA	Pectobacterium_phage(100.0%)	1	NA	NA
AWZ41484.1|2221989_2223246_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	42.9	4.2e-86
>prophage 128
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	2230535	2231651	2288482		Yellowstone_lake_mimivirus(100.0%)	1	NA	NA
AWZ41491.1|2230535_2231651_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	30.5	6.8e-32
>prophage 129
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	2238596	2242053	2288482		Bacillus_phage(100.0%)	2	NA	NA
AWZ41499.1|2238596_2240339_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	24.4	9.4e-20
AWZ41500.1|2240328_2242053_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	23.4	1.1e-25
>prophage 130
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	2253455	2259428	2288482	transposase	Paenibacillus_phage(66.67%)	3	NA	NA
AWZ41504.1|2253455_2254274_-|transposase	transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	32.1	3.6e-22
AWZ41505.1|2254303_2257414_-	hypothetical protein	NA	A0A0C5AJ29	Paenibacillus_phage	36.6	1.5e-28
AWZ41506.1|2257931_2259428_-	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	38.7	2.2e-70
>prophage 131
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	2263831	2270541	2288482		Bacillus_phage(66.67%)	5	NA	NA
AWZ41511.1|2263831_2265025_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	4.7e-31
AWZ41512.1|2265024_2265876_+	glycine/betaine ABC transporter	NA	NA	NA	NA	NA
AWZ41513.1|2265872_2266775_+	glycine/betaine ABC transporter	NA	NA	NA	NA	NA
AWZ41514.1|2266966_2268808_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	34.1	1.8e-58
AWZ41515.1|2268807_2270541_-	multidrug ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.9	1.5e-46
>prophage 132
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	2273959	2275351	2288482		Lactobacillus_phage(100.0%)	1	NA	NA
AWZ41518.1|2273959_2275351_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	32.8	2.2e-56
>prophage 133
CP023566	Lactobacillus murinus strain CR141 chromosome, complete genome	2288482	2279854	2285913	2288482		Tupanvirus(33.33%)	4	NA	NA
AWZ41524.1|2279854_2281030_-	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	36.5	7.9e-47
AWZ41525.1|2281113_2283309_-	exodeoxyribonuclease V subunit beta	NA	A0A2K9V9X6	Bandra_megavirus	23.2	3.2e-09
AWZ41526.1|2283468_2283768_+	DUF454 domain-containing protein	NA	NA	NA	NA	NA
AWZ41527.1|2283831_2285913_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	28.4	1.2e-29
