The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP025136	Lactobacillus sakei strain WiKim0072 chromosome, complete genome	1975341	79569	91623	1975341	transposase	Enterococcus_phage(30.0%)	12	NA	NA
AWZ41680.1|79569_80942_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	39.2	4.9e-32
AWZ41681.1|81025_81724_-	LysM domain-containing protein	NA	A0A288TY55	Enterococcus_phage	46.4	1.7e-17
AWZ41682.1|82392_82644_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41683.1|82871_83246_-	hypothetical protein	NA	E3W8I0	Leuconostoc_phage	32.7	6.9e-05
AWZ41684.1|83238_84543_-	excinuclease ABC subunit A	NA	Q6DMX4	Streptococcus_phage	39.7	1.3e-85
AWZ41685.1|84542_84788_-	hypothetical protein	NA	A0A0S2MYI8	Enterococcus_phage	41.2	1.8e-06
AWZ41686.1|84807_85182_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41687.1|85208_85907_-	LysM domain-containing protein	NA	A0A288TY55	Enterococcus_phage	46.4	1.7e-17
AWZ41688.1|86149_88192_-	potassium transporter Kup	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	35.5	1.2e-69
AWZ41689.1|88655_89135_+	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	35.4	1.1e-15
AWZ41690.1|89186_90560_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	30.4	3.0e-45
AWZ41691.1|90903_91623_-	aquaporin family protein	NA	M1HQB9	Paramecium_bursaria_Chlorella_virus	30.2	2.4e-22
>prophage 2
CP025136	Lactobacillus sakei strain WiKim0072 chromosome, complete genome	1975341	191929	200038	1975341		Bacillus_phage(33.33%)	9	NA	NA
AWZ41776.1|191929_193675_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.7	1.2e-46
AWZ41777.1|193816_194047_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ41778.1|194127_194370_-	DUF896 family protein	NA	NA	NA	NA	NA
AWZ41779.1|194504_195119_+	LexA repressor	NA	A0A1B2APZ1	Phage_Wrath	58.2	1.1e-15
AWZ41780.1|195252_195771_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	41.3	4.4e-26
AWZ41781.1|195794_198107_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.9	3.8e-77
AWZ41782.1|198251_199244_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	37.0	3.8e-50
AWZ41783.1|199329_199695_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
AWZ41784.1|199711_200038_+	hypothetical protein	NA	M4STD1	Rhodobacter_phage	34.6	5.4e-06
>prophage 3
CP025136	Lactobacillus sakei strain WiKim0072 chromosome, complete genome	1975341	1415471	1425105	1975341	protease	Streptococcus_phage(33.33%)	9	NA	NA
AWZ42846.1|1415471_1418324_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	54.9	1.7e-305
AWZ42847.1|1418445_1418982_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ42848.1|1419107_1419992_+	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.0	1.4e-08
AWZ42849.1|1419988_1421023_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	54.5	3.4e-94
AWZ42850.1|1421025_1421970_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.0	2.3e-52
AWZ42851.1|1422061_1422517_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWZ42852.1|1422631_1423156_-	thioredoxin	NA	NA	NA	NA	NA
AWZ42853.1|1423380_1423965_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	53.4	1.5e-51
AWZ42854.1|1424508_1425105_-	hypothetical protein	NA	A0A249Y0X5	Enterococcus_phage	41.0	9.9e-22
>prophage 4
CP025136	Lactobacillus sakei strain WiKim0072 chromosome, complete genome	1975341	1520720	1529014	1975341		Synechococcus_phage(33.33%)	8	NA	NA
AWZ42955.1|1520720_1522016_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	29.6	8.0e-16
AWZ42956.1|1522128_1522854_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FUQ7	Synechococcus_phage	39.9	9.2e-38
AWZ42957.1|1522846_1523107_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AWZ42958.1|1523103_1523790_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AWZ42959.1|1523779_1526005_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.1	2.5e-150
AWZ42960.1|1525980_1527414_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.9	3.8e-51
AWZ42961.1|1527419_1528448_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.6	5.6e-65
AWZ42962.1|1528444_1529014_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.4	5.4e-25
>prophage 5
CP025136	Lactobacillus sakei strain WiKim0072 chromosome, complete genome	1975341	1647971	1740279	1975341	integrase,capsid,holin,tail,transposase,terminase,tRNA	Lactobacillus_phage(39.53%)	108	1647634:1647650	1677093:1677109
1647634:1647650	attL	ATTGAAGACGCTCAAAA	NA	NA	NA	NA
AWZ43087.1|1647971_1649111_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AWZ43088.1|1649270_1649921_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
AWZ43089.1|1649936_1651127_+	phosphopentomutase	NA	NA	NA	NA	NA
AWZ43090.1|1651143_1651848_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
AWZ43091.1|1651869_1653099_+	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
AWZ43092.1|1653122_1654397_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	24.9	3.5e-24
AWZ43093.1|1654424_1655378_+	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
AWZ43094.1|1655396_1656695_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	54.0	1.4e-121
AWZ43095.1|1656931_1658266_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AWZ43096.1|1658418_1659078_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
AWZ43097.1|1659089_1659749_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ43098.1|1659754_1662283_+	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	29.3	2.0e-42
AWZ43099.1|1662325_1663537_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWZ43100.1|1663597_1663837_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ43101.1|1663839_1664934_-|integrase	site-specific integrase	integrase	Q9ZXG6	Leuconostoc_phage	36.1	1.5e-44
AWZ43102.1|1665136_1665766_-	hypothetical protein	NA	A0A097BY93	Leuconostoc_phage	63.8	4.9e-11
AWZ43103.1|1665857_1666787_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ43104.1|1666870_1667281_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1B0Y2S4	Lactobacillus_phage	40.2	2.8e-23
AWZ43105.1|1667267_1667609_-	XRE family transcriptional regulator	NA	A0A1B0Y3N1	Lactobacillus_phage	46.2	4.3e-22
AWZ43106.1|1667862_1668072_+	transcriptional regulator	NA	NA	NA	NA	NA
AWZ43107.1|1668083_1668848_+	phage antirepressor	NA	A0A0A7DN31	Lactobacillus_phage	61.5	5.8e-67
AWZ43108.1|1669010_1669556_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ43109.1|1669645_1669873_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ43110.1|1669963_1670191_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ43111.1|1670187_1670367_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ43112.1|1670476_1670746_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ43113.1|1670748_1671381_+	ERF superfamily protein	NA	A0A1P8BKZ7	Lactococcus_phage	36.4	1.0e-08
AWZ43114.1|1671383_1672082_+	hypothetical protein	NA	U5U4M2	Lactobacillus_phage	47.3	1.4e-54
AWZ43115.1|1672059_1672803_+	DNA replication protein	NA	A0A1P8BKK3	Lactococcus_phage	49.0	2.0e-56
AWZ43116.1|1672783_1673620_+	DNA replication protein	NA	O03914	Lactobacillus_phage	51.8	4.9e-67
AWZ43117.1|1673728_1674142_+	RusA family crossover junction endodeoxyribonuclease	NA	D6PSU4	Lactobacillus_phage	54.5	2.1e-31
AWZ43118.1|1674131_1674344_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ43119.1|1674355_1674829_+	single-stranded DNA-binding protein	NA	A0A2D1GPB7	Lactobacillus_phage	61.8	2.7e-46
AWZ43120.1|1674841_1675549_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ43121.1|1675585_1675852_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ43122.1|1675910_1676165_+	hypothetical protein	NA	A0A0E3TAK6	Staphylococcus_phage	49.1	3.5e-08
AWZ43123.1|1676157_1676754_+	HNH endonuclease	NA	A0A2H4JIA5	uncultured_Caudovirales_phage	33.3	9.9e-30
AWZ43124.1|1676789_1677296_+	hypothetical protein	NA	NA	NA	NA	NA
1677093:1677109	attR	ATTGAAGACGCTCAAAA	NA	NA	NA	NA
AWZ43125.1|1677306_1677645_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ43126.1|1677693_1678521_+	hypothetical protein	NA	A0A0P0IX70	Lactobacillus_phage	38.8	1.1e-29
AWZ43127.1|1678750_1679182_+	transcriptional regulator	NA	O03925	Lactobacillus_phage	50.4	1.2e-32
AWZ43128.1|1679464_1680145_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ43129.1|1680193_1680406_+	hypothetical protein	NA	A0A1C8E971	Bacillus_phage	85.7	6.0e-30
AWZ43130.1|1680589_1681084_+|terminase	terminase small subunit	terminase	O03926	Lactobacillus_phage	53.5	2.4e-37
AWZ43131.1|1681061_1682396_+|terminase	PBSX family phage terminase large subunit	terminase	A4L7R3	Lactococcus_phage	56.2	1.7e-146
AWZ43132.1|1682404_1683928_+|capsid	phage capsid protein	capsid	Q938L2	Temperate_phage	47.7	1.5e-122
AWZ43133.1|1683927_1685052_+|capsid	capsid protein	capsid	U3PFU0	Lactobacillus_phage	39.6	4.6e-68
AWZ43134.1|1685091_1685763_+	hypothetical protein	NA	O03931	Lactobacillus_phage	38.2	4.3e-13
AWZ43135.1|1685767_1686592_+|capsid	N4-gp56 family major capsid protein	capsid	Q9AZ61	Lactococcus_phage	69.8	4.2e-95
AWZ43136.1|1686659_1687064_+	hypothetical protein	NA	C5IUJ7	Streptococcus_phage	33.1	2.4e-11
AWZ43137.1|1687056_1687401_+	hypothetical protein	NA	O03932	Lactobacillus_phage	33.3	6.1e-08
AWZ43461.1|1687409_1687736_+|capsid	capsid protein	capsid	Q5YA66	Bacillus_phage	48.6	1.3e-23
AWZ43138.1|1687735_1688128_+|capsid	capsid protein	capsid	Q5YA65	Bacillus_phage	46.2	3.5e-31
AWZ43139.1|1688138_1688591_+|tail	phage tail protein	tail	A0A1S5SEC5	Streptococcus_phage	51.7	2.0e-30
AWZ43140.1|1688730_1689195_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ43141.1|1689205_1689808_+	hypothetical protein	NA	Q938K4	Temperate_phage	34.7	5.7e-25
AWZ43142.1|1689779_1692821_+	hypothetical protein	NA	L0P6G7	Lactobacillus_phage	60.8	6.5e-77
AWZ43143.1|1692804_1693530_+|tail	phage tail protein	tail	A0A1B2APY0	Phage_Wrath	43.2	1.7e-52
AWZ43144.1|1693529_1695479_+	hypothetical protein	NA	A0A1B2APX2	Phage_Wrath	40.5	1.4e-80
AWZ43145.1|1696484_1697480_+	hypothetical protein	NA	A0A0P0HRJ7	Lactobacillus_phage	84.6	6.8e-124
AWZ43146.1|1697484_1698009_+	hypothetical protein	NA	A0A2P0ZL13	Lactobacillus_phage	56.7	1.4e-43
AWZ43147.1|1698171_1698621_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ43148.1|1698625_1698964_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ43149.1|1698965_1699109_+	XkdX family protein	NA	NA	NA	NA	NA
AWZ43150.1|1699122_1699398_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ43151.1|1699394_1699604_+|holin	holin	holin	A0A2H4IZQ3	uncultured_Caudovirales_phage	45.9	1.7e-05
AWZ43462.1|1699660_1700491_+	N-acetylmuramidase	NA	Q9MCC8	Lactobacillus_phage	51.1	1.2e-46
AWZ43152.1|1700751_1701198_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ43153.1|1701198_1701582_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ43154.1|1702027_1702639_+	amino acid transporter	NA	NA	NA	NA	NA
AWZ43155.1|1702730_1703843_+	hypothetical protein	NA	NA	NA	NA	NA
AWZ43156.1|1704021_1704738_+	transcriptional regulator	NA	NA	NA	NA	NA
AWZ43157.1|1704739_1705294_+	N-acetyltransferase	NA	NA	NA	NA	NA
AWZ43158.1|1705561_1706017_+	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
AWZ43159.1|1706027_1707008_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
AWZ43160.1|1707050_1707290_+	acyl carrier protein	NA	NA	NA	NA	NA
AWZ43161.1|1707427_1708372_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
AWZ43162.1|1708371_1709103_+	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.6	2.4e-17
AWZ43163.1|1709116_1710349_+	beta-ketoacyl-[acyl-carrier-protein] synthase II	NA	NA	NA	NA	NA
AWZ43164.1|1710353_1710809_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
AWZ43165.1|1710812_1711235_+	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
AWZ43166.1|1711248_1712595_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AWZ43167.1|1712608_1713460_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
AWZ43168.1|1713437_1714235_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
AWZ43169.1|1714258_1715008_+	enoyl-[acyl-carrier-protein] reductase FabI	NA	NA	NA	NA	NA
AWZ43170.1|1715013_1715769_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
AWZ43171.1|1715787_1716321_+	BioY family transporter	NA	NA	NA	NA	NA
AWZ43172.1|1716435_1717569_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
AWZ43173.1|1717640_1718108_+	GAF domain-containing protein	NA	NA	NA	NA	NA
AWZ43174.1|1718146_1718692_-	ECF transporter S component	NA	NA	NA	NA	NA
AWZ43175.1|1718704_1719679_-	nucleoside hydrolase	NA	NA	NA	NA	NA
AWZ43176.1|1720135_1720738_-	nitroreductase	NA	NA	NA	NA	NA
AWZ43177.1|1721065_1722040_+	DUF2785 domain-containing protein	NA	NA	NA	NA	NA
AWZ43178.1|1722066_1722717_+	HAD family phosphatase	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	25.8	6.0e-12
AWZ43179.1|1722856_1723711_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWZ43180.1|1723780_1725152_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	39.2	4.9e-32
AWZ43181.1|1725209_1725704_-	universal stress protein	NA	NA	NA	NA	NA
AWZ43182.1|1725766_1726042_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ43183.1|1726356_1727637_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	48.4	6.1e-101
AWZ43184.1|1727769_1730049_+	bifunctional glutamate--cysteine ligase GshA/glutathione synthetase GshB	NA	NA	NA	NA	NA
AWZ43185.1|1730103_1730547_-	DUF1694 domain-containing protein	NA	NA	NA	NA	NA
AWZ43186.1|1730617_1731223_+	DUF1054 domain-containing protein	NA	NA	NA	NA	NA
AWZ43187.1|1731318_1731924_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
AWZ43188.1|1732296_1734009_+	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
AWZ43189.1|1734168_1735317_+	cysteine desulfurase	NA	NA	NA	NA	NA
AWZ43190.1|1735341_1736559_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
AWZ43191.1|1736685_1737312_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
AWZ43192.1|1737630_1740279_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.3	1.3e-158
>prophage 6
CP025136	Lactobacillus sakei strain WiKim0072 chromosome, complete genome	1975341	1895951	1903347	1975341	tRNA	Staphylococcus_phage(33.33%)	7	NA	NA
AWZ43468.1|1895951_1896797_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	44.2	7.7e-20
AWZ43336.1|1896993_1897494_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	38.7	3.5e-28
AWZ43337.1|1897504_1898455_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	64.3	1.6e-122
AWZ43338.1|1898601_1900491_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.1	2.3e-48
AWZ43339.1|1900603_1901065_-	hypothetical protein	NA	NA	NA	NA	NA
AWZ43340.1|1901133_1902327_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	44.1	9.2e-43
AWZ43341.1|1902474_1903347_+	hypothetical protein	NA	M1Q1P6	Streptococcus_phage	41.9	3.7e-57
>prophage 1
CP025137	Lactobacillus sakei strain WiKim0072 plasmid pLSW72_1, complete sequence	42297	0	3796	42297	transposase	Clostridium_phage(33.33%)	3	NA	NA
AWZ43471.1|611_1187_-	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	45.2	1.1e-33
AWZ43472.1|1626_2696_-|transposase	IS3-like element IS1520 family transposase	transposase	Q6J1X2	Lactobacillus_phage	34.9	6.3e-27
AWZ43473.1|3133_3796_-	beta-phosphoglucomutase	NA	A7ITQ4	Paramecium_bursaria_Chlorella_virus	25.8	1.7e-09
>prophage 2
CP025137	Lactobacillus sakei strain WiKim0072 plasmid pLSW72_1, complete sequence	42297	8648	9602	42297		Enterobacteria_phage(100.0%)	1	NA	NA
AWZ43502.1|8648_9602_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	23.9	7.9e-05
>prophage 3
CP025137	Lactobacillus sakei strain WiKim0072 plasmid pLSW72_1, complete sequence	42297	13150	27031	42297	integrase,holin,transposase	Enterococcus_phage(22.22%)	11	22172:22214	36357:36399
AWZ43479.1|13150_14101_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	55.0	3.2e-99
AWZ43480.1|14115_15042_-	ribonucleoside-diphosphate reductase	NA	A0A2H4P8A9	Corynebacterium_phage	31.4	5.0e-36
AWZ43481.1|15148_17317_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	60.2	1.1e-254
AWZ43482.1|17323_17776_-	ribonucleotide reductase assembly protein NrdI	NA	NA	NA	NA	NA
AWZ43483.1|18197_19127_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	34.8	3.0e-25
AWZ43484.1|19212_19431_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
AWZ43485.1|19823_21413_-	asparagine synthase B	NA	L7RC73	Acanthamoeba_polyphaga_moumouvirus	40.8	7.3e-104
AWZ43486.1|22166_22754_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	34.4	1.9e-17
22172:22214	attL	ATCTTTTTATATTGCACTTCTTGCGATATCTGATAAAAGTTGT	NA	NA	NA	NA
AWZ43487.1|23000_25268_+	daunorubicin resistance protein DrrC	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	30.9	9.7e-126
AWZ43488.1|25466_26141_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	32.9	3.1e-27
AWZ43489.1|26137_27031_+|integrase	integrase	integrase	A0A1B1P773	Bacillus_phage	28.5	1.1e-19
36357:36399	attR	ATCTTTTTATATTGCACTTCTTGCGATATCTGATAAAAGTTGT	NA	NA	NA	NA
>prophage 4
CP025137	Lactobacillus sakei strain WiKim0072 plasmid pLSW72_1, complete sequence	42297	34796	35825	42297		Enterococcus_phage(100.0%)	1	NA	NA
AWZ43497.1|34796_35825_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	28.0	6.7e-26
>prophage 5
CP025137	Lactobacillus sakei strain WiKim0072 plasmid pLSW72_1, complete sequence	42297	41180	41630	42297		Bacillus_phage(100.0%)	1	NA	NA
AWZ43501.1|41180_41630_-	cupin domain-containing protein	NA	Q2I8C5	Bacillus_phage	46.3	6.8e-31
